Exome sequencing supports a de novo mutational paradigm for schizophrenia
|
|
- Jonathan Shields
- 5 years ago
- Views:
Transcription
1 Supplementary Information Exome sequencing supports a de novo mutational paradigm for schizophrenia Bin Xu 1,2, J. Louw Roos 3, Phillip Dexheimer 4, Braden Boone 4, Brooks Plummer 4, Shawn Levy 4, Joseph A. Gogos 2,5,*, Maria Karayiorgou 1,* 1 Department of Psychiatry, Columbia University, New York, NY Department of Physiology & Cellular Biophysics, Columbia University, New York, NY Weskoppies Hospital & Department of Psychiatry, University of Pretoria, Pretoria, RSA HudsonAlpha Institute for Biotechnology, Huntsville, AL Department of Neuroscience, Columbia University, New York, NY *Correspondence should be addressed to Maria Karayiorgou (mk2758@columbia.edu) or Joseph A. Gogos (jag90@columbia.edu)
2 Supplementary Notes Sample characteristics. The case sample consisted of 33 males (62%) and 20 females (38%) and both their unaffected biological parents, all of Afrikaner origin. In this sample, 90% of the probands met strict diagnostic DSM-IV criteria for schizophrenia (n = 47), 5% for schizoaffective disorder, depressed type (n = 3), and 5% for schizoaffective disorder, bipolar type (n = 3). The control sample consisted of 14 males (64%) and 8 females (36%) and both their biological parents. All controls were also of Afrikaner origin (all 4 grandparents were Afrikaans-speaking), adults (past the age at risk for any major psychiatric disease) and were screened via a systematic questionnaire to exclude history of psychiatric illness in themselves and close first- or second-degree relatives. Phenotypic variables in the sporadic cases cohort. The entire case sample includes 1 patient with mental retardation (who did not have a de novo mutation), 10 patients with a history of learning disabilities (4 of whom had de novo mutations) and 9 patients with a history of developmental delays (5 of whom had de novo mutations). History of learning disabilities was recorded as positive if there had been a diagnosis of a learning disability, or clear history of being a slow learner, requiring remediation at school, or placement in a special class. History of developmental delay was recorded as positive when there was clear history of maturation lag or milestone delays prior to age 6 (i.e. delayed crawling, walking, speaking, etc.). There were no significant differences in the distribution of the sexes among the
3 cases carrying de novo mutations and non-carriers [19 males (70%) and 8 females (30%) in the subgroup carrying de novo mutations; 14 males (54%) and 12 females (46%) in the non-carrier subgroup, Fisher s exact test, P = 0.26]. Similarly, age at disease onset defined as the age at which full DSM-IV criteria for SCZ or SCZAFF disorder were met was similar among cases carrying de novo mutations (23 yrs) versus non-carriers (21.5 yrs). Moreover, comparison of available clinical data from the families carrying de novo events and the rest of the sporadic cohort cases did not reveal any exceptional features suggestive of a more severe clinical presentation or of elevated rates of developmental delays, learning disabilities or presence of mental retardation (Supplementary Table 2). In particular, in comparing variables that could reflect severity of the disease (i.e. number of hospitalizations and total time spent in illness) we found no differences (average number of hospitalizations at the time of recruitment in the study was 2.5 in the subgroup carrying de novo mutations versus 2.7 in the non-carrier subgroup; similarly, total time spent in illness (in months) prior to the study entry diagnostic interview was 107 versus 102, respectively (Supplementary Table 2). We also asked whether the number of de novo events per case may act additively or synergistically to determine disease severity or atypical developmental course but we found no differences between single and multiple de novo mutation carriers. In general, the significance of two or more validated events in a single proband in terms of disease risk, severity, or both, remains to be determined using considerably larger patient samples.
4 Clinical information for the patient carrying the de novo p.pro429arg mutation in DGCR2. At the time of recruitment in the study, patient was a 35-year-old unmarried male staying with his parents. He has had numerous admissions to the psychiatric hospital because he did not comply with his medication plan and kept on relapsing into psychosis. Early childhood was insignificant with birth and developmental milestones reported as normal. There was no history of learning difficulties or early strange behavior and he did socialize easily. It was after the age of 10 that socialization became poor and after age 15 his academic performance started to deteriorate. He struggled through the military and a number of jobs over the next 10 years of his life, and at age 26 he developed grandiose and persecutory delusions meeting full diagnostic criteria for schizophrenia. He was also objectively hallucinating (talking to himself). There have been several admissions to the psychiatric hospital since disease onset at 26. He still has delusions and no insight into his illness. Since onset, he has not been working and his functioning has steadily declined. Literature-based evidence for other conserved/damaging variants. The WDR11(also known as BRWD2) gene encodes for a protein that contains multiple WD-domain and interacts with EMX1, a homeodomain transcription factor involved in brain development 1. Interestingly, mutations in the WDR11 gene have been found in subjects with Kallmann syndrome, a rare condition often associated with psychiatric pathology 1. The PLCL2 gene is thought to modulate GABAergic transmission, as well as behavioral performance in transgenic mice 2,3. TRAK1 encodes for kinesin adaptor that appears to regulate mitochondrial transport along axons.
5 Interestingly, TRAK1 also interacts with GABA type A (GABA(A)) receptors and regulates their levels. Mice carrying a homozygous mutation in the gene (hyrt) show hypertonicity, which is likely caused by deficits in GABA-mediated motor neuron inhibition 4,5. The KLF12 gene that encodes for a transcription factor has been tentatively implicated in the pathogenesis of bipolar disorder via a convergent functional genomics approach 6. The RBB1CC1 (FIP200) gene encodes for a protein that interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, and especially autophagy, as well as cell migration. It has also been identified as a tumor suppressor, which enhances retinoblastoma 1 gene expression in cancer cells 7,8. The LAMA2 gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 and 4. Homozygous mutations in LAMA2 lead predominantly but with variable penetrance to classical congenital muscular dystrophy characterized by clinical central nervous system involvement including white matter abnormalities, cognitive impairment, seizures and neuronal migration defects 9. De novo mutations in a related gene, LAMC3, were recently described in a autism spectrum disorders cohort 10.
6 Supplementary Figure 1: Flow diagram of sequence analysis pipeline. The flow diagram describes the procedure for sequence data cleanup, variant genotype calling and inheritance pattern determination. First, raw sequence reads were mapped to the human genome (build hg19) using BWA. Second, duplicates were removed, followed by data cleanup using GATK. Third, variant genotype calls were made by GATK Unified Genotyper and in/del genotype calls were made by Dindel. Fourth, low QC variants and variants overlapping with dbsnp132 were removed using a custom script. Fifth, the inheritance pattern of each variant was determined by comparing offspring and parental genotypes. Sixth, candidate variants were revalidated using the mpileup module of the SAMtools. Lastly, de novo variants were experimentally validated by Sanger sequencing.
7 Supplementary Figure 2: Identification and confirmation of a de novo SNV in a subject with SCZ. A. Identification of a de novo SNV in a subject with SCZ. IGV browser view of a de novo SNV in the DGCR2 gene. Top panel shows chromosome 22 with the mutation location indicated by a red box. Middle panels depict representative individual reads as well as the relative coverage per base pair for proband, mother and father. Colored coverage columns indicate the location of the SNV. The relative proportion of colors represents the ratio of variant reads observed. Bases that deviate from the reference sequence are highlighted in blue. Lower panel shows reference sequence and translated aminoacids. B. Sanger sequencing traces. Partial electropherograms surrounding the predicted mutation site validating the de novo occurrence for the candidate SNV depicted in (A).
8 Red arrow indicates that the proband, but not his parents, is a heterozygous SNV carrier at the predicted site. C. DGCR2 multi-species sequence alignment. The protein sequences of human, chimpanzee, mouse and zebrafish orthologues were compared. Black blocks indicate completely conserved residues; grey blocks indicate similar residues (defined by Boxshade default similarities); white blocks indicate variable residues. The position of the de novo SNV depicted in (A) is labeled with a red asterisk.
9 Supplementary Figure 3: Identification and confirmation of a de novo in/del in a subject with SCZ. A. Identification of a de novo in/del in a subject with SCZ. IGV browser view of a de novo in/del in the RB1CC1 gene. Top panel shows chromosome 8 with the mutation location indicated by a red box. Middle panels depict representative individual reads as well as the relative coverage per base pair for proband, mother and father. Lower coverage columns and dashes in the variant reads indicate the location of the in/del. Lower panel shows reference sequence and translated aminoacids. B. Sanger sequencing traces. Partial electropherograms surrounding the predicted mutation site validating the de novo occurrence for the candidate in/del depicted in (A). Red arrow indicates that the proband, but not his parents, has a deletion at the predicted mutation site.
10 Supplementary Figure 4: Sequencing coverage comparison. A. Average base pair reads at 1X, 4X, 8X, 20X and 30X coverage in case (blue) and control cohorts (red). B. The percentage of read coverage at each depth in case (blue) and control (red) cohorts. C. Average base pair reads at 1X, 4X, 8X, 20X and 30X coverage in cases with (blue) or without (red) de novo events. The error bars represent s.e.m.
11 Supplementary Table 1 De novo mutations identified in 22 control trios Gene Symbol Mutation Type NS vs S Chr:Pos Nucleotide change Aminoacid change Sex Trio ID LY75 SNV NS 2: TGT-gGT p.cys1511gly F C trio_054 KAZALD1 SNV S 10: CTG-tTG p.leu284leu F C trio_059 MYO5B SNV NS 18: CAG-CgG p.gln430arg F C trio_062 CPSF4 SNV NS 7: CGG-CaG p.arg144gln M C trio_068 DGKA SNV S 12: CCC-CCg p.pro724pro M C trio_069 SCARB1 SNV NS 12: CGC-CtC p.arg174leu F C trio_076 KIAA0430 SNV S 16: GGG-GGc p.gly231gly F C trio_076 MAP3K5 SNV Splice 6: T/C - M C trio_070 NS = Non-synonymous; S = Synonymous; C = Control
12 Supplementary Table 2 Phenotypic variables in cases with de novo mutations Sex Age Diagnosis Mental Retardation History of Learning Disabilities History of Developmental Delay Age at Disease Onset Education (yrs) # Hospitalizations History of Suicide Attempts # Suicide attempts Male 38 SCZ NO NO NO NO 0 MAGEC1 Male 31 SCZ NO NO NO NO 0 WDR11,TEKT5 Male 43 SCZ NO YES YES YES 2 THBS1 Male 31 SCZ NO NO NO YES 1 DPYD,CELF2 Female 36 SCZ NO YES NO NO 0 OR4C46 Male 35 SCZ NO NO YES U U PAG1 Gene(s) Affected Female 29 SCZ NO NO NO NO 0 UGT1A4,NPRL2,ADAMTS3,SPATA5 Male 17 SCZ NO NO NO 16 U 3 U U FAM3D Male 38 SCZ NO NO NO NO 0 RB1CC1 Male 32 SCZ NO NO YES NO 0 KLF12,TRRAP Male 20 SCZ NO NO NO NO 0 ADCY7 Female 26 SCZAFFdpr NO NO NO YES 6 GIF Male 33 SCZ NO NO NO NO 0 PLCL2,VPS35 Male 28 SCZ NO NO NO NO 0 PITPNM1 Male 23 SCZAFFdpr NO NO NO U U GPR153,RGS12 Male 23 SCZ NO NO YES NO 0 ESAM Male 34 SCZAFFdpr NO NO NO NO 0 PML Female 31 SCZ NO NO NO NO 0 ACOT6,SAP30BP Female 43 SCZAFF-bp NO NO NO YES 1 ZNF530,SLC26A8 Female 40 SCZ NO YES YES YES 1 MTOR,CCDC108,GPR115 Female 49 SCZ NO NO NO NO 0 TRAK1 Male 22 SCZ NO NO NO NO 0 COL3A1,FASTKD5 Male 35 SCZ NO NO NO NO 0 DGCR2 Male 20 SCZ NO NO NO U U LAMA2 Female 31 SCZAFF-bp NO NO NO NO 0 INPP5A Male 31 SCZ NO NO NO NO 0 SLC26A7 Male 24 SCZ NO NO NO NO 0 EDEM2 SCZ: Schizophrenia ; SCZAFF-dpr: Schizoaffective disorder, depressed subtype ;SCZAFF-bp: Schizoaffective disorder, bipolar subtype ;U: Unknown Note: Subject Age, # Hospitalizations, as well as History and Number of Suicide Attempts are all reported for the time of admission to the study.
13 Supplementary References 1. Kim, H.G. et al. WDR11, a WD protein that interacts with transcription factor EMX1, is mutated in idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Am J Hum Genet 87, (2010). 2. Mizokami, A. et al. Phospholipase C-related inactive protein is involved in trafficking of gamma2 subunit-containing GABA(A) receptors to the cell surface. J Neurosci 27, (2007). 3. Tomiyama, K. et al. Orofacial movements in phospholipase C-related catalytically inactive protein-1/2 double knockout mice: Effect of the GABAergic agent diazepam and the D(1) dopamine receptor agonist SKF Synapse 64, (2010). 4. Brickley, K. & Stephenson, F.A. Trafficking Kinesin Protein (TRAK)-mediated Transport of Mitochondria in Axons of Hippocampal Neurons. J Biol Chem 286, (2011). 5. Gilbert, S.L. et al. Trak1 mutation disrupts GABA(A) receptor homeostasis in hypertonic mice. Nat Genet 38, (2006). 6. Le-Niculescu, H. et al. Convergent functional genomics of genome-wide association data for bipolar disorder: comprehensive identification of candidate genes, pathways and mechanisms. Am J Med Genet B Neuropsychiatr Genet 150B, (2009). 7. Gan, B. & Guan, J.L. FIP200, a key signaling node to coordinately regulate various cellular processes. Cell Signal 20, (2008). 8. Liang, C.C., Wang, C., Peng, X., Gan, B. & Guan, J.L. Neural-specific deletion of FIP200 leads to cerebellar degeneration caused by increased neuronal death and axon degeneration. J Biol Chem 285, (2010). 9. Jones, K.J. et al. The expanding phenotype of laminin alpha2 chain (merosin) abnormalities: case series and review. J Med Genet 38, (2001). 10. O'Roak, B.J. et al. Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations. Nat Genet (2011).
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationSupplementary Information. Data Identifies FAN1 at 15q13.3 as a Susceptibility. Gene for Schizophrenia and Autism
Supplementary Information A Scan-Statistic Based Analysis of Exome Sequencing Data Identifies FAN1 at 15q13.3 as a Susceptibility Gene for Schizophrenia and Autism Iuliana Ionita-Laza 1,, Bin Xu 2, Vlad
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Relationship of the Icelandic psychosis family to five individuals (X1 X5) who carry the haplotype harboring RBM12 c.2377g>t but not RBM12 c.2377g>t. An asterisk marks whole-genome-sequenced
More informationVariant Detection & Interpretation in a diagnostic context. Christian Gilissen
Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationMOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY
MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY Intellectual disability (ID) or mental retardation is characterized by significant limitations in cognitive abilities and social/behavioral adaptive
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationPsych 3102 Lecture 3. Mendelian Genetics
Psych 3102 Lecture 3 Mendelian Genetics Gregor Mendel 1822 1884, paper read 1865-66 Augustinian monk genotype alleles present at a locus can we identify this? phenotype expressed trait/characteristic can
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationAutism shares features with cerebellar syndromes
NEWS Autism shares features with cerebellar syndromes BY KELLY RAE CHI 3 DECEMBER 2009 1 / 7 2 / 7 Misshapen structures: MRI scans show that, compared with controls (A), the cerebellum of a child with
More informationGenetics of Behavior (Learning Objectives)
Genetics of Behavior (Learning Objectives) Recognize that behavior is multi-factorial with genetic components Understand how multi-factorial traits are studied. Explain the terms: prevalence, incidence,
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More information1 in 68 in US. Autism Update: New research, evidence-based intervention. 1 in 45 in NJ. Selected New References. Autism Prevalence CDC 2014
Autism Update: New research, evidence-based intervention Martha S. Burns, Ph.D. Joint Appointment Professor Northwestern University. 1 Selected New References Bourgeron, Thomas (2015) From the genetic
More informationWhat can genetic studies tell us about ADHD? Dr Joanna Martin, Cardiff University
What can genetic studies tell us about ADHD? Dr Joanna Martin, Cardiff University Outline of talk What do we know about causes of ADHD? Traditional family studies Modern molecular genetic studies How can
More informationOpen Translational Science in Schizophrenia. Harvard Catalyst Workshop March 24, 2015
Open Translational Science in Schizophrenia Harvard Catalyst Workshop March 24, 2015 1 Fostering Use of the Janssen Clinical Trial Data The goal of this project is to foster collaborations around Janssen
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationand Maria Whole exome sequencing Copy number variation Schizophrenia Autism
A scan-statistic based analysis of exome sequencing data identifies FAN1 at 15q13.3 as a susceptibility gene for schizophrenia and autism Iuliana Ionita-Laza, Bin Xu, Vlad Makarov, Joseph D. Buxbaum, J.
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
More informationThe Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012
The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 Tracy Dixon-Salazar, Ph.D. University of California, San Diego American Epilepsy Society Annual Meeting 1 Disclosure
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative
More informationp.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure
a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a
More informationNovel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas
Novel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas Julius T. Oatts 1, Sarah Hull 2, Michel Michaelides 2, Gavin Arno 2, Andrew R. Webster 2*, Anthony T. Moore 1,2* 1. Department
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
More informationSingle Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions
Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationCognitive, affective, & social neuroscience
Cognitive, affective, & social neuroscience Time: Wed, 10:15 to 11:45 Prof. Dr. Björn Rasch, Division of Cognitive Biopsychology University of Fribourg 1 Content } 5.11. Introduction to imaging genetics
More informationThe coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,
More informationSMA IS A SEVERE NEUROLOGICAL DISORDER [1]
SMA OVERVIEW SMA IS A SEVERE NEUROLOGICAL DISORDER [1] Autosomal recessive genetic inheritance 1 in 50 people (approximately 6 million Americans) are carriers [2] 1 in 6,000 to 1 in 10,000 children born
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationHow many disease-causing variants in a normal person? Matthew Hurles
How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final
More informationChapter 18 Genetics of Behavior. Chapter 18 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 18 Genetics of Behavior Behavior Most human behaviors are polygenic and have significant environmental influences Methods used to study inheritance include Classical methods of linkage and pedigree
More informationClinical Spectrum and Genetic Mechanism of GLUT1-DS. Yasushi ITO (Tokyo Women s Medical University, Japan)
Clinical Spectrum and Genetic Mechanism of GLUT1-DS Yasushi ITO (Tokyo Women s Medical University, Japan) Glucose transporter type 1 (GLUT1) deficiency syndrome Mutation in the SLC2A1 / GLUT1 gene Deficiency
More informationCongenital Heart Disease How much of it is genetic?
Congenital Heart Disease How much of it is genetic? Stephen Robertson Curekids Professor of Paediatric Genetics Dunedin School of Medicine University of Otago Congenital Heart Disease The most common survivable
More informationLO S I N G TO U C H W I T H R E A L I T Y SEARCHING FOR THE SEEDS OF PSYCHOSIS
LO S I N G TO U C H W I T H R E A L I T Y SEARCHING FOR THE SEEDS OF PSYCHOSIS Dolores Malaspina, MD, MS, MSPH Anita & Joseph Steckler Professor of Psychiatry & Child Psychiatry - NYU Langone Medical Center
More informationThe Neurobiology of Psychiatric Disorders
The Neurobiology of Psychiatric Disorders Vikaas S. Sohal, MD PhD Department of Psychiatry Center for Integrative Neuroscience Sloan Swartz Center for Theoretical Neurobiology Overview 1. Classification
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Amyotrophic Lateral Sclerosis 10 (ALS10) and Amyotrophic Lateral Sclerosis 6 (ALS6)
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationVeronika Borbélyová, MSc., PhD.
Veronika Borbélyová, MSc., PhD. borbelyova.veronika88@gmail.com History Eugen Bleuler autism (from the Greek words autos = self, ismus = orientation, status) the patient reduces the contact with the outside
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationHuman Genetic Diseases (non mutation)
mutation) Pedigrees mutation) 1. Autosomal recessive inheritance: this is the inheritance of a disease through a recessive allele. In order for the person to have the condition they would have to be homozygous
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationDiscovery of Schizophrenia Drug Targets from DISC1 Mechanisms Atsushi Kamiya M.D., Ph.D.
Discovery of Schizophrenia Drug Targets 1 Assistant Professor Department of Psychiatry and Behavioral Sciences Johns Hopkins University School of Medicine akamiya1@jhmi.edu How does neurobiology offer
More informationProteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids
Proteins Protein carbon, hydrogen, oxygen, nitrogen and often sulphur Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids During protein synthesis, amino acids
More informationChapter 11 Patterns of Chromosomal Inheritance
Inheritance of Chromosomes How many chromosomes did our parents gametes contain when we were conceived? 23, 22 autosomes, 1 sex chromosome Autosomes are identical in both male & female offspring For the
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationSupplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures
The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,
More information38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationMeiotic Mistakes and Abnormalities Learning Outcomes
Meiotic Mistakes and Abnormalities Learning Outcomes 5.6 Explain how nondisjunction can result in whole chromosomal abnormalities. (Module 5.10) 5.7 Describe the inheritance patterns for strict dominant
More informationTitle:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2)
Author's response to reviews Title:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2) Authors: Sebastian Fröhler (Sebastian.Froehler@mdc-berlin.de)
More informationPersonalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationUntitled Document. 1. Which of the following is the template for the production of RNA within a cell? A. DNA B. ATP C. protein D.
Name: Date: 1. Which of the following is the template for the production of RNA within a cell? A. DNA B. ATP C. protein D. carbohydrate 2. Which sequence of DNA bases would pair with the ones shown in
More informationCatastrophic disruption of the blood-brain barrier in paediatric traumatic brain injury Dr Josie Fullerton
Catastrophic disruption of the blood-brain barrier in paediatric traumatic brain injury Dr Josie Fullerton Traumatic brain injury (TBI) represents the leading cause of death in children and adolescents
More informationMendelian Inheritance. Jurg Ott Columbia and Rockefeller Universities New York
Mendelian Inheritance Jurg Ott Columbia and Rockefeller Universities New York Genes Mendelian Inheritance Gregor Mendel, monk in a monastery in Brünn (now Brno in Czech Republic): Breeding experiments
More informationGuided Notes: Simple Genetics
Punnett Squares Guided Notes: Simple Genetics In order to determine the a person might inherit, we use a simple diagram called a o Give us of an offspring having particular traits Pieces of the Punnett
More informationCHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
More informationWDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
More informationSingle Genes can modify behavior: Worms; Flies; Mice: Humans
Single Genes can modify behavior: Worms; Flies; Mice: Humans Social Behavior in C. elegans. Mutation in a neuropeptide-y-like protein; the NPR-1 receptor. In mammals, important for feeding. Clumping is
More informationSingle Genes can modify behavior: Worms; Flies; Mice: Humans
Single Genes can modify behavior: Worms; Flies; Mice: Humans Social Behavior in C. elegans. Mutation in a neuropeptide-y-like protein; the NPR-1 receptor. In mammals, important for feeding. Clumping is
More informationAuthor Appendix Contents. Appendix A. Model fitting results for Autism and ADHD by 8 years old
1 Author Appendix Contents Appendix A. Model fitting results for Autism and ADHD by 8 years old Appendix B. Results for models controlling for paternal age at first childbearing while estimating associations
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISORDER/CONDITION POPULATION TRIAD Submitting laboratory: Exeter RGC Approved: Sept 2013 1. Disorder/condition
More informationResearchers probe genetic overlap between ADHD, autism
NEWS Researchers probe genetic overlap between ADHD, autism BY ANDREA ANDERSON 22 APRIL 2010 1 / 7 Puzzling link: More than half of children with attention deficit hyperactivity disorder meet the diagnostic
More informationBasic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH
Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationGenetics of Behavior (Learning Objectives)
Genetics of Behavior (Learning Objectives) Recognize that behavior is multi-factorial with genetic components Understand how multi-factorial traits are studied. Explain the terms: incidence, prevalence,
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationPROGRESS: Beginning to Understand the Genetic Predisposition to PSC
PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for
More informationSupplementary Information to
Supplementary Information to Exome sequencing to identify de novo mutations in sporadic ALS trios Alessandra Chesi 1,11, Brett T. Staahl 2, Ana Jovicic 1, Julien Couthouis 1, Maria Fasolino 3, Alya R.
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Choroideremia OMIM number for disease 303100 Disease alternative names please
More informationBiomarkers in Schizophrenia
Biomarkers in Schizophrenia David A. Lewis, MD Translational Neuroscience Program Department of Psychiatry NIMH Conte Center for the Neuroscience of Mental Disorders University of Pittsburgh Disease Process
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationNature Genetics: doi: /ng Supplementary Figure 1. TNFAIP3-associated haplotypes in family 1.
Supplementary Figure 1 TNFAIP3-associated haplotypes in family 1. The p.leu227* mutation (shown as a star) arose de novo in the first affected member of the family (P1). Red haplotypes carry the TNFAIP3
More informationUpdate on First Psychotic Episodes in Childhood and Adolescence. Cheryl Corcoran, MD Assistant Professor of Psychiatry Columbia University
Update on First Psychotic Episodes in Childhood and Adolescence Cheryl Corcoran, MD Assistant Professor of Psychiatry Columbia University Childhood-Onset Psychosis 8% of psychiatrically referred youth
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More informationSupplementary Note. Patient #1 Additional Details
Supplementary Note Patient #1 Additional Details Past medical history: The patient was ambidextrous. She had a history of hypertension, hyperlipidemia, migraines, and remote history of an ANA-positive
More informationBrain complexity and disease SM MAAS
Brain complexity and disease September 9, 2009 Dr. Stefan Maas, BioS Lehigh U. Brain networks lehigh.edu SMAAS Brain Trivia The average number of more than The adult neurons in 100,000 brain weighs the
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationCHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationChapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS
Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS Chapter Summary In order to study the transmission of human genetic traits to the next generation, a different method of operation had to be adopted. Instead
More information