CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

Size: px
Start display at page:

Download "CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE"

Transcription

1 CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr G C heterozygous DDX11L1 chr A G Homozygous rs ISG15 chr A G heterozygous rs C1orf159 chr A AC heterozygous clinical rs ABCA4 chr T - Homozygous rs HRNR chr C CAGCTCT heterozygous rs LCE4A chr A G heterozygous 36 probable-pathogenic clinical rs699 mito AGT chr T C heterozygous AGAP11;AGAP11,BC chr G C heterozygous SMG6 1 CHR Name of the reference contig/chromosome where the variant occurs 2 POS Position in the reference contig/chromosome where the variant occurs 3 REF Reference base at the variant site 4 OBS Observed/alternate base in the samples at the variant site 5 ALLELE Genotype of the sample. Genotypes: homozygous and heterozygous 6 BUILD Gene ID associated with the locaation of the variant call 7 CLINICAL_SIGNIFICANCE SNP clinical significance. Possible values are unknown, non-pathogenic,probable-nonpathogenic, probable-patogenic, pathogenic, drug-response, histocompatibility, other. Information from dbsnp 8 is_clinical SNP is clinical. Information from dbsnp 9 dbsnp dbsnp identifier. If the observed variant exists in the dbsnp the rs identifier is shown 10 MITO If protein is predicted to target the mitochondria 11 GENE Gene ID associated with the location of the variant call

2 DESCRIPTION VARIANT_FUNC TION EXONIC_FUNCTION AA_CHANGES AA_CHANGE - ncrna_exonic Ubiquitin-like protein ISG15 exonic synonymous ISG15:uc001acj.3:exon2:c.A294G:p.V98V, V => V Uncharacterized protein C1orf159 exonic synonymous C1orf159:uc001acn.2:exon5:c.T357C:p.I119I,C1or I => I Retinal-specific ATP-binding cassette transporter intronic Hornerin exonic frameshift deletion HRNR:uc001ezt.1:exon2:c.1delA:p.M1fs, - Late cornified envelope protein 4A exonic nonframeshift substitution LCE4A:uc001fak.2:exon1:c.129_129delinsCAGCTC TGGGGGCTGCTGT, - Angiotensinogen exonic nonsynonymous AGT:uc009xff.2:exon3:c.T719C:p.M240T,AGT:uc0 M => T Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 11 exonic;splicing nonsynonymous AGAP11:uc009xnf.2:exon4:c.A395G:p.H132R, H => R Telomerase-binding protein EST1A exonic nonsynonymous SMG6:uc010vqv.1:exon5:c.C569G:p.S190W,SMG 6:uc002fub.1:exon13:c.C3293G:p.S1098W, S => W 12 DESCRIPTION Gene ID description VARIANT_FUNCT ION EXONIC_FUNCTI ON Annotation of the variant with respect to its genomic context. Possible annotations are exonic, UTR5, UTR3, intronic, intergenic, splicing, downstream, upstream. When several protein splice variants overlap Annotation of the functional class of the variant. Possible annotations are synonymous, nonsynonymous, framshift deletion, frameshift substitution 15 AA_CHANGES Aminoacid change produced in the different transcripts. c = cdna, p = protein 16 AA_CHANGE Aminoacid change produced: REFERENCE => MUTATION

3 SIFT PP2 LRT OMIM OMIM_DESC PATHWAY GO GO_DESC UBIQUITIN-LIKE RIG-I-like receptor signaling GO: protein binding GO: membrane integral to ,601718, STARGARDT DISEASE 1; ABC transporters GO: nucleotide binding cornified envelope GO: LATE CORNIFIED - GO: keratinization tolerated benign neutral ANGIOTENSINOGEN; Hypertrophic cardiomyopathy GO: ovarian follicle rupture damaging GO: ARF GTPase activator damaging probably damaging deleterius SMG6, C. ELEGANS, - GO: nuclear-transcribed COLUMN NAME COLUMN NAME 17 SIFT 18 PP2 19 LRT Prediction whether the aminoacid substitution affects protein function. SIFT is based on the degree of cosnervation of aminoa amino acid residues in sequence alignments derived from closely related sequences. Possible values are tolater, damaging Prediction of the possible impact of the amino acid substitution on the structure and function of the protein using straightforward physical and comparative considerations. Possible values are probably damaging, possibly damaging and benign Prediction of deletetious mutations that disrupt highly conserved amino acid residues through a likelihood ratio test. Possible values are deleterious, neutral and unknown 20 OMIM OMIM IDs that are related to the corresponding gene. Information from the OMIM database 21 OMIM_DESC Description of the OMIM Ids 22 PATHWAY Functional pathway to which the corresponding gene belongs to. Information taken from the KEGG pathway database 23 GO Gene ontology IDs that are related to the correspondin gene. Information from GO.org 24 GO_DESC Description of the GO Ids

4 CONSERVE D SCORE FILTER DP A C G T conserved StdFilter PASS conserved PASS StdFilter conserved StdFilter PASS PASS conserved StdFilter conserved PASS CONSERVED Conserved elements produce by the phastcons program based on a whole-genome alignment of 46 vertebrates. Information taken from UCSC 26 SCORE Probability that REF/ALT polymorphism exists at this site given the sequencing data. In phred scale 27 FILTER Default filters for SNPs: StdFilter (QUAL<50.0 AB >0.75 FS > QD < 5.0 HRun > 5.0), LowD (DP < 6.0), Hard2Validate (MQ0 >= 4.0 && MQ0/DP> 0.1) Default filters for Indels: StdFilter (QUAL<50.0 FS > QD < 2.0), LowD (DP <6 ) Variant passing the default filters will be tagged as PASS 28 DP Total depth of reads 29 A A s observed at the variant position 30 C C s observed at the variant position 31 G G s observed at the variant position 32 T T s observed at the variant position FS QD MQ AB GT GQ LKH /1 99 0:1:0

5 /1 99 0:0: /1 99 0:1: /1 99 0:1: /1 99 0:0: /1 99 0:1: /1 99 0:1: /1 99 0:1: /1 99 0:1:0 33 FS Strand Bias. Evidence for the variation of the reads to be seen only on the forward or only in te reverse strand. Higher values denote more bias and therfore are more likely to indicate fasle positive calls 34 QD Quality by depth. Variant confidence. Low scores are indicative of fals positive calls and artifacts 35 MQ Mapping quality 36 AB Allele balance of REF/ALT in heterozygous 37 GT The genotype of this sample. Possible values are heterozygous (0/1: 1 REF and 1 ALT) and homozygous (1/1: 2 ALT alleles) 38 GQ Genotype quality. In Phred scale 39 LKH Likelihoods of the 3 genotypes.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Variant Annotation and Functional Prediction

Variant Annotation and Functional Prediction Variant Annotation and Functional Prediction Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret candidate

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Concurrent Practical Session ACMG Classification

Concurrent Practical Session ACMG Classification Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim

More information

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing

More information

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 131 disease or trait variations are found in this genome

Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 131 disease or trait variations are found in this genome Report Date: August 2, 215 Software Annotation Version: 8 Genome Summary Name: Greg Mendel Genome ID: genome_greg_mendel_dad Sequencing Provider: 23andMe Sequencing Type: Genotyping SNP Array Sequencing

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Dr. Maricel G. Kann Assistant Professor Dept of Biological Sciences UMBC 2 The term protein domain

More information

Using SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute

Using SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute Using SuSPect to Predict the Phenotypic Effects of Missense Variants Chris Yates UCL Cancer Institute c.yates@ucl.ac.uk Outline SAVs and Disease Development of SuSPect Features included Feature selection

More information

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Director of Cytogenomics and Molecular Pathology Evidence-based

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

CHAPTER IV RESULTS Microcephaly General description

CHAPTER IV RESULTS Microcephaly General description 47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified

More information

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

More information

STATISTICAL METHODS IN BIOLOGY

STATISTICAL METHODS IN BIOLOGY STATISTICAL METHODS IN BIOLOGY JOANNA SZYDA MAGDALENA FRĄSZCZAK INTRODUCTION 1. Statistical methods in biology??? 2. The Biostatistic Group current projects 3. Course contents 4. Contact 5. Literature

More information

SpliceDB: database of canonical and non-canonical mammalian splice sites

SpliceDB: database of canonical and non-canonical mammalian splice sites 2001 Oxford University Press Nucleic Acids Research, 2001, Vol. 29, No. 1 255 259 SpliceDB: database of canonical and non-canonical mammalian splice sites M.Burset,I.A.Seledtsov 1 and V. V. Solovyev* The

More information

MutationTaster & RegulationSpotter

MutationTaster & RegulationSpotter MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure

More information

Annotation of Drosophila mojavensis fosmid 8 Priya Srikanth Bio 434W

Annotation of Drosophila mojavensis fosmid 8 Priya Srikanth Bio 434W Annotation of Drosophila mojavensis fosmid 8 Priya Srikanth Bio 434W 5.1.2007 Overview High-quality finished sequence is much more useful for research once it is annotated. Annotation is a fundamental

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting

More information

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Colorspace & Matching

Colorspace & Matching Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties

More information

Supplementary Information

Supplementary Information 1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y Clin Genet 2013: 83: 477 481 Printed in Singapore. All rights reserved Short Report 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd CLINICAL GENETICS doi: 10.1111/cge.12006 Whole exome

More information

Supplementary Figure 1

Supplementary Figure 1 Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the

More information

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.

More information

EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS

EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS IULIANA IONITA-LAZA 1,7,, KENNETH MCCALLUM 1,7, BIN XU 2, JOSEPH BUXBAUM

More information

PALB2 c g>c is. VARIANT OF UNCERTAIN SIGNIFICANCE (VUS) CGI s summary of the available evidence is in Appendices A-C.

PALB2 c g>c is. VARIANT OF UNCERTAIN SIGNIFICANCE (VUS) CGI s summary of the available evidence is in Appendices A-C. Consultation sponsor (may not be the patient): First LastName [Patient identity withheld] Date received by CGI: 2 Sept 2017 Variant Fact Checker Report ID: 0000001.5 Date Variant Fact Checker issued: 12

More information

Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s

Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s ROMA, 23 GIUGNO 2011 Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s USSD Lab Genetica Medica Ospedali Riuniti Bergamo The problem What does the clinician/patient want to know?? Diagnosis,

More information

A guide to understanding variant classification

A guide to understanding variant classification White paper A guide to understanding variant classification In a diagnostic setting, variant classification forms the basis for clinical judgment, making proper classification of variants critical to your

More information

Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009

Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed

More information

Supplementary information to:

Supplementary information to: Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors

More information

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation. SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang

More information

MSI positive MSI negative

MSI positive MSI negative Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Functional analysis of DNA variants

Functional analysis of DNA variants Functional analysis of DNA variants GS011143, Introduction to Bioinformatics The University of Texas GSBS program, Fall 2012 Ken Chen, Ph.D. Department of Bioinformatics and Computational Biology UT MD

More information

Cardiology Genetics Report Long QT Syndrome (LQTS) Panel

Cardiology Genetics Report Long QT Syndrome (LQTS) Panel Patient Name: Test(s) Requested: The ordered test and the genes analyzed are Genes Evaluated (Disease): Result: Only mutations detected appear here KCNQ1 (LQT1 and Jervell and LangeNielsen syndrome), KCNH2

More information

A rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France

A rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

For all of the following, you will have to use this website to determine the answers:

For all of the following, you will have to use this website to determine the answers: For all of the following, you will have to use this website to determine the answers: http://blast.ncbi.nlm.nih.gov/blast.cgi We are going to be using the programs under this heading: Answer the following

More information

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline

More information

Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016

Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016 Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016 Human Papillomavirus (HPV) Small non-enveloped Double stranded DNA Virus Genome 8000 basepairs 8 coding genes, Early (E)

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: EPHB2 germline variants in patients with colorectal cancer or hyperplastic polyposis Authors: Antti Kokko (antti.kokko@helsinki.fi) Paivi Laiho (paivi.laiho@helsinki.fi)

More information

Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations

Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations Korean J Lab Med 2010;30:190-4 DOI 10.3343/kjlm.2010.30.2.190 Original Article Diagnostic Genetics Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report

More information

FINAL ANNOTATION REPORT: Drosophila virilis Fosmid 11 (48P14) Robert Carrasquillo Bio 4342

FINAL ANNOTATION REPORT: Drosophila virilis Fosmid 11 (48P14) Robert Carrasquillo Bio 4342 FINAL ANNOTATION REPORT: Drosophila virilis Fosmid 11 (48P14) Robert Carrasquillo Bio 4342 2006 TABLE OF CONTENTS I. Overview... 3 II. Genes... 4 III. Clustal Analysis... 15 IV. Repeat Analysis... 17 V.

More information

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still 157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can

More information

TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition

TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition AD Award Number: W81XWH-13-1-0336 TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition PRINCIPAL INVESTIGATOR: Mary-Claire King,

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

Case Report Intermediate MCAD Deficiency Associated with a Novel Mutation of the ACADM Gene: c.1052c>t

Case Report Intermediate MCAD Deficiency Associated with a Novel Mutation of the ACADM Gene: c.1052c>t Case Reports in Genetics Volume 215, Article ID 5329, 4 pages http://dx.doi.org/1.1155/215/5329 Case Report Intermediate MCAD Deficiency Associated with a Novel Mutation of the ACADM Gene: c.152c>t Holli

More information

Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects

Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects MOLECULAR AND CLINICAL ONCOLOGY 2: 435-439, 2014 Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects LUBOMIR BALABANSKI 1*, GEORGI ANTOV 2*, IVANKA DIMOVA 3, SAMUIL

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Country distribution of GME samples and designation of geographical subregions.

Nature Genetics: doi: /ng Supplementary Figure 1. Country distribution of GME samples and designation of geographical subregions. Supplementary Figure 1 Country distribution of GME samples and designation of geographical subregions. GME samples collected across 20 countries and territories from the GME. Pie size corresponds to the

More information

Mutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark

Mutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark Clin Genet 2016: 90: 247 251 Printed in Singapore. All rights reserved Short Report 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12692 Mutational and

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation

The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,

More information

Bio 312, Spring 2017 Exam 3 ( 1 ) Name:

Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years.

Nature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years. Supplementary Figure 1 Brain magnetic resonance imaging in patient 9 at age 3.6 years. (a d) Axial T2-weighted images show a marked degree of ventriculomegaly. Note the diencephalic mesencephalic junction

More information

A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in

A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

More information

BRCA1 and BRCA2 germline muta-ons in Moroccan breast/ovarian cancer families

BRCA1 and BRCA2 germline muta-ons in Moroccan breast/ovarian cancer families BRCA1 and BRCA2 germline muta-ons in Moroccan breast/ovarian cancer families A Tazzite a, H Jouhadi b, A Benider b, K Hamzi a and S Nadifi a a Genetics and Molecular Pathology Laboratory, Medical School

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

Pirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians

Pirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Public Health Theses School of Public Health January 2015 Pirna Sequence Variants Associated With Prostate Cancer In African

More information

Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 106 disease or trait variations are found in this genome

Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 106 disease or trait variations are found in this genome Report Date: August 24, 2016 Software Annotation Version: 8 Genome Summary Name: (unknown) Genome ID: GFG_filtered_unphased_genotypes Sequencing Provider: (unknown) Sequencing Type: (unknown) Sequencing

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10643 Supplementary Table 1. Identification of hecw-1 coding polymorphisms at amino acid positions 322 and 325 in 162 strains of C. elegans. WWW.NATURE.COM/NATURE 1 Supplementary Figure

More information

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:

More information

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm

More information

Gene Finding in Eukaryotes

Gene Finding in Eukaryotes Gene Finding in Eukaryotes Jan-Jaap Wesselink jjwesselink@cnio.es Computational and Structural Biology Group, Centro Nacional de Investigaciones Oncológicas Madrid, April 2008 Jan-Jaap Wesselink jjwesselink@cnio.es

More information

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Introduction to Bioinformatics Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

More information

Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March

Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response Ray White Verona March 18. 2008 Craig Venter Genome 2,810,000,000 bases, 7.5-fold coverage 3,213,401 SNPs 85% in

More information

Supplemental Table 1. Components of MDS and AHEI

Supplemental Table 1. Components of MDS and AHEI Supplemental Table 1. Components of MDS and AHEI MDS AHEI Vegetable Fruit SSB & fruit juice Nut Legume Whole grain Fish Red meat MUFA/SAT ratio EPA & DHA PUFA Trans-fat Alcohol Sodium MDS: Mediterranean-style

More information

Molecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY Tel: Fax:

Molecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY Tel: Fax: Molecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY 01234 Tel: 555-920-3333 Fax: 555-920-3334 www.moldxlaboratory.com Patient Name: Jane Doe Specimen type: Blood, peripheral DOB: 04/05/1990

More information

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for

More information