How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"

Size: px
Start display at page:

Download "How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?""

Transcription

1 How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015

2 Cost per raw Megabase of DNA sequence $10, $1, $ $10.00 $1.00 Jul-98 Apr-01 Jan-04 Oct-06 Jul-09 Apr-12 Dec-14Sep-17 $0.10 Decreasing sequencing cost sequencingcosts $0.01 Democratization of sequencing

3 Applications of High throughput sequencing" Whole genome sequencing Genome variability within a host De-novo assembly of novel viruses Metagenomics of communities

4 Considerations for a genome assembly pipeline Flexible pipeline: Handling unknown genotypes or virus samples Platform independent: work with data from different platforms Virus independent: work on any virus Scalable to hundreds or thousands of samples Accuracy of SNP calling in the genome (outbreak analysis where samples are more closely related)

5 Pre-assembly " Processing" Check format (sff, fastq) Convert to FASTQ Remove adaptor contaminants Remove host genome contamination Quality & length trimming Assembly" De-novo assembly Reference assembly Validation Contig merge Classification Scaffolding contigs Post-assembly processing" Consensus Variant calling Annotation Genome comparison Known reference" Unknown reference"

6 Examples in Northern Italy: emergence of highly pathogenic avian influenza H7N1 Identify known molecular markers for viral pathogenicity in intra-host viral populations OIE & FAO reference lab for Influenza in the Netherlands: die-off of >1000 wild water frogs and newts Isolation, characterisation and relationship to known viruses of the Dutch frog killer Van Beurden et al. (2014). Genome Announc. hybrid Edible frog (Pelophylax kl. esculentus)

7 Monne et al. (2014). Journal of Virology Example 1: Characterization of HPAI signature mutations"

8 Pre-assembly processing" trim_galore and FastQC for quality control

9 Reference assemblers?" Hash based tools: Mosaik, Novoalign, Stampy, Tanoti Borrrows-Wheeler Transform-based tools: BWA, Bowtie2, NextGenMap HA M log10(doc) log10(doc) Too many to choose from position position NA NP 3.5 log10(doc) position NS log10(doc) position PA Bowtie2 and Stampy Tanoti log10(doc) log10(doc) position position 3.0 PB1 PB2 log10(doc) position log10(doc) position

10 Tablet - assembly

11 Variant calling detecting true mutations" Many tools LoFreq, Vphaser, DiversiTools Using replicates to validate mutations (e.g. FMDV experiments) Frequency of LPAI in HPAI samples Frequency of HPAI in LPAI samples X X X X X X X X X Samples PB2_I398T PB1_D154G Amino acid changes PB1_G216S PB1_E745K PA_T61I PA_K115N PA_K252E HA_A130T HA_T146A HA_E228A HA_T454A HA_R554K NP_A349T NP_N376S NA_K173R M1_A166V NS1_I136V NS1_N139D X X X X X NS1_-225R PB2_I398T PB1_D154G Amino acid changes One LPAI sample collected after the identification of HPAI with an HA cleavage site and multiple HPAI associated mutations at extremely low frequency PB1_G216S PB1_E745K PA_T61I PA_K115N PA_K252E HA_A130T HA_T146A HA_E228A HA_T454A HA_R554K NP_A349T NP_N376S NA_K173R M1_A166V NS1_I136V NS1_N139D NS1_-225R

12 Example 2: Isolation and Sequencing" From dead wild water frog in September 2013 Suspension from pooled internal organs Inoculated on BF-2 cells (Bluegill Fry cells fibroblast) DNA extracted using Dneasy kit (viral purity of 67% DNA sheared by sonication KAPA library preparation MiSeq (Illumina) Machine #2 test run: total run 26,700,000 reads including 50% PhiX (16Gb) 13,127,123 paired-end 300 bp reads from the sample (7.9 Gb)

13 Assembly" Abyss-pe de-novo assembler reconstructed the fullgenome in a single contig of 107,260 5 different regions had ambiguous/repetitive sequences Re-sequencing ambiguous regions with Sanger 1?????

14 Finishing assembly" CodonCode Aligner for assembling and checking the Sanger sequences SequencePatcher.pl to stitch the Sanger sequences into the de-novo contig icorn2 Final genome of 107,260 => 107,772bp

15 Annotating BLAST to find the most similar annotated genome Common Midwife Toad Virus (CMTV) from Spain Transfer of annotations from CMTV to the full genome (RATT) Identifies inappropriate start codons, frame-shifts Correcting of transferred models using Artemis

16 100 RGV JQ STIV EU FV3 KJ FV3 AY TFV AF CGSIV KF ADRV KF ADRV KC CMTV NL CMTV JQ ATV AY EHNV FJ ESV JQ kb

17 Standard formats" FASTQ quality score depends on the technology and base caller SAM soon v1.5 extensions

18 Genome standards 5 categories % genome covered >50% ~80-90% ~90-99% 100% 100% HTS coverage ~15-30 x >100 x RACE ~ x Ladner et al.(2014) mbio

19 Challenges: Rates of increase in data" 1,000, ,000 NGS (bp/$) Doubling time 5 months 100,000,000 10,000,000 1,000,000 Disk storage (Mbytes/$) 10,000 1, Hard disk storage (MB/$) Doubling time 14 months 100,000 10, DNA sequencing (bp/$) Pre-NGS (bp/$) Doubling time 19 months Year

20 Challenges: resources and technologies" Shift towards more data, labs need to have dedicated bioinformaticians Rule of thumb: invest as much in computers and data scientists as in sequencing equipment and lab technicians Non-uniform coverage, repeat regions, systematic biases, PCR errors, sequencing errors, sequence length

21 Director of OIE Collaborating Centre for Viral Genomics and Bioinformatics Director of Centre for Virus Research CVR bioinformatics team

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Transcriptome Analysis

Transcriptome Analysis Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits

More information

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:

More information

Introduction of an NGS gene panel into the Haemato-Oncology MPN service

Introduction of an NGS gene panel into the Haemato-Oncology MPN service Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics

More information

Future applications of full length virus genome sequencing

Future applications of full length virus genome sequencing Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

VIP: an integrated pipeline for metagenomics of virus

VIP: an integrated pipeline for metagenomics of virus VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory

More information

Clinical utility of NGS for the detection of HIV and HCV resistance

Clinical utility of NGS for the detection of HIV and HCV resistance 18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical

More information

New technologies reaching the clinic

New technologies reaching the clinic New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...

More information

Contribution of avian influenza data through OFFLU network

Contribution of avian influenza data through OFFLU network Dr Gounalan Pavade Chargé de Mission, OIE Headquarters Contribution of avian influenza data through OFFLU network Asia-Pacific Workshop on surveillance, prevention and control of zoonotic influenza Paro,

More information

Analysis of the genetic diversity of influenza A viruses using next-generation DNA sequencing

Analysis of the genetic diversity of influenza A viruses using next-generation DNA sequencing See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/273470093 Analysis of the genetic diversity of influenza A viruses using next-generation DNA

More information

APHL Next Generation Sequencing (NGS) Survey

APHL Next Generation Sequencing (NGS) Survey Next Generation Sequencing 1. How long has your lab had a sequencer? [If lab does not have a sequencer go to 1a1 through 1a3 and then end survey] [If lab does have a sequencer continue to 1a and the rest

More information

Next Generation Surveillance Systems integrating whole genome sequencing data into real-time detection and control (of TADs / EADs)

Next Generation Surveillance Systems integrating whole genome sequencing data into real-time detection and control (of TADs / EADs) Next Generation Surveillance Systems integrating whole genome sequencing data into real-time detection and control (of TADs / EADs) Peter Durr Ivano Broz Kerryne Graham Jianning Wang Frank Wong Sam McCullough

More information

Synthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI)

Synthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI) Synthetic Genomics and Its Application to Viral Infectious Diseases Timothy Stockwell (JCVI) David Wentworth (JCVI) Outline Using informatics to predict drift (strain selection) Synthetic Genomics: Preparedness

More information

Proposed EPPO validation of plant viral diagnostics using next generation sequencing

Proposed EPPO validation of plant viral diagnostics using next generation sequencing Proposed EPPO validation of plant viral diagnostics using next generation sequencing Ian Adams, Ummey Hany, Rachel Glover, Erin Lewis, Neil Boonham, Adrian Fox Adoption of Next Generation Sequencing for

More information

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control Hanoi, 2-3 October 2012

in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control Hanoi, 2-3 October 2012 Influenza A virus Prevalence Studies in Poultry in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia, 2008-2012 Kenji Sakurai OIE Asia Pacific Kenji Sakurai, OIE

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 24/04/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

Recent surveillance of influenza in animals and joint risk assessments

Recent surveillance of influenza in animals and joint risk assessments Recent surveillance of influenza in animals and joint risk assessments FAO ECTAD TEAM LAOS, MYANMAR, VIETNAM, RAP, HQ OIE Regional Expert Group Meeting for the Control of Avian Influenza in Asia Sapporo,

More information

GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA

GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA Dr Gounalan Pavade OIE Regional Expert Group Meeting for the Control of Avian Influenza in Asia Sapporo, Japan 3-5 October 2017 1 Avian influenza Outbreaks

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

The Open Bioinformatics Journal, 2014, 8, 1-5 1

The Open Bioinformatics Journal, 2014, 8, 1-5 1 Send Orders for Reprints to reprints@benthamscience.net The Open Bioinformatics Journal, 214, 8, 1-5 1 Open Access Performances of Bioinformatics Pipelines for the Identification of Pathogens in Clinical

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

HPAI H5(N8) in Member States in poultry, captive and wild birds

HPAI H5(N8) in Member States in poultry, captive and wild birds HPAI H5(N8) in Member States in poultry, captive and wild birds (01/10/2016-01/03/2017) DG Health and Food Safety 13,578,000 5,610,000 234,000 Broad migration flows of ducks across Europe 1,000,000 71,000

More information

Avian influenza at the poultry-human interface: Bangladesh

Avian influenza at the poultry-human interface: Bangladesh Avian influenza at the poultry-human interface: Bangladesh Syed Sayeem Uddin Ahmed, PhD Senior International Fellow Infectious Diseases Division Programme on Emerging Infections icddr,b Solving public

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Profile on TADs in Japan

Profile on TADs in Japan Profile on TADs in Japan Country Report Tatsumi Okura Deputy Director, Animal Health Division, Food Safety and Consumer Affairs Bureau, Ministry of Agriculture, Forestry and Fisheries, Japan Coordination

More information

Cristina Cassetti, Ph.D.

Cristina Cassetti, Ph.D. NIAID Extramural Research Update: Recombinant Influenza Viruses and Biosafety Cristina Cassetti, Ph.D. Influenza Program Officer Division of Microbiology and Infectious Diseases NIAID Influenza virus DMID

More information

VIROLOGY OF INFLUENZA. Subtypes: A - Causes outbreak B - Causes outbreaks C - Does not cause outbreaks

VIROLOGY OF INFLUENZA. Subtypes: A - Causes outbreak B - Causes outbreaks C - Does not cause outbreaks INFLUENZA VIROLOGY OF INFLUENZA Subtypes: A - Causes outbreak B - Causes outbreaks C - Does not cause outbreaks PATHOGENICITY High pathogenicity avian influenza (HPAI) Causes severe disease in poultry

More information

Avian influenza in poultry, wild and captive birds (AI)

Avian influenza in poultry, wild and captive birds (AI) Avian influenza in poultry, wild and captive birds (AI) Analysis of ADNS data since 01/2018 Reporting period: 2018-01-01 2018-10-28 Data query: 2018-10-30 AGES DSR Austrian Agency for Health and Food Safety

More information

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Third Global Conference of OIE Reference Centres Incheon(Seoul),

More information

Surviving an HPAI Outbreak

Surviving an HPAI Outbreak Surviving an HPAI Outbreak Lessons Learned VIV Poultry & Egg Summit Latin America, October 2016 Travis Schaal, DVM Avian Influenza Secreted in birds feces and nasal discharges Virus survives for days

More information

OIE Situation Report for Highly Pathogenic Avian Influenza

OIE Situation Report for Highly Pathogenic Avian Influenza OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 28/02/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and

More information

HIV DNA Genotyping by UDS compared with cumulative HIV RNA Genotypes in Pretreated Patients

HIV DNA Genotyping by UDS compared with cumulative HIV RNA Genotypes in Pretreated Patients HIV DNA Genotyping by UDS compared with cumulative HIV RNA Genotypes in Pretreated Patients Mathieu BLOT, Yannis DUFFOURD, Hélène GIRAUDON, Emilie TISSERAND, Arnaud SALMON-ROUSSEAU, Sophie MAHY, Marielle

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 18/09/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

H5N1 avian influenza: timeline

H5N1 avian influenza: timeline H5N1 avian influenza: timeline 28 October 2005 Previous events in Asia 1996 Highly pathogenic H5N1 virus is isolated from a farmed goose in Guangdong Province, China. 1997 Outbreaks of highly pathogenic

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 10/07/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Introduction to Avian Influenza

Introduction to Avian Influenza Introduction to Avian Influenza David L. Suarez D.V.M., Ph.D. Research Leader Exotic and Emerging Avian Viral Disease Research Unit Agricultural Research Service United States Department of Agriculture

More information

a. From the grey navigation bar, mouse over Analyze & Visualize and click Annotate Nucleotide Sequences.

a. From the grey navigation bar, mouse over Analyze & Visualize and click Annotate Nucleotide Sequences. Section D. Custom sequence annotation After this exercise you should be able to use the annotation pipelines provided by the Influenza Research Database (IRD) and Virus Pathogen Resource (ViPR) to annotate

More information

VirusDetect pipeline - virus detection with small RNA sequencing

VirusDetect pipeline - virus detection with small RNA sequencing VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering

More information

Study the Evolution of the Avian Influenza Virus

Study the Evolution of the Avian Influenza Virus Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction

More information

Competing co-infections of LP and HP AIV H7N7

Competing co-infections of LP and HP AIV H7N7 Competing co-infections of LP and HP AIV H7N7 Friedrich-Loeffler-Institute, Federal Research Institute for Animal Health Suedufer 10, 17493 Greifswald-Island of Riems, Germany Annika Graaf, Timm Harder

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 25/01/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and strains within

More information

Framework for the evaluation of. and scientific impacts of plant viruses. technologies.

Framework for the evaluation of. and scientific impacts of plant viruses. technologies. Framework for the evaluation of biosecurity, commercial, regulatory and scientific impacts of plant viruses and viroids identified by NGS technologies. Sebastien Massart, Thierry Candresse, José Gil, Christophe

More information

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Influenza Surveillance Animal and Public Health Partnership. Jennifer Koeman Director, Producer and Public Health National Pork Board

Influenza Surveillance Animal and Public Health Partnership. Jennifer Koeman Director, Producer and Public Health National Pork Board Influenza Surveillance Animal and Public Health Partnership Jennifer Koeman Director, Producer and Public Health National Pork Board Outline Background on influenza surveillance in swine Case example animal

More information

Dealing with Post-market Issues: PCV Case Study

Dealing with Post-market Issues: PCV Case Study Dealing with Post-market Issues: PCV Case Study CASE STUDY: Adventitious agent in raw material ISSUE: Presence of porcine circovirus (PCV-1) DNA detected in marketed rotavirus vaccine by an independent

More information

De Novo Viral Quasispecies Assembly using Overlap Graphs

De Novo Viral Quasispecies Assembly using Overlap Graphs De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique

More information

OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011

OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011 OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011 Frank Wong CSIRO Australian Animal Health Laboratory, Geelong, Australia OIE Reference Laboratory

More information

Evolution of influenza

Evolution of influenza Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal

More information

ANALYZING AND MANAGING RISKS IN LIFE SCIENCES RESEARCH

ANALYZING AND MANAGING RISKS IN LIFE SCIENCES RESEARCH Practical Training Exercise ANALYZING AND MANAGING RISKS IN LIFE SCIENCES RESEARCH Based on the article by Siddique, N. et al. Sequence and phylogenetic analysis of highly pathogenic avian influenza H5N1

More information

INFLUENZA-2 Avian Influenza

INFLUENZA-2 Avian Influenza INFLUENZA-2 Avian Influenza VL 7 Dec. 9 th 2013 Mohammed El-Khateeb Overview 1. Background Information 2. Origin/History 3. Brief overview of genome structure 4. Geographical Distribution 5. Pandemic Nature

More information

OFFLU the joint OIE-FAO network of expertise on animal influenza

OFFLU the joint OIE-FAO network of expertise on animal influenza OFFLU the joint OIE-FAO network of expertise on animal influenza FAO/OIE HPAI Laboratory Network Meeting for SE Asia Keith Hamilton OIE Scientific and Technical Department, OIE Paris OFFLU Objectives Share

More information

Amber Teacher, University of Helsinki

Amber Teacher, University of Helsinki Pathological Changes Observed in European Amphibians with Ranaviral Diseases Dr. Ana Balseiro Servicio Regional de Investigación y Desarrollo Agroalimentario (SERIDA), Centro de Biotecnología Animal, Área

More information

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA David L. Suarez Southeast Poultry Research Laboratory, Exotic and Emerging Avian Viral Diseases Research

More information

IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION

IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division

More information

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5

More information

Bilateral cooperation between a laboratory in Korea and laboratories in other countries:

Bilateral cooperation between a laboratory in Korea and laboratories in other countries: Bilateral cooperation between a laboratory in Korea and laboratories in other countries: the basis for a future extended network Yi Seok Joo DVM, Ph D National Veterinary Research and Quarantine Service

More information

I. H. Brown*, S. M. Reid, G. Simon, W. Loeffen, L. E. Larsen, P. Kellam, S.Watson, N. Lewis, S. M. Brookes, O.Pybus & ESNIP3 Consortium

I. H. Brown*, S. M. Reid, G. Simon, W. Loeffen, L. E. Larsen, P. Kellam, S.Watson, N. Lewis, S. M. Brookes, O.Pybus & ESNIP3 Consortium Coordinated surveillance of influenza viruses in European pigs: Enhanced Virological and Epidemiological analysis from the European Surveillance Network for Influenza in Pigs (ESNIP3) I. H. Brown*, S.

More information

High-throughput transcriptome sequencing

High-throughput transcriptome sequencing High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome

More information

Vaccination to stop transmission

Vaccination to stop transmission Vaccination to stop transmission Arjan Stegeman j.a.stegeman@uu.nl Faculty of Veterinary Medicine Goals of vaccination To prevent clinical disease (production, animal welfare, treatment costs, antimicrobial

More information

Surveillance for Avian Influenza in the European Union in EU Reference Laboratory for Avian Influenza, APHA-Weybridge, UK

Surveillance for Avian Influenza in the European Union in EU Reference Laboratory for Avian Influenza, APHA-Weybridge, UK Surveillance for Avian Influenza in the European Union in 2016 EU Reference Laboratory for Avian Influenza, APHA-Weybridge, UK Overview 2016 surveillance programme in Poultry Wild birds Additional epidemiological

More information

Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness

Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness Takato Odagiri Director WHO Collaborating Center on Influenza, Tokyo and Influenza Virus Research Center, National

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Principles for event based and active avian influenza surveillance. Les Sims Asia Pacific Veterinary Information Services

Principles for event based and active avian influenza surveillance. Les Sims Asia Pacific Veterinary Information Services Principles for event based and active avian influenza surveillance Les Sims Asia Pacific Veterinary Information Services apvis@bigpond.net.au Introduction No one size fits all surveillance system for avian

More information

The Controversy About the H5N1 Transmissibility Experiments. resumes on lethal flu strains

The Controversy About the H5N1 Transmissibility Experiments.   resumes on lethal flu strains The Controversy About the H5N1 Transmissibility Experiments http://www.nature.com/news/work resumes on lethal flu strains 1.12266 3 M AY 2 0 1 2 VO L 4 8 5 N AT U R E 1 3 Learning Objectives Participants

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

HPAI virus evolution and vaccination in Indonesia

HPAI virus evolution and vaccination in Indonesia OFFLU avian influenza virus characterisation meeting 29 30 March 2017 FAO Headquarters, Rome, Italy HPAI virus evolution and vaccination in Indonesia Ernes Andesfha 1 Hendra Wibawa 2,3 1 National Veterinary

More information

Influenza and other Respiratory Viruses Update

Influenza and other Respiratory Viruses Update Influenza and other Respiratory Viruses Update-- 2017 Pete Shult, PhD CDD Director & Emergency Laboratory Response and Erik Reisdorf, MPH, M(ASCP) CM Surveillance and Virology Lab-Team Lead WISCONSIN STATE

More information

High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P

High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P Zach Smith and Scott D. Michaels The Center for Genomics and Bioinformatics Indiana University Bloomington, IN USA Mary Blair

More information

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025

More information

OIE s initiative on HPAI control

OIE s initiative on HPAI control Current global situation on HPAI and OIE s initiative on HPAI control The 5 th OIE Regional Meeting on Strengthening e g Animal Health Information Networking for HPAI control and prevention in Asia Hanoi,

More information

Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation

Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Objectives Upon completion of this exercise, you will be able to use the annotation pipelines provided by

More information

Relative activity (%) SC35M

Relative activity (%) SC35M a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

Fifteen years of molecular EQA: progress and challenges

Fifteen years of molecular EQA: progress and challenges Fifteen years of molecular EQA: progress and challenges Anton M van Loon 1, Stuart West 2 and Paul Wallace 2 1 Department of Virology, UMC Utrecht, The Netherlands 2 QCMD, Glasgow, Scotland Key Issues

More information

Early Diagnosis: A Critical Step in Bird Flu Prevention

Early Diagnosis: A Critical Step in Bird Flu Prevention Early Diagnosis: A Critical Step in Bird Flu Prevention If avian influenza (bird flu) mutates sufficiently to jump from chickens and migratory birds to people, early diagnosis and identification of the

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 08/05/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Regional Overview of the implementation of National Control Strategies for Avian Influenza. Summary review of questionnaire OIE RRAP

Regional Overview of the implementation of National Control Strategies for Avian Influenza. Summary review of questionnaire OIE RRAP Regional Overview of the implementation of National Control Strategies for Avian Influenza Summary review of questionnaire OIE RRAP The OIE Questionnaire on Influenza A surveillance in animals in the Asia

More information

Influenza Viruses A Review

Influenza Viruses A Review Influenza Viruses A Review AVIAN INFLUENZA: INTERSECTORAL COLLABORATION Larnaca, Cyprus 20 22 July 2009 Kate Glynn Scientific and Technical Department, OIE Influenza Viruses C. Goldsmith,1981 Influenza

More information