Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software
|
|
|
- Luke Fox
- 5 years ago
- Views:
Transcription
1 Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section of Forensic Genetics, Department of Forensic Medicine, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark
2 Why do STR sequencing? Example: Among 120 Danes, 48 individuals (20.16 %) had allele 14 in the locus D8S1179: Capillary electrophoresis CE name (CE) Sequence Frequency in 120 Danes D8S1179[14] D8S1179[14] TCTA[14] 2.5 % (6 individuals) TCTA[1]TCTG[1]TCTA[12] 11.8 % (28 individuals) TCTA[1]TCTG[1]TGTA[1]TCTA[11] 1.7 % (4 individuals) TCTA[2]TCTG[1]TCTA[11] 4.2 % (10 individuals) One CE allele can correspond to several sequence alleles higher diversity higher possible discrimination power 20.2 % (48 individuals)
3 Why do STR sequencing? Higher discrimination power can be valuable in cases of Mixtures: Separate DNA from two individuals, if possible Partly degraded samples: Need to get as much information as possible from the few markers that can be typed Complex relationship cases: Need to find genetic differences among closely related individuals
4 Sequencing method: The Illumina ForenSeq TM workflow 1) ForenSeq TM library build 58 STRs (27 autosomal, 24 Y-STRs, 7 X-STRs) 94 identity-informative SNPs, 56 ancestry-informative SNPs, 24 phenotypic-informative SNPs Amelogenin Source: 2) Sequencing on the MiSeq FGx instrument Source: 3) Data analysis in ForenSeq TM Universal Analysis Software (FUAS)
5 Analysis of DNA sequences Data analysis using FUAS Reproducibility CE-MPS concordance Sensitivity / low template samples DNA mixtures Data analysis using STRinNGS v.1.0 Locus balance Allele balances SNPs in STR flanking regions
6 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex
7 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex Locus drop-outs
8 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex Locus drop-outs
9 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex and allele drop-in
10 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex Allele drop-out (low coverage)
11 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex Allele drop-outs (low coverage)
12 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex Allele drop-outs (low coverage)
13 Reproducibility of DNA sequencing of STRs 30 individuals (12 males, 18 females, 1,308 s): Concordant: 98.6 %, discordant: 1.4 % Marker D9S1122 D17S1301 D20S482 D21S11 DYS392 Duplicate 1 Duplicate 2 11, 12, 14 12, 13, 14-13, 15 13, 14, 15-29, 32 29, 31, 32-32, , 32, , 13 10, 13 M 14 13, 14 M DXS , 34 25, 33, 34 F 17, 17 17, 19 F 16, 16 17, 17 F DXS , 15 15, 20 F 18, 19 - F 19, 20 - F Sex and allele drop-in Locus and allele drop-outs (low coverage)
14 CE-MPS concordance (15 autosomal markers) 30 individuals (12 males, 18 females, 450 s): Concordant: 99.1 %, discordant: 0.9 % Marker CE ForenSeq D2S1338 LDO 19, 25 FGA LDO 19, 20 D21S11 29, 32 29, 31, 32 32, , 32, 32.2
15 CE-MPS concordance (15 autosomal markers) 30 individuals (12 males, 18 females, 450 s): Concordant: 99.1 %, discordant: 0.9 % Marker CE ForenSeq D2S1338 LDO 19, 25 FGA LDO 19, 20 Locus drop-out Locus drop-out D21S11 29, 32 29, 31, 32 32, , 32, 32.2 s
16 Low template DNA samples Called autosomal STR markers (n=4) Called X-STR markers (n=4) Called Y-STR markers (n=2)
17 Low template DNA samples Called autosomal STR markers (n=4) 90 % of markers typed 50 % of markers typed Called X-STR markers (n=4) Called Y-STR markers (n=2)
18 DNA mixtures STRs & SNPs - FUAS screenshot STRs IDENTITY SNPs Imbalanced alleles warning Multiple alleles warning
19 DNA mixtures autosomal STRs Male:female mixture ratio Average # of Multiple alleles warnings Average # of Imbalanced warnings 1,000: : : : : : : : : : : : : : :1, single contributor samples
20 DNA mixtures autosomal STRs Male:female mixture ratio Average # of Multiple alleles warnings Average # of Imbalanced warnings 1,000: : : : : : :1 Notable difference :1 to single contributor :3 samples : : : : : :1, single contributor samples
21 Calling STR alleles with STRinNGS v.1.0 In-house software for calling STR sequence alleles 1 Predefined STR repeat structures and start and stop positions of flanking regions Pipeline: 1) Identifies STR flanking regions 2) Counts STR repeat numbers and identifies SNPs in flanks 3) Provides detailed information for each unique sequence, e.g. locus coverage, allele coverage, and full STR and flanking sequences 1 Friis SL et al.: Introduction of the Python script STRinNGS for analysis of STR regions in FASTQ or BAM files and expansion of the Danish STR sequence database to 11 STRs. Forensic Sci Int Genet. 2016; 21:
22 Calling STR alleles with STRinNGS v.1.0 STRinNGS v.1.0 (in-house) features not in FUAS: Analyses of STR flanking regions Automatic naming of SNP-STR alleles Simultaneous obtainment of allele and locus coverage of all unique sequences from all samples in a run
23 Coverage numbers of relevant DNA sequences 30 individuals (12 males, 18 females) DXS10103
24 Coverage numbers of relevant DNA sequences 30 individuals (12 males, 18 females) DXS10103 Average marker coverage: 4,173 X
25 Coverage numbers of relevant DNA sequences 30 individuals (12 males, 18 females) DXS10103 DYS460 DYS522 Average marker coverage: 4,173 X Tentative threshold: 200 X
26 Allele balances (longest allele / shortest allele) 30 individuals (12 males, 18 females) Increasing amplicon length
27 Allele balances (longest allele / shortest allele) 30 individuals (12 males, 18 females) 1:3 allele ratio (current CE discard threshold) 1:2 allele ratio (current CE imbalance threshold) 1:2 allele ratio 1:3 allele ratio Increasing amplicon length
28 Allele balances (longest allele / shortest allele) 30 individuals (12 males, 18 females) 1:3 allele ratio (current CE discard threshold) 1:2 allele ratio (current CE imbalance threshold) 1:2 allele ratio 1:3 allele ratio D22S1045 Avg amplicon length: 222 bp DXS8378 Avg amplicon length: 273 bp Increasing amplicon length
29 Conclusion The ForenSeq TM kit gave good results in sequencing 58 STRs simultaneously Lack of reproducibility was mainly due to calling of stutters as a true, third allele and low coverage in DXS10103 Few discordances to CE genotyping was observed (CE locus drop-out, stutters called as true alleles by ForenSeq TM ) Above 90 % of markers were called at 250 pg input DNA, and above 50 % at 62.5 pg The FUA software could effectively mark mixtures as imbalanced and/or containing more than two alleles in mixtures ranging from 1:1 to 1:25/1:50 ratios of DNA
30 Conclusion STRinNGS v.1.0 proved to be efficient in analysing STRs Acceptable locus and allele coverages were obtained except for the locus coverage of DXS10103, DYS460, and DYS522 (below 200 X) A total 26 SNPs were observed in the flanking regions of 19 different STRs.
31 Acknowledgements Members of the staff of the Section of Forensic Genetics, Faculty of Health and Medical Sciences, University of Copenhagen: Technician Anja Ladegaard Jørgensen Bioinformatician Carina Grøntved Jønck Forensic Geneticist Eszter Rockenbauer, MSc, PhD Forensic Geneticist Anders Buchard, MSc, PhD
Internal Validation Guide of Y-STR Systems for Forensic Laboratories Printed in USA. 11/12 Part# GE713
REFERENCE MANUAL Internal Validation Guide of Y-STR Systems for Forensic Laboratories 11/12 Internal Validation Guide of Y-STR Systems for Forensic Laboratories PLEASE DISCARD PREVIOUS VERSIONS. All technical
Performance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
Taming Uncertainty in Forensic DNA Evidence. Uncertainty. Genotype. Cybergenetics Prior probability
Taming Uncertainty in Forensic DNA Evidence ENFSI Meeting April, 2011 Brussels, Belgium Mark W Perlin,, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Cybergenetics 2003-2011 Uncertainty people (and the law)
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
MODULE NO.14: Y-Chromosome Testing
SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:
Golden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller
Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller TRUEALLELE WORK AND WORKFLOW: KERN COUNTY S FIRST CASES APRIL 23, 2014 Presenters! Kelly Woolard! Garett Sugimoto! Jerry Garza
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
Project Information. Manufacturer Information. Stakeholder Information. Evaluation Team. Evaluation Summary
Evaluation of Applied Biosystems AmpFℓSTR Identifiler Plus Amplification Kit 7881 114th Avenue North Largo, FL 33773 ph (727) 549-6067 www.nfstc.org Project Information Title: Evaluation of Applied Biosystems
Statistical Weights of Mixed DNA Profiles
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Statistical Weights of Mixed DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Implementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
New technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
DNA Short Tandem Repeats. Organism
DNA Short Tandem Repeats Organism DNA Short Tandem Repeats Organ DNA Short Tandem Repeats Cell Weights 1kg a bag of sugar 1g paper clip 1mg (milligram) 0.001g brain of a bee 1µg (microgram) 0.000001g weight
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation
A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
Elucigene Male Factor Infertility Products Guide to Interpretation
Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
PSSV User Manual (V1.0)
PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
Accel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
Applied Biosystems YFiler Plus and the UK YHRD Expansion Project. David Ballard, PhD King s Forensics
Applied Biosystems YFiler Plus and the UK YHRD Expansion Project David Ballard, PhD King s Forensics UK Population self described ancestry Ethnicity Percentage of Popula3on White Bri3sh 80.5 White Irish
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
Investigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
PSSV User Manual (V2.1)
PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
White Paper Estimating Complex Phenotype Prevalence Using Predictive Models
White Paper 23-12 Estimating Complex Phenotype Prevalence Using Predictive Models Authors: Nicholas A. Furlotte Aaron Kleinman Robin Smith David Hinds Created: September 25 th, 2015 September 25th, 2015
Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
DNA Profiling of the Semen Donor in Extended Interval (72 h) Post Coital Cervicovaginal Samples
DNA Profiling of the Semen Donor in Extended Interval (72 h) Post Coital Cervicovaginal Samples Jack Ballantyne University of Central Florida, Orlando, FL National Center for Forensic Science Problem some
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
Statistical Tests for X Chromosome Association Study. with Simulations. Jian Wang July 10, 2012
Statistical Tests for X Chromosome Association Study with Simulations Jian Wang July 10, 2012 Statistical Tests Zheng G, et al. 2007. Testing association for markers on the X chromosome. Genetic Epidemiology
Integrating the Quantifiler Duo DNA. Yfiler PCR Amplification Kit in Sexual Assault Investigations
Integrating the Quantifiler Duo DNA Quantification Kit with the AmpFlSTR Yfiler PCR Amplification Kit in Sexual Assault Investigations Lisa Calandro, M.P.H. Sr. Manager, Technical Marketing Outline Introduction
Small RNA Sequencing. Project Workflow. Service Description. Sequencing Service Specification BGISEQ-500 SERVICE OVERVIEW SAMPLE PREPARATION
BGISEQ-500 SERVICE OVERVIEW Small RNA Sequencing Service Description Small RNAs are a type of non-coding RNA (ncrna) molecules that are less than 200nt in length. They are often involved in gene silencing
Introduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
medoct group, Medical University Vienna, Jack Ballantyne, PhD National Center for Forensic Science, Orlando, FL USA
medoct group, Medical University Vienna, Jack Ballantyne, PhD National Center for Forensic Science, Orlando, FL USA Association of Forensic DNA Analysts and Administrators San Antonio, TX June 2012 Perceived
Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
Somatic cancer applications of NGS in in vitro Diagnostics.
Somatic cancer applications of NGS in in vitro Diagnostics. Nitin Udar PhD In Vitro Diagnsotics Division Illumina, Inc. 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray,
PG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
DNA Identification: TrueAllele Testimony. Interpretion: Same Principle. Different Methods. Cybergenetics
DNA Identification: TrueAllele Testimony Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Continuing Legal Education Allegheny County Courthouse March, 2011 Cybergenetics 2003-20112011 Interpretion:
Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages
Article DOI: http://dx.doi.org/10.3201/eid2009.131095 Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages Technical Appendix Technical Appendix
The Focused Exome service at Bristol Genetics Laboratory
The Focused Exome service at Bristol Genetics Laboratory Chris Buxton Maggie Williams July 2016 Bristol Clinical exome Service to mid July Validation: Agilent FE kit, NextSeq 500 and new pipeline 1st reports
Genetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Structural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015
Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling
Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
Listeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen
Listeria whole-genome-sequencing EFSA Project Anses Statens Serum Institut Public Health England University of Aberdeen Closing gaps for performing a risk assessment on Listeria monocytogenes in ready-to-eat
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
Molecular Characterization of Tumors Using Next-Generation Sequencing
Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation
FRAGILE X MOLECULAR DIAGNOSTICS ORDERING INFORMATION. FragilEaseTM FRAGILEASETM ASSAY CHARACTERISTICS WORKFLOW. PCR Purification.
ORDERING INFORMATION FRAGILEASE ASSAY CHARACTERISTICS High and low throughput options for cost- and timeefficient analyses 96 or 1152 reactions per kit Turnaround time from DNA to report approximately
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
Transcript of Dr. Mark Perlin's talk on "Preserving DNA Information" delivered on
Transcript of Dr. Mark Perlin's talk on "Preserving DNA Information" delivered on 2 October 2010 in Cleveland, OH at the National Association of Medical Examiners 2010 Annual Meeting. Dr. Perlin: I would
COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI)
COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI) Kevin D McCormick; Kerri J Penrose; Rahil Sethi; Jacob Waldman; William Schwarzmann; Uma Chandran;
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
The evidential value of STRs
Int J Legal Med (2001) 114 : 173 177 Springer-Verlag 2001 ORIGINAL ARTICLE B. Brinkmann H. Pfeiffer M. Schürenkamp C. Hohoff The evidential value of STRs An analysis of exclusion cases Received: 28 April
Case Study. Overview. Deleterious MLH1 mutation detected on sequencing 10/16/2014
The Role of Next Generation Sequencing for Hereditary Cancer Syndromes: A Focus on Endometrial Cancer Laura J. Tafe, MD Assistant Professor of Pathology Assistant Director, Molecular Pathology Dartmouth-Hitchcock
Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded lung adenocarcinoma samples
Bonfiglio et al. BMC Cancer (2016) 16:692 DOI 10.1186/s12885-016-2720-4 RESEARCH ARTICLE Open Access Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded
Interaction of Genes and the Environment
Some Traits Are Controlled by Two or More Genes! Phenotypes can be discontinuous or continuous Interaction of Genes and the Environment Chapter 5! Discontinuous variation Phenotypes that fall into two
Benchmark datasets for phylogenomic pipeline validation
Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept. 2018 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator Validation for phylogenomics Phylogenomic
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
Introduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
ANNUAL REPORT SUMMARY FOR TESTING IN 2008 Prepared by the Relationship Testing Program Unit ANNUAL VOLUME OF TESTING
1' OOio ANNUAL REPORT SUMMARY FOR TESTING IN 2008 Prepared by the Relationship Testing Program Unit PREFACE The goal of the survey is to ask relevant questions, gather pertinent data, track trends in testing,
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
ADVANCED PGT SERVICES
Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art
Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy
1 SYSTEM REQUIREMENTS 1 Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy Franziska Zickmann and Bernhard Y. Renard Research Group
SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
Y CHROMOSOME MICRODELETION Detection System v.4.0
Y CHROMOSOME MICRODELETION Detection System v.4.0 India Contact: Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 42208111,
Supplementary Methods. 1. Cancer Genetic Markers of Susceptibility (CGEMS) Prostate Cancer Genome-Wide Association Scan
Supplementary Methods 1. Cancer Genetic Markers of Susceptibility (CGEMS) Prostate Cancer Genome-Wide Association Scan The CGEMS data portal provides public access to summary results for approximately
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn
HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:
Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
Mendel Short IGES 2003 Data Preparation. Eric Sobel. Department of of Human Genetics UCLA School of of Medicine
Mendel Short Course @ IGES 2003 Data Preparation Eric Sobel Department of of Human Genetics UCLA School of of Medicine 02 November 2003 Mendel Short Course @ IGES Slide 1 Web Sites Mendel5: www.genetics.ucla.edu/software
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names Osteogenesis Imperfecta
NGS in neurodegenerative disorders - our experience
Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation
CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
Click and Learn CSI Wildlife: Using genetics to hunt elephant poachers
ABOUT THIS WORKSHEET Forensic scientists collect and analyze scientific evidence to solve crimes. One type of evidence they use is genetic data. In this activity, you will use DNA analysis to solve several
The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:
The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): DNA Profiling of the Semen Donor in Extended
Nature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
The Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase
HIV drug resistance and tracing outcomes among antiretroviral therapy defaulters in Malawi
HIV drug resistance and tracing outcomes among antiretroviral therapy defaulters in Malawi Bello G 1, ParkinN 2, KagoliM 1, ChipetaS 1, CzaickiN 3, Pry J 3, OdenyT 3, NyasuluI 4, LapointeH 5, Doherty M
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Loeys-Dietz Syndrome OMIM number for disease 609192; 608967; 610380; 610168 Disease
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria