World Journal of Gastroenterology

Transcription

1 ISSN (print) ISSN (online) World Journal of Gastroenterology World J Gastroenterol 2015 July 21; 21(27): Published by Baishideng Publishing Group Inc

2 Editorial Board The World Journal of Gastroenterology Editorial Board consists of 1380 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 68 countries, including Algeria (2), Argentina (7), Australia (31), Austria (9), Belgium (11), Brazil (20), Brunei Darussalam (1), Bulgaria (2), Cambodia (1), Canada (26), Chile (4), China (165), Croatia (2), Cuba (1), Czech (6), Denmark (2), Egypt (9), Estonia (2), Finland (6), France (20), Germany (58), Greece (31), Guatemala (1), Hungary (15), Iceland (1), India (33), Indonesia (2), Iran (10), Ireland (9), Israel (18), Italy (194), Japan (151), Jordan (1), Kuwait (1), Lebanon (7), Lithuania (1), Malaysia (1), Mexico (11), Morocco (1), Netherlands (5), New Zealand (4), Nigeria (3), Norway (6), Pakistan (6), Poland (12), Portugal (8), Puerto Rico (1), Qatar (1), Romania (10), Russia (3), Saudi Arabia (2), Singapore (7), Slovenia (2), South Africa (1), South Korea (69), Spain (51), Sri Lanka (1), Sudan (1), Sweden (12), Switzerland (5), Thailand (7), Trinidad and Tobago (1), Tunisia (2), Turkey (55), United Kingdom (49), United States (181), Venezuela (1), and Vietnam (1). EDITORS-IN-CHIEF Stephen C Strom, Stockholm Saleh A Naser, Orlando Andrzej S Tarnawski, Long Beach Damian Garcia-Olmo, Madrid ASSOCIATE EDITOR Yung-Jue Bang, Seoul Vincent Di Martino, Besancon Daniel T Farkas, Bronx Roberto J Firpi, Gainesville Maria Gazouli, Athens Chung-Feng Huang, Kaohsiung Namir Katkhouda, Los Angeles Anna Kramvis, Johannesburg Wolfgang Kruis, Cologne Peter L Lakatos, Budapest Han Chu Lee, Seoul Christine McDonald, Cleveland Nahum Mendez-Sanchez, Mexico City George K Michalopoulos, Pittsburgh Suk Woo Nam, Seoul Shu-You Peng, Hangzhou Daniel von Renteln, Montreal Angelo Sangiovanni, Milan Hildegard M Schuller, Knoxville Dong-Wan Seo, Seoul Adrian John Stanley, Glasgow Jurgen Stein, Frankfurt Bei-Cheng Sun, Nanjing Yoshio Yamaoka, Yufu GUEST EDITORIAL BOARD MEMBERS Jia-Ming Chang, Taipei Jane CJ Chao, Taipei Kuen-Feng Chen, Taipei Tai-An Chiang, Tainan Yi-You Chiou, Taipei Seng-Kee Chuah, Kaohsiung Wan-Long Chuang, Kaohsiung How-Ran Guo, Tainan Ming-Chih Hou, Taipei Po-Shiuan Hsieh, Taipei Ching-Chuan Hsieh, Chiayi county Jun-Te Hsu, Taoyuan Chung-Ping Hsu, Taichung Chien-Ching Hung, Taipei Chao-Hung Hung, Kaohsiung Chen-Guo Ker, Kaohsiung Yung-Chih Lai, Taipei Teng-Yu Lee, Taichung City Wei-Jei Lee, Taoyuan Jin-Ching Lee, Kaohsiung Jen-Kou Lin, Taipei Ya-Wen Lin, Taipei Hui-kang Liu, Taipei Min-Hsiung Pan, Taipei Bor-Shyang Sheu, Tainan Hon-Yi Shi, Kaohsiung Fung-Chang Sung, Taichung Dar-In Tai, Taipei Jung-Fa Tsai, Kaohsiung Yao-Chou Tsai, New Taipei City Chih-Chi Wang, Kaohsiung Liang-Shun Wang, New Taipei City Hsiu-Po Wang, Taipei Jaw-Yuan Wang, Kaohsiung Yuan-Huang Wang, Taipei Yuan-Chuen Wang, Taichung Deng-Chyang Wu, Kaohsiung Shun-Fa Yang, Taichung Hsu-Heng Yen, Changhua MEMBERS OF THE EDITORIAL BOARD Algeria Saadi Berkane, Algiers Samir Rouabhia, Batna Argentina N Tolosa de Talamoni, Córdoba Eduardo de Santibanes, Buenos Aires Bernardo Frider, Capital Federal Guillermo Mazzolini, Pilar Carlos Jose Pirola, Buenos Aires Bernabé Matías Quesada, Buenos Aires María Fernanda Troncoso, Buenos Aires Australia Golo Ahlenstiel, Westmead Minoti V Apte, Sydney Jacqueline S Barrett, Melbourne Michael Beard, Adelaide Filip Braet, Sydney Guy D Eslick, Sydney Christine Feinle-Bisset, Adelaide Mark D Gorrell, Sydney Michael Horowitz, Adelaide I May 25, 2015

3 Gordon Stanley Howarth, Roseworthy Seungha Kang, Brisbane Alfred King Lam, Gold Coast Ian C Lawrance, PerthFremantle Barbara Anne Leggett, Brisbane Daniel A Lemberg, Sydney Rupert W Leong, Sydney Finlay A Macrae, Victoria Vance Matthews, Melbourne David L Morris, Sydney Reme Mountifield, Bedford Park Hans J Netter, Melbourne Nam Q Nguyen, Adelaide Liang Qiao, Westmead Rajvinder Singh, Adelaide Ross Cyril Smith, StLeonards Kevin J Spring, Sydney Debbie Trinder, Fremantle Daniel R van Langenberg, Box Hill David Ian Watson, Adelaide Desmond Yip, Garran Li Zhang, Sydney Austria Felix Aigner, Innsbruck Gabriela A Berlakovich, Vienna Herwig R Cerwenka, Graz Peter Ferenci, Wien Alfred Gangl, Vienna Kurt Lenz, Linz Markus Peck-Radosavljevic, Vienna Markus Raderer, Vienna Stefan Riss, Vienna Belgium Michael George Adler, Brussels Benedicte Y De Winter, Antwerp Mark De Ridder, Jette Olivier Detry, Liege Denis Dufrane Dufrane, Brussels Sven M Francque, Edegem Nikos Kotzampassakis, Liège Geert KMM Robaeys, Genk Xavier Sagaert, Leuven Peter Starkel, Brussels Eddie Wisse, Keerbergen Brazil SMP Balzan, Santa Cruz do Sul JLF Caboclo, Sao jose do rio preto Fábio Guilherme Campos, Sao Paulo Claudia RL Cardoso, Rio de Janeiro Roberto J Carvalho-Filho, Sao Paulo Carla Daltro, Salvador José Sebastiao dos Santos, Ribeirao Preto Eduardo LR Mello, Rio de Janeiro Sthela Maria Murad-Regadas, Fortaleza Claudia PMS Oliveira, Sao Paulo Júlio C Pereira-Lima, Porto Alegre Marcos V Perini, Sao Paulo Vietla Satyanarayana Rao, Fortaleza Raquel Rocha, Salvador AC Simoes e Silva, Belo Horizonte Mauricio F Silva, Porto Alefre Aytan Miranda Sipahi, Sao Paulo Rosa Leonôra Salerno Soares, Niterói Cristiane Valle Tovo, Porto Alegre Eduardo Garcia Vilela, Belo Horizonte Brunei Darussalam Vui Heng Chong, Bandar Seri Begawan Bulgaria Tanya Kirilova Kadiyska, Sofia Mihaela Petrova, Sofia Cambodia Francois Rouet, Phnom Penh Canada Brian Bressler, Vancouver Frank J Burczynski, Winnipeg Wangxue Chen, Ottawa Francesco Crea, Vancouver Mirko Diksic, Montreal Jane A Foster, Hamilton Hugh J Freeman, Vancouver Shahrokh M Ghobadloo, Ottawa Yuewen Gong, Winnipeg Philip H Gordon, Quebec Rakesh Kumar, Edmonton Wolfgang A Kunze, Hamilton Patrick Labonte, Laval Zhikang Peng, Winnipeg Jayadev Raju, Ottawa Maitreyi Raman, Calgary Giada Sebastiani, Montreal Maida J Sewitch, Montreal Eldon A Shaffer, Alberta Christopher W Teshima, Edmonton Jean Sévigny, Québec Pingchang Yang, Hamilton Pingchang Yang, Hamilton Eric M Yoshida, Vancouver Bin Zheng, Edmonton Chile Marcelo A Beltran, La Serena Flavio Nervi, Santiago Adolfo Parra-Blanco, Santiago Alejandro Soza, Santiago China Zhao-Xiang Bian, Hong Kong San-Jun Cai, Shanghai Guang-Wen Cao, Shanghai Long Chen, Nanjing Ru-Fu Chen, Guangzhou George G Chen, Hong Kong Li-Bo Chen, Wuhan Jia-Xu Chen, Beijing Hong-Song Chen, Beijing Lin Chen, Beijing Yang-Chao Chen, Hong Kong Zhen Chen, Shanghai Ying-Sheng Cheng, Shanghai Kent-Man Chu, Hong Kong Zhi-Jun Dai, Xi an Jing-Yu Deng, Tianjin Yi-Qi Du, Shanghai Zhi Du, Tianjin Hani El-Nezami, Hong Kong Bao-Ying Fei, Hangzhou Chang-Ming Gao, Nanjing Jian-Ping Gong, Chongqing Zuo-Jiong Gong, Wuhan Jing-Shan Gong, Shenzhen Guo-Li Gu, Beijing Yong-Song Guan, Chengdu Mao-Lin Guo, Luoyang Jun-Ming Guo, Ningbo Yan-Mei Guo, Shanghai Xiao-Zhong Guo, Shenyang Guo-Hong Han, Xi an Ming-Liang He, Hong Kong Peng Hou, Xi an Zhao-Hui Huang, Wuxi Feng Ji, Hangzhou Simon Law, Hong Kong Yu-Yuan Li, Guangzhou Meng-Sen Li, Haikou Shu-De Li, Shanghai Zong-Fang Li, Xi an Qing-Quan Li, Shanghai Kang Li, Lasa Han Liang, Tianjin Xing e Liu, Hangzhou Zheng-Wen Liu, Xi an Xiao-Fang Liu, Yantai Bin Liu, Tianjin Quan-Da Liu, Beijing Hai-Feng Liu, Beijing Fei Liu, Shanghai Ai-Guo Lu, Shanghai He-Sheng Luo, Wuhan Xiao-Peng Ma, Shanghai Yong Meng, Shantou Ke-Jun Nan, Xi an Siew Chien Ng, Hong Kong Simon SM Ng, Hong Kong Zhao-Shan Niu, Qingdao Bo-Rong Pan, Xi an Di Qu, Shanghai Ying-Mo Shen, Beijing Rui-Hua Shi, Nanjing Bao-Min Shi, Shanghai Xiao-Dong Sun, Hangzhou Si-Yu Sun, Shenyang Guang-Hong Tan, Haikou Wen-Fu Tang, Chengdu Anthony YB Teoh, Hong Kong Wei-Dong Tong, Chongqing Eric Tse, Hong Kong Hong Tu, Shanghai Rong Tu, Haikou Jian-She Wang, Shanghai Kai Wang, Jinan Xiao-Ping Wang, Xianyang Xiu-Yan Wang, Shanghai II May 25, 2015

4 Dao-Rong Wang, Yangzhou De-Sheng Wang, Xi an Chun-You Wang, Wuhan Ge Wang, Chongqing Xi-Shan Wang, Harbin Wei-hong Wang, Beijing Zhen-Ning Wang, Shenyang Wai Man Raymond Wong, Hong Kong Chun-Ming Wong, Hong Kong Jian Wu, Shanghai Sheng-Li Wu, Xi an Wu-Jun Wu, Xi an Qing Xia, Chengdu Yan Xin, Shenyang Dong-Ping Xu, Beijing Jian-Min Xu, Shanghai Wei Xu, Changchun Ming Yan, Jinan Xin-Min Yan, Kunming Yi-Qun Yan, Shanghai Feng Yang, Shanghai Yong-Ping Yang, Beijing He-Rui Yao, Guangzhou Thomas Yau, Hong Kong Winnie Yeo, Hong Kong Jing You, Kunming Jian-Qing Yu, Wuhan Ying-Yan Yu, Shanghai Wei-Zheng Zeng, Chengdu Zong-Ming Zhang, Beijing Dian-Liang Zhang, Qingdao Ya-Ping Zhang, Shijiazhuang You-Cheng Zhang, Lanzhou Jian-Zhong Zhang, Beijing Ji-Yuan Zhang, Beijing Hai-Tao Zhao, Beijing Jian Zhao, Shanghai Jian-Hong Zhong, Nanning Ying-Qiang Zhong, Guangzhou Ping-Hong Zhou, Shanghai Yan-Ming Zhou, Xiamen Tong Zhou, Nanchong Li-Ming Zhou, Chengdu Guo-Xiong Zhou, Nantong Feng-Shang Zhu, Shanghai Jiang-Fan Zhu, Shanghai Zhao-Hui Zhu, Beijing Croatia Tajana Filipec Kanizaj, Zagreb Mario Tadic, Zagreb Cuba Damian Casadesus, Havana Czech Jan Bures, Hradec Kralove Marcela Kopacova, Hradec Kralove Otto Kucera, Hradec Kralove Marek Minarik, Prague Pavel Soucek, Prague Miroslav Zavoral, Prague Denmark Vibeke Andersen, Odense E Michael Danielsen, Copenhagen Egypt Mohamed MM Abdel-Latif, Assiut Hussein Atta, Cairo Ashraf Elbahrawy, Cairo Mortada Hassan El-Shabrawi, Cairo Mona El Said El-Raziky, Cairo Elrashdy M Redwan, New Borg Alrab Zeinab Nabil Ahmed Said, Cairo Ragaa HM Salama, Assiut Maha Maher Shehata, Mansoura Estonia Margus Lember, Tartu Tamara Vorobjova, Tartu Finland Marko Kalliomäki, Turku Thomas Kietzmann, Oulu Kaija-Leena Kolho, Helsinki Eija Korkeila, Turku Heikki Makisalo, Helsinki Tanja Pessi, Tampere France Armando Abergel Clermont, Ferrand Elie K Chouillard, Polssy Pierre Cordelier, Toulouse Pascal P Crenn, Garches Catherine Daniel, Lille Fanny Daniel, Paris Cedric Dray, Toulouse Benoit Foligne, Lille Jean-Noel Freund, Strasbourg Hervé Guillou, Toulouse Nathalie Janel, Paris Majid Khatib, Bordeaux Jacques Marescaux, Strasbourg Jean-Claude Marie, Paris Driffa Moussata, Pierre Benite Hang Nguyen, Clermont-Ferrand Hugo Perazzo, Paris Alain L Servin, Chatenay-Malabry Chang Xian Zhang, Lyon Germany Stavros A Antoniou, Monchengladbach Erwin Biecker, Siegburg Hubert E Blum, Freiburg Thomas Bock, Berlin Katja Breitkopf-Heinlein, Mannheim Elke Cario, Essen Güralp Onur Ceyhan, Munich Angel Cid-Arregui, Heidelberg Michael Clemens Roggendorf, München Christoph F Dietrich, Bad Mergentheim Valentin Fuhrmann, Hamburg Nikolaus Gassler, Aachen Andreas Geier, Wuerzburg Markus Gerhard, Munich Anton Gillessen, Muenster Thorsten Oliver Goetze, Offenbach Daniel Nils Gotthardt, Heidelberg Robert Grützmann, Dresden Thilo Hackert, Heidelberg Claus Hellerbrand, Regensburg Harald Peter Hoensch, Darmstadt Jens Hoeppner, Freiburg Richard Hummel, Muenster Jakob Robert Izbicki, Hamburg Gernot Maximilian Kaiser, Essen Matthias Kapischke, Hamburg Michael Keese, Frankfurt Andrej Khandoga, Munich Jorg Kleeff, Munich Alfred Koenigsrainer, Tuebingen Peter Christopher Konturek, Saalfeld Michael Linnebacher, Rostock Stefan Maier, Kaufbeuren Oliver Mann, Hamburg Marc E Martignoni, Munic Thomas Minor, Bonn Oliver Moeschler, Osnabrueck Jonas Mudter, Eutin Sebastian Mueller, Heidelberg Matthias Ocker, Berlin Andreas Ommer, Essen Albrecht Piiper, Frankfurt Esther Raskopf, Bonn Christoph Reichel, Bad Brückenau Elke Roeb, Giessen Udo Rolle, Frankfurt Karl-Herbert Schafer, Zweibrücken Peter Schemmer, Heidelberg Andreas G Schreyer, Regensburg Manuel A Silva, Penzberg Georgios C Sotiropoulos, Essen Ulrike S Stein, Berlin Dirk Uhlmann, Leipzig Michael Weiss, Halle Hong-Lei Weng, Mannheim Karsten Wursthorn, Hamburg Greece Alexandra Alexopoulou, Athens Nikolaos Antonakopoulos, Athens Stelios F Assimakopoulos, Patras Grigoris Chatzimavroudis, Thessaloniki Evangelos Cholongitas, Thessaloniki Gregory Christodoulidis, Larisa George N Dalekos, Larissa Urania Georgopoulou, Athens Eleni Gigi, Thessaloniki Stavros Gourgiotis, Athens Leontios J Hadjileontiadis, Thessaloniki Thomas Hyphantis, Ioannina Ioannis Kanellos, Thessaloniki Stylianos Karatapanis, Rhodes Michael Koutsilieris, Athens Spiros D Ladas, Athens III May 25, 2015

5 Theodoros K Liakakos, Athens Emanuel K Manesis, Athens Spilios Manolakopoulos, Athens Gerassimos John Mantzaris, Athens Athanasios D Marinis, Piraeus Nikolaos Ioannis Nikiteas, Athens Konstantinos X Papamichael, Athens George Sgourakis, Athens Konstantinos C Thomopoulos, Patras Konstantinos Triantafyllou, Athens Christos Triantos, Patras Georgios Zacharakis, Athens Petros Zezos, Alexandroupolis Demosthenes E Ziogas, Ioannina Guatemala Carlos Maria Parellada, Guatemala Hungary Mihaly Boros, Szeged Tamás Decsi, Pécs Gyula Farkas, Szeged Andrea Furka, Debrecen Y vette Mandi, Szeged Peter L Lakatos, Budapest Pal Miheller, Budapest Tamás Molnar, Szeged Attila Olah, Gyor Maria Papp, Debrecen Zoltan Rakonczay, Szeged Ferenc Sipos, Budapest Miklós Tanyi, Debrecen Tibor Wittmann, Szeged Iceland Tryggvi Bjorn Stefánsson, Reykjavík India Brij B Agarwal, New Delhi Deepak N Amarapurkar, Mumbai Shams ul Bari, Srinagar Sriparna Basu, Varanasi Runu Chakravarty, Kolkata Devendra C Desai, Mumbai Nutan D Desai, Mumbai Suneela Sunil Dhaneshwar, Pune Radha K Dhiman, Chandigarh Pankaj Garg, Mohali Uday C Ghoshal, Lucknow Kalpesh Jani, Vadodara Premashis Kar, New Delhi Jyotdeep Kaur, Chandigarh Rakesh Kochhar, Chandigarh Pradyumna K Mishra, Mumbai Asish K Mukhopadhyay, Kolkata Imtiyaz Murtaza, Srinagar P Nagarajan, New Delhi Samiran Nundy, Delhi Gopal Pande, Hyderabad Benjamin Perakath, Vellore Arun Prasad, New Delhi D Nageshwar Reddy, Hyderabad Lekha Saha, Chandigarh Sundeep Singh Saluja, New Delhi Mahesh Prakash Sharma, New Delhi Sadiq Saleem Sikora, Bangalore Sarman Singh, New Delhi Rajeev Sinha, Jhansi Rupjyoti Talukdar, Hyderabad Rakesh Kumar Tandon, New Delhi Narayanan Thirumoorthy, Coimbatore Indonesia David Handojo Muljono, Jakarta Andi Utama, Jakarta Iran Arezoo Aghakhani, Tehran Seyed Mohsen Dehghani, Shiraz Ahad Eshraghian, Shiraz Hossein Khedmat, Tehran Sadegh Massarrat, Tehran Marjan Mohammadi, Tehran Roja Rahimi, Tehran Farzaneh Sabahi, Tehran Majid Sadeghizadeh, Tehran Farideh Siavoshi, Tehran Ireland Gary Alan Bass, Dublin David J Brayden, Dublin Ronan A Cahill, Dublin Glen A Doherty, Dublin Liam J Fanning, Cork Barry Philip McMahon, Dublin RossMcManus, Dublin Dervla O Malley, Cork Sinead M Smith, Dublin Israel Dan Carter, Ramat Gan Jorge-Shmuel Delgado, Metar Eli Magen, Ashdod Nitsan Maharshak, Tel Aviv Shaul Mordechai, Beer Sheva Menachem Moshkowitz, Tel Aviv William Bahij Nseir, Nazareth Shimon Reif, Jerusalem Ram Reifen, Rehovot Ariella Bar-Gil Shitrit, Jerusalem Noam Shussman, Jerusalem Igor Sukhotnik, Haifa Nir Wasserberg, Petach Tiqwa Jacob Yahav, Rehovot Doron Levi Zamir, Gedera Shira Zelber-Sagi, Haifa Romy Zemel, Petach-Tikva Italy Ludovico Abenavoli, Catanzaro Luigi Elio Adinolfi, Naples Carlo Virginio Agostoni, Milan Anna Alisi, Rome Piero Luigi Almasio, Palermo Donato Francesco Altomare, Bari Amedeo Amedei, Florence Pietro Andreone, Bologna Imerio Angriman, Padova Vito Annese, Florence Paolo Aurello, Rome Salavtore Auricchio, Naples Gian Luca Baiocchi, Brescia Gianpaolo Balzano, Milan Antonio Basoli, Rome Gabrio Bassotti, San Sisto Mauro Bernardi, Bologna Alberto Biondi, Rome Ennio Biscaldi, Genova Massimo Bolognesi, Padua Luigi Bonavina, Milano Aldo Bove, Chieti Raffaele Bruno, Pavia Luigi Brusciano, Napoli Giuseppe Cabibbo, Palermo Carlo Calabrese, Bologna Daniele Calistri, Meldola Vincenza Calvaruso, Palermo Lorenzo Camellini, Reggio Emilia Marco Candela, Bologna Raffaele Capasso, Naples Lucia Carulli, Modena Renato David Caviglia, Rome Luigina Cellini, Chieti Giuseppe Chiarioni, Verona Claudio Chiesa, Rome Michele Cicala, Roma Rachele Ciccocioppo, Pavia Sandro Contini, Parma Gaetano Corso, Foggia Renato Costi, Parma Alessandro Cucchetti, Bologna Rosario Cuomo, Napoli Giuseppe Currò, Messina Paola De Nardi, Milano Giovanni D De Palma, Naples Raffaele De Palma, Napoli Giuseppina De Petro, Brescia Valli De Re, Aviano Paolo De Simone, Pisa Giuliana Decorti, Trieste Emanuele Miraglia del Giudice, Napoli Isidoro Di Carlo, Catania Matteo Nicola Dario Di Minno, Naples Massimo Donadelli, Verona Mirko D Onofrio, Verona Maria Pina Dore, Sassari Luca Elli, Milano Massimiliano Fabozzi, Aosta Massimo Falconi, Ancona Ezio Falletto, Turin Silvia Fargion, Milan Matteo Fassan, Verona Gianfranco Delle Fave, Roma Alessandro Federico, Naples Francesco Feo, Sassari Davide Festi, Bologna Natale Figura, Siena Vincenzo Formica, Rome Mirella Fraquelli, Milan IV May 25, 2015

6 Marzio Frazzoni, Modena Walter Fries, Messina Gennaro Galizia, Naples Andrea Galli, Florence Matteo Garcovich, Rome Eugenio Gaudio, Rome Paola Ghiorzo, Genoa Edoardo G Giannini, Genova Luca Gianotti, Monza Maria Cecilia Giron, Padova Alberto Grassi, Rimini Gabriele Grassi, Trieste Francesco Greco, Bergamo Luigi Greco, Naples Antonio Grieco, Rome Fabio Grizzi, Rozzano Laurino Grossi, Pescara Simone Guglielmetti, Milan Tiberiu Hershcovici, Jerusalem Calogero Iacono, Verona Enzo Ierardi, Bari Amedeo Indriolo, Bergamo Raffaele Iorio, Naples Paola Iovino, Salerno Angelo A Izzo, Naples Loreta Kondili, Rome Filippo La Torre, Rome Giuseppe La Torre, Rome Giovanni Latella, L Aquila Salvatore Leonardi, Catania Massimo Libra, Catania Anna Licata, Palermo C armela Loguercio, Naples Amedeo Lonardo, Modena Carmelo Luigiano, Catania Francesco Luzza, Catanzaro Giovanni Maconi, Milano Antonio Macrì, Messina Mariano Malaguarnera, Catania Francesco Manguso, Napoli Tommaso Maria Manzia, Rome Daniele Marrelli, Siena Gabriele Masselli, Rome Sara Massironi, Milan Giuseppe Mazzarella, Avellino Michele Milella, Rome Giovanni Milito, Rome Antonella d Arminio Monforte, Milan Fabrizio Montecucco, Genoa Giovanni Monteleone, Rome Mario Morino, Torino Vincenzo La Mura, Milan Gerardo Nardone, Naples Riccardo Nascimbeni, Brescia Gabriella Nesi, Florence Giuseppe Nigri, Rome Erica Novo, Turin Veronica Ojetti, Rome Michele Orditura, Naples Fabio Pace, Seriate Lucia Pacifico, Rome Omero Alessandro Paoluzi, Rome Valerio Pazienza, San Giovanni Rotondo Rinaldo Pellicano, Turin Adriano M Pellicelli, Rome Nadia Peparini, Ciampino Mario Pescatori, Rome Antonio Picardi, Rome Alberto Pilotto, Padova Alberto Piperno, Monza Anna Chiara Piscaglia, Rome Maurizio Pompili, Rome Francesca Romana Ponziani, Rome Cosimo Prantera, Rome Girolamo Ranieri, Bari Carlo Ratto, Tome Barbara Renga, Perugia Alessandro Repici, Rozzano Maria Elena Riccioni, Rome Lucia Ricci-Vitiani, Rome Luciana Rigoli, Messina Mario Rizzetto, Torino Ballarin Roberto, Modena Roberto G Romanelli, Florence Claudio Romano, Messina Luca Roncucci, Modena Cesare Ruffolo, Treviso L ucia Sacchetti, Napoli Rodolfo Sacco, Pisa Lapo Sali, Florence Romina Salpini, Rome Giulio Aniello, Santoro Treviso Armando Santoro, Rozzano Edoardo Savarino, Padua Marco Senzolo, Padua Annalucia Serafino, Rome Giuseppe S Sica, Rome Pierpaolo Sileri, Rome Cosimo Sperti, Padua Vincenzo Stanghellini, Bologna Cristina Stasi, Florence Gabriele Stocco, Trieste Roberto Tarquini, Florence Mario Testini, Bari Guido Torzilli, Milan Guido Alberto Massimo, Tiberio Brescia Giuseppe Toffoli, Aviano Alberto Tommasini, Trieste Francesco Tonelli, Florence Cesare Tosetti Porretta, Terme Lucio Trevisani, Cona Guglielmo M Trovato, Catania Mariapia Vairetti, Pavia Luca Vittorio Valenti, Milano Mariateresa T Ventura, Bari Giuseppe Verlato, Verona Marco Vivarelli, Ancona Giovanni Li Volti, Catania Giuseppe Zanotti, Padua Vincenzo Zara, Lecce Gianguglielmo Zehender, Milan Anna Linda Zignego, Florence Rocco Antonio Zoccali, Messina Angelo Zullo, Rome Japan Yasushi Adachi, Sapporo Takafumi Ando, Nagoya Masahiro Arai, Tokyo Makoto Arai, Chiba Takaaki Arigami, Kagoshima Itaru Endo,Yokohama Munechika Enjoji, Fukuoka Shunji Fujimori, Tokyo Yasuhiro Fujino, Akashi Toshiyoshi Fujiwara, Okayama Yosuke Fukunaga, Tokyo Toshio Fukusato, Tokyo Takahisa Furuta, Hamamatsu Osamu Handa, Kyoto Naoki Hashimoto, Osaka Yoichi Hiasa, Toon Masatsugu Hiraki, Saga Satoshi Hirano, Sapporo Keiji Hirata, Fukuoka Toru Hiyama, Higashihiroshima Akira Hokama, Nishihara Shu Hoteya, Tokyo Masao Ichinose, Wakayama Tatsuya Ide, Kurume Masahiro Iizuka, Akita Toshiro Iizuka, Tokyo Kenichi Ikejima, Tokyo Tetsuya Ikemoto, Tokushima Hiroyuki Imaeda, Saitama Atsushi Imagawa, Kan-onji Hiroo Imazu, Tokyo Shuji Isaji, Tsu Toru Ishikawa, Niigata Toshiyuki Ishiwata, Tokyo Soichi Itaba, Kitakyushu Yoshiaki Iwasaki, Okayama Tatehiro Kagawa, Isehara Satoru Kakizaki, Maebashi Naomi Kakushima, Shizuoka Terumi Kamisawa, Tokyo Akihide Kamiya, Isehara Osamu Kanauchi, Tokyo Tatsuo Kanda, Chiba Shin Kariya, Okayama Shigeyuki Kawa, Matsumoto Takumi Kawaguchi, Kurume Takashi Kawai, Tokyo Soo Ryang Kim, Kobe Shinsuke Kiriyama, Gunma Tsuneo Kitamura, Urayasu Masayuki Kitano, Osakasayama Hirotoshi Kobayashi, Tokyo Hironori Koga, Kurume Takashi Kojima, Sapporo Satoshi Kokura, Kyoto Shuhei Komatsu, Kyoto Tadashi Kondo, Tokyo Yasuteru Kondo, Sendai Yasuhiro Kuramitsu, Yamaguchi Yukinori Kurokawa, Osaka Shin Maeda, Yokohama Koutarou Maeda, Toyoake Hitoshi Maruyama, Chiba Atsushi Masamune, Sendai Hiroyuki Matsubayashi, Suntogun Akihisa Matsuda, Inzai Hirofumi Matsui, Tsukuba Akira Matsumori, Kyoto Yoichi Matsuo, Nagoya Y Matsuzaki, Ami Toshihiro Mitaka, Sapporo Kouichi Miura, Akita Shinichi Miyagawa, Matumoto Eiji Miyoshi, Suita Toru Mizuguchi, Sapporo Nobumasa Mizuno, Nagoya Zenichi Morise, Nagoya V May 25, 2015

7 Tomohiko Moriyama, Fukuoka Kunihiko Murase, Tusima Michihiro Mutoh, Tsukiji Akihito Nagahara, Tokyo Hikaru Nagahara, Tokyo Hidenari Nagai, Tokyo Koichi Nagata, Shimotsuke-shi Masaki Nagaya, Kawasaki Hisato Nakajima, Nishi-Shinbashi Toshifusa Nakajima, Tokyo Hiroshi Nakano, Kawasaki Hiroshi Nakase, Kyoto Toshiyuki Nakayama, Nagasaki Takahiro Nakazawa, Nagoya Shoji Natsugoe, Kagoshima City Tsutomu Nishida, Suita Shuji Nomoto, Naogya Sachiyo Nomura, Tokyo Takeshi Ogura, Takatsukishi Nobuhiro Ohkohchi, Tsukuba Toshifumi Ohkusa, Kashiwa Hirohide Ohnishi, Akita Teruo Okano, Tokyo Satoshi Osawa, Hamamatsu Motoyuki Otsuka, Tokyo Michitaka Ozaki, Sapporo Satoru Saito, Yokohama Chouhei Sakakura, Kyoto Naoaki Sakata, Sendai Ken Sato, Maebashi Toshiro Sato, Tokyo Tomoyuki Shibata, Toyoake H Shimada, Tokyo Tomohiko Shimatani, Kure Yukihiro Shimizu, Nanto Tadashi Shimoyama, Hirosaki Masayuki Sho, Nara Ikuo Shoji, Kobe Atsushi Sofuni, Tokyo Takeshi Suda, Niigata M Sugimoto, Hamamatsu Ken Sugimoto, Hamamatsu Haruhiko Sugimura, Hamamatsu Shoichiro Sumi, Kyoto Hidekazu Suzuki, Tokyo Masahiro Tajika, Nagoya Hitoshi Takagi, Takasaki Toru Takahashi, Niigata Yoshihisa Takahashi, Tokyo Shinsuke Takeno, Fukuoka Akihiro Tamori, Osaka Kyosuke Tanaka, Tsu Shinji Tanaka, Hiroshima Atsushi Tanaka, Tokyo Yasuhito Tanaka, Nagoya Shinji Tanaka, Tokyo Minoru Tomizawa, Yotsukaido City Kyoko Tsukiyama-Kohara, Kagoshima Takuya Watanabe, Niigata Kazuhiro Watanabe, Sendai Satoshi Yamagiwa, Niigata Takayuki Yamamoto, Yokkaichi Hiroshi Yamamoto, Otsu Kosho Yamanouchi, Nagasaki Ichiro Yasuda, Gifu Yutaka Yata, Maebashi-city Shin-ichi Yokota, Sapporo Norimasa Yoshida, Kyoto Hiroshi Yoshida, Tama-City Hitoshi Yoshiji, Kashihara Kazuhiko Yoshimatsu, Tokyo Kentaro Yoshioka, Toyoake Nobuhiro Zaima, Nara Jordan Khaled Ali Jadallah, Irbid Kuwait Islam Khan, Kuwait Lebanon Bassam N Abboud, Beirut Kassem A Barada, Beirut Marwan Ghosn, Beirut Iyad A Issa, Beirut Fadi H Mourad, Beirut AIa Sharara, Beirut Rita Slim, Beirut Lithuania Antanas Mickevicius, Kaunas Malaysia Huck Joo Tan, Petaling Jaya Mexico Richard A Awad, Mexico City Carlos R Camara-Lemarroy, Monterrey Norberto C Chavez-Tapia, Mexico City Wolfgang Gaertner, Mexico City Diego Garcia-Compean, Monterrey Arturo Panduro, Guadalajara OT Teramoto-Matsubara, Mexico City Felix Tellez-Avila, Mexico City Omar Vergara-Fernandez, Mexico City Saúl Villa-Trevino, Cuidad de México Morocco Samir Ahboucha, Khouribga Netherlands Robert J de Knegt, Rotterdam Tom Johannes Gerardus Gevers, Nijmegen Menno Hoekstra, Leiden BW Marcel Spanier, Arnhem Karel van Erpecum, Utrecht New Zealand Leo K Cheng, Auckland Andrew Stewart Day, Christchurch Jonathan Barnes Koea, Auckland Max Petrov, Auckland Nigeria Olufunmilayo Adenike Lesi, Lagos Jesse Abiodun Otegbayo, Ibadan Stella Ifeanyi Smith, Lagos Norway Trond Berg, Oslo Trond Arnulf Buanes, Krokkleiva Thomas de Lange, Rud Magdy El-Salhy, Stord Rasmus Goll, Tromso Dag Arne Lihaug Hoff, Aalesund Pakistan Zaigham Abbas, Karachi Usman A Ashfaq, Faisalabad Muhammad Adnan Bawany, Hyderabad Muhammad Idrees, Lahore Saeed Sadiq Hamid, Karachi Yasir Waheed, Islamabad Poland Thomas Brzozowski, Cracow Magdalena Chmiela, Lodz Krzysztof Jonderko, Sosnowiec Anna Kasicka-Jonderko, Sosnowiec Michal Kukla, Katowice Tomasz Hubert Mach, Krakow Agata Mulak, Wroclaw Danuta Owczarek, Kraków Piotr Socha, Warsaw Piotr Stalke, Gdansk Julian Teodor Swierczynski, Gdansk Anna M Zawilak-Pawlik, Wroclaw Portugal Marie Isabelle Cremers, Setubal Ceu Figueiredo, Porto Ana Isabel Lopes, LIsbon M Paula Macedo, Lisboa Ricardo Marcos, Porto Rui T Marinho, Lisboa Guida Portela-Gomes, Estoril Filipa F Vale, Lisbon Puerto Rico Caroline B Appleyard, Ponce Qatar Abdulbari Bener, Doha Romania Mihai Ciocirlan, Bucharest Dan LucianDumitrascu, Cluj-Napoca Carmen Fierbinteanu-Braticevici, Bucharest VI May 25, 2015

8 Romeo G Mihaila, Sibiu Lucian Negreanu, Bucharest Adrian Saftoiu, Craiova Andrada Seicean, Cluj-Napoca Ioan Sporea, Timisoara Letiţia Adela Maria Streba, Craiova Anca Trifan, Iasi Russia Victor Pasechnikov, Stavropol Vasiliy Ivanovich Reshetnyak, Moscow Vitaly Skoropad, Obninsk Saudi Arabia Abdul-Wahed N Meshikhes, Dammam M Ezzedien Rabie, Khamis Mushait Singapore Brian KP Goh, Singapore Richie Soong, Singapore Ker-Kan Tan, Singapore Kok-Yang Tan, Singapore Yee-Joo Tan, Singapore Mark Wong, Singapore Hong Ping Xia, Singapore Slovenia Matjaz Homan, Ljubljana Martina Perse, Ljubljana South Korea Sang Hoon Ahn, Seoul Seung Hyuk Baik, Seoul Soon Koo Baik, Wonju Soo-Cheon Chae, Iksan Byung-Ho Choe, Daegu Suck Chei Choi, Iksan Hoon Jai Chun, Seoul Yeun-Jun Chung, Seoul Young-Hwa Chung, Seoul Ki-Baik Hahm, Seongnam Sang Young Han, Busan Seok Joo Han, Seoul Seung-Heon Hong, Iksan Jin-Hyeok Hwang, Seoungnam Jeong Won Jang, Seoul Jin-Young Jang, Seoul Dae-Won Jun, Seoul Young Do Jung, Kwangju Gyeong Hoon Kang, Seoul Sung-Bum Kang, Seoul Koo Jeong Kang, Daegu Ki Mun Kang, Jinju Chang Moo Kang, Seodaemun-gu Gwang Ha Kim, Busan Sang Soo Kim, Goyang-si Jin Cheon Kim, Seoul Tae Il Kim, Seoul Jin Hong Kim, Suwon Kyung Mo Kim, Seoul Kyongmin Kim, Suwon Hyung-Ho Kim, Seongnam Seoung Hoon Kim, Goyang Sang Il Kim, Seoul Hyun-Soo Kim, Wonju Jung Mogg Kim, Seoul Dong Yi Kim, Gwangju Kyun-Hwan Kim, Seoul Jong-Han Kim, Ansan Sang Wun Kim, Seoul Ja-Lok Ku, Seoul Kyu Taek Lee, Seoul Hae-Wan Lee, Chuncheon Inchul Lee, Seoul Jung Eun Lee, Seoul Sang Chul Lee, Daejeon Song Woo Lee, Ansan-si Hyuk-Joon Lee, Seoul Seong-Wook Lee, Yongin Kil Yeon Lee, Seoul Jong-Inn Lee, Seoul Kyung A Lee, Seoul Jong-Baeck Lim, Seoul Eun-Yi Moon, Seoul SH Noh, Seoul Seung Woon Paik, Seoul Won Sang Park, Seoul Sung-Joo Park, Iksan Kyung Sik Park, Daegu Se Hoon Park, Seoul Yoonkyung Park, Gwangju Seung-Wan Ryu, Daegu Il Han Song, Cheonan Myeong Jun Song, Daejeon Yun Kyoung Yim, Daejeon Dae-Yeul Yu Daejeon Spain Mariam Aguas, Valencia Raul J Andrade, Málaga Antonio Arroyo, Elche Josep M Bordas, Barcelona Lisardo Boscá, Madrid Ricardo Robles Campos, Murcia Jordi Camps, Reus Carlos Cervera Barcelona Alfonso Clemente, Granada Pilar Codoner-Franch, Valencia Fernando J Corrales, Pamplona Fermin Sánchez de Medina, Granada Alberto Herreros de Tejada, Majadahonda Enrique de-madaria, Alicante JE Dominguez-Munoz, Santiago de Compostela Vicente Felipo, Valencia CM Fernandez-Rodriguez, Madrid Carmen Frontela-Saseta, Murcia Julio Galvez, Granada Maria Teresa García, Vigo MI Garcia-Fernandez, Málaga Emilio Gonzalez-Reimers, La Laguna Marcel Jimenez, Bellaterra Angel Lanas, Zaragoza Juan Ramón Larrubia, Guadalajara Antonio Lopez-Sanroman, Madrid Vicente Lorenzo-Zuniga, Badalona Alfredo J Lucendo, Tomelloso Vicenta Soledad Martinez-Zorzano, Vigo José Manuel Martin-Villa, Madrid Julio Mayol, Madrid Manuel Morales-Ruiz, Barcelona Alfredo Moreno-Egea, Murcia Albert Pares, Barcelona Maria Pellise, Barcelona José Perea, Madrid Miguel Angel Plaza, Zaragoza María J Pozo, Cáceres Enrique Quintero, La Laguna Jose M Ramia, Madrid Francisco Rodriguez-Frias, Barcelona Silvia Ruiz-Gaspa, Barcelona Xavier Serra-Aracil, Barcelona Vincent Soriano, Madrid Javier Suarez, Pamplona Carlos Taxonera, Madrid M Isabel Torres, Jaén Manuel Vazquez-Carrera, Barcelona Benito Velayos, Valladolid Silvia Vidal, Barcelona Sri Lanka Arjuna Priyadarsin De Silva, Colombo Sudan Ishag Adam, Khartoum Sweden Roland G Andersson, Lund Bergthor Björnsson, Linkoping Johan Christopher Bohr, Örebro Mauro D Amato, Stockholm Thomas Franzen, Norrkoping Evangelos Kalaitzakis, Lund Riadh Sadik, Gothenburg Per Anders Sandstrom, Linkoping Ervin Toth, Malmö Konstantinos Tsimogiannis, Vasteras Apostolos V Tsolakis, Uppsala Switzerland Gieri Cathomas, Liestal Jean Louis Frossard, Geneve Christian Toso, Geneva Stephan Robert Vavricka, Zurich Dominique Velin, Lausanne Thailand Thawatchai Akaraviputh, Bangkok P Yoysungnoen Chintana, Pathumthani Veerapol Kukongviriyapan, Muang Vijittra Leardkamolkarn, Bangkok Varut Lohsiriwat, Bangkok Somchai Pinlaor, Khaon Kaen D Wattanasirichaigoon, Bangkok VII May 25, 2015

9 Trinidad and Tobago B Shivananda Nayak, Mount Hope Tunisia Ibtissem Ghedira, Sousse Lilia Zouiten-Mekki, Tunis Turkey Inci Alican, Istanbul Mustafa Altindis, Sakarya Mutay Aslan, Antalya Oktar Asoglu, Istanbul Yasemin Hatice Balaban, Istanbul Metin Basaranoglu, Ankara Yusuf Bayraktar, Ankara Süleyman Bayram, Adiyaman Ahmet Bilici, Istanbul Ahmet Sedat Boyacioglu, Ankara Züleyha Akkan Cetinkaya, Kocaeli Cavit Col, Bolu Yasar Colak, Istanbul Cagatay Erden Daphan, Kirikkale Mehmet Demir, Hatay Ahmet Merih Dobrucali, Istanbul Gülsüm Ozlem Elpek, Antalya Ayse Basak Engin, Ankara Eren Ersoy, Ankara Osman Ersoy, Ankara Yusuf Ziya Erzin, Istanbul Mukaddes Esrefoglu, Istanbul Levent Filik, Ankara Ozgur Harmanci, Ankara Koray Hekimoglu, Ankara Abdurrahman Kadayifci, Gaziantep Cem Kalayci, Istanbul Selin Kapan, Istanbul Huseyin Kayadibi, Adana Sabahattin Kaymakoglu, Istanbul Metin Kement, Istanbul Mevlut Kurt, Bolu Resat Ozaras, Istanbul Elvan Ozbek, Adapazari Cengiz Ozcan, Mersin Hasan Ozen, Ankara Halil Ozguc, Bursa Mehmet Ozturk, Izmir Orhan V Ozkan, Sakarya Semra Paydas, Adana Ozlem Durmaz Suoglu, Istanbul Ilker Tasci, Ankara Müge Tecder-ünal, Ankara Mesut Tez, Ankara Serdar Topaloglu, Trabzon Murat Toruner, Ankara Gokhan Tumgor, Adana Oguz Uskudar, Adana Mehmet Yalniz, Elazig Mehmet Yaman, Elazig Veli Yazisiz, Antalya Yusuf Yilmaz, Istanbul Ozlem Yilmaz, Izmir Oya Yucel, Istanbul Ilhami Yuksel, Ankara United Kingdom Nadeem Ahmad Afzal, Southampton Navneet K Ahluwalia, Stockport Yeng S Ang, Lancashire Ramesh P Arasaradnam, Coventry Ian Leonard Phillip Beales, Norwich John Beynon, Swansea Barbara Braden, Oxford Simon Bramhall, Birmingham Geoffrey Burnstock, London Ian Chau, Sutton Thean Soon Chew, London Helen G Coleman, Belfast Anil Dhawan, London Sunil Dolwani, Cardiff Piers Gatenby, London Anil T George, London Pasquale Giordano, London Paul Henderson, Edinburgh Georgina Louise Hold, Aberdeen Stefan Hubscher, Birmingham Robin D Hughes, London Nusrat Husain, Manchester Matt W Johnson, Luton Konrad Koss, Macclesfield Anastasios Koulaouzidis, Edinburgh Simon Lal, Salford John S Leeds, Aberdeen JK K Limdi, Manchester Hongxiang Liu, Cambridge Michael Joseph McGarvey, London Michael Anthony Mendall, London Alexander H Mirnezami, Southampton J Bernadette Moore, Guildford Claudio Nicoletti, Norwich Savvas Papagrigoriadis, London Sylvia LF Pender, Southampton David Mark Pritchard, Liverpool James A Ross, Edinburgh Kamran Rostami, Worcester Xiong Z Ruan, London Frank I Tovey, London Dhiraj Tripathi, Birmingham Vamsi R Velchuru, Great Yarmouth Nicholas T Ventham, Edinburgh Diego Vergani, London Jack Westwood Winter, Glasgow Terence Wong, London Ling Yang, Oxford United States Daniel E Abbott, Cincinnati Ghassan K Abou-Alfa, New York Julian Abrams, New York David William Adelson, Los Angeles Jonathan Steven Alexander, Shreveport Tauseef Ali, Oklahoma City Mohamed R Ali, Sacramento Rajagopal N Aravalli, Minneapolis Hassan Ashktorab, Washington Shashi Bala, Worcester Charles F Barish, Raleigh P Patrick Basu, New York Robert L Bell, Berkeley Heights David Bentrem, Chicago Henry J Binder, New Haven Joshua Bleier, Philadelphia Wojciech Blonski, Johnson City Kenneth Boorom, Corvallis Brian Boulay, Chicago Carla W Brady, Durham Kyle E Brown, Iowa City Adeel A Butt, Pittsburgh Weibiao Cao, Providence Andrea Castillo, Cheney Fernando J Castro, Weston Adam S Cheifetz, Boston Xiaoxin Luke Chen, Durham Ramsey Cheung, Palo Alto Parimal Chowdhury, Little Rock Edward John Ciaccio, New York Dahn L Clemens, Omaha Yingzi Cong, Galveston Laura Iris Cosen-Binker, Boston Joseph John Cullen, Lowa Mark J Czaja, Bronx Mariana D Dabeva, Bronx Christopher James Damman, Seattle Isabelle G De Plaen, Chicago Punita Dhawan, Nashville Hui Dong, La Jolla Wael El-Rifai, Nashville Sukru H Emre, New Haven Paul Feuerstadt, Hamden Josef E Fischer, Boston Laurie N Fishman, Boston Joseph Che Forbi, Atlanta Temitope Foster, Atlanta Amy E Foxx-Orenstein, Scottsdale Daniel E Freedberg, New York Shai Friedland, Palo Alto Virgilio George, Indianapolis Ajay Goel, Dallas Oliver Grundmann, Gainesville Stefano Guandalini, Chicago Chakshu Gupta, St. Joseph Grigoriy E Gurvits, New York Xiaonan Han, Cincinnati Mohamed Hassan, Jackson Martin Hauer-Jensen, Little Rock Koichi Hayano, Boston Yingli Hee, Atlanta Samuel B Ho, San Diego Jason Ken Hou, Houston Lifang Hou, Chicago K-Qin Hu, Orange Jamal A Ibdah, Columbia Robert Thomas Jensen, Bethesda Huanguang Charlie Jia, Gainesville Rome Jutabha, Los Angeles Andreas M Kaiser, Los Angeles Avinash Kambadakone, Boston David Edward Kaplan, Philadelphia Randeep Kashyap, Rochester Rashmi Kaul, Tulsa Ali Keshavarzian, Chicago Amir Maqbul Khan, Marshall Nabeel Hasan Khan, New Orleans Sahil Khanna, Rochester Kusum K Kharbanda, Omaha VIII May 25, 2015

10 Hyun Sik Kim, Pittsburgh Joseph Kim, Duarte Jae S Kim, Gainesville Miran Kim, Providence Timothy R Koch, Washington Burton I Korelitz, New York Betsy Kren, Minneapolis Shiu-Ming Kuo, Buffalo Michelle Lai, Boston Andreas Larentzakis, Boston Edward Wolfgang Lee, Los Angeles Daniel A Leffler, Boston Michael Leitman, New York Suthat Liangpunsakul, Indianapolis Joseph K Lim, New Haven Elaine Y Lin, Bronx Henry C Lin, Albuquerque Rohit Loomba, La Jolla James David Luketich, Pittsburgh Li Ma, Stanford Mohammad F Madhoun, Oklahoma City Thomas C Mahl, Buffalo Ashish Malhotra, Bettendorf Pranoti Mandrekar, Worcester John Marks, Wynnewood Wendy M Mars, Pittsburgh Julien Vahe Matricon, San Antonio Craig J McClain, Louisville Tamir Miloh, Phoenix Ayse Leyla Mindikoglu, Baltimore Huanbiao Mo, Denton Klaus Monkemuller, Birmingham John Morton, Stanford Adnan Muhammad, Tampa Michael J Nowicki, Jackson Patrick I Okolo, Baltimore Giusepp Orlando, Winston Salem Natalia A Osna, Omaha Virendra N Pandey, Newark Mansour A Parsi, Cleveland Michael F Picco, Jacksonville Daniel S Pratt, Boston Xiaofa Qin, Newark Janardan K Reddy, Chicago Victor E Reyes, Galveston Jon Marc Rhoads, Houston Giulia Roda, New York Jean-Francois Armand Rossignol, Tampa Paul A Rufo, Boston Madhusudana Girija Sanal, New York Miguel Saps, Chicago Sushil Sarna, Galveston Ann O Scheimann, Baltimore Bernd Schnabl, La Jolla Matthew J Schuchert, Pittsburgh Ekihiro Seki, La Jolla Chanjuan Shi, Nashville David Quan Shih, Los Angeles Shadab A Siddiqi, Orlando William B Silverman, Iowa City Shashideep Singhal, New York Bronislaw L Slomiany, Newark Steven F Solga, Bethlehem Byoung-Joon Song, Bethesda Dario Sorrentino, Roanoke Scott R Steele, Fort Lewis Branko Stefanovic, Tallahassee Arun Swaminath, New York Kazuaki Takabe, Richmond Naoki Tanaka, Bethesda Hans Ludger Tillmann, Durham George Triadafilopoulos, Stanford John Richardson Thompson, Nashville Andrew Ukleja, Weston Miranda AL van Tilburg, Chapel Hill Gilberto Vaughan, Atlanta Vijayakumar Velu, Atlanta Gebhard Wagener, New York Kasper Saonun Wang, Los Angeles Xiangbing Wang, New Brunswick Daoyan Wei, Houston Theodore H Welling, Ann Arbor C Mel Wilcox, Birmingham Jacqueline Lee Wolf, Boston Laura Ann Woollett, Cincinnati Harry Hua-Xiang Xia, East Hanover Wen Xie, Pittsburgh Guang Yu Yang, Chicago Michele T Yip-Schneider, Indianapolis Sam Zakhari, Bethesda Kezhong Zhang, Detroit Huiping Zhou, Richmond Xiao-Jian Zhou, Cambridge Richard Zubarik, Burlington Venezuela Miguel Angel Chiurillo, Barquisimeto Vietnam Van Bang Nguyen, Hanoi IX May 25, 2015

11 S Contents Weekly Volume 21 Number 27 July 21, 2015 EDITORIAL 8221 Non-celiac gluten sensitivity: time for sifting the grain Elli L, Roncoroni L, Bardella MT 8227 Genomic medicine in gastroenterology: A new approach or a new specialty? Roman S, Panduro A TOPIC HIGHLIGHT 8238 CREB-binding protein, p300, butyrate, and Wnt signaling in colorectal cancer Bordonaro M, Lazarova DL 8249 Management of hepatitis B virus infection during treatment for hepatitis B virus-related hepatocellular carcinoma Kubo S, Takemura S, Tanaka S, Shinkawa H, Nishioka T, Nozawa A, Kinoshita M, Hamano G, Ito T, Urata Y 8256 Grey zone in the Barcelona Clinic Liver Cancer Classification for hepatocellular carcinoma: Surgeons perspective Yang T, Lau WY, Zhang H, Huang B, Lu JH, Wu MC 8262 Clusterin: Review of research progress and looking ahead to direction in hepatocellular carcinoma Xiu P, Dong XF, Li XP, Li J REVIEW 8271 Effects of Yttrium-90 selective internal radiation therapy on non-conventional liver tumors Kuei A, Saab S, Cho SK, Kee ST, Lee EW 8284 MicroRNAs potential utility in colon cancer: Early detection, prognosis, and chemosensitivity Hollis M, Nair K, Vyas A, Chaturvedi LS, Gambhir S, Vyas D 8293 Lipid dysregulation in hepatitis C virus, and impact of statin therapy upon clinical outcomes Simon TG, Butt AA 8304 Acupuncture and regulation of gastrointestinal function Li H, He T, Xu Q, Li Z, Liu Y, Li F, Yang BF, Liu CZ ORIGINAL ARTICLE Basic Study 8314 TLR4-HMGB1-, MyD88- and TRIF-dependent signaling in mouse intestinal ischemia/reperfusion injury Wang J, He GZ,Wang YK, Zhu QK, Chen W, Guo T July 21, 2015 Volume 21 Issue 27

12 Contents World Journal of Gastroenterology Volume 21 Number 27 July 21, Givinostat inhibition of hepatic stellate cell proliferation and protein acetylation Wang YG, Xu L, Wang T, Wei J, Meng WY, Wang N, Shi M 8340 Potential protective effects of Clostridium butyricum on experimental gastric ulcers in mice Wang FY, Liu JM, Luo HH, Liu AH, Jiang Y 8352 Apoptosis of human pancreatic carcinoma cell-1 cells induced by Yin Chen Hao Decoction Zhou HB, Chen JM, Shao LM, Chen ZG Case Control Study 8358 Clinical features of second primary cancers arising in early gastric cancer patients after endoscopic resection Kim JW, Jang JY, Chang YW, Kim YH Retrospective Cohort Study 8366 Effect of oral mesalamine on inflammatory response in acute uncomplicated diverticulitis Nespoli L, Lo Bianco G, Uggeri F, Romano F, Nespoli A, Bernasconi DP, Gianotti L Retrospective Study 8373 Score model for predicting acute-on-chronic liver failure risk in chronic hepatitis B Gao FY, Liu Y, Li XS, Ye XQ, Sun L, Geng MF, Wang R, Liu HM, Zhou XB, Gu LL, Liu YM, Wan G, Wang XB 8382 Demethylation of tumor necrosis factor-α converting enzyme promoter associated with high hepatitis B e antigen level in chronic hepatitis B Wang ZL, Gao S, Li XY, Sun FK, Li F, Fan YC, Wang K 8389 Anatomy and influence of the splenic artery in laparoscopic spleen-preserving splenic lymphadenectomy Zheng CH, Xu M, Huang CM, Li P, Xie JW, Wang JB, Lin JX, Lu J, Chen QY, Cao LL, Lin M Clinical Trials Study 8398 SLITRK3 expression correlation to gastrointestinal stromal tumor risk rating and prognosis Wang CJ, Zhang ZZ, Xu J, Wang M, Zhao WY, Tu L, Zhuang C, Liu Q, Shen YY, Cao H, Zhang ZG Observational Study 8408 Gastric mucosa in Mongolian and Japanese patients with gastric cancer and Helicobacter pylori infection Matsuhisa T, Yamaoka Y, Uchida T, Duger D, Adiyasuren B, Khasag O, Tegshee T, Tsogt-Ochir B 8418 Downregulation of KIF1B mrna in hepatocellular carcinoma tissues correlates with poor prognosis Yang SZ, Wang JT, Yu WW, Liu Q, Wu YF, Chen SG Prospective Study 8425 Parameters affecting different acoustic radiation force impulse applications in the diagnosis of fibrotic liver changes Galgenmueller S, Jaeger H, Kratzer W, Schmidt SA, Oeztuerk S, Haenle MM, Mason RA, Graeter T II July 21, 2015 Volume 21 Issue 27

13 Contents World Journal of Gastroenterology Volume 21 Number 27 July 21, 2015 SYSTEMATIC REVIEWS 8433 Systematic review: Eosinophilic esophagitis in Asian countries Kinoshita Y, Ishimura N, Oshima N, Ishihara S META-ANALYSIS 8441 Outcomes of robotic vs laparoscopic hepatectomy: A systematic review and meta-analysis Montalti R, Berardi G, Patriti A, Vivarelli M, Troisi RI CASE REPORT 8452 Unusual presentation of a pancreatic cyst resulting from osteosarcoma metastasis Akpinar B, Obuch J, Fukami N, Pokharel SS 8458 Resected tumor seeding in stomach wall due to endoscopic ultrasonography-guided fine needle aspiration of pancreatic adenocarcinoma Tomonari A, Katanuma A, Matsumori T, Yamazaki H, Sano I, Minami R, Sen-yo M, Ikarashi S, Kin T, Yane K, Takahashi K, Shinohara T, Maguchi H 8462 Acute appendicitis following endoscopic mucosal resection of cecal adenoma Nemoto Y, Tokuhisa J, Shimada N, Gomi T, Maetani I 8467 Primary intestinal lymphangiectasia with generalized warts Lee SJ, Song HJ, Boo SJ, Na SY, Kim HU, Hyun CL III July 21, 2015 Volume 21 Issue 27

14 Contents World Journal of Gastroenterology Volume 21 Number 27 July 21, 2015 ABOUT COVER Editorial Board Member of World Journal of Gastroenterology, Hai-Tao Zhao, MD, Assistant Professor, Chief Doctor, Department of Liver Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing , China AIMS AND SCOPE World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1380 experts in gastroenterology and hepatology from 68 countries. The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. INDEXING/ABSTRACTING World Journal of Gastroenterology is now indexed in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Journal Citation Reports, Gastroenterology and Hepatology, 2013 Impact Factor: (36/74); Total Cites: (6/74); Current Articles: 1205 (1/74); and Eigenfactor Score: (6/74). FLYLEAF I-IX Editorial Board EDITORS FOR THIS ISSUE Responsible Assistant Editor: Xiang Li Responsible Electronic Editor: Xiao-Mei Liu Proofing Editor-in-Chief: Lian-Sheng Ma Responsible Science Editor: Jing Yu Proofing Editorial Office Director: Jin-Lei Wang NAME OF JOURNAL World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) LAUNCH DATE October 1, 1995 FREQUENCY Weekly EDITORS-IN-CHIEF Damian Garcia-Olmo, MD, PhD, Doctor, Professor, Surgeon, Department of Surgery, Universidad Autonoma de Madrid; Department of General Surgery, Fundacion Jimenez Diaz University Hospital, Madrid 28040, Spain Saleh A Naser, PhD, Professor, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL 32816, United States Stephen C Strom, PhD, Professor, Department of Laboratory Medicine, Division of Pathology, Karolinska Institutet, Stockholm , Sweden Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States EDITORIAL OFFICE Jin-Lei Wang, Director Xiu-Xia Song, Vice Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: editorialoffice@wjgnet.com Help Desk: PUBLISHER Baishideng Publishing Group Inc 8226 Regency Drive, Pleasanton, CA 94588, USA Telephone: Fax: bpgoffice@wjgnet.com Help Desk: PUBLICATION DATE July 21, 2015 COPYRIGHT 2015 Baishideng Publishing Group Inc. Articles published by this Open-Access journal are distributed under the terms of the Creative Commons Attribution Noncommercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. SPECIAL STATEMENT All articles published in journals owned by the Baishideng Publishing Group (BPG) represent the views and opinions of their authors, and not the views, opinions or policies of the BPG, except where otherwise explicitly indicated. INSTRUCTIONS TO AUTHORS Full instructions are available online at wjgnet.com/ /g_info_ htm ONLINE SUBMISSION IV July 21, 2015 Volume 21 Issue 27

15 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Non-celiac gluten sensitivity: time for sifting the grain EDITORIAL Luca Elli, Leda Roncoroni, Maria Teresa Bardella Luca Elli, Leda Roncoroni, Maria Teresa Bardella, Center for Prevention and Diagnosis of Celiac Disease, Gastroenterology and Endoscopy Unit, Department of Pathophysiology and Transplantation, Università degli Studi di Milano. Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico, Milano, Italy Author contributions: Elli L, Roncoroni L and Bardella MT contributed equally to this paper. Conflict-of-interest statement: The authors declare no conflict of interests. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Luca Elli, MD, PhD, Center for Prevention and Diagnosis of Celiac Disease, Gastroenterology and Endoscopy Unit, Department of Pathophysiology and Transplantation, Università degli Studi di Milano. Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico, Via F. Sforza 35, Milano, Italy. dottorlucaelli@gmail.com Telephone: Fax: Received: January 23, 2015 Peer-review started: January 23, 2015 First decision: March 10, 2015 Revised: April 1, 2015 Accepted: May 27, 2015 Article in press: May 27, 2015 Published online: July 21, 2015 Abstract In the last few years, a new nomenclature has been proposed for the disease induced by the ingestion of gluten, a protein present in wheat, rice, barley and oats. Besides celiac disease and wheat allergy, the most studied forms of gluten-related disorders characterized by an evident immune mechanism (autoimmune in celiac disease and IgE-mediated in wheat allergy), a new entity has been included, apparently not driven by an aberrant immune response: the non-celiac gluten sensitivity (NCGS). NCGS is characterized by a heterogeneous clinical picture with intestinal and extraintestinal symptoms arising after gluten ingestion and rapidly improving after its withdrawal from the diet. The pathogenesis of NCGS is largely unknown, but a mixture of factors such as the stimulation of the innate immune system, the direct cytotoxic effects of gluten, and probably the synergy with other wheat molecules, are clues for the complicated puzzle. In addition, the diagnostic procedures still remain problematic due to the absence of efficient diagnostic markers; thus, diagnosis is based upon the symptomatic response to a gluten-free diet and the recurrence of symptoms after gluten reintroduction with the possibility of an important involvement of a placebo effect. The temporary withdrawal of gluten seems a reasonable therapy, but the timing of gluten reintroduction and the correct patient management approach are have not yet been determined. Key words: Celiac disease; Gluten; Gluten-related disorders; Gluten sensitivity; Non-celiac gluten sensitivity The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Gluten-related disorders are extremely relevant in gastroenterologic practice, and their prevalence has increased in recent decades. Besides celiac disease and allergy, the newly born non-celiac gluten sensitivity is still an obscure syndrome with an unknown pathogenesis and important clinical concerns regarding diagnosis and patient management. Elli L, Roncoroni L, Bardella MT. Non-celiac gluten sensitivity: time for sifting the grain. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8221.htm DOI: July 21, 2015 Volume 21 Issue 27

16 Elli L et al. Non-celiac gluten sensitivity org/ /wjg.v21.i INTRODUCTION Wheat is a basic staple of the human diet, especially in Western countries where wheat-containing food dominates the menu. Since the start of agriculture in Mesopotamia about years ago, wheat has sustained mankind s development and health up to the present day [1]. This apparently contrasts with the selection of a genetic background susceptible to immune reactions against gluten [i.e., celiac disease (CD)], the HLA DQ2 haplotype [2]. The development of adverse reactions against wheat and, in particular, against gluten, is supposed to be concomitant with the very moment humans started its ingestion. The first description of a patient affected by CD is ascribed to Areteus of Cappadocia, who in the 2 nd century AD reported a case of chronic diarrhea and malabsorption. However, only at the end of the 19 th century, Samuel Gee scientifically described the celiac syndrome in childhood and in the 1950s, Willem Dicke identified gluten as the environmental agent of CD [3]. Since then, the scientific community s interest concerning the effects of gluten on humans and the mechanisms underpinning gluten-induced intestinal and systemic damage has increased [4-6]. Nowadays, CD is considered an autoimmune disorder affecting about 1% of the worldwide population [7,8]. A different mechanism is involved in the allergic reaction to wheat (wheat allergy): a condition affecting 4% of the population with heterogeneous intestinal, respiratory, and cutaneous symptoms [6]. In addition to the food allergy against wheat, the other major forms of wheat allergy are baker s asthma and wheat-dependent exerciseinduced anaphylaxis, which can lead to important anaphylactic reactions [9]. Recently, a third clinical syndrome has been introduced under the generic umbrella of gluten-related disorder, or non-celiac gluten sensitivity (NCGS), which apparently involves neither the allergic nor autoimmune mechanisms or a specific genetic background, as in CD [4]. Thus, gluten or other wheat components are supposedly the environmental factors that induce a wide range of gluten-related diseases with different pathogenic pathways, which globally affect a large proportion of the population [4,10]. NCGS AND ITS POSSIBLE PATHOMECHANISMS NCGS is a clinical syndrome characterized by both intestinal and extraintestinal symptoms, which are responsive to gluten (wheat) withdrawal from the diet. The mechanisms by which gluten induces symptoms in NCGS are largely unknown, but their difference from those present in CD and wheat allergy appears clear. Although data is scant and conflicting, one can hypothesize that a multifactorial process is at the base of the NCGS symptomatic onset. The involvement of the innate immune system, a direct cytotoxic effect of gluten and gliadin, and the involvement of different target organs and other proteic components of wheat can be all implicated. Firstly, the study by Sapone et al [11] demonstrated in a series of NCGS subjects reporting different gastrointestinal symptoms that intestinal permeability and adaptive immune responses are not involved in the process. In fact, by using the lactulose/mannitol test and investigating the main components of tight junctions (zonulin and claudins), the authors found no alterations, this fact excluding the presence of a leaky gut as in CD or other intestinal inflammatory conditions. The concomitant duodenal increase of tolllike receptor-2 and the significant reduction of the T-regulatory cell marker FOXP3 compared to healthy subjects and CD patients suggested a stimulation of the innate immune system that does not involve the interferon γ pathway. In the duodenal histology of NCGS, a slight increase of γ and δ intraepithelial lymphocytes was reported. The data collected on the absence of an adaptive immune response stimulation seems to be confirmed by another study that investigated the effect of a gluten-containing diet in patients affected by a diarrhea-type irritable bowel syndrome (IBS) [12]. In contrast with the previous studies, an alteration of gut permeability was reported in these patients, especially in subjects carrying a CD-compatible genetic background (i.e., HLA DQ2). However, the definitive exclusion of the adaptive immune system is not possible. Based on the findings published by Brottveit et al [13], who explored and compared the initial mucosal immunologic events in CD and NCGS subjects before and after a gluten challenge, an increase of interferon γ and heat shock protein 27 levels after gluten challenge was evidenced together with an increased density of intraepithelial lymphocytes, this latter independent from the gluten challenge. Differently, other authors failed to identify any gliadin-related immunologic alteration in the duodenal mucosa of NCGS patients [14]. Besides the possible alteration of the immune system, gluten presents some peculiar biologic properties that induce intestinal damage [15]. Different in vitro studies on two- and three-dimensional cell cultures (mainly enterocytes) demonstrated that the treatment with gluten and gliadin induces alterations of the main cellular homeostatic processes. Cellular morphology and motility [16,17] and cytoskeleton organization and intercellular contact through the tight junction proteins are all altered [18,19]. Treated cells present a reduced viability due to the stimulation of apoptosis and a reduction of synthesis of nucleic acids (DNA and RNA) and proteins [20]. Moreover, the oxidative balance is disrupted by a decrease of reduced glutathione and thiols [18,21] July 21, 2015 Volume 21 Issue 27

17 Elli L et al. Non-celiac gluten sensitivity While the researchers attention is focused on gluten, other molecules also contained in wheat may be involved in the NCGS symptoms. Among them, the amylase trypsin inhibitor enzymatic family is a known trigger of the toll-like receptor-4 pathway of the innate immune system, stimulating the release of proinflammatory cytokines in cells from CD and non-cd patients and biopsies [22]. Other authors have indicated that the fermentable oligosaccharides, disaccharides, monosaccharides and polyols-present in wheat (fructans) and other foods and known as FODMAPs-are important factors in causing unspecific gastrointestinal symptoms (especially bloating). These poorly absorbed short-chain carbohydrates are fermented in the colon with gas release, the resulting intestinal distension being at the base of reported symptoms. In a placebocontrolled, crossover rechallenge study, Biesiekierski et al [23] found no evidence of a specific dose-dependent effect of gluten in patients with suspected NCGS undergoing a low FODMAPs diet. Although graved by an important nocebo effect, their data suggest that NCGS might be confused with FODMAP sensitivity, and gluten might be only a cofactor (or a confounder) when looking for the origin of gastrointestinal symptoms. In a recent study, a low FODMAP diet was effective in controlling gastrointestinal symptoms in patients with intestinal bowel disease [24], thus supporting its use as a first-line therapy. However, the data from the reported studies are extremely heterogeneous and even scant in the case of amylase trypsin inhibitor, thus making their interpretation difficult. The main bias is caused by the absence of a clear diagnostic flowchart for NCGS as all the studies simply enrolled patients clinically responding to a period of gluten-free dieting without excluding the placebo effect. HOW MANY PATIENTS WITH NCGS ARE THERE AND WHICH SYMPTOMS DO THEY REPORT? Subjects with NCGS claim a variety of intestinal and/or extra-intestinal symptoms, similar to those occurring in patients affected by CD or IBS [25]. Symptoms occur after gluten ingestion; they improve/disappear when gluten is withdrawn from the diet or recur within a few hours or days on gluten challenge. In a recent Italian, multicenter prospective survey of 486 subjects with symptomatic benefit from a gluten-free diet (62% of these subjects underwent intestinal biopsy to exclude CD), the large majority of patients reported more than two associated gastrointestinal or extraintestinal symptoms [10]. The most frequent intestinal symptoms (> 80%) were bloating and abdominal pain, while more than 50% of patients reported diarrhea, 27% alternating bowel habits, and 24% constipation. Also, epigastric pain was frequent and followed, with decreasing prevalence, by nausea, aerophagia, gastroesophageal reflux disease, and aphthous stomatitis. In this study, as in many other studies on NCGS, systemic extraintestinal symptoms were frequently present: tiredness, lack of well-being, and neuropsychiatric symptoms such as headache, anxiety, foggy mind, arm/leg numbness, and depression. Additional extraintestinal manifestations were as reported: muscle or joint pain, weight loss, dermatitis, and skin rash. Looking at the data regarding gluten withdrawal, NCGS is suspected in children (with fatigue apparently as their most frequent systemic symptom) and in adults, with a higher prevalence in females than in males [6,26]. Additionally, there are reports that NCGS is more common in families with a history of CD [26-29]. There is some overlap between IBS and NCGS. In fact, in patients fulfilling the Rome Ⅲ criteria for IBS, mainly in those with diarrhea, both predominant and in mixed form, NCGS has been diagnosed in a high percentage of cases: these have been sub-grouped as having gluten-sensitive IBS [30-32]. Similarly, in patients affected by allergic disorders, a high prevalence of NCGS has been reported (77/262 patients), thus confirming the need for a clearer definition of both the syndrome and the effects of gluten on the gastrointestinal tract [33]. An objective approach to NCGS diagnosis is not available to date, as significant serologic and histologic markers are lacking; thus, the epidemiology of the NCGS disorder is quite approximate and not based on powerful studies. The reported prevalence of NCGS in the current literature varies between 0.6% and 6%. The former prevalence rate results from the National Health and Nutrition Examination Survey program, based on interviews and medical examinations carried out by general practitioners [34], while the latter rate is the outcome of the experience by the Tertiary Center for Celiac Research at the University of Maryland [6]. At present, we should consider as affected by NCGS only those subjects who have been extensively studied to exclude CD or wheat allergy and have responded to a blind placebo-controlled gluten challenge, therefore excluding self-diagnosed self-treated subjects. HOW CAN WE DIAGNOSE AND TREAT NCGS? The main problem concerning NCGS is the absence of a set of standardized diagnostic criteria. The clinical picture of NCGS seems very unspecific. Although some allergic manifestations (urticaria, asthma, labial edema, etc.) strongly suggest the presence of an IgE-mediated disorder, the presence of abdominal discomfort, evacuation disturbances, foggy mind, chronic fatigue, and unspecific skin manifestations do not help clinicians in any differential diagnosis. As a result, when NCGS is suspected, the first step is represented by the exclusion of other disorders, especially CD and wheat allergy. Serologic negativity to anti-transglutaminase IgA and anti-wheat component IgE antibodies and/or the absence of a duodenal atrophy at duodenal histology and skin reaction during 8223 July 21, 2015 Volume 21 Issue 27

18 Elli L et al. Non-celiac gluten sensitivity Table 1 Non-celiac gluten sensitivity identikit Name and definition Pathogenesis Prevalence Diagnosis Treatment Non-celiac gluten/wheat sensitivity is an intestinal/extraintestinal syndrome responsive to gluten withdrawal in absence of CD and WA Multi-factorial, including innate immunity and direct cytotoxic effects of gluten Other molecules are potentially involved: Amylase trypsin inhibitor, FODMAPs Ranging from 3% to 5%, though specific studies are lacking Via placebo-controlled blind gluten challenge Prior exclusion of celiac disease and allergy AGA IgG, IELs, basophil activation and eosinophil duodenal/colon infiltration are potential biomarkers No data are available for guidance An on-demand gluten-free regimen should be considered AGA: Anti-gliadin antibodies; CD: Celiac disease; FODMAP: Fermentable oligosaccharides, disaccharides, monosaccharides, and polyols; IELs: Intraepithelial lymphocytes; WA: Wheat allergy. a prick test, are necessary pre-requisites. Despite the absence of reliable NCGS biomarkers, some serologic and/or histologic alterations have been reported: (1) anti-gliadin antibodies IgG class could be present in 50% of patients with suspected NCGS [27] ; (2) cytometric basophil activation is positive in 66% of patients responding to a wheat blind challenge associated to duodenal intraepithelial lymphocytosis and eosinophil infiltration of duodenum and colon [35,36] ; and (3) mild duodenal intraepithelial lymphocytosis could be present in about 50% of NCGS cases, suggesting a microscopic enteritis [10,36,37]. Once alternative causes of a patient s clinical status have been excluded, the second step is to focus on a link between symptoms and gluten ingestion with an on/off mechanism. Typically, symptoms would arise rapidly or at least after a few hours from the ingestion of gluten-containing food and would disappear instantly once gluten is withdrawn from the diet. This passage meets some criticism. Firstly, the period of gluten exclusion to ascertain the symptomatic response is not standardized, therefore, it is not clear how long the gluten-free diet should be maintained in absence of any clinical response. Secondly, the glutenfree dietary regimen during the proof period (if you pardon the pun) should be kept absolutely strict-the same way as for CD-to facilitate nutritional control. Thirdly, how should a gluten-free diet response be checked and measured, and how great should the symptomatic improvement be in order to define a patient responsive to gluten exclusion? Because of the absence of reliable biomarkers altered by gluten ingestion, a symptomatic trend can be measured using scores (as the gastrointestinal symptom rating scale) validated for functional diseases or visual analogue scales [38]. The quantification of symptomatic improvement is at the base of a common definition of gluten-free diet response. Although necessary, a response to a gluten-free diet would be insufficient to define a patient as gluten sensitive, due to the possibility of a placebo effect, which is known to be present in functional diseases [39]. Thus, a third step is required in order to eliminate or reduce the impact of the placebo effect in the diagnostic process. To reach this goal, a double- or at least single-blind challenge should be proposed to patients while they are on their gluten-free diet, to make evident the symptomatic onset during the blind assumption of gluten in a sort of n-of-1 process [40]. The problems to be solved here are: What dosage of gluten? Which vehicle should be used? How long should the challenge last? Which method to use for symptoms quantification? POTENTIAL MANAGEMENT OPTIONS AND CONCLUSIONS Once the diagnosis of NCGS is reasonably reached, the management and follow-up of patients is completely obscure. A logical approach is to undertake a glutenfree dietary regimen for a limited period (e.g., six months), followed by the gradual reintroduction of gluten. During the gluten-free diet, the ingestion of prolamine peptide (gliadin)-derived from wheat, rye, barley, oats, bulgur, and hybrids of these cereal grains-should be avoided. Rice, corn, and potatoes have been the typical substitutes, but nowadays other different cereals and pseudocereals, such as amaranth, buckwheat, manioc, fonio, teff, millet, quinoa, and sorghum, can be used. After some period on a glutenfree diet, the reintroduction of gluten can start with cereals of low gluten content (e.g., oats). In addition, einkorn farro (Triticum monococcum) can be used, having no direct in vitro or ex vivo toxicity and low (7%) gluten content [41]. Chronically, gluten-free-diet periods can be administered during symptomatic relapses as a sort of on-demand therapy. NCGS is a clinical syndrome hampered by many obscure sides (summarized in table 1). Its pathogenesis and clinical presentation are not clear, and the diagnostic flowchart and patient management are not standardized. However, in the 8224 July 21, 2015 Volume 21 Issue 27

19 Elli L et al. Non-celiac gluten sensitivity epidemiologic dimension, the possibility to spare a large number of patients undergoing a drug-based therapy with side effects and costs is intriguing and makes NCGS a hot topic in gastroenterology. REFERENCES 1 Rostami K, Malekzadeh R, Shahbazkhani B, Akbari MR, Catassi C. Coeliac disease in Middle Eastern countries: a challenge for the evolutionary history of this complex disorder? Dig Liver Dis 2004; 36: [PMID: ] 2 Lionetti E, Catassi C. Co-localization of gluten consumption and HLA-DQ2 and -DQ8 genotypes, a clue to the history of celiac disease. Dig Liver Dis 2014; 46: [PMID: DOI: /j.dld ] 3 Losowsky MS. A history of coeliac disease. Dig Dis 2008; 26: [PMID: DOI: / ] 4 Catassi C, Bai JC, Bonaz B, Bouma G, Calabrò A, Carroccio A, Castillejo G, Ciacci C, Cristofori F, Dolinsek J, Francavilla R, Elli L, Green P, Holtmeier W, Koehler P, Koletzko S, Meinhold C, Sanders D, Schumann M, Schuppan D, Ullrich R, Vécsei A, Volta U, Zevallos V, Sapone A, Fasano A. Non-Celiac Gluten sensitivity: the new frontier of gluten related disorders. Nutrients 2013; 5: [PMID: DOI: /nu ] 5 Catassi C, Kryszak D, Bhatti B, Sturgeon C, Helzlsouer K, Clipp SL, Gelfond D, Puppa E, Sferruzza A, Fasano A. Natural history of celiac disease autoimmunity in a USA cohort followed since Ann Med 2010; 42: [PMID: DOI: / ] 6 Sapone A, Bai JC, Ciacci C, Dolinsek J, Green PH, Hadjivassiliou M, Kaukinen K, Rostami K, Sanders DS, Schumann M, Ullrich R, Villalta D, Volta U, Catassi C, Fasano A. Spectrum of gluten-related disorders: consensus on new nomenclature and classification. BMC Med 2012; 10: 13 [PMID: DOI: / ] 7 Buscarini E, Conte D, Cannizzaro R, Bazzoli F, De Boni M, Delle Fave G, Farinati F, Ravelli P, Testoni PA, Lisiero M, Spolaore P. White paper of Italian Gastroenterology: delivery of services for digestive diseases in Italy: weaknesses and strengths. Dig Liver Dis 2014; 46: [PMID: ] 8 Gujral N, Freeman HJ, Thomson AB. Celiac disease: prevalence, diagnosis, pathogenesis and treatment. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 9 Soares-Weiser K, Takwoingi Y, Panesar SS, Muraro A, Werfel T, Hoffmann-Sommergruber K, Roberts G, Halken S, Poulsen L, van Ree R, Vlieg-Boerstra BJ, Sheikh A. The diagnosis of food allergy: a systematic review and meta-analysis. Allergy 2014; 69: [PMID: DOI: /all.12333] 10 Volta U, Bardella MT, Calabrò A, Troncone R, Corazza GR. An Italian prospective multicenter survey on patients suspected of having non-celiac gluten sensitivity. BMC Med 2014; 12: 85 [PMID: DOI: / ] 11 Sapone A, Lammers KM, Casolaro V, Cammarota M, Giuliano MT, De Rosa M, Stefanile R, Mazzarella G, Tolone C, Russo MI, Esposito P, Ferraraccio F, Cartenì M, Riegler G, de Magistris L, Fasano A. Divergence of gut permeability and mucosal immune gene expression in two gluten-associated conditions: celiac disease and gluten sensitivity. BMC Med 2011; 9: 23 [PMID: DOI: / ] 12 Vazquez-Roque MI, Camilleri M, Smyrk T, Murray JA, Marietta E, O Neill J, Carlson P, Lamsam J, Janzow D, Eckert D, Burton D, Zinsmeister AR. A controlled trial of gluten-free diet in patients with irritable bowel syndrome-diarrhea: effects on bowel frequency and intestinal function. Gastroenterology 2013; 144: e3 [PMID: ] 13 Brottveit M, Beitnes AC, Tollefsen S, Bratlie JE, Jahnsen FL, Johansen FE, Sollid LM, Lundin KE. Mucosal cytokine response after short-term gluten challenge in celiac disease and non-celiac gluten sensitivity. Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ] 14 Bucci C, Zingone F, Russo I, Morra I, Tortora R, Pogna N, Scalia G, Iovino P, Ciacci C. Gliadin does not induce mucosal inflammation or basophil activation in patients with nonceliac gluten sensitivity. Clin Gastroenterol Hepatol 2013; 11: e1 [PMID: DOI: /j.cgh ] 15 Elli L, Dolfini E, Bardella MT. Gliadin cytotoxicity and in vitro cell cultures. Toxicol Lett 2003; 146: 1-8 [PMID: DOI: /j.toxlet ] 16 Roncoroni L, Elli L, Bardella MT, Perrucci G, Ciulla M, Lombardo V, Tomba C, Conte D, Doneda L. Extracellular matrix proteins and displacement of cultured fibroblasts from duodenal biopsies in celiac patients and controls. J Transl Med 2013; 11: 91 [PMID: DOI: / ] 17 Roncoroni L, Elli L, Doneda L, Piodi L, Ciulla MM, Paliotti R, Bardella MT. Isolation and culture of fibroblasts from endoscopic duodenal biopsies of celiac patients. J Transl Med 2009; 7: 40 [PMID: DOI: / ] 18 Dolfini E, Elli L, Roncoroni L, Costa B, Colleoni MP, Lorusso V, Ramponi S, Braidotti P, Ferrero S, Falini ML, Bardella MT. Damaging effects of gliadin on three-dimensional cell culture model. World J Gastroenterol 2005; 11: [PMID: ] 19 Dolfini E, Roncoroni L, Elli L, Fumagalli C, Colombo R, Ramponi S, Forlani F, Bardella MT. Cytoskeleton reorganization and ultrastructural damage induced by gliadin in a three-dimensional in vitro model. World J Gastroenterol 2005; 11: [PMID: ] 20 Giovannini C, Mancini E, De Vincenzi M. Inhibition of the cellular metabolism of Caco-2 cells by prolamin peptides from cereals toxic for coeliacs. Toxicol In Vitro 1996; 10: [PMID: DOI: /S (96) ] 21 Caputo I, Secondo A, Lepretti M, Paolella G, Auricchio S, Barone MV, Esposito C. Gliadin peptides induce tissue transglutaminase activation and ER-stress through Ca2+ mobilization in Caco-2 cells. PLoS One 2012; 7: e45209 [PMID: DOI: / journal.pone ] 22 Junker Y, Zeissig S, Kim SJ, Barisani D, Wieser H, Leffler DA, Zevallos V, Libermann TA, Dillon S, Freitag TL, Kelly CP, Schuppan D. Wheat amylase trypsin inhibitors drive intestinal inflammation via activation of toll-like receptor 4. J Exp Med 2012; 209: [PMID: DOI: /jem ] 23 Biesiekierski JR, Peters SL, Newnham ED, Rosella O, Muir JG, Gibson PR. No effects of gluten in patients with self-reported nonceliac gluten sensitivity after dietary reduction of fermentable, poorly absorbed, short-chain carbohydrates. Gastroenterology 2013; 145: e e3 [PMID: DOI: /j.gastro ] 24 Halmos EP, Power VA, Shepherd SJ, Gibson PR, Muir JG. A diet low in FODMAPs reduces symptoms of irritable bowel syndrome. Gastroenterology 2014; 146: e5 [PMID: DOI: /j.gastro ] 25 Eswaran S, Goel A, Chey WD. What role does wheat play in the symptoms of irritable bowel syndrome? Gastroenterol Hepatol (N Y) 2013; 9: [PMID: ] 26 Tanpowpong P, Broder-Fingert S, Katz AJ, Camargo CA. Agerelated patterns in clinical presentations and gluten-related issues among children and adolescents with celiac disease. Clin Transl Gastroenterol 2012; 3: e9 [PMID: DOI: / ctg ] 27 Volta U, Tovoli F, Cicola R, Parisi C, Fabbri A, Piscaglia M, Fiorini E, Caio G. Serological tests in gluten sensitivity (nonceliac gluten intolerance). J Clin Gastroenterol 2012; 46: [PMID: DOI: /MCG.0b013e ] 28 Volta U, De Giorgio R. New understanding of gluten sensitivity. Nat Rev Gastroenterol Hepatol 2012; 9: [PMID: DOI: /nrgastro ] 29 Biesiekierski JR, Newnham ED, Irving PM, Barrett JS, Haines M, Doecke JD, Shepherd SJ, Muir JG, Gibson PR. Gluten causes gastrointestinal symptoms in subjects without celiac disease: a double-blind randomized placebo-controlled trial. Am J Gastroenterol 2011; 106: ; quiz 515 [PMID: July 21, 2015 Volume 21 Issue 27

20 Elli L et al. Non-celiac gluten sensitivity DOI: /ajg ] 30 Verdu EF, Armstrong D, Murray JA. Between celiac disease and irritable bowel syndrome: the no man s land of gluten sensitivity. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 31 Verdu EF. Editorial: Can gluten contribute to irritable bowel syndrome? Am J Gastroenterol 2011; 106: [PMID: DOI: /ajg ] 32 Aziz I, Lewis NR, Hadjivassiliou M, Winfield SN, Rugg N, Kelsall A, Newrick L, Sanders DS. A UK study assessing the population prevalence of self-reported gluten sensitivity and referral characteristics to secondary care. Eur J Gastroenterol Hepatol 2014; 26: [PMID: DOI: /01. meg f7] 33 Massari S, Liso M, De Santis L, Mazzei F, Carlone A, Mauro S, Musca F, Bozzetti MP, Minelli M. Occurrence of nonceliac gluten sensitivity in patients with allergic disease. Int Arch Allergy Immunol 2011; 155: [PMID: DOI: / ] 34 DiGiacomo DV, Tennyson CA, Green PH, Demmer RT. Prevalence of gluten-free diet adherence among individuals without celiac disease in the USA: results from the Continuous National Health and Nutrition Examination Survey Scand J Gastroenterol 2013; 48: [PMID: DOI: / ] 35 Carroccio A, Brusca I, Mansueto P, D alcamo A, Barrale M, Soresi M, Seidita A, La Chiusa SM, Iacono G, Sprini D. A comparison between two different in vitro basophil activation tests for glutenand cow s milk protein sensitivity in irritable bowel syndrome (IBS)-like patients. Clin Chem Lab Med 2013; 51: [PMID: DOI: /cclm ] 36 Carroccio A, Mansueto P, Iacono G, Soresi M, D Alcamo A, Cavataio F, Brusca I, Florena AM, Ambrosiano G, Seidita A, Pirrone G, Rini GB. Non-celiac wheat sensitivity diagnosed by double-blind placebo-controlled challenge: exploring a new clinical entity. Am J Gastroenterol 2012; 107: ; quiz 1907 [PMID: DOI: /ajg ] 37 Rostami K, Aldulaimi D, Holmes G, Johnson MW, Robert M, Srivastava A, Fléjou JF, Sanders DS, Volta U, Derakhshan MH, Going JJ, Becheanu G, Catassi C, Danciu M, Materacki L, Ghafarzadegan K, Ishaq S, Rostami-Nejad M, Peña AS, Bassotti G, Marsh MN, Villanacci V. Microscopic enteritis: Bucharest consensus. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i9.2593] 38 Svedlund J, Sjödin I, Dotevall G. GSRS--a clinical rating scale for gastrointestinal symptoms in patients with irritable bowel syndrome and peptic ulcer disease. Dig Dis Sci 1988; 33: [PMID: DOI: /BF ] 39 Shah E, Pimentel M. Placebo effect in clinical trial design for irritable bowel syndrome. J Neurogastroenterol Motil 2014; 20: [PMID: DOI: /jnm ] 40 Lillie EO, Patay B, Diamant J, Issell B, Topol EJ, Schork NJ. The n-of-1 clinical trial: the ultimate strategy for individualizing medicine? Per Med 2011; 8: [PMID: DOI: /pme.11.7] 41 Pizzuti D, Buda A, D Odorico A, D Incà R, Chiarelli S, Curioni A, Martines D. Lack of intestinal mucosal toxicity of Triticum monococcum in celiac disease patients. Scand J Gastroenterol 2006; 41: [PMID: DOI: / ] P- Reviewer: Bassotti G, Ciccocioppo R, Guandalini S S- Editor: Ma YJ L- Editor: AmEditor E- Editor: Liu XM 8226 July 21, 2015 Volume 21 Issue 27

21 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. EDITORIAL Genomic medicine in gastroenterology: A new approach or a new specialty? Sonia Roman, Arturo Panduro Sonia Roman, Arturo Panduro, Department of Molecular Biology in Medicine, Civil Hospital of Guadalajara, Fray Antonio Alcalde, Mexico and Health Sciences Center, University of Guadalajara, Guadalajara, Jalisco 44280, Mexico Author contributions: Roman S and Panduro A contributed equally to this work. Conflict-of-interest statement: There is no conflict of interest in this study. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Arturo Panduro, MD, PhD, Department of Molecular Biology in Medicine, Civil Hospital of Guadalajara, Fray Antonio Alcalde, Mexico and Health Sciences Center, University of Guadalajara, Guadalajara, Hospital No. 278, Col. El Retiro, Guadalajara, Jalisco 44280, México. apanduro@prodigy.net.mx Telephone: Fax: Received: January 27, 2015 Peer-review started: January 28, 2015 First decision: March 10, 2015 Revised: March 24, 2015 Accepted: May 4, 2015 Article in press: May 4, 2015 Published online: July 21, 2015 Abstract Throughout history, many medical milestones have been achieved to prevent and treat human diseases. Man s early conception of illness was naturally holistic or integrative. However, scientific knowledge was atomized into quantitative and qualitative research. In the field of medicine, the main trade-off was the creation of many medical specialties that commonly treat patients in advanced stages of disease. However, now that we are immersed in the post-genomic era, how should we reevaluate medicine? Genomic medicine has evoked a medical paradigm shift based on the plausibility to predict the genetic susceptibility to disease. Additionally, the development of chronic diseases should be viewed as a continuum of interactions between the individual s genetic make-up and environmental factors such as diet, physical activity, and emotions. Thus, personalized medicine is aimed at preventing or reversing clinical symptoms, and providing a better quality of life by integrating the genetic, environmental and cultural factors of diseases. Whether using genomic medicine in the field of gastroenterology is a new approach or a new medical specialty remains an open question. To address this issue, it will require the mutual work of educational and governmental authorities with public health professionals, with the goal of translating genomic medicine into better health policies. Key words: Chronic diseases; Nutritional genomics; Obesity; Liver disease; Gastrointestinal diseases The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: New knowledge is growing on how genes are involved in the physiopathology of liver and gastrointestinal diseases and how environmental factors, such as diet, physical activity, and emotions modulate the onset and progression of chronic disease. In the era of genomic medicine, gastroenterologists and hepatologists should be determined to integrate genetic, environmental and cultural factors into medical practice to prevent or reverse medical symptoms July 21, 2015 Volume 21 Issue 27

22 Roman S et al. Genomic medicine in gastroenterology Roman S, Panduro A. Genomic medicine in gastroenterology: A new approach or a new specialty? World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8227.htm DOI: org/ /wjg.v21.i Orandum est ut mens sana in corpore sano sit [Juvenal/55 AD] (body-mind-spirit) R. Descartes [XVIII century] INTRODUCTION Throughout past and present history, humans have sought cures for their illnesses based on whatever they believed was the cause of the malady in question [1,2]. In the ancient world, Greek medicine was influenced by Hippocrates theorem, which proposed that diseases arose in response to a natural imbalance of four basic humors and that treatment could be accomplished by means of balancing the opposites [1,3]. Among the world s oldest medical techniques is the traditional Chinese Medicine method of using acupuncture to unblock the body s energy channels or meridians to restore health [1,4]. The practitioners of Indian Ayurvedic medicine promote the use of herbal compounds and special diets based on their conceptions about what causes health and disease [1,3,5]. During the Middle Ages in Europe diseases were perceived as a consequence of people s sins; in this case, treatment consisted of prayer and herbalism. The practice of alchemy also arose during this time, which became a protoscience of medicine that later produced a broad range of contributions to chemistry and the physical sciences. Although Hippocrates is considered the Father of Medicine, it wasn t until the introduction of the scientific method, inspired by Rene Descartes Discourse on Method, that medicine began its next stage of development [6]. Major progress began when the previously concealed dissection of the human body gave rise to the subject of anatomy, which later enabled the improvement of surgical procedures [7]. The development of the microscope fostered the transition from the macroscopic world to the microscopic scale, impacting two fields of knowledge: the study of human tissues and cells and the study of microorganisms. These two areas of study led to the fields of cell biology and bacteriology (and, later on, virology), respectively, and inspired Louis Pasteur s germ theory of disease, in addition to the development of antiseptics/antibiotics and vaccines [8]. However, it was not until the twentieth century that scientific medicine emerged. The development of biochemistry and physiology significantly advanced the understanding of many metabolic processes and laid the foundation for the fields of pathophysiology and pharmacology. These discoveries were the starting point of the current paradigm that exists in scientific-based medicine, which relies on either surgical intervention or drug therapy to treat disease. Additionally, the discovery of the double-stranded DNA molecule in the 1950 s by Watson and Crick [9] Quantitative research Medical or surgical treatment Genes and bioinformatics Genomic medicine was a significant step forward in the field of molecular biology. Decoding the DNA of the prokaryotic bacterial cell led to the one gene, one ribosome, one protein hypothesis [10]. In the early 1980 s, recombinant DNA techniques based on the combined use of the PBR422 plasmid and restriction enzymes [11] enabled the cloning of other biologically relevant DNA sequences and marked the beginning of the pre-genomic era. The genomic era began nearly 20 years later with the sequencing of the entire human genome in the year 2000 [12,13]. What s next in medicine? We began this editorial with a brief overview of the world s history of medicine to elicit only one question: How should these medical milestones be reevaluated, especially now that we are immersed in the post-genomic era? PARADIGM SHIFT IN MEDICINE, OR BACK TO THE FUTURE Qualitative research Emotions/ spirituality Figure 1 Esquematic representation of genomic medicine: a new paradigm shift or back to the future. Interestingly, the 2000-year-old Biblical verse that asks Do you not know that your bodies are temples of the Holy Spirit, who is in you, whom you have received from God? (Corinthians 6:19) is the ancient predecessor of the expression Orandum est ut mens sana in corpore sano sit, a phrase which has been ascribed to the Roman poet Juvenal, author of the famous Satires. From this famous Latin aphorism emerges the medical proverb Body, Mind and Spirit, which describes the ideal triad necessary for maintaining or restoring health (Figure 1). However, following the onset of the Descartian method, only the measurable corporal phenomenon that could be proven rationally was considered to be science. Thus, quantitative studies became used to reinforce the paradigm of providing medical treatment by either 8228 July 21, 2015 Volume 21 Issue 27

23 Roman S et al. Genomic medicine in gastroenterology surgery or prescription drugs [2,14]. Unfortunately, the formal study of how spirituality and emotions affect health fell outside of the scientific context of that time, only to be taken up years later by religious leaders or professionals in the fields of behavioral and social sciences [2,14,15]. Interestingly, modern day genomic-era scientists have been faced with an unexpected paradox. They realized that the massive human DNA blueprint making up the book of life was insufficient to understanding how the human body works [16], i.e., what makes us get sick and how can we heal. However, there is now a consensus that additional environmental factors have been interacting with the human genome for millennia, thus contributing to man s evolution. Some of these factors include diet, physical activity, and emotions/ spirituality [17]. Overall, the advent of genomic medicine has evoked a medical paradigm shift caused by the effects that the evolving and dynamic interactions between the human genome and the environment have on the processes of the human body [18]. This shift in medical thinking is providing new knowledge into what makes people either prone or resistant to chronic diseases and is laying the framework needed to establish strategies for disease prevention and the development of new therapeutic interventions [19]. Thus, genomic medicine, with the aid of bioinformatics and biotechnology, should enable greater understanding of the medical aspects of human disease [20]. Such understanding may be achieved by studying the complex interaction between genes, the environment and culture with the goals of preventing illness and treating diseases [21]. What is making us sick and how should we manage illness? The major public health obstacles of any given country or region are the diseases that cause the highest rates of mortality. In Latin America, as well as in several other developed countries, non-communicable chronic diseases are the foremost illnesses that affect people [22,23]. Most of these illnesses are caused by the ongoing obesity epidemic, and include cardiovascular disease, diabetes, cirrhosis, and cancer, as well as alcoholism. Obese patients commonly seek medical attention only once the clinical complications of obesity have become manifest, e.g., insulin resistance or type 2 diabetes, dyslipidemia, impaired distal circulation, nonalcoholic steatohepatitis (NASH) or vascular brain disease, among others. Furthermore, chronic illnesses frequently occur with co-morbidities. For example, alcoholism is frequently combined with some degree of liver damage due to NASH or viral hepatitis. Subsequently, this creates a costly burden for both the patient and the health care system because medicine is increasingly comprised of specialists that only treat one facet of a disease. For example, in the case listed above, an endocrinologist will control the metabolic problem, an infectious disease specialist will treat the viral infection, a hepatologist or gastroenterologist will treat the liver damage, and a cardiologist will treat any vascular problems. Similarly, in alternative medical fields such as medical molecular biology or the behavioral and social sciences, health professionals approach patients with chronic disease from their respective points of view (Figure 2). For this reason, the paradigm shift toward genomic medicine should focus more on disease prevention and less on treating patients at advanced stages of disease [24]. Genomic medicine can empower both physicians and their patients to more effectively prevent chronic disease, particularly if we come to understand the key genome-environmental interactions that affect our health. Furthermore, because these interactions regularly occur, chronic diseases should be looked upon as a continuum of bodily (unhealthy) changes that occur over the course of a lifetime. For example, obesityrelated chronic diseases may advance through four stages of development: induction, progression, clinical complications, and death [25] (Figure 3). The induction phase begins in young adults between approximately 18 to 25 years of age. During this period of life the balance between caloric intake and expenditure can be lost as a once active person stops regularly exercising and becomes less physically active. As he or she enters into a sedentary lifestyle, which is associated with increased caloric intake, metabolic abnormalities may become manifest. First comes dyslipidemia and weight gain, followed by a gradual increase in blood glucose, which in turn raises serum insulin. Hyperglycemia and hyperinsulinemia develop next, followed by insulin resistance and, finally, overt type 2 diabetes mellitus. However, a period of 20 to 30 years may have elapsed between the start of induction and the advent of overt disease, and many patients present with additional medical complications by the time of diagnosis. For this reason, if we are to advance to old age in better health, we must ideally avoid the induction and progression stages of chronic disease (Figure 3). Thus, if a patient is either only gradually progressing through or just starting at an early stage of disease the best approach is to try to halt or reverse the physiopathological process, whereas in cases of patients that are in advanced stages of disease the goal of treatment is the provision of a better quality of life. However, co-morbidities are often associated with the same periods of the induction and progression stages of illness. For example, among the Mexican population the consumption of alcohol starts at adolescence [26]. The period between the initiation of drinking and the development of alcohol dependence and addiction is usually 25 to 30 years [26]. In the case of viral hepatitis and HIV, sexual promiscuity plays a predominant role as one of the major risk factors, as well as the exposure to viral hepatitis by contact with contaminated biological fluids [25,27]. As discussed 8229 July 21, 2015 Volume 21 Issue 27

24 Roman S et al. Genomic medicine in gastroenterology Infectology Endocrinology Obesity Hepatology gastroenterology HCV ETOH Molecular biology Social sciences Cardiology Culture and society Genomic medicine Figure 2 From medical specialties to genomic medicine. The same patient usually requires consultation by different medical specialists. However, from a genomic medicine viewpoint, modern medicine should be integrative to prevent or halt chronic disease at an early stage of development. Negative emotions Virus Alcohol Physical inactivity Poor diet Genes Death Healthy old age Body mass index (kg/mt 2 ) Insulin resistance Obesity NASH Fibrosis DM2 CVD cirrhosis > 65 Adult ages (years) Healthy Overweight and obesity Figure 3 Four stages of the continuum of most chronic diseases. 1: Induction; 2: Disease progression; 3: Clinical complications; 4: Death. An individual with several risk factors may die at an earlier age (DARK LINE), in contrast, with an individual who has a healthier lifestyle (DASHED LINE). above, 25 to 30 years may pass between the onset of infection and the onset of liver damage and cirrhosis. In the case of NASH it has been observed that liver damage may be detectable as early as ten years after a patient initially becomes overweight or obese. The result is that an individual who becomes overweight or obese may become addicted to alcohol, infected with a hepatotropic virus and/or may be susceptible to developing NASH [28]. Furthermore, patients suffering from obesity or type 2 diabetes may also have cardiovascular disease (Figure 4). Figure 4 Overweight and obesity influence the onset of insulin resistance syndrome, a primary stage towards the development of type 2 diabetes mellitus, cardiovascular disease, nonalcoholic steatohepatitis fibrosis and cirrhosis. DM2: Type 2 diabetes mellitus; CVD: Cardiovascular disease; NASH: Nonalcoholic steatohepatitis. However, most physicians know from experience that not every obese patient will progress to type 2 diabetes. Likewise, not all those who consume excessive alcohol will develop cirrhosis because some patients are more prone than others to developing liver damage [29]. Furthermore, NASH generally only manifests in obese patients who are genetically susceptible to the disease. In the case of viral hepatitis, not every infected patient will progress to cirrhosis and hepatocellular carcinoma [30]. Therefore, the variance 8230 July 21, 2015 Volume 21 Issue 27

25 Roman S et al. Genomic medicine in gastroenterology Genetics in clinical medicine Chromosomopathies Gestation in a patient s susceptibility to developing a chronic disease seems to involve two important factors: genes and the environment. GENETIC FACTORS Inborn errors of metabolism At birth and adolescence Complex diseases - IR - Obesity - NASH - DM2 - Cirrhosis Adults Figure 5 Impact of molecular biology in medicine: From cytogenetics to the study of complex diseases. DM2: Type 2 diabetes mellitus; IR: Insulin resistance; NASH: Nonalcoholic steatohepatitis. The genetic factors that modify the expression of genes comprise a broad range of structural and functional variations of the DNA molecule. The history of clinical genetics dates back to the time when chromosomal disorders, such as abnormalities in the structure or number of chromosomes, were associated with a particular syndrome. In general, these disorders are accompanied by congenital malformation, growth retardation, and short stature. Severe chromosomal abnormalities that arise in utero usually lead to miscarriage or the premature termination of gestation [31]. Further advances have spurred the investigation of pathologies that are associated with innate errors of metabolism, which can be identified by biochemical and genetic testing. Although the genetic defect may be diagnosed during the first few years of life, offspring born with these metabolic disorders are generally healthy at birth. These and other single-gene (monogenic) pathologies are denoted as Mendelian inheritance disorders and generally result from de novo or inherited mutations that are transmitted to offspring as dominant, recessive or X-linked traits [32]. For example, in the case of obesity-related disorders, a single structural change in one gene may lead to rare genetic diseases such as Prader-Willi, Fraser- Jequier-Chen, Alström or Bardet-Biedl syndromes [33]. In contrast, complex diseases (e.g., cardiovascular disease, cancers, type 2 diabetes, cirrhosis, obesity) are associated with multiple risk factors, i.e., the risk of disease arises from more than one gene (polygenic) interacting with different environmental factors [32]. By this definition, common obesity can be considered a polygenic disease because of its association with single nucleotide polymorphisms (SNPs) that encode allelic forms of proteins that act in lipid and carbohydrate metabolism, the regulation of food appetite and the circadian cycle [34] (Figure 5). However, not all SNPs and environmental factors are alike in all individuals, which results in variability in the worldwide distribution of SNPs and non-genomic risk factors within the global population [35,36]. With the advent of the Human Genome Project came an onslaught of novel medical technology that was based on the newly available human genetic data [37]. A current goal of genetic and genomic research is the identification of panels of SNPs that can be associated with complex common diseases, to better understand which populations are at risk of developing specific health conditions (e.g., colorectal cancer) [38]. Additionally, next generation sequencing technologies have advanced from whole-genome to whole-exome sequencing (WGS/WES) to better identify DNA variants that are associated with disease [39]. Likewise, genomewide association studies analyze the relationship between the distribution of SNPs and disease outcomes among distinct human populations worldwide [40]. Given these advanced technologies, several genomic catalogs currently serve as complementary resources to the Online Mendelian Inheritance in Man database ( including the Human HapMap Project, the 1000 Genome Project, the Human Gene Mutation Database, and, most recently, the reference genes of the Human Gut Microbiome Project and Human Epigenome Project [41,42]. Furthermore, current research is focused on integrating these different genomic datasets to aid in the discovery of associations between genetic variants, expression quantitative trait loci (eqtls), and disease phenotypes [43]. Altogether, these findings have had great impact on the practice of medicine and will continue to do so as we better refine disease prevention and treatment strategies based on the genome/environmental interactions that occur on the level of each individual, hence the term personalized medicine [44]. ENVIRONMENTAL FACTORS Among numerous environmental factors, diet, physical activity, and emotional state may all serve to modulate man s genetic susceptibility to chronic disease. Diet The ingestion of unhealthy food is one of the main factors associated with chronic disease. As discussed above, these diseases often begin at a young age, as an individual begins to become overweight, and then progress in response to obesity. Over the past 30 years, people in modern societies worldwide have acquired unhealthy lifestyle habits such as spending increasing amounts of time engaging in activities requiring very little energy expenditure and engaging in less exercise than before [45]. Additionally, the majority of obese patients have a high intake of calories in conjunction with reduced energy expenditure. If one 8231 July 21, 2015 Volume 21 Issue 27

26 Roman S et al. Genomic medicine in gastroenterology considers obesity to be a mismatched disease [17] it is easy to understand how young people with unhealthy food habits gradually gain weight over their lifetimes, eventually leading to the development of specific dyslipidemias. Dyslipidemia may be a primary or secondary lipid disorder; the former is gene-related and the latter is associated with the eating habits of an individual or a population [46]. Dyslipidemia that presents in the form of hypertriglyceridemia represents a critical risk factor for the development of insulin resistance and liver fibrosis [47], whereas hypercholesterolemia is associated with cardiovascular disease [48]. Furthermore, these altered metabolic states are associated with glucotoxicity and lipotoxicity in target organs, in addition to systematic inflammation that further deteriorates bodily health [49]. Global rates of obesity have risen dramatically, and Mexico has one of the world s highest proportions of overweight and obese adults [50]. Genetically, Mexicans are both ApoE2 and ApoE4 carriers according to the population s ancestral background [51]. The former has been associated with hypertriglyceridemia and the latter has been associated with hypercholesterolemia. Unhealthy Mexican diets are also hepatopathogenic because they consist of large quantities of simple carbohydrates and saturated animal fats and are low in fiber, vitamins and minerals [52,53]. The chronic consumption of this type of diet in conjunction with the genetic makeup of the population offers an explanation for the high prevalence of hypertriglyceridemia, hypercholesterolemia, and mixed dyslipidemia within Mexico, each of which are in turn risk factors for further metabolic complications [54]. With regard to the link between diet and inflammation, research into how the gut microbiome impacts health and disease has become a rapidly growing field [55,56]. Among the multiple causes of obesity and obesity-associated chronic diseases is the shift in dietary preferences from traditional/ethnic staple foods to more processed/industrial foodstuffs, a change which has altered the natural microbiome [50]. These foods have a high energy density and lack the natural and vital ingredients that act as antioxidants, which limits their capacity to inhibit inflammation and potentially prevent liver fibrosis. Furthermore, this so-called Western diet has been associated with an increased rate of food allergies [57], Crohn s disease [58], ulcerative colitis [59], gastritis and gastroesophageal reflux disease [60]. Many of these conditions can be avoided if we focus on the relationship between health and the microbiota [61,62]. Physical activity All activity generates some degree of caloric expenditure; thus any person that is not resting in a bed (sleeping) is undergoing some caloric expenditure through physical activity. However, routine physical activity must be differentiated from exercise, which is defined as a physical activity that is performed systematically in a timely manner [63]. Engaging in physical activity is another important factor toward maintaining good general health. There was once a myth among patients and physicians that those suffering from viral hepatitis just needed to rest and eat plenty of sweets. Currently, patients with NASH can reverse liver damage during the early stages of fibrosis by ensuring that they are of healthy weight, or alternatively by losing 10% of their original body weight over the course of six months [64]. This may be achieved by instructing the patient to increase physical activity or formally exercise, in addition to adopting a low-calorie diet. It is important to note that it is unlikely that the patient will succeed in losing weight if the indicated diet is not prescribed together with physical activity or exercise [65]. Regular exercise and/or increased physical activity may improve insulin sensitivity and cause significant metabolic changes in the lipid and glucose profiles of patients with initial or on-going chronic disease [66]. Additionally, physical activity can counteract low metabolic rates, improve the cardiovascular system, and promote a faster rate of weight loss than diet alone, in addition to promoting a feeling of well-being and alleviating psychological stress [66]. Emotions Studies of the impact of emotions and spirituality on physical health make up a qualitative field of medical research that has been almost completely disregarded by health professionals [2,14]. Spiritual issues are mainly attended to by religious leaders, while altered states of emotional and mental health are the purview of psychologists and psychiatrists. However, with recent advances in molecular biology and the development of genomic medicine we can now begin to link genes to emotions. For instance, several polymorphisms may influence the response of an individual to the environment and thus influence an individual s response to different emotions. One such example is the Val 158 Met polymorphism of the catechol-omethyltransferase gene, which metabolizes dopamine and norepinephrine. The Met 158 polymorphism encodes an unstable enzyme that increases the levels of dopamine in the prefrontal cortex generating a worrier personality type whereas the Val 158 allele can generate a warrior personality type [67]. Individuals with the warrior Val 158 allele perform worse on memory tests and at work, and in terms of executive cognition. Furthermore, individuals with the warrior Val 158 allele tend to have stronger emotions, reduced pain thresholds and an increased resistance to stress [67]. Overall, the worldwide adoption of healthier lifestyle habits has proven to be a difficult undertaking. Many factors are involved in the lack of compliance in 8232 July 21, 2015 Volume 21 Issue 27

27 Roman S et al. Genomic medicine in gastroenterology Nutrigenetics IL-28 Antiviral/HCV Treatment Emotions PNPLA3 LyPLAL1 NASH ApoE DM2 Health Disease ADH CYP2E1 ALDH DRD2 Alcoholism Spirituality Pharmacogenetics Intrauterine development Physical activity Nutrients Infections Figure 6 Genomic medicine: Interaction between specific polymorphisms with clinical implications and different environmental factors. Diseaserelated gene polymorphisms: IL-28: Interleukin 28B; PNPLA3: Patatin-like phospholipase domain-containing protein 3; LyPLAL1: lysophospholipase-like 1; ApoE: Apolipoprotein E; ADH: Alcohol dehydrogenase; CYP2E1: Cytochrome P450 2E1; ALDH: Aldehyde dehydrogenase; DRD2: Dopamine receptor D2. NASH: Nonalcoholic steatohepatitis; DM2: Type 2 diabetes mellitus. following medical indications on how to regain health. However, with regard to obesity, as is the case with any chronic disease, health professionals might be better at motivating more patients if they personally act to acquire healthier lifestyle habits, thus leading by example. FINAL CONSIDERATIONS From bench to bedside Genomic medicine was once believed to be a promise of science fiction that would never progress into an actual practice; however, numerous medical disciplines have recently found applications to using this medical approach. For instance, individualized medicine has arisen in the clinical practices of gastroenterology and hepatology [68]. Several SNPs have been proposed that are believed to influence whether an alcoholic patient is either resistant or sensitive to liver damage [26]. Additionally, genes that control alcohol metabolism, genes that control addiction, and, more recently, genes which influence an individual to favor the taste of alcohol are all currently under investigation [26,69,70]. Several genes have been identified that influence the susceptibility of an individual to liver damage, which may explain why not all patients who are overweight or obese will develop NASH. Additionally, there are various genes that have been proposed to serve as genetic markers to help identify patients that may develop liver damage faster and more severely than others, who appear to tolerate liver damage for long periods of time [29,71]. In the first group the presence of hepatocellular carcinoma is usually very rare [30], whereas in the second group it is more prevalent. Finally, there are genes that have been found to be associated with sustained viral responses in patients being treated with antiviral therapy for viral hepatitis C [72]. Additionally, because many chronic diseases are related to nutrition, nutritional genomics has provided a new scope for the dietary management of these diseases [73]. As in the paradigm of personalized medicine, practitioners of nutritional genomics recommend a diet plan based on an individual s genetic profile, in addition to the principles of conventional diet therapy and lifestyle modifications [50]. Furthermore, differences in the food preferences and types of food consumed between different populations are also considered to have evolved in response to gene-nutrient interactions [50]. Currently, nutritional genomic research is unraveling the evolutionary aspects that have influenced the selection of genes that cause modern-day chronic diseases [50,73-75]. As shown in Figure 6, this integrated approach of genomic medicine provides a new medical paradigm for disease prevention and treatment. Perspectives Any scientific knowledge that causes a paradigm shift should eventually modify university curriculums. All professionals in the field of health science should strive to stay updated in their field, and genomic medicine is at present a reality. Thus, changes in curricula for medical and other health sciences students, residents and health professionals are only the beginning [76,77]. Furthermore, issues regarding the ethical, legal and social implications of human genomics in many fields of medicine, including gastroenterology, remain unresolved 8233 July 21, 2015 Volume 21 Issue 27

28 Roman S et al. Genomic medicine in gastroenterology and controversial [38]. Although pre-test genetic counseling is formally handled by clinical geneticists, the delivery of genetic results by gastroenterologists and hepatologists may present a challenge that requires the acquisition of new training skills. Therefore, whether using genomic medicine in the field of gastroenterology is a new approach or a new medical specialty remains an open question. Any decision made with regard to that matter will require the mutual work of educational and governmental authorities with public health professionals, with the goal of translating the knowledge generated in the field of genomic medicine (gene discovery and geneenvironmental associations) into better health policies. REFERENCES 1 Subbarayappa BV. The roots of ancient medicine: an historical outline. J Biosci 2001; 26: [PMID: DOI: /BF ] 2 Panduro A. Evolución de la medicina científica: dogmas, mitos y realidades. In: Panduro A, Ed. Biología molecular en la clínica. 2da Ed. México, D.F: McGraw Hill, 2012: Ventegodt S, Thegler S, Andreasen T, Struve F, Jacobsen S, Torp M, Aegedius H, Enevoldsen L, Merrick J. A review and integrative analysis of ancient holistic character medicine systems. ScientificWorldJournal 2007; 7: [PMID: DOI: /tsw ] 4 Mao JJ, Kapur R. Acupuncture in primary care. Prim Care 2010; 37: [PMID: DOI: /j.pop ] 5 Dhruva A, Hecht FM, Miaskowski C, Kaptchuk TJ, Bodeker G, Abrams D, Lad V, Adler SR. Correlating traditional Ayurvedic and modern medical perspectives on cancer: results of a qualitative study. J Altern Complement Med 2014; 20: [PMID: DOI: /acm ] 6 Descartes R. Discourse on method and meditations on first philosophy. 4th Ed. Indianapolis: Hackett Publishing Company, 1999: González Hernández A, Domínguez Rodríguez MV, Fabre Pi O, Cubero González A. [Descartes influence on the development of the anatomoclinical method]. Neurologia 2010; 25: [PMID: DOI: /j.nrl ] 8 Looking back on the millennium in medicine. N Engl J Med 2000; 342: [PMID: DOI: / NEJM ] 9 Watson JD, Crick FH. Genetical implications of the structure of deoxyribonucleic acid. Nature 1953; 171: [PMID: DOI: /171964b0] 10 Portin P. Historical development of the concept of the gene. J Med Philos 2002; 27: [PMID: DOI: / jmep ] 11 Balbás P, Soberón X, Merino E, Zurita M, Lomeli H, Valle F, Flores N, Bolivar F. Plasmid vector pbr322 and its specialpurpose derivatives--a review. Gene 1986; 50: 3-40 [PMID: DOI: / (86) ] 12 Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA, Gocayne JD, Amanatides P, Ballew RM, Huson DH, Wortman JR, Zhang Q, Kodira CD, Zheng XH, Chen L, Skupski M, Subramanian G, Thomas PD, Zhang J, Gabor Miklos GL, Nelson C, Broder S, Clark AG, Nadeau J, McKusick VA, Zinder N, Levine AJ, Roberts RJ, Simon M, Slayman C, Hunkapiller M, Bolanos R, Delcher A, Dew I, Fasulo D, Flanigan M, Florea L, Halpern A, Hannenhalli S, Kravitz S, Levy S, Mobarry C, Reinert K, Remington K, Abu- Threideh J, Beasley E, Biddick K, Bonazzi V, Brandon R, Cargill M, Chandramouliswaran I, Charlab R, Chaturvedi K, Deng Z, Di Francesco V, Dunn P, Eilbeck K, Evangelista C, Gabrielian AE, Gan W, Ge W, Gong F, Gu Z, Guan P, Heiman TJ, Higgins ME, Ji RR, Ke Z, Ketchum KA, Lai Z, Lei Y, Li Z, Li J, Liang Y, Lin X, Lu F, Merkulov GV, Milshina N, Moore HM, Naik AK, Narayan VA, Neelam B, Nusskern D, Rusch DB, Salzberg S, Shao W, Shue B, Sun J, Wang Z, Wang A, Wang X, Wang J, Wei M, Wides R, Xiao C, Yan C, Yao A, Ye J, Zhan M, Zhang W, Zhang H, Zhao Q, Zheng L, Zhong F, Zhong W, Zhu S, Zhao S, Gilbert D, Baumhueter S, Spier G, Carter C, Cravchik A, Woodage T, Ali F, An H, Awe A, Baldwin D, Baden H, Barnstead M, Barrow I, Beeson K, Busam D, Carver A, Center A, Cheng ML, Curry L, Danaher S, Davenport L, Desilets R, Dietz S, Dodson K, Doup L, Ferriera S, Garg N, Gluecksmann A, Hart B, Haynes J, Haynes C, Heiner C, Hladun S, Hostin D, Houck J, Howland T, Ibegwam C, Johnson J, Kalush F, Kline L, Koduru S, Love A, Mann F, May D, McCawley S, McIntosh T, McMullen I, Moy M, Moy L, Murphy B, Nelson K, Pfannkoch C, Pratts E, Puri V, Qureshi H, Reardon M, Rodriguez R, Rogers YH, Romblad D, Ruhfel B, Scott R, Sitter C, Smallwood M, Stewart E, Strong R, Suh E, Thomas R, Tint NN, Tse S, Vech C, Wang G, Wetter J, Williams S, Williams M, Windsor S, Winn-Deen E, Wolfe K, Zaveri J, Zaveri K, Abril JF, Guigó R, Campbell MJ, Sjolander KV, Karlak B, Kejariwal A, Mi H, Lazareva B, Hatton T, Narechania A, Diemer K, Muruganujan A, Guo N, Sato S, Bafna V, Istrail S, Lippert R, Schwartz R, Walenz B, Yooseph S, Allen D, Basu A, Baxendale J, Blick L, Caminha M, Carnes-Stine J, Caulk P, Chiang YH, Coyne M, Dahlke C, Mays A, Dombroski M, Donnelly M, Ely D, Esparham S, Fosler C, Gire H, Glanowski S, Glasser K, Glodek A, Gorokhov M, Graham K, Gropman B, Harris M, Heil J, Henderson S, Hoover J, Jennings D, Jordan C, Jordan J, Kasha J, Kagan L, Kraft C, Levitsky A, Lewis M, Liu X, Lopez J, Ma D, Majoros W, McDaniel J, Murphy S, Newman M, Nguyen T, Nguyen N, Nodell M, Pan S, Peck J, Peterson M, Rowe W, Sanders R, Scott J, Simpson M, Smith T, Sprague A, Stockwell T, Turner R, Venter E, Wang M, Wen M, Wu D, Wu M, Xia A, Zandieh A, Zhu X. The sequence of the human genome. Science 2001; 291: [PMID: DOI: /science ] 13 Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, Stange-Thomann N, Stojanovic N, Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J, Clee C, Carter N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R, French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C, McMurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M, Shownkeen R, Sims S, Waterston RH, Wilson RK, Hillier LW, McPherson JD, Marra MA, Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC, Delehaunty KD, Miner TL, Delehaunty A, Kramer JB, Cook LL, Fulton RS, Johnson DL, Minx PJ, Clifton SW, Hawkins T, Branscomb E, Predki P, Richardson P, Wenning S, Slezak T, Doggett N, Cheng JF, Olsen A, Lucas S, Elkin C, Uberbacher E, Frazier M, Gibbs RA, Muzny DM, Scherer SE, Bouck JB, Sodergren EJ, Worley KC, Rives CM, Gorrell JH, Metzker ML, Naylor SL, Kucherlapati RS, Nelson DL, Weinstock GM, Sakaki Y, Fujiyama A, Hattori M, Yada T, Toyoda A, Itoh T, Kawagoe C, Watanabe H, Totoki Y, Taylor T, Weissenbach J, Heilig R, Saurin W, Artiguenave F, Brottier P, Bruls T, Pelletier E, Robert C, Wincker P, Smith DR, Doucette- Stamm L, Rubenfield M, Weinstock K, Lee HM, Dubois J, Rosenthal A, Platzer M, Nyakatura G, Taudien S, Rump A, Yang H, Yu J, Wang J, Huang G, Gu J, Hood L, Rowen L, Madan A, Qin S, Davis RW, Federspiel NA, Abola AP, Proctor MJ, Myers RM, Schmutz J, Dickson M, Grimwood J, Cox DR, Olson MV, Kaul R, Raymond C, Shimizu N, Kawasaki K, Minoshima S, Evans GA, Athanasiou M, Schultz R, Roe BA, Chen F, Pan H, Ramser J, Lehrach H, Reinhardt R, McCombie WR, de la Bastide 8234 July 21, 2015 Volume 21 Issue 27

29 Roman S et al. Genomic medicine in gastroenterology M, Dedhia N, Blöcker H, Hornischer K, Nordsiek G, Agarwala R, Aravind L, Bailey JA, Bateman A, Batzoglou S, Birney E, Bork P, Brown DG, Burge CB, Cerutti L, Chen HC, Church D, Clamp M, Copley RR, Doerks T, Eddy SR, Eichler EE, Furey TS, Galagan J, Gilbert JG, Harmon C, Hayashizaki Y, Haussler D, Hermjakob H, Hokamp K, Jang W, Johnson LS, Jones TA, Kasif S, Kaspryzk A, Kennedy S, Kent WJ, Kitts P, Koonin EV, Korf I, Kulp D, Lancet D, Lowe TM, McLysaght A, Mikkelsen T, Moran JV, Mulder N, Pollara VJ, Ponting CP, Schuler G, Schultz J, Slater G, Smit AF, Stupka E, Szustakowski J, Thierry-Mieg D, Thierry-Mieg J, Wagner L, Wallis J, Wheeler R, Williams A, Wolf YI, Wolfe KH, Yang SP, Yeh RF, Collins F, Guyer MS, Peterson J, Felsenfeld A, Wetterstrand KA, Patrinos A, Morgan MJ, de Jong P, Catanese JJ, Osoegawa K, Shizuya H, Choi S, Chen YJ. Initial sequencing and analysis of the human genome. Nature 2001; 409: [PMID: DOI: / ] 14 Panduro A, Zepeda-Carrillo EA. De los genes a las emociones y a la espiritualidad. In: Panduro A, Ed. Biología molecular en la clínica. 2da Ed. México, D.F: McGraw Hill, 2012: Mabry PL, Olster DH, Morgan GD, Abrams DB. Interdisciplinarity and systems science to improve population health: a view from the NIH Office of Behavioral and Social Sciences Research. Am J Prev Med 2008; 35: S211-S224 [PMID: DOI: /j.amepre ] 16 Aldhous P. Genomics. Beyond the book of life. Nature 2000; 408: [PMID: DOI: / ] 17 Lieberman DE. The story of the human body: Evolution, health and disease. New York: Random House, 2013: Loscalzo J, Kohane I, Barabasi AL. Human disease classification in the postgenomic era: a complex systems approach to human pathobiology. Mol Syst Biol 2007; 3: 124 [PMID: DOI: /msb ] 19 Manolio TA, Chisholm RL, Ozenberger B, Roden DM, Williams MS, Wilson R, Bick D, Bottinger EP, Brilliant MH, Eng C, Frazer KA, Korf B, Ledbetter DH, Lupski JR, Marsh C, Mrazek D, Murray MF, O Donnell PH, Rader DJ, Relling MV, Shuldiner AR, Valle D, Weinshilboum R, Green ED, Ginsburg GS. Implementing genomic medicine in the clinic: the future is here. Genet Med 2013; 15: [PMID: DOI: /gim ] 20 Bio*Medical Informatics and Genomic Medicine: Research and Training. J Biomed Inform 2007; 40: 1-4 [PMID: DOI: /j.jbi ] 21 Louie B, Mork P, Martin-Sanchez F, Halevy A, Tarczy-Hornoch P. Data integration and genomic medicine. J Biomed Inform 2007; 40: 5-16 [PMID: DOI: /j.jbi ] 22 Webber L, Kilpi F, Marsh T, Rtveladze K, Brown M, McPherson K. High rates of obesity and non-communicable diseases predicted across Latin America. PLoS One 2012; 7: e39589 [PMID: DOI: /journal.pone ] 23 Barquera S, Campos-Nonato I, Aguilar-Salinas C, Lopez-Ridaura R, Arredondo A, Rivera-Dommarco J. Diabetes in Mexico: cost and management of diabetes and its complications and challenges for health policy. Global Health 2013; 9: 3 [PMID: DOI: / ] 24 Lazaridis KN, McAllister TM, Babovic-Vuksanovic D, Beck SA, Borad MJ, Bryce AH, Chanan-Khan AA, Ferber MJ, Fonseca R, Johnson KJ, Klee EW, Lindor NM, McCormick JB, McWilliams RR, Parker AS, Riegert-Johnson DL, Rohrer Vitek CR, Schahl KA, Schultz C, Stewart K, Then GC, Wieben ED, Farrugia G. Implementing individualized medicine into the medical practice. Am J Med Genet C Semin Med Genet 2014; 166C: [PMID: DOI: /ajmg.c.31387] 25 Panduro A, Maldonado-Gonzalez M, Fierro NA, Roman S. Distribution of HBV genotypes F and H in Mexico and Central America. Antivir Ther 2013; 18: [PMID: DOI: /IMP2605] 26 Roman S, Zepeda-Carrillo EA, Moreno-Luna LE, Panduro A. Alcoholism and liver disease in Mexico: genetic and environmental factors. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i ] 27 Roman S, Panduro A, Aguilar-Gutierrez Y, Maldonado M, Vazquez-Vandyck M, Martinez-Lopez E, Ruiz-Madrigal B, Hernandez-Nazara Z. A low steady HBsAg seroprevalence is associated with a low incidence of HBV-related liver cirrhosis and hepatocellular carcinoma in Mexico: a systematic review. Hepatol Int 2009; 3: [PMID: DOI: / s ] 28 Roman S, Jose-Abrego A, Fierro NA, Escobedo-Melendez G, Ojeda-Granados C, Martinez-Lopez E, Panduro A. Hepatitis B virus infection in Latin America: a genomic medicine approach. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] 29 Hernández-Nazará ZH, Ruiz-Madrigal B, Martínez-López E, Roman S, Panduro A. Association of the epsilon 2 allele of APOE gene to hypertriglyceridemia and to early-onset alcoholic cirrhosis. Alcohol Clin Exp Res 2008; 32: [PMID: DOI: /j x] 30 Roman S, Fierro NA, Moreno-Luna LE, Panduro A. Hepatitis B virus genotype H and environmental factors associated to the low prevalence of hepatocellular carcinoma in Mexico. J Cancer Ther 2013; 4: [DOI: /jct A044] 31 van den Berg MM, van Maarle MC, van Wely M, Goddijn M. Genetics of early miscarriage. Biochim Biophys Acta 2012; 1822: [PMID: DOI: /j.bbadis ] 32 Genetic Alliance, the New England Public Health Genetics Education Collaborative. Understanding Genetics: A New England Guide for Patients and Health Professionals. Washington (DC): Genetic Alliance: Available from: URL: nlm.nih.gov/books/nbk132168/ 33 National Center for Advancing Translational Sciences. Office of Rare Diseases Research. Available from: URL: info.nih.gov/ 34 Loos RJ. Recent progress in the genetics of common obesity. Br J Clin Pharmacol 2009; 68: [PMID: DOI: /j x] 35 Silva-Zolezzi I, Hidalgo-Miranda A, Estrada-Gil J, Fernandez- Lopez JC, Uribe-Figueroa L, Contreras A, Balam-Ortiz E, del Bosque-Plata L, Velazquez-Fernandez D, Lara C, Goya R, Hernandez-Lemus E, Davila C, Barrientos E, March S, Jimenez- Sanchez G. Analysis of genomic diversity in Mexican Mestizo populations to develop genomic medicine in Mexico. Proc Natl Acad Sci USA 2009; 106: [PMID: DOI: /pnas ] 36 Bentley DR. The Human Genome Project--an overview. Med Res Rev 2000; 20: [PMID: DOI: /(SICI) (200005)20] 37 Wilson BJ, Nicholls SG. The Human Genome Project, and recent advances in personalized genomics. Risk Manag Healthc Policy 2015; 8: 9-20 [PMID: DOI: /RMHP.S58728] 38 Altshuler D, Daly MJ, Lander ES. Genetic mapping in human disease. Science 2008; 322: [PMID: DOI: /science ] 39 van El CG, Cornel MC, Borry P, Hastings RJ, Fellmann F, Hodgson SV, Howard HC, Cambon-Thomsen A, Knoppers BM, Meijers-Heijboer H, Scheffer H, Tranebjaerg L, Dondorp W, de Wert GM. Whole-genome sequencing in health care: recommendations of the European Society of Human Genetics. Eur J Hum Genet 2013; 21: [PMID: DOI: / ejhg ] 40 Manry J, Quintana-Murci L. A genome-wide perspective of human diversity and its implications in infectious disease. Cold Spring Harb Perspect Med 2013; 3: a [PMID: DOI: /cshperspect.a012450] 41 Naidoo N, Pawitan Y, Soong R, Cooper DN, Ku CS. Human genetics and genomics a decade after the release of the draft sequence of the human genome. Hum Genomics 2011; 5: [PMID: DOI: / ] 42 Abubucker S, Segata N, Goll J, Schubert AM, Izard J, Cantarel 8235 July 21, 2015 Volume 21 Issue 27

30 Roman S et al. Genomic medicine in gastroenterology BL, Rodriguez-Mueller B, Zucker J, Thiagarajan M, Henrissat B, White O, Kelley ST, Methé B, Schloss PD, Gevers D, Mitreva M, Huttenhower C. Metabolic reconstruction for metagenomic data and its application to the human microbiome. PLoS Comput Biol 2012; 8: e [PMID: DOI: /journal. pcbi ] 43 Kabakchiev B, Silverberg MS. Expression quantitative trait loci analysis identifies associations between genotype and gene expression in human intestine. Gastroenterology 2013; 144: , 1496.e e3 [PMID: DOI: / j.gastro ] 44 Epstein CJ. Medical genetics in the genomic medicine of the 21st century. Am J Hum Genet 2006; 79: [PMID: DOI: /507610] 45 Hamilton MT, Hamilton DG, Zderic TW. Role of low energy expenditure and sitting in obesity, metabolic syndrome, type 2 diabetes, and cardiovascular disease. Diabetes 2007; 56: [PMID: DOI: /db ] 46 Pejic RN, Lee DT. Hypertriglyceridemia. J Am Board Fam Med 2006; 19: [PMID: DOI: /jabfm ] 47 Berlanga A, Guiu-Jurado E, Porras JA, Auguet T. Molecular pathways in non-alcoholic fatty liver disease. Clin Exp Gastroenterol 2014; 7: [PMID: DOI: /CEG.S62831] 48 Banerjee S, Kahali D, Banerjee A, Brilakis ES. LDL cholesterol: should guidelines include targets? Expert Rev Cardiovasc Ther 2014; 12: [PMID: DOI: / ] 49 Peverill W, Powell LW, Skoien R. Evolving concepts in the pathogenesis of NASH: beyond steatosis and inflammation. Int J Mol Sci 2014; 15: [PMID: DOI: / ijms ] 50 Roman S, Ojeda-Granados C, Ramos-Lopez O, Panduro A. Genome-based nutrition: an intervention strategy for the prevention and treatment of obesity and nonalcoholic steatohepatitis. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 51 Aceves D, Ruiz B, Nuño P, Roman S, Zepeda E, Panduro A. Heterogeneity of apolipoprotein E polymorphism in different Mexican populations. Hum Biol 2006; 78: [PMID: DOI: /hub ] 52 Ramos-Lopez O, Román S, Ojeda-Granados C, Sepúlveda- Villegas M, Martínez-López E, Torres-Valadez R, Trujillo-Trujillo E, Panduro A. Patrón de ingesta alimentaria y actividad física en pacientes hepatópatas en el Occidente de México. Rev Endocrinol Nutr 2013; 21: Aguilar-Salinas CA, Olaiz G, Valles V, Torres JM, Gómez Pérez FJ, Rull JA, Rojas R, Franco A, Sepulveda J. High prevalence of low HDL cholesterol concentrations and mixed hyperlipidemia in a Mexican nationwide survey. J Lipid Res 2001; 42: [PMID: ] 54 Mathus-Vliegen L, Toouli J, Fried M, Khan AG, Garisch J, Hunt R, Fedail S, Štimac D, Lemair T, Krabshuis J, Kaufmann P, Roberts E, Riccardi G. World Gastroenterology Organisation global guidelines on obesity. J Clin Gastroenterol 2012; 46: [PMID: DOI: /MCG.0b013e318259bd04] 55 Konkel L. The environment within: exploring the role of the gut microbiome in health and disease. Environ Health Perspect 2013; 121: A276-A281 [PMID: DOI: /ehp.121-a276] 56 Lee YK. Effects of diet on gut microbiota profile and the implications for health and disease. Biosci Microbiota Food Health 2013; 32: 1-12 [PMID: DOI: /bmfh.32.1] 57 Legatzki A, Rösler B, von Mutius E. Microbiome diversity and asthma and allergy risk. Curr Allergy Asthma Rep 2014; 14: 466 [PMID: DOI: /s ] 58 Stasi C, Orlandelli E. Role of the brain-gut axis in the pathophysiology of Crohn s disease. Dig Dis 2008; 26: [PMID: ] 59 Collins SM, Bercik P. The relationship between intestinal microbiota and the central nervous system in normal gastrointestinal function and disease. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 60 Preidis GA, Versalovic J. Targeting the human microbiome with antibiotics, probiotics, and prebiotics: gastroenterology enters the metagenomics era. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 61 Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001; 292: [PMID: DOI: /science ] 62 Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host-bacterial mutualism in the human intestine. Science 2005; 307: [PMID: DOI: /science ] 63 Luís Griera J, María Manzanares J, Barbany M, Contreras J, Amigó P, Salas-Salvadó J. Physical activity, energy balance and obesity. Public Health Nutr 2007; 10: [PMID: DOI: /S ] 64 Glass LM, Dickson RC, Anderson JC, Suriawinata AA, Putra J, Berk BS, Toor A. Total body weight loss of 10 % is associated with improved hepatic fibrosis in patients with nonalcoholic steatohepatitis. Dig Dis Sci 2015; 60: [PMID: DOI: /s ] 65 Donnelly JE, Blair SN, Jakicic JM, Manore MM, Rankin JW, Smith BK. American College of Sports Medicine Position Stand. Appropriate physical activity intervention strategies for weight loss and prevention of weight regain for adults. Med Sci Sports Exerc 2009; 41: [PMID: DOI: / MSS.0b013e ] 66 Vázquez-Vandyck M, Roman S, Vázquez JL, Huacuja L, Khalsa G, Troyo-Sanromán R, Panduro A. Effect of Breathwalk on body composition, metabolic and mood state in chronic hepatitis C patients with insulin resistance syndrome. World J Gastroenterol 2007; 13: [PMID: DOI: /wjg ] 67 Stein DJ, Newman TK, Savitz J, Ramesar R. Warriors versus worriers: the role of COMT gene variants. CNS Spectr 2006; 11: [PMID: ] 68 Lazaridis KN, Juran BD. American Gastroenterological Association future trends committee report: the application of genomic and proteomic technologies to digestive disease diagnosis and treatment and their likely impact on gastroenterology clinical practice. Gastroenterology 2005; 129: [PMID: DOI: /j.gastro ] 69 Ducci F, Goldman D. Genetic approaches to addiction: genes and alcohol. Addiction 2008; 103: [PMID: DOI: /j x] 70 Ramos-Lopez O, Roman S, Martinez-Lopez E, Gonzalez- Aldaco K, Ojeda-Granados C, Sepulveda-Villegas M, Panduro A. Association of a novel TAS2R38 haplotype with alcohol intake among Mexican-Mestizo population. Annals Hepatol 2015; In press 71 Sookoian S, Pirola CJ. Liver enzymes, metabolomics and genomewide association studies: from systems biology to the personalized medicine. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i3.711] 72 Fierro NA, Gonzalez-Aldaco K, Torres-Valadez R, Martinez- Lopez E, Roman S, Panduro A. Immunologic, metabolic and genetic factors in hepatitis C virus infection. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20. i ] 73 Gibney MJ, Walsh MC. The future direction of personalised nutrition: my diet, my phenotype, my genes. Proc Nutr Soc 2013; 72: [PMID: DOI: /S ] 74 Minich DM, Bland JS. Personalized lifestyle medicine: relevance for nutrition and lifestyle recommendations. ScientificWorldJournal 2013; 2013: [PMID: DOI: /2013/129841] 75 Fenech M, El-Sohemy A, Cahill L, Ferguson LR, French TA, Tai ES, Milner J, Koh WP, Xie L, Zucker M, Buckley M, Cosgrove L, Lockett T, Fung KY, Head R. Nutrigenetics and nutrigenomics: viewpoints on the current status and applications in nutrition research and practice. J Nutrigenet Nutrigenomics 2011; 4: July 21, 2015 Volume 21 Issue 27

31 Roman S et al. Genomic medicine in gastroenterology [PMID: DOI: / ] 76 Panduro A, Roman S, Escobedo G. Medicina genómica y hepatologíca. Investigación en Salud 2006; 8: Román-Maldonado SM, Panduro A. Medicina genómica: Curriculum y formación de recursos humanos en salud. Investigación en Salud 2005; 8: P- Reviewer: El-Nezami H, Elpek GO, Sanal MG, Liu ZW S- Editor: Qi Y L- Editor: O Neill M E- Editor: Ma S 8237 July 21, 2015 Volume 21 Issue 27

32 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved Advances in Colorectal Cancer TOPIC HIGHLIGHT CREB-binding protein, p300, butyrate, and Wnt signaling in colorectal cancer Michael Bordonaro, Darina L Lazarova Michael Bordonaro, Darina L Lazarova, Department of Basic Sciences, The Commonwealth Medical College, Scranton, PA 18509, United States Author contributions: Bordonaro M and Lazarova DL both contributed to the concept and writing of the manuscript. Supported by National Institutes of Health (Bethesda, MD) National Cancer Institute, No. 1R15CA Conflict-of-interest statement: The authors have no conflicts of interest. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Michael Bordonaro, PhD, Associate Professor of Molecular Biology, Department of Basic Sciences, The Commonwealth Medical College, 525 Pine Street, Scranton, PA 18509, United States. mbordonaro@tcmedc.org Telephone: Fax: Received: March 30, 2015 Peer-review started: March 31, 2015 First decision: April 23, 2015 Revised: May 2, 2015 Accepted: May 27, 2015 Article in press: May 27, 2015 Published online: July 21, 2015 Abstract This paper reviews the distinctive roles played by the transcriptional coactivators CREB-binding protein (CBP) and p300 in Wnt/β-catenin signaling and cell physiology in colorectal cancer (CRC). Specifically, we focus on the effects of CBP- and p300-mediated Wnt activity on (1) neoplastic progression; (2) the activities of butyrate, a breakdown product of dietary fiber, on cell signaling and colonic cell physiology; (3) the development of resistance to histone deacetylase inhibitors (HDACis), including butyrate and synthetic HDACis, in colonic cells; and (4) the physiology and number of cancer stem cells. Mutations of the Wnt/ β-catenin signaling pathway initiate the majority of CRC cases, and we have shown that hyperactivation of this pathway by butyrate and other HDACis promotes CRC cell apoptosis. This activity by butyrate may in part explain the preventive action of fiber against CRC. However, individuals with a high-fiber diet may still develop neoplasia; therefore, resistance to the chemopreventive action of butyrate likely contributes to CRC. CBP or p300 may modify the ability of butyrate to influence colonic cell physiology since the two transcriptional coactivators affect Wnt signaling, and likely, its hyperactivation by butyrate. Also, CBP and p300 likely affect colonic tumorigenesis, as well as stem cell pluripotency. Improvement of CRC prevention and therapy requires a better understanding of the alterations in Wnt signaling and gene expression that underlie neoplastic progression, stem cell fate, and the development of resistance to butyrate and clinically relevant HDACis. Detailed knowledge of how CBP- and p300 modulate colonic cell physiology may lead to new approaches for anti-crc prevention and therapeutics, particularly with respect to combinatorial therapy of CBP/p300 inhibitors with HDACis. Key words: CREB-binding protein; p300; Wnt; colorectal cancer; butyrate; stem cells The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved July 21, 2015 Volume 21 Issue 27

33 Bordonaro M et al. CBP and p300 in colorectal cancer Core tip: Deregulated Wnt/β-catenin signaling is responsible for initiating most human colorectal cancer (CRC), and hyperactivation of this pathway by histone deacetylase inhibitors such as butyrate, derived from dietary fiber, promotes CRC cell death. The transcriptional cofactors CREB-binding protein (CBP) or p300 affect Wnt signaling and the hyperactivation of this pathway by butyrate. CBP and p300 likely affect colonic tumorigenesis, stem cell fate, and butyrate resistance in CRC. Therefore, pharmacological or genetic methodologies that target CBP- and p300-mediated Wnt activity are possible preventive or therapeutic approaches against CRC. Bordonaro M, Lazarova DL. CREB-binding protein, p300, butyrate, and Wnt signaling in colorectal cancer. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: WNT SIGNALING, BUTYRATE, AND CREB-BINDING PROTEIN /P300 Dietary fiber, colorectal cancer, and Wnt signaling The anti-colorectal cancer (CRC) protective effect [1-5] of dietary fiber has been attributed to its fermentation product butyrate [6-10], a histone deacetylase inhibitor (HDACi) [11]. HDACis, which are current or proposed chemotherapeutic agents, induce apoptosis [1,2,12-14], CRC cell cycle arrest, and/or differentiation in vitro [1,2,15-17]. Deregulated Wnt/β-catenin signaling [18-23], involving β-catenin and Tcf/Lef factors [23,24], is responsible for most CRCs [25-27], and in these cells HDACis hyperactivate the Wnt/β-catenin pathway [1,2,17]. Exciting new findings [18] suggest one mechanism whereby this hyperactivation takes place at Wnt target genes. Thus, the repressor p15rs inhibits Wnt/β-catenin activity by recruiting HDAC2 to Wnt target gene promoters, where it associates with Tcf4 and maintains histone H3 in a deacetylated state. In this scenario, β-catenin- Tcf4 association is disrupted and transcription from Wnt target gene promoters is repressed; HDACis interfere with the activity of p15rs and HDAC2 at these promoters, upregulating canonical Wnt transcriptional activity [18]. Wnt hyperactivation has important consequences for CRC cell physiology. Butyrate and other HDACis induce CRC cell apoptosis, and we have shown that Wnt signaling hyperactivation promotes high levels of apoptosis [1,2,17]. Thus, there is a causative linear relationship between fold-induction of Wnt activity and the degree of apoptosis in CRC cells exposed to butyrate. In agreement with these findings, abrogation of Wnt/β-catenin activity in CRC cells markedly reduces the levels of butyrate-induced apoptosis [1]. To summarize, Wnt/β-catenin signaling, which is deregulated by mutations, leads to moderate Wnt activity levels that promote colonic cell proliferation and tumorigenesis; however, relatively high and relatively low levels of the same signaling activity lead to increased CRC cell apoptosis and repressed cell proliferation [1,2,17,28,29]. CREB-binding protein, p300, butyrate, and Wnt signaling The physical association between β-catenin and the histone acetylases CREB-binding protein (CBP) and p300 [30-34], which are cotranscriptional factors [35-39], influences Wnt/β-catenin signaling [30-33]. CBP-mediated Wnt signaling has been associated with colonic cell proliferation, and p300-mediated Wnt activity promotes differentiation [30-39]. The interaction between CBP and Wnt signaling can be evaluated utilizing the small molecule inhibitor ICG-001 that binds to CBP but not to p300 [30]. ICG-001 downregulates Wnt transcriptional activity in CRC cells by suppressing the association between CBP and β-catenin without blocking p300/ β-catenin association [30]. Treatment of cells with ICG-001 enhances p300/β-catenin association at the expense of CBP/β-catenin association, promoting cellular pathways that favor differentiation and/or apoptosis and repress cell proliferation [30-33]. Thus, ICG-001 inhibits CRC cell proliferation, increases apoptosis as measured by caspase activity, and inhibits expression of the anti-apoptotic factor survivin [30,33]. A water soluble version of ICG-001 reduced the formation of intestinal neoplasms in the APC Min mouse model of CRC [30], and the second generation CBP- Wnt inhibitor PRI-724 is in clinical trials [31,40]. Thus, although CBP and p300 have pleiotropic effects on gene expression and cell physiology, these findings clearly indicate differential roles for CBP- and p300- mediated Wnt signaling in colonic cell physiology. In summary, these studies suggest that Wnt signaling can be divided into CBP-mediated and p300-mediated components, with CBP-Wnt activity promoting cell proliferation, while p300-wnt activity is associated with cell differentiation and, possibly, apoptosis. HDACis are promising agents against malignancies [15,16], including CRC. In addition to the already recognized therapeutic uses of synthetic HDACis, the production of the HDACi butyrate from dietary fiber in the human colon and the effects of butyrate on CRC cells suggest that dietary HDACis play a role in CRC prevention [1,2,17,28,29]. HDACis may influence the ability of CBP and p300 to modulate Wnt/β-catenin activity and affect colonic cell physiology. Therefore, studies have been conducted to evaluate how CBP and p300 activity influence butyrate-mediated effects on Wnt activity and cell physiology in colonic adenoma and butyrate-sensitive and butyrate-resistant colonic carcinoma cells [41-43]. While all studied human CRC cells expressed 8239 July 21, 2015 Volume 21 Issue 27

34 Bordonaro M et al. CBP and p300 in colorectal cancer CBP [41,42], differences in p300 expression have been detected. Thus, butyrate-sensitive HCT-116 and SW620 CRC cells express p300; butyrate-resistant HCT-R cells, which were derived from HCT-116 cells, do not [41,42]. Treatment with ICG-001, which specifically targets the association of CBP, but not of p300, with β-catenin, inhibited basal and butyrate-induced Wnt signaling in all CRC cell lines studied [41-43]. Both ICG-001 and butyrate were shown to reduce HCT-116 and SW620 cell proliferation; however, ICG-001 interfered with butyrate-induced apoptosis in SW620, but not HCT-116, CRC cells [41]. Butyrate-mediated apoptosis in SW620 cells was reduced by ICG-001, but it was not completely abrogated, since (1) p300- mediated Wnt activity remains intact after treatment with ICG-001 [30] ; and (2) butyrate exerts both Wnt signaling-dependent and Wnt signaling-independent effects on CRC cell apoptosis [1,2]. Most likely, the differential modulation of butyrate-mediated apoptosis by ICG-001 in the CRC cell lines is at least partially due to the relative utilization of CBP-mediated vs p300- mediated Wnt activity in each CRC cell line. Modulation of cell cycle progression and proliferation can also affect apoptosis. Therefore, the differential effects of ICG-001 on butyrate-induced apoptosis in CRC cells could be due to the variable effects of ICG-001/butyrate treatment on cell proliferation, through modulated expression of the cell cycle inhibitor p21 and the anti-apoptotic factor survivin (a gene targeted by CBP-mediated Wnt signaling) [33,41]. Significantly, ICG-001 has more marked effects on proliferation and cell cycle arrest in SW620 cells than in HCT-116 cells, and the effects of butyrate and ICG-001 on p21 and survivin expression differ between these two cell lines [41]. ICG-001 was shown to repress butyrate-induced Wnt activity, and knockdown of p300 with sirna also repressed butyrate-mediated Wnt signaling [42] ; therefore, CBP and p300 activities are both required for the hyperactivation of Wnt signaling by butyrate. It is likely that butyrate upregulates separate CBPand p300-mediated components of Wnt activity, which both contribute to the overall hyperactivation of Wnt signaling observed in butyrate-treated CRC cells. Targeting CBP vs p300 activity can have different effects on butyrate-mediated changes in CRC cell physiology. For example, unlike ICG-001 treatment, partial p300 knockdown did not affect HCT-116 or SW620 CRC cell proliferation in the presence or absence of butyrate [42] ; this lack of effect may be due to differences in the function of CBP and p300 in these cell lines. However, the role of p300 in butyratemediated CRC cell proliferation is likely cell typespecific; thus, findings from CRC cells that naturally lack p300 expression suggest that p300-wnt activity is required for optimal butyrate-mediated repression of cell proliferation (see below) [42]. Thus, upregulation of the specific p300-mediated component of Wnt signaling by butyrate may be responsible for that agent s activity in promoting CRC cell apoptosis, consistent with previous reports that p300-wnt activity is associated with differentiation (and possibly apoptosis), while CBP-Wnt activity is more proproliferative [30-33]. The relative effects of butyrate upregulation of CBP-Wnt vs p300-wnt activities likely determine the final cell fate, and would differ on a celltype dependent basis. Thus, in summary, modulating distinct CBP-mediated and p300-mediated components of Wnt/β-catenin activity (e.g., by ICG-001, sirna, HDACis) may differentially affect CRC cell physiology (e.g., proliferation vs differentiation/apoptosis cell fate) in a cell type-specific manner [41-43]. Combinatorial therapy and effects on apoptosis Both relatively high and low levels of Wnt/β-catenin activity can promote apoptosis of colonic cells with activating mutations in the pathway [1,2,17,28,29]. Interference between butyrate and ICG-001 on apoptosis in certain CRC cells can be explained by the fact that butyrate upregulates Wnt activity; whereas, ICG-001 suppresses that activity. The hyperactivation of Wnt signaling by butyrate is responsible for part, albeit not all, of that agent s ability to promote CRC cell apoptosis [1] ; on the other hand, ICG-001 can activate apoptosis by repressing Wnt activity [30-33]. However, in certain CRC cell lines butyrate and ICG-001 cooperate to enhance Wnt activity-dependent effects on apoptosis and proliferation, and this requires explanation. One possibility is that ICG-001 has both Wnt activity-independent as well as Wnt activity-dependent effects on colonic cell physiology. Thus, one study suggested that ICG-001 may enhance apoptosis in multiple myeloma cells in a Wnt activity-independent manner [44], although that study did not distinguish between the effects of CBP-Wnt and p300-wnt activity. However, it has been shown that in colonic cells ICG-001 has significant Wnt-dependent effects [30-43]. Thus, a Wnt activity-specific mechanism to explain our findings is that ICG-001, a specific inhibitor of CBPmediated Wnt signaling, represses the CBP-mediated Wnt activity required for cell growth; whereas, leaving unaffected p300-mediated Wnt signaling that promotes colonic cell differentiation and apoptosis [41-43]. Further, it is the fold-change in Wnt activity, and not its absolute levels, which correlates to butyrate s effects on cell proliferation and apoptosis [1]. Thus, whereas ICG-001 suppresses the absolute level of Wnt/β-catenin signaling, butyrate retains the ability to induce a fold-increase in Wnt activity even in the presence of ICG-001 [41-43]. Thus, combinatorial treatment of colonic cells with ICG-001 and butyrate inhibits CBP-mediated Wnt signaling, a pathway responsible for cell proliferation, whereas, it maintains fold-induction of p300- mediated Wnt signaling, a pathway that enhances 8240 July 21, 2015 Volume 21 Issue 27

35 Bordonaro M et al. CBP and p300 in colorectal cancer differentiation [30-33] and apoptosis in certain cell types [41-43]. On the other hand, in butyrate-resistant CRC cells in which butyrate does not increase Wnt signaling levels and does not induce apoptosis, ICG- 001-like agents enhance apoptosis [42] by repressing CBP-mediated Wnt activity below the threshold required for CRC cell viability. Finally, both butyrate and ICG-001 can have Wnt-independent, as well as Wntdependent, effects on cell apoptosis and proliferation. Therefore, in some cell lines the Wnt-independent effects of butyrate/hdacis and ICG-001 on apoptosis may be additive while, at the same time, the Wntdependent effects of these agents may counteract each other. ICG-001 and high/low-wnt activity fractions in CRC Modulation of the relative levels of CBP vs p300 activity can affect tumor behavior by influencing the cell populations within a neoplasm. CRC cell populations in culture can be divided into fractions with high and low Wnt activity, and the number of cells with high Wnt activity is increased by butyrate treatment [1,2]. CRC cells with hyperactivated Wnt signaling commit to apoptosis [1,2] ; whereas, cells with moderate but constitutive levels of Wnt signaling have been associated with more aggressive CRC phenotypes [45]. An EGFP reporter for Wnt activity combined with flow cytometry analysis of the transfected cells was utilized to evaluate the effects of ICG-001 treatment on Wnt activity fractions in CRC cell populations. This experimental approach revealed that CBPmediated Wnt signaling is absolutely required for the maintenance of high Wnt activity and low Wnt activity fractions in CRC cell lines, and that ICG-001 abrogates the ability of butyrate to increase the number of CRC cells with high Wnt signaling levels [41]. These findings suggest a possible CRC therapy approach of modulating CBP-mediated Wnt activity in order to transition CRC cells to less tumorigenic types. NEOPLASTIC PROGRESSION Repression of CBP-mediated Wnt/β-catenin activity by ICG-001 has greater effects on butyrate action on apoptosis and proliferation in SW620 cells than in HCT-116 cells [41]. SW620 cells are derived from a CRC metastasis and HCT-116 cells are derived from a primary CRC. One possibility is that CBP-mediated Wnt activity, which is associated with cell proliferation and pluripotency [30-33,40], has a more central role (i.e., it is utilized to a greater extent) in later, advanced stages of neoplastic development. Although studies evaluating different forms of cancer come to variable conclusions about the prognostic value of p300 expression, the most recent study involving colon cancer showed that overexpression of nuclear p300 was associated with a favorable prognosis (disease-free survival rate for patients with colon cancer) [46]. This finding is generally supportive of the general hypothesis that p300-mediated Wnt activity is associated with a lesser degree of neoplastic progression, while CBP-mediated Wnt activity is associated with more aggressive and advanced cancer. The differential effects of CBP and p300 on cell physiology during neoplastic progression may derive from altered expression of genes targeted by CBP-mediated and p300-mediated Wnt activity. For example, survivin, c-myc, and cyclin D1 are all genes targeted by Wnt/β-catenin signaling, and their expression is controlled by the relative levels of CBP vs p300 activity; furthermore, the products of these genes directly influence decisions of proliferation, differentiation, and apoptosis. Thus, survivin expression is stimulated by CBP and repressed by p300, expression of cyclin D1 is stimulated by CBP and unaffected by p300, and expression of c-myc is stimulated by p300 [33]. The anti-apoptotic protein survivin and the pro-proliferative cyclin D1 may mediate more tumorigenic/aggressive cell phenotypes associated with CBP-mediated Wnt activity [30,33]. The role of c-myc expression in the downstream consequences of p300 activity is uncertain, as increased expression of c-myc is usually associated with tumorigenesis. However, c-myc can, in certain contexts, promote differentiation and apoptosis, consistent with the pro-differentiation role suggested for p300-mediated Wnt activity [30,33]. In vitro studies evaluating the effects of butyrate have typically utilized CRC cells; however, diet-derived butyrate is likely most effective against early stage colonic neoplasia [1,2]. In this context, it is important to note that microadenoma LT97 cells, isolated from the earliest stage of colonic neoplasia [3,4], have been found to be extremely sensitive to the growth-suppressing [4] and apoptosis-inducing [43] effects of butyrate. These cells were used to determine the role of CBP- and p300-mediated Wnt signaling in modulating the effects of butyrate. Similar to what was observed in colon carcinoma cells, ICG-001 repressed the butyrateinduced hyperactivation of Wnt signaling in LT97 adenoma cells. Unlike late-stage metastatic SW620 CRC cells, cotreatment of LT97 cells with ICG-001 does not repress butyrate-mediated apoptosis. Proliferation of LT97 cells was more affected by butyrate than by ICG-001, and expression of the anti-apoptotic product of the survivin gene was unaffected by ICG-001 treatment. Differences in apoptotic levels between ICG-001/ butyrate-treated LT97 adenoma cells and metastatic SW620 CRC cells may be due to: (1) the relative role of CBP-mediated and p300-mediated Wnt signaling; and/ or (2) the levels of factors such as survivin (a target gene of CBP-mediated Wnt signaling), p21, and other Wnt signaling-targeted genes. Thus, the repression of butyrate-induced apoptosis in ICG-001 treated SW620 cells, compared to LT97 cells, is consistent with 8241 July 21, 2015 Volume 21 Issue 27

36 Bordonaro M et al. CBP and p300 in colorectal cancer a more prominent role of CBP-mediated Wnt activity in SW620 CRC cells, and a more prominent role of p300- mediated Wnt activity (not affected by ICG-001) in LT97 cells. ICG-001 represses butyrate-induced Wnt transcriptional activity in both SW620 and LT97 cells, and this finding could be reconciled by the possibility that p300-mediated Wnt activity (that is not affected by ICG-001) is utilized to a greater extent in LT97 than in SW620 cells. In addition, the lack of effect of ICG-001 on the expression of survivin, a gene targeted by CBP-mediated Wnt activity [33], in LT97 cells [43] also suggests that CBP-mediated Wnt signaling has a lesser role in these cells compared to later-stage, metastatic SW620 cells. This explanation is supported by the higher RNA expression levels of survivin in SW620 cells compared to LT97 cells, as established by microarray analysis [43]. In addition, exogenous overexpression of CBP stimulates the butyrate-induced hyperactivation of Wnt signaling in LT97 cells [43], but not in SW620 cells [42], a finding that suggests saturation of CBPmediated Wnt activity in SW620 but not in LT97 cells. In summary, findings reported in the literature are consistent with neoplastic progression being affected by the relative role/activity of CBP-mediated and p300-mediated Wnt signaling. This possibility is supported by the following findings: (1) most of the analyzed CRC cell lines express CBP but some do not express p300 [41-43] ; (2) p300-mediated Wnt signaling is associated with cell differentiation; whereas, CBP-mediated Wnt signaling is associated with cell proliferation [30,33] ; (3) CBP is the preferred binding partner for β-catenin in CRC cell lines [30,41] ; (4) expression of survivin, a gene targeted by CBPmediated Wnt activity, is inhibited by ICG-001 in CRC cells but not in LT97 cells, suggesting a greater utilization of CBP-mediated Wnt activity in later stages of colonic neoplasia; and (5) overexpression of CBP in LT97 cells enhances butyrate-induced hyperactivation of Wnt signaling [43] ; whereas, no similar effect is observed in CRC cells [42], suggesting that endogenous CBP-mediated Wnt signaling is saturated in CRC cells, but not in LT97 adenoma cells. In addition, a recent report [47] suggests that CBP can interact with thymine DNA glycosylase to enhance Wnt signaling and proliferation of colonic cells. This finding suggests that it is likely that a number of signaling pathways and enzymatic factors cross-talk with CBP and p300 to influence decisions of proliferation vs differentiation/ apoptosis, and underscores the importance of CBP activity in promoting Wnt activity-driven proliferation of human colon cancer cells. An interpretation of these findings is that a more advanced neoplastic phenotype is characterized by enhanced expression of genes targeted by CBP-mediated Wnt activity (e.g., survivin, cyclin D1). Transcription reporter assays and microarray findings [1,2,45,48,49] clearly have established that HDACis hyperactivate Wnt signaling; however, certain Wnt activity-targeted genes exhibit downregulated expression due to both Wnt signaling-dependent and Wnt signalingindependent mechanisms [45,48,49]. For example, expression of survivin, c-myc, and cyclin D1 is typically repressed in HDACi-treated CRC cells [48]. Therefore, one possibility is that both up- and downregulated expression of Wnt activity-targeted genes in HDACi-treated colonic neoplastic cells is influenced by the relative levels of CBP-mediated vs p300-mediated Wnt activity, and the relative levels of these activities in different colonic cells determine the direction and magnitude of the effects of HDACis on gene expression. These conjectures need to be carefully evaluated in future studies. Such additional studies will require use of other colonic cell lines, particularly those intermediate on the neoplastic spectrum between the LT97 and SW620 lines. Another cell line useful for evaluating neoplastic progression is SW480. The SW480 cell line was derived from a primary tumor from the same patient from whom the SW620 metastatic line was isolated, and we have shown that these two cell lines differ in the degree of response to butyrate [1]. Thus, future studies should utilize cell lines such as SW480, in addition to LT97 and SW620, to further dissect the role of CBP and p300 in colonic tumorigenesis. In general, studies that compare cells from matched primary vs metastatic tumors from the same patient would assist in identifying the roles played by CBP and p300 in neoplastic progression. We would expect that cell lines derived from metastases would exhibit a greater degree of CBP-Wnt activity and less p300-wnt activity compared to matched primary tumor samples from the same patient. Butyrate/HDACis resistance Preliminary analyses of the mechanisms underlying butyrate resistance in CRC cells [49] utilized HCT-R cells that were derived from HCT-116 cells exposed to increasing concentrations of butyrate (up to 5 mmol/l). Microarray and western blot analyses demonstrated altered gene expression in HCT-R cells, compared to HCT-116 cells [47]. Importantly, HCT-R cells exhibit a markedly decreased expression of p300 compared to parental HCT-116 CRC cells. ICG-001, an inhibitor of CBP-mediated Wnt activity, was shown to repress Wnt activity in HCT-R cells, and these cells are highly sensitive to the apoptosis-inducing effects of ICG-001, suggesting that survival of butyrate resistant cells is associated with CBP-mediated Wnt activity. Butyrate does not affect HCT-R cell proliferation, unlike the sharp repression of cell growth caused by the agent in butyrate-sensitive CRC cells expressing p300 [41]. HCT-15 CRC cells that, similar to HCT-R cells, lack expression of p300 also exhibit repressed hyperactivation of Wnt signaling upon exposure to butyrate [42]. Also similar to HCT-R cells, the proliferation of HCT-15 cells is not influenced by butyrate [42]. Thus, both HCT-15 CRC cells that are deficient in p300 expression, and HCT-R cells with repressed p July 21, 2015 Volume 21 Issue 27

37 Bordonaro M et al. CBP and p300 in colorectal cancer A LT97 cells p300 > CBP activity B HCT116 cells p300 > CBP activity Neoplastic progression Therapeutic direction butyrate/hdacis resistance Therapeutic direction SW620 cells CBP > p300 activity HCT-R cells CBP > p300 activity Figure 1 CREB-binding protein/p300 in neoplastic progression and Histone deacetylase inhibitors resistance, and a possible therapeutic approach. We posit that neoplastic progression (A) and resistance to HDACis (B) are associated with downregulated p300-mediated Wnt activity and relatively increased CBP-mediated Wnt signaling. Gene expression programs dependent upon CBP activity > p300 activity drive cell phenotype changes characteristic of greater neoplastic progression and HDACi resistance. Therefore, therapeutic approaches to prevent and/or reverse progression and resistance will depend upon enhancing p300-mediated Wnt activity at the expense of that mediated by CBP. Adapted from [43]. CBP: CREB-binding protein; HDACis: histone deacetylase inhibitors. expression, exhibit relative resistance to the effects of butyrate on Wnt signaling and cell proliferation. Unlike HCT-R cells, HCT-15 cells respond to butyrate treatment with a modest upregulation of apoptosis and lack the heightened sensitivity to the apoptosisinducing action of ICG-001 displayed by the HCT-R line [42]. These findings suggest that p300-mediated Wnt signaling is required for optimal hyperactivation of Wnt signaling and repression of cell proliferation by butyrate in at least some CRC cell lines. This possible role for p300 in mediating butyrate-modulated CRC cell apoptosis may be related to the association of p300- mediated Wnt signaling in colonic cell differentiation and apoptosis [30-33]. In butyrate-resistant HCT-R cells, CBP-mediated Wnt signaling likely promotes cell proliferation [42], and the downregulation of this signaling by ICG-001 induces apoptosis [42]. Thus, resistance to butyrate and other HDACis might be associated with a shift of the cancer cells utilizing more CBP-mediated than p300-mediated Wnt signaling. Summary: neoplastic progression and resistance to HDACis Further studies should address the possibility that the simultaneous upregulation of p300-mediated Wnt signaling and downregulation of CBP-mediated Wnt signaling represent a therapeutic approach against both neoplastic progression and the development of resistance to butyrate and other HDACis (Figure 1). CBP/p300-Wnt activity and cancer stem cell therapeutics Differential modulation of CBP and p300 activity can target the cancer stem cell (CSC) fraction of a tumor, while sparing normal somatic stem cells (SSCs). The Wnt signaling pathway is associated with promotion of pluripotency/stemness; enhanced nuclear translocation of β-catenin (a marker for Wnt transcriptional activity) is most evident at the invasive front of metastatic solid tumors where epithelial to mesenchymal transition (EMT) takes place [31]. However, Wnt activity has also been associated with differentiation; therefore Wnt activity can trigger distinct physiological pathways in normal and neoplastic cells. These reports are consistent with the proposed specific role of CBPmediated Wnt activity in proliferation vs the role of p300-mediated Wnt activity in differentiation. Thus, blocking the CBP-β-catenin interaction (e.g., with ICG-001) promotes p300-mediated Wnt activity and differentiation of stem and progenitor cells; conversely, inhibiting the p300-β-catenin interaction enhances CBP-mediated Wnt activity, promoting pluripotency and multipotency [31]. Therefore, repression of CBPmediated Wnt signaling would seem to be an effective approach to eliminate CSCs through enforced differentiation. However, this leads to the question of whether normal SSCs will be also targeted by this CBP-Wnt inhibitory approach. Lenz and Kahn [31] argue that negative effects on SSCs may be evaded due to the tendency of SSCs to multiply through asymmetric division (producing one daughter stem cell and one daughter differentiated cell); whereas, CSCs, due to various mutations, tend to divide symmetrically (producing either two daughter stem cells or two daughter differentiated cells). Agents such as ICG-001 would not change the differences between these types of stem cells regarding division; SSCs and CDCs exposed to these agents will continue to divide asymmetrically and symmetrically, respectively. However, the objective of treatment would be to force the CSC symmetrical cell division to produce two differentiated cells, abrogating the symmetrical production of daughter stem cells. The CSC symmetrical division that produces stem cells would be repressed by CBP-Wnt inhibitors, reducing the fraction of stem cells in the tumor. Thus, when exposed to a pro-differentiation CBP-Wnt inhibitor (such as ICG-001), CSCs would undergo a symmetrical division that only produces differentiated cells. In contrast, when exposed to the same agent, SSCs continue to normally divide asymmetrically, producing daughter stem cells that allow for the maintenance of the stem cell niche [31]. Effects of CBP and p300 on stem cell dynamics have a number of implications for cancer. For example, in human CML cell lines, hypoxia enhances the leukemia stem/initiating-like fraction of the cell population via increased CBPmediated Wnt signaling [50]. ICG-001 can reverse the effects, emphasizing the role played by CBP in 8243 July 21, 2015 Volume 21 Issue 27

38 Bordonaro M et al. CBP and p300 in colorectal cancer CSC maintenance and suggesting that repression of CBP-Wnt activity is a therapeutic option against the relatively larger pool of CSCs maintained in hypoxic conditions. Therapeutic implications of findings involving HDACis and modulation of CBP and p300 activity Findings [41-43] suggest that combinatorial therapy utilizing HDACis and ICG-001-like agents is likely to be effective in suppressing CRC cell growth. However, since apoptosis is a preferable outcome to repressed cell growth in therapy, cotreatment with HDACis and CBP-Wnt signaling inhibitors (such as ICG-001) should be avoided in CRCs in which these two types of agents interfere with each other s effect on apoptosis. A challenge would be identifying which subset of CRCs fall into this category. In addition, the effect of diet on anti-crc chemotherapeutics must be considered. Physiologically relevant concentrations of butyrate are produced in the colonic lumen from the fermentation of dietary fiber, and may also interfere with the activity of ICG-001-like agents on apoptosis. Therefore, the effects of a fiber-rich diet on the therapeutic activity of ICG-001-like agents against CRC needs to be investigated through animal studies. To evade undesirable interactions between dietary factors such as butyrate and CBP-Wnt inhibitors, CRC patients who are treated with ICG-001-like agents may need to fast or consume a low-fiber diet [41]. Modulation of p300-mediated Wnt activity represents another potential therapeutic approach, although further studies evaluating of the association of p300 with β-catenin are required in order to fully evaluate the role of p300 in colonic cell physiology. Compared to HDACi-sensitive CRC cell lines, HDACi-resistant CRC cells exhibited greater apoptotic response to ICG-001 [41,42]. Possibly, CBP-Wnt signaling inhibitors exert their greatest therapeutic effects against CRCs that are resistant to dietary and pharmacological HDACis. We theorize that right-sided colonic tumors may be particularly sensitive to CBP-Wnt signaling inhibitors since these neoplasms are more likely to be butyrate resistant since they have developed in the proximal colon where diet-derived butyrate is at its highest levels. The anti-crc preventive action of diet-derived butyrate is most likely exerted during early stage disease. Consistent with this, LT97 microadenoma cells are highly sensitive to the anti-proliferative and pro-apoptotic effects of butyrate [3,4,43]. Thus, growth arrest is an important mechanism whereby HDACis, combined with CBP-Wnt signaling inhibitors, affect cells in early stage colonic neoplasia [43]. With respect to apoptosis, both ICG-001 and butyrate each stimulated apoptosis of LT97 cells, and there was no interference between these agents in the induction of LT97 cell death; whereas, this type of interaction was observed in some CRC cell lines [41-43]. These findings suggest that CBP-Wnt signaling inhibitors, alone or in combination with HDACis, are effective in suppressing the earliest stages of colonic tumorigenesis. Practically speaking, application of this combinatorial treatment approach would be most useful in patients who are at particularly high risk for developing CRC (e.g., patients who have already had CRC and are at risk for recurrence). Suppression of CBP-mediated Wnt activity may also have a therapeutic effect by stimulating differentiation of cancer stem cells [31,40]. How this activity of ICG like agents is influenced by dietary or pharmacological HDACis remains to be determined. The therapeutic choice of enhancing or suppressing Wnt signaling activity in CRC could be based upon (1) levels of the Wnt pathway, CBP and p300 expression levels in neoplastic cells ascertained through biopsy of patient samples; and (2) identification of specific gene mutation profiles associated with the HDACi-resistant and HDACi-sensitive phenotypes. What next? CBP-Wnt signaling inhibitors are in clinical trial for cancer and are specifically being investigated as differentiating agents for normal and cancer stem cells [31,40]. We believe that modulation of CBP- and p300-mediated Wnt activity has preventive and therapeutic potential for CRC, particularly with respect to controlling neoplastic progression and preventing/ reversing resistance to HDACis. Combinatorial therapy with such agents and HDACis remains a possibility. However, additional in vitro and in vivo studies are required to further evaluate these possibilities. The unexplored question of how the combination of CBP- Wnt signaling inhibitors and HDACis influences cancer stem cell phenotypes remains to be determined. The dissection of the relative roles of CBP and p300 in Wnt activity-mediated CRC would be advanced by the development of new specific inhibitors of p300- mediated Wnt activity in human cells, analogous to the CBP-Wnt inhibitor ICG-001. One promising development in this regard is the identification of windorphen as an agent which has greater activity against p300 HAT activity and the p300-β-catenin association compared to its effects on CBP; in addition, windorphen treatment also stimulates apoptosis of CRC cells [51]. The activity and specificity of this agent, alone or in combination with other agents (e.g., HDACis) requires further investigation. Future studies can utilize primary patient samples and animal models of CRC to validate in vitro findings. Comparison of adenoma vs carcinoma stage in patients and animal models may recapitulate the differences observed between LT97 vs SW620 cells with respect to CBP and p300 expression and activity, response to butyrate and/or ICG-001, as well as expression of target genes. Further, primary neoplastic samples acquired along 8244 July 21, 2015 Volume 21 Issue 27

39 Bordonaro M et al. CBP and p300 in colorectal cancer ICG-001 Wnt/beta-catenin Signaling Fiber CBP-mediated proliferation, butyrate resistance p300-mediated differentiation, apoptosis, butyrate sensitivity Butyrate loss of p300 activity Apoptosis Right-Sided colon cancer (often MSI+) Butyrate resistance Proximal colon (higher butyrate levels) Figure 2 Hypothetical relationship between p300 loss, butyrate-resistance, and right-sided colon cancer. Wnt/β-catenin signaling has both CBP-mediated and p300-mediated components. CBP-Wnt activity, which is repressed by the clinically relevant agent ICG-001, likely mediates colonic cell proliferation and resistance to butyrate (and other HDACis). In contrast, p300-wnt activity likely mediates differentiation, apoptosis, and sensitivity to butyrate. Butyrate, derived from dietary fiber, enhances apoptosis of colon cancer cells, possibly acting through the p300-mediated component of Wnt/β-catenin activity. Neoplasms that arise in the proximal colon, where butyrate concentrations are highest, may be resistant to butyrate, and this resistance may arise through loss of p300 expression and activity and a greater reliance on CBP-mediated Wnt signaling. Development of these right-sided colon cancers may be prevented/threated via agents such as ICG-001 and/or other approaches that can promote p300-wnt > CBP-Wnt activity. CBP: CREB-binding protein; HDACis: histone deacetylase inhibitors. the length of the large bowel should be evaluated for relative butyrate resistance in ex vivo experiments. For example, CRCs from the right colon have been hypothesized to exhibit more butyrate resistance than those from the left colon [52,53], due to intra-colonic differences in luminal butyrate concentrations. We also note that CRCs with microsatellite instability (MSI+) are typically found in right-sided colon cancer; importantly, these tumors, which display differences in cell signaling and therapeutic response compared to non-msi CRC, frequently exhibit mutations in CBP and, particularly, p300 [54]. A number of cell lines, including HCT-116, that are characterized by p300 mutation, are MSI+ [54], and one can hypothesize a link between MSI+ status, p300 expression, butyrateresistance, and the development of right-sided CRC in the context of higher levels of butyrate in the proximal colon [53]. Whether agents such as ICG-001 would be especially efficacious against MSI+ colonic neoplasms (Figure 2) needs to be evaluated, including through the use of animal models of mismatch repair-deficient CRC (see below). Thus, variation in butyrate sensitivity in primary patient samples may reflect differences in CBP-mediated and p300-mediated Wnt activity, and the downstream consequences with respect to effects of butyrate. Mouse xenograft models can be utilized to determine how alteration in CBP- and p300-mediated Wnt activity correlates to in vivo tumorigenicity. Thus, adenoma cells engineered to exhibit greater neoplastic potential in vitro can be tested for their ability to form tumors in vivo; conversely, carcinoma cells with modified CBP- and p300-mediated Wnt activity and reduced neoplastic potential in vitro can be compared to parental cells with respect to tumorigenicity in vivo. The same principle can be applied in evaluating how modulation of CBP- and p300-mediated Wnt signaling in butyrate-resistant cells affects the ability of these cells to form tumors and the sensitivity of the resulting tumors to butyrate/hdacis. The findings generated by these studies can be subsequently utilized to evaluate approaches that target earlier stages in tumor development using genetic Apc mutant mouse models. Perhaps a more optimal set of mouse models for these studies are those mismatch repair-deficient strains developed by the Edelmann laboratory [55]. Given the prevalence of MSI+ tumors in right-sided colon cancer, the increased possibility of butyrate resistance in such tumors, and the frequency of CBP and p300 mutations in MSI+ CRC, murine models of mismatch repair-deficient CRC should also be utilized to understand the role of CBP and p300 in colonic neoplasia, possible connections between MSI+ status, p300 expression, and butyrateresistance, as well as the utility of using ICG-001-like agents for the treatment of such tumors. Finally, we note that many of the issues discussed in this review are likely not confined to CRC; for example, the CBP- Wnt inhibitor ICG-001 has shown efficacy in repressing pancreatic cell growth [56]. Further, inhibition of p300- mediated Wnt signaling in mouse models indicate a role for p300-wnt activity in proximalizing lung 8245 July 21, 2015 Volume 21 Issue 27

40 Bordonaro M et al. CBP and p300 in colorectal cancer epithelium [57], raising the possibility that perturbation of CBP vs p300 activity influences lung carcinogenesis. These findings, and the work on effects of CBP and p300 on normal vs cancer stem cells, suggest that modulation of CBP vs p300 activity can be a common therapeutic tool against many forms of human cancer. CONCLUSION A more comprehensive understanding of how CBP and p300 influence colonic cell physiology will allow for the development of anti-crc preventive and therapeutic approaches that target CBP and p300 activity in order to repress neoplastic progression, prevent or reverse the development of resistance to butyrate and other HDACis, and target colon cancer stem cells. Further studies are required to generate data that may lead to novel chemopreventive and therapeutic approaches against CRC. REFERENCES 1 Lazarova DL, Bordonaro M, Carbone R, Sartorelli AC. Linear relationship between Wnt activity levels and apoptosis in colorectal carcinoma cells exposed to butyrate. Int J Cancer 2004; 110: [PMID: DOI: /ijc.20152] 2 Bordonaro M, Lazarova DL, Sartorelli AC. The activation of beta-catenin by Wnt signaling mediates the effects of histone deacetylase inhibitors. Exp Cell Res 2007; 313: [PMID: DOI: /j.yexcr ] 3 Richter M, Jurek D, Wrba F, Kaserer K, Wurzer G, Karner- Hanusch J, Marian B. Cells obtained from colorectal microadenomas mirror early premalignant growth patterns in vitro. Eur J Cancer 2002; 38: [PMID: DOI: /S (02] ] 4 Kautenburger T, Beyer-Sehlmeyer G, Festag G, Haag N, Kühler S, Küchler A, Weise A, Marian B, Peters WH, Liehr T, Claussen U, Pool-Zobel BL. The gut fermentation product butyrate, a chemopreventive agent, suppresses glutathione S-transferase theta (hgstt1) and cell growth more in human colon adenoma (LT97) than tumor (HT29) cells. J Cancer Res Clin Oncol 2005; 131: [PMID: DOI: /s ] 5 Brabletz T, Jung A, Spaderna S, Hlubek F, Kirchner T. Opinion: migrating cancer stem cells - an integrated concept of malignant tumour progression. Nat Rev Cancer 2005; 5: [PMID: DOI: /nrc1694] 6 Bingham SA, Day NE, Luben R, Ferrari P, Slimani N, Norat T, Clavel-Chapelon F, Kesse E, Nieters A, Boeing H, Tjønneland A, Overvad K, Martinez C, Dorronsoro M, Gonzalez CA, Key TJ, Trichopoulou A, Naska A, Vineis P, Tumino R, Krogh V, Buenode-Mesquita HB, Peeters PH, Berglund G, Hallmans G, Lund E, Skeie G, Kaaks R, Riboli E. Dietary fibre in food and protection against colorectal cancer in the European Prospective Investigation into Cancer and Nutrition (EPIC): an observational study. Lancet 2003; 361: [PMID: DOI: / S (03] ] 7 Peters U, Sinha R, Chatterjee N, Subar AF, Ziegler RG, Kulldorff M, Bresalier R, Weissfeld JL, Flood A, Schatzkin A, Hayes RB. Dietary fibre and colorectal adenoma in a colorectal cancer early detection programme. Lancet 2003; 361: [PMID: DOI: /S (03]13173-X] 8 Bingham SA, Norat T, Moskal A, Ferrari P, Slimani N, Clavel- Chapelon F, Kesse E, Nieters A, Boeing H, Tjønneland A, Overvad K, Martinez C, Dorronsoro M, González CA, Ardanaz E, Navarro C, Quirós JR, Key TJ, Day NE, Trichopoulou A, Naska A, Krogh V, Tumino R, Palli D, Panico S, Vineis P, Bueno-de-Mesquita HB, Ocké MC, Peeters PH, Berglund G, Hallmans G, Lund E, Skeie G, Kaaks R, Riboli E. Is the association with fiber from foods in colorectal cancer confounded by folate intake? Cancer Epidemiol Biomarkers Prev 2005; 14: [PMID: DOI: / EPI ] 9 Bingham SA. Mechanisms and experimental and epidemiological evidence relating dietary fibre (non-starch polysaccharides) and starch to protection against large bowel cancer. Proc Nutr Soc 1990; 49: [PMID: DOI: /PNS ] 10 Cummings JH, Pomare EW, Branch WJ, Naylor CP, Macfarlane GT. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1987; 28: [PMID: DOI: /gut ] 11 Boffa LC, Lupton JR, Mariani MR, Ceppi M, Newmark HL, Scalmati A, Lipkin M. Modulation of colonic epithelial cell proliferation, histone acetylation, and luminal short chain fatty acids by variation of dietary fiber (wheat bran) in rats. Cancer Res 1992; 52: [PMID: ] 12 Heerdt BG, Houston MA, Augenlicht LH. Potentiation by specific short-chain fatty acids of differentiation and apoptosis in human colonic carcinoma cell lines. Cancer Res 1994; 54: [PMID: ] 13 Hague A, Elder DJ, Hicks DJ, Paraskeva C. Apoptosis in colorectal tumour cells: induction by the short chain fatty acids butyrate, propionate and acetate and by the bile salt deoxycholate. Int J Cancer 1995; 60: [PMID: DOI: / ijc ] 14 Medina V, Edmonds B, Young GP, James R, Appleton S, Zalewski PD. Induction of caspase-3 protease activity and apoptosis by butyrate and trichostatin A (inhibitors of histone deacetylase): dependence on protein synthesis and synergy with a mitochondrial/ cytochrome c-dependent pathway. Cancer Res 1997; 57: [PMID: ] 15 Marks PA, Dokmanovic M. Histone deacetylase inhibitors: discovery and development as anticancer agents. Expert Opin Investig Drugs 2005; 14: [PMID: DOI: / ] 16 Lin HY, Chen CS, Lin SP, Weng JR, Chen CS. Targeting histone deacetylase in cancer therapy. Med Res Rev 2006; 26: [PMID: DOI: /med.20056] 17 Bordonaro M, Mariadason JM, Aslam F, Heerdt BG, Augenlicht LH. Butyrate-induced apoptotic cascade in colonic carcinoma cells: modulation of the beta-catenin-tcf pathway and concordance with effects of sulindac and trichostatin A but not curcumin. Cell Growth Differ 1999; 10: [PMID: ] 18 Liu C, Zhang Y, Li J, Wang Y, Ren F, Zhou Y, Wu Y, Feng Y, Zhou Y, Su F, Jia B, Wang D, Chang Z. p15rs/rprd1a (p15ink4b-related sequence/regulation of nuclear pre-mrna domain-containing protein 1A) interacts with HDAC2 in inhibition of the Wnt/ β-catenin signaling pathway. J Biol Chem 2015; 290: [PMID: DOI: /jbc.M ] 19 Cook D, Fry MJ, Hughes K, Sumathipala R, Woodgett JR, Dale TC. Wingless inactivates glycogen synthase kinase-3 via an intracellular signalling pathway which involves a protein kinase C. EMBO J 1996; 15: [PMID: ] 20 Rubinfeld B, Souza B, Albert I, Müller O, Chamberlain SH, Masiarz FR, Munemitsu S, Polakis P. Association of the APC gene product with beta-catenin. Science 1993; 262: [PMID: DOI: /science ] 21 Su LK, Vogelstein B, Kinzler KW. Association of the APC tumor suppressor protein with catenins. Science 1993; 262: [PMID: DOI: /science ] 22 Munemitsu S, Albert I, Souza B, Rubinfeld B, Polakis P. Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc Natl Acad Sci USA 1995; 92: [PMID: DOI: / 8246 July 21, 2015 Volume 21 Issue 27

41 Bordonaro M et al. CBP and p300 in colorectal cancer pnas ] 23 Behrens J, von Kries JP, Kühl M, Bruhn L, Wedlich D, Grosschedl R, Birchmeier W. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 1996; 382: [PMID: DOI: /382638a0] 24 Molenaar M, van de Wetering M, Oosterwegel M, Peterson- Maduro J, Godsave S, Korinek V, Roose J, Destrée O, Clevers H. XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell 1996; 86: [PMID: DOI: /S (00] ] 25 Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, Clevers H. Constitutive transcriptional activation by a beta-catenin-tcf complex in APC-/- colon carcinoma. Science 1997; 275: [PMID: DOI: /science ] 26 Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW. Activation of beta-catenin-tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 1997; 275: [PMID: DOI: /science ] 27 Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 2000; 103: [PMID: DOI: / S (00] ] 28 Albuquerque C, Breukel C, van der Luijt R, Fidalgo P, Lage P, Slors FJ, Leitão CN, Fodde R, Smits R. The just-right signaling model: APC somatic mutations are selected based on a specific level of activation of the beta-catenin signaling cascade. Hum Mol Genet 2002; 11: [PMID: DOI: / hmg/ ] 29 Bordonaro M, Lazarova DL, Sartorelli AC. Hyperinduction of Wnt activity: a new paradigm for the treatment of colorectal cancer? Oncol Res 2008; 17: 1-9 [PMID: ] 30 Emami KH, Nguyen C, Ma H, Kim DH, Jeong KW, Eguchi M, Moon RT, Teo JL, Kim HY, Moon SH, Ha JR, Kahn M. A small molecule inhibitor of beta-catenin/creb-binding protein transcription [corrected]. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: /pnas ] 31 Lenz HJ, Kahn M. Safely targeting cancer stem cells via selective catenin coactivator antagonism. Cancer Sci 2014; 105: [PMID: DOI: /cas.12471] 32 Teo JL, Ma H, Nguyen C, Lam C, Kahn M. Specific inhibition of CBP/beta-catenin interaction rescues defects in neuronal differentiation caused by a presenilin-1 mutation. Proc Natl Acad Sci USA 2005; 102: [PMID: DOI: / pnas ] 33 Ma H, Nguyen C, Lee KS, Kahn M. Differential roles for the coactivators CBP and p300 on TCF/beta-catenin-mediated survivin gene expression. Oncogene 2005; 24: [PMID: DOI: /sj.onc ] 34 Miyabayashi T, Teo JL, Yamamoto M, McMillan M, Nguyen C, Kahn M. Wnt/beta-catenin/CBP signaling maintains long-term murine embryonic stem cell pluripotency. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: / pnas ] 35 Teo JL, Kahn M. The Wnt signaling pathway in cellular proliferation and differentiation: A tale of two coactivators. Adv Drug Deliv Rev 2010; 62: [PMID: DOI: /j.addr ] 36 Waltzer L, Bienz M. Drosophila CBP represses the transcription factor TCF to antagonize Wingless signalling. Nature 1998; 395: [PMID: DOI: /26785] 37 Hecht A, Vleminckx K, Stemmler MP, van Roy F, Kemler R. The p300/cbp acetyltransferases function as transcriptional coactivators of beta-catenin in vertebrates. EMBO J 2000; 19: [PMID: DOI: /emboj/ ] 38 Li J, Sutter C, Parker DS, Blauwkamp T, Fang M, Cadigan KM. CBP/p300 are bimodal regulators of Wnt signaling. EMBO J 2007; 26: [PMID: DOI: /sj.emboj ] 39 Lévy L, Wei Y, Labalette C, Wu Y, Renard CA, Buendia MA, Neuveut C. Acetylation of beta-catenin by p300 regulates betacatenin-tcf4 interaction. Mol Cell Biol 2004; 24: [PMID: DOI: /MCB ] 40 Takahashi-Yanaga F, Kahn M. Targeting Wnt signaling: can we safely eradicate cancer stem cells? Clin Cancer Res 2010; 16: [PMID: DOI: / CCR ] 41 Lazarova DL, Chiaro C, Wong T, Drago E, Rainey A, O Malley S, Bordonaro M. CBP Activity Mediates Effects of the Histone Deacetylase Inhibitor Butyrate on WNT Activity and Apoptosis in Colon Cancer Cells. J Cancer 2013; 4: [PMID: DOI: /jca.6583] 42 Lazarova DL, Wong T, Chiaro C, Drago E, Bordonaro M. p300 Influences Butyrate-Mediated WNT Hyperactivation In Colorectal Cancer Cells. J Cancer 2013; 4: [PMID: DOI: /jca.6582] 43 Lazarova D, Lee A, Wong T, Marian B, Chiaro C, Rainey C, Bordonaro M. Modulation of Wnt Activity and Cell Physiology by Butyrate in LT97 Microadenoma Cells. J Cancer 2014; 5: [PMID: DOI: /jca.8569] 44 Grigson ER, Ozerova M, Pisklakova A, Liu H, Sullivan DM, Nefedova Y. Canonical Wnt pathway inhibitor ICG-001 induces cytotoxicity of multiple myeloma cells in Wnt-independent manner. PLoS One 2015; 10: e [PMID: DOI: /journal.pone ] 45 Fodde R, Brabletz T. Wnt/beta-catenin signaling in cancer stemness and malignant behavior. Curr Opin Cell Biol 2007; 19: [PMID: DOI: /j.ceb ] 46 Huh JW, Kim HC, Kim SH, Park YA, Cho YB, Yun SH, Lee WY, Chun HK. Prognostic impact of p300 expression in patients with colorectal cancer. J Surg Oncol 2013; 108: [PMID: DOI: /jso.23405] 47 Jia Y, Nie F, Du A, Chen Z, Qin Y, Huang T, Song X, Li L. Thymine DNA glycosylase promotes transactivation of β-catenin/ TCFs by cooperating with CBP. J Mol Cell Biol 2014; 6: [PMID: DOI: /jmcb/mju014] 48 Götze S, Coersmeyer M, Müller O, Sievers S. Histone deacetylase inhibitors induce attenuation of Wnt signaling and TCF7L2 depletion in colorectal carcinoma cells. Int J Oncol 2014; 45: [PMID: DOI: /ijo ] 49 Chiaro C, Lazarova DL, Bordonaro M. Tcf3 and cell cycle factors contribute to butyrate resistance in colorectal cancer cells. Biochem Biophys Res Commun 2012; 428: [PMID: DOI: /j.bbrc ] 50 Kida A, Kahn M. Hypoxia selects for a quiescent, CML stem/ leukemia initiating-like population dependent on CBP/catenin transcription. Curr Mol Pharmacol 2013; 6: [PMID: ] 51 Hao J, Ao A, Zhou L, Murphy CK, Frist AY, Keel JJ, Thorne CA, Kim K, Lee E, Hong CC. Selective small molecule targeting β-catenin function discovered by in vivo chemical genetic screen. Cell Rep 2013; 4: [PMID: DOI: / j.celrep ] 52 Bordonaro M, Tewari S, Cicco CE, Atamna W, Lazarova DL. A switch from canonical to noncanonical Wnt signaling mediates drug resistance in colon cancer cells. PLoS One 2011; 6: e27308 [PMID: DOI: /journal.pone ] 53 Lazarova DL, Bordonaro M. Extreme fluctuations in Wnt/betacatenin signaling as an approach for colon cancer prevention and therapy. Adv Stud Biol 2012; 4: Ionov Y, Matsui S, Cowell JK. A role for p300/creb binding protein genes in promoting cancer progression in colon cancer cell lines with microsatellite instability. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: / pnas ] 55 Woerner SM, Tosti E, Yuan YP, Kloor M, Bork P, Edelmann W, Gebert J. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors. Mol Carcinog 2014; Epub ahead of print [PMID: DOI: /mc.22213] 8247 July 21, 2015 Volume 21 Issue 27

42 Bordonaro M et al. CBP and p300 in colorectal cancer 56 Arensman MD, Telesca D, Lay AR, Kershaw KM, Wu N, Donahue TR, Dawson DW. The CREB-binding protein inhibitor ICG-001 suppresses pancreatic cancer growth. Mol Cancer Ther 2014; 13: [PMID: DOI: / MCT ] 57 Sasaki T, Kahn M. Inhibition of β-catenin/p300 interaction proximalizes mouse embryonic lung epithelium. Transl Respir Med 2014; 2: 8 [PMID: DOI: /s ] P- Reviewer: Kadiyska TK, Linnebacher M, Zouiten-Mekki L S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8248 July 21, 2015 Volume 21 Issue 27

43 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved Advances in Hepatitis B virus TOPIC HIGHLIGHT Management of hepatitis B virus infection during treatment for hepatitis B virus-related hepatocellular carcinoma Shoji Kubo, Shigekazu Takemura, Shogo Tanaka, Hiroji Shinkawa, Takayoshi Nishioka, Akinori Nozawa, Masahiko Kinoshita, Genya Hamano, Tokuji Ito, Yorihisa Urata Shoji Kubo, Shigekazu Takemura, Shogo Tanaka, Hiroji Shinkawa, Takayoshi Nishioka, Akinori Nozawa, Masahiko Kinoshita, Genya Hamano, Tokuji Ito, Yorihisa Urata, Department of Hepato-Biliary-Pancreatic Surgery, Osaka City University Graduate School of Medicine, Osaka , Japan Author contributions: Kubo S and Urata Y contributed equally to this work and wrote the manuscript; Nishioka T, Nozawa A, Kinoshita M, Hamano G and Ito T researched the literature; Takemura S, Tanaka S, Shinkawa H and Kubo S evaluated and edited the manuscript. Conflict-of-interest statement: No potential conflicts of interest relevant to this article were reported. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Shoji Kubo, MD, Department of Hepato- Biliary-Pancreatic Surgery, Osaka City University Graduate School of Medicine, Asahimachi, Abeno-ku, Osaka , Japan. m @msic.med.osaka-cu.ac.jp Telephone: Fax: Received: January 26, 2015 Peer-review started: January 27, 2015 First decision: March 10, 2015 Revised: March 16, 2015 Accepted: May 4, 2015 Article in press: May 4, 2015 Published online: July 21, 2015 Abstract Although liver resection is considered the most effective treatment for hepatocellular carcinoma (HCC), treatment outcomes are unsatisfactory because of the high rate of HCC recurrence. Since we reported hepatitis B e-antigen positivity and high serum hepatitis B virus (HBV) DNA concentrations are strong risk factors for HCC recurrence after curative resection of HBV-related HCC in the early 2000s, many investigators have demonstrated the effects of viral status on HCC recurrence and post-treatment outcomes. These findings suggest controlling viral status is important to prevent HCC recurrence and improve survival after curative treatment for HBV-related HCC. Antiviral therapy after curative treatment aims to improve prognosis by preventing HCC recurrence and maintaining liver function. Therapy with interferon and nucleos(t)ide analogs may be useful for preventing HCC recurrence and improving overall survival in patients who have undergone curative resection for HBV-related HCC. In addition, reactivation of viral replication can occur after liver resection for HBV-related HCC. Antiviral therapy can be recommended for patients to prevent HBV reactivation. Nevertheless, further studies are required to establish treatment guidelines for patients with HBVrelated HCC. Key words: Chronic hepatitis B; Liver resection; Hepatocellular carcinoma; Antiviral therapy; Nucleos(t)ide analogs The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Although liver resection is considered the most effective treatment for hepatocellular carcinoma (HCC), treatment outcomes are unsatisfactory because 8249 July 21, 2015 Volume 21 Issue 27

44 Kubo S et al. Management of HBV for HBV-related HCC of the high rate of HCC recurrence. Many investigators have demonstrated the effects of viral status on HCC recurrence and post-treatment outcomes. Therapy with interferon and nucleos(t)ide analogs may be useful for preventing HCC recurrence and improving overall survival in patients who have undergone curative resection for hepatitis B virus (HBV)-related HCC. In addition, reactivation of viral replication can occur after liver resection for HBV-related HCC. Antiviral therapy can be recommended for patients to prevent HBV reactivation. Kubo S, Takemura S, Tanaka S, Shinkawa H, Nishioka T, Nozawa A, Kinoshita M, Hamano G, Ito T, Urata Y. Management of hepatitis B virus infection during treatment for hepatitis B virus-related hepatocellular carcinoma. World J Gastroenterol 2015; 21(27): Available from: URL: wjgnet.com/ /full/v21/i27/8249.htm DOI: org/ /wjg.v21.i INTRODUCTION Hepatocellular carcinoma (HCC) is the fifth most common cancer worldwide and the third most common cause of cancer mortality [1,2]. Chronic infection with hepatitis B virus (HBV) is a major risk factor for HCC development. Risk factors for HCC among HBV carriers include male sex and advanced age, longer infection, alcohol consumption, and hepatic fibrosis [3]. The incidence of HCC is reportedly 0.2 per 100 personyears among inactive carriers, between 0.8 and 1.0 among people with chronic hepatitis B infections without cirrhosis, and between 3.2 and 4.3 among patients with compensated cirrhosis [4]. Although liver resection and radiofrequency ablation therapy are curative treatments for HCC, treatment outcomes are often unsatisfactory because of the high rate of HCC recurrence, which includes metastases from primary carcinomas and multicentric carcinogenesis after treatment (i.e., multicentric recurrence). Risk factors for HCC recurrence include tumor factors such as tumor number and vascular invasion, which are related to metastasis from the primary carcinoma. Multicentric carcinogenesis is closely associated with persistent active hepatitis and hepatic fibrosis. Therefore, strategies for both HCC and chronic hepatitis B infection are required to improve the post-treatment outcome of HCC in patients with chronic hepatitis B infections [5]. Liver transplantation is the most radical treatment for HCC as well as the treatment of underlying disease including chronic hepatitis B infection. However, donor shortage is a major problem associated with liver transplantation. Since we reported in the early 2000s that hepatitis B e-antigen (HBeAg) positivity and high serum concentrations of HBV DNA are strong risk factors for HCC recurrence after curative resection of HBV-related HCC [6-8], many investigators have reported the effects of viral status in HBV-infected individuals on HCC recurrence and post-treatment outcomes [9-13]. These studies suggest controlling viral status is important to prevent HCC recurrence and improve survival after curative treatment for HBV-related HCC. Since we first reported the reactivation of viral replication occurred after liver resection in patients with HBV-related HCC in 2001 [14], some investigators have reported the same findings. It is important to prevent such reactivation after liver resection [15-17]. Two types of drugs, conventional interferon (IFN)-α or pegylated IFN (PEG-IFN)-alpha, and nucleos(t)ide analogs (NAs), have recently become available for the treatment of chronic hepatitis B infection. Studies have shown that IFN therapy reduces progression to cirrhosis and HCC development [18,19]. Meanwhile antiviral therapy with NAs including lamivudine (LAM), adefovir dipivoxil (ADV), and entecavir (ETV), suppresses viral replication and appears to be useful for preventing progression to cirrhosis and HCC development in patients with chronic hepatitis B infection [20-26]. This paper reviews the impacts of perioperative antiviral therapy on viral replication reactivation after treatment as well as on HCC recurrence and survival following curative treatment for HBV-related HCC. REACTIVATION OF HBV REPLICATION AFTER LIVER RESECTION Reactivation of HBV replication in patients who receive cytotoxic or immunosuppressive therapy is well recognized. Since we first reported the reactivation of viral replication occurring after liver resection in patients with HBV-related HCC [14], some investigators have also reported reactivation after chemoembolization, radiofrequency ablation therapy, and liver resection [15-17]. Reactivation occurred in 20%-30% of patients who underwent liver resection. The risk factors for HBV reactivation include high alanine aminotransferase activity, high viral load, the presence of wild-type DNA, and the detection of hepatitis B core antigen in hepatocytes, which are all features of the immune clearance phase in the natural course of HBV infection [14]. Huang et al [27] recently reported antiviral therapy using telbivudine can significantly decrease the perioperative reactivation of viral replication after liver resection for HBV-related HCC. We also did not have experienced acute exacerbation since the induction of NAs. Changes in serum HBV DNA levels should be monitored during the treatment for HBV-related HCC. Antiviral therapy can be recommended for patients with risk factor(s) for HBV reactivation. EFFECTS OF ANTIVIRAL THERAPY ON OUTCOME AFTER TREATMENT FOR HCC IFN has been used to treat chronic hepatitis B infection 8250 July 21, 2015 Volume 21 Issue 27

45 Kubo S et al. Management of HBV for HBV-related HCC Table 1 Clinical trials of antiviral therapy after curative treatment for hepatitis B virus-related hepatocellular carcinoma Effects of antiviral therapy Author Year Study design Treatment Adjuvant therapy Tumor-free survival Overall survival Interferon Sun et al [39] 2006 RCT Resection Inteferon-α Postponed Improved Lo et al [37] 2007 RCT Resection Inteferon-α2b Not significant Improved in stage Ⅲ/Ⅳ A patients Chen et al [42] 2012 RCT Resection Inteferon-α2b Not significant Not significant Nucleos(t)ide analogues Kubo et al [45] 2007 Prospective cohort Resection LAM (with ADV rescue) Improved ND Kuzuya et al [48] 2007 Retrospective cohort Resection or RFA LAM (with ADV rescue) Not significant Improved (tendency) Yoshida et al [49] 2008 Retrospective cohort RFA LAM (with ADV rescue) Not significant Not significant Chuma et al [11] 2009 Retrospective cohort Resection or RFA LAM (with ADV rescue) Improved ND or ETV Koda et al [50] 2009 Cohort Resection or RFA LAM (with ADV rescue) Not significant Improved or ETV Li et al [51] 2010 Prospective cohort Resection LAM (with ADV rescue) Not significant Improved Chan et al [52] 2011 Retrospective cohort Resection LAM or ETV Improved Improved Urata et al [44] 2012 Retrospective cohort Resection LAM (with ADV rescue) Improved Improved or ETV Wu et al [53] 2012 Cohort Resection LAM, ETV, telbivudine Improved Improved Su et al [54] 2013 Retrospective cohort Rection LAM or ETV or Pegylated Improved Improved interferon Ke et al [55] 2013 Retrospective cohort Resection LAM Not significant Improved Yin et al [56] 2013 Cohort including RCT Resection LAM (with ADV or ETV Improved Improved rescue) Nishikawa et al [57] 2014 Retrospective cohort Resection or RFA or PEI LAM (with ADV rescue) or ETV Not significant Improved RCT: Randomised clinical trial; RFA: Radiofrequency ablation therapy; PEI: Percutaneous ethanol injection; LAM: Lamivudine; ADV: Adefovir dipivoxil; ETV: Entecavir; ND: Not determined. for many years. IFNs are cytokines that possess a variety of biologic properties, including antiviral, immunomodulatory, antiproliferative, antiangiogenic, and tumoricidal effects [28]. Meta-analyses of controlled trials of IFN therapy in HBeAg-positive patients show that patients treated with IFN achieve greater HBeAg losses, suppression of HBV DNA levels, and alanine aminotransferase normalization than untreated control patients [29]. In addition, IFN therapy induces higher rates of hepatitis B surface antigen (HBsAg) seroclearance, resulting in lower rates of cirrhosis development, reduced HCC incidence, and better overall survival [30]. IFN conjugated with polyethylene glycol, i.e., PEG-IFN, has recently become widely used because it is convenient and patients with chronic hepatitis B infections treated with it exhibit clinical outcomes superior to those of patients treated with unconjugated IFN [31]. Several studies show that IFN effectively suppresses HBV replication, reduces HCC incidence, and improves outcomes in patients with chronic hepatitis B infections [32-34]. Although the potential effectiveness of IFN-α as an adjuvant therapy for preventing HCC recurrence has been demonstrated in clinical trials and meta-analyses [35-41], other studies report conflicting results [42,43] (Table 1). Furthermore, while the use of adjuvant IFN therapy in HCC has been studied extensively, it has not yet been accepted as a standard treatment after curative therapy, because previous studies have only involved small numbers of patients and varying types and doses of IFN. Therefore, further studies are required to establish appropriate postoperative therapy with IFN in HCC patients. We reported that a high serum concentration of HBV DNA is a strong risk factor for HCC recurrence and poor survival after curative HCC resection [44] (Figure 1). Furthermore, we reported that the incidence of HCC recurrence was significantly higher in patients who experienced acute postoperative exacerbations of their hepatitis, showed constantly high serum concentrations of HBV DNA, and showed sustained HBsAg expression postoperatively [45]. Several subsequent studies also demonstrated high serum concentrations of HBV DNA are significantly associated with shorter survival times, with the cause of death being HCC recurrence [6,7,9-13,45]. It is well established that a high serum concentration of HBV-DNA is strongly associated with HCC development [46]. The risk of HCC in such patients is more than 10 times higher than that in patients with low serum concentrations of HBV DNA. Antiviral therapy with NAs including LAM, ADV, and ETV, has recently been reported to be useful for preventing progression to cirrhosis and HCC development in patients with chronic hepatitis B infections [20-26]. Since we reported that LAM may prevent HCC recurrence after curative resection for HCC [47] (Figure 2), several published reports describe the effects of NAs after HCC treatment [11,44,48-57] (Table 1). A recent meta-analysis shows that antiviral therapy with NAs reduces HCC-related mortality and HCC recurrence 8251 July 21, 2015 Volume 21 Issue 27

46 Kubo S et al. Management of HBV for HBV-related HCC A B Tumor-free survival rate (%) P = Cumulative survival rate (%) Years after surgery Years after surgery Figure 1 Tumor-free survival (A) and cumulative survival rates (B) after curative resection of hepatocellular carcinoma. Figure adapted from Urata et al [44] with permission. Open circles and triangle indicate high and low serum hepatitis B virus DNA concentrations ( 4 and < 4 log10 copies/ml), respectively. A 100 B 100 P = Tumor-free survival rate (%) P = Cumulative survival rate (%) Years after surgery Years after surgery Figure 2 Tumor-free survival (A) and cumulative survival rates (B) after curative resection of hepatocellular carcinoma. Figure adapted from Urata et al [44] with permission. Open circles and triangles indicate patients with high serum hepatitis B virus DNA concentrations who were administered and not administered nucleoside analogs, respectively. postoperatively, and improves overall survival in patients with HBV-related HCC [58-60]. A recent cohort study of patients with chronic hepatitis B infections treated with ETV demonstrates the importance of a sustained virologic response [61]. However, antiviral therapy using NAs cannot suppress HCC recurrence caused by metastases from the original tumor, because NAs do not have any anticancer activity. In addition, NAs cannot prevent multicentric recurrence of HCC, because the HBV DNA will already have been integrated into the host s genome, which is the first step in hepatocarcinogenesis in patients with chronic hepatitis B infections and cirrhosis. Therefore, HCC may still develop despite the effective suppression of viral replication by antiviral agents. A retrospective study of 2795 Japanese patients with chronic hepatitis B infections shows that absence of treatment, male sex, family history of HBV carriage, age over 40 years, fibrosis exceeding grade 2, on a scale of 0-4, and albumin < 40 g/l and platelet count < / mm 3 are independent risk factors for HCC [22]. Close follow-up is necessary for elderly patients who have cirrhosis, even if antiviral therapy has been effective. We previously showed that antiviral therapy with NAs induces the remission of active hepatitis, maintains liver function, and increases the likelihood of successful treatment for HCC recurrence, even if recurrence developed after curative resection [44]. Similar results were subsequently reported in other studies, namely that antiviral therapy with NAs improved patient outcomes following curative treatment [48,50,51,55,56]. Drug resistance is increasingly emerging in association with long-term antiviral therapy. Hence, the effects of drug resistance on HCC recurrence following treatment for HBV-related HCC must be evaluated. CONCLUSION Antiviral therapy after curative treatment aims to improve prognosis by suppressing viral replication. Recent accumulating evidence indicates high serum HBV DNA levels, either preoperatively or postoperatively, is associated with a higher risk of HCC recurrence and that this affects the effectiveness of the antiviral therapy administered after curative treatment for HBV-related HCC. Although IFN has antiproliferative, 8252 July 21, 2015 Volume 21 Issue 27

47 Kubo S et al. Management of HBV for HBV-related HCC antiangiogenic, and tumoricidal effects, IFN therapy may be accompanied by a substantial risk of hepatic decompensation in patients with advanced liver disease. While serum concentrations of HBV DNA become undetectable in most patients who undergo antiviral therapy with NAs, these compounds have no anticancer activity. Therefore, combining IFN and NAs may be an alternative strategy to prevent HCC recurrence after curative treatment for HBV-related HCC. Although IFN therapy and NAs are useful for preventing HCC recurrence and maintaining liver function after treatment for HBV-related HCC, there is insufficient evidence to reach a conclusion and consensus about the optimal perioperative antiviral therapy. Nevertheless, further studies are necessary to establish treatment guidelines for these patients. REFERENCES 1 Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, CA Cancer J Clin 2005; 55: [PMID: DOI: /canjclin ] 2 El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 3 Chen CJ, Yu MW, Liaw YF. Epidemiological characteristics and risk factors of hepatocellular carcinoma. J Gastroenterol Hepatol 1997; 12: S294-S308 [PMID: DOI: /j tb00513.x] 4 Fattovich G, Stroffolini T, Zagni I, Donato F. Hepatocellular carcinoma in cirrhosis: incidence and risk factors. Gastroenterology 2004; 127: S35-S50 [PMID: DOI: /j.gastro ] 5 Kubo S, Takemura S, Sakata C, Urata Y, Uenishi T. Adjuvant therapy after curative resection for hepatocellular carcinoma associated with hepatitis virus. Liver Cancer 2013; 2: [PMID: DOI: / ] 6 Kubo S, Hirohashi K, Tanaka H, Tsukamoto T, Shuto T, Yamamoto T, Ikebe T, Wakasa K, Nishiguchi S, Kinoshita H. Effect of viral status on recurrence after liver resection for patients with hepatitis B virus-related hepatocellular carcinoma. Cancer 2000; 88: [PMID: DOI: /(SICI) ( )88] 7 Kubo S, Hirohashi K, Tanaka H, Shuto T, Takemura S, Yamamoto T, Uenishi T, Kinoshita H, Nishiguchi S. Usefulness of viral concentration measurement by transcription-mediated amplification and hybridization protection as a prognostic factor for recurrence after resection of hepatitis B virus-related hepatocellular carcinoma. Hepatol Res 2003; 25: [PMID: DOI: /S (02) ] 8 Kubo S, Hirohashi K, Yamazaki O, Matsuyama M, Tanaka H, Horii K, Shuto T, Yamamoto T, Kawai S, Wakasa K, Nishiguchi S, Kinoshita H. Effect of the presence of hepatitis B e antigen on prognosis after liver resection for hepatocellular carcinoma in patients with chronic hepatitis B. World J Surg 2002; 26: [PMID: DOI: /s ] 9 Ohkubo K, Kato Y, Ichikawa T, Kajiya Y, Takeda Y, Higashi S, Hamasaki K, Nakao K, Nakata K, Eguchi K. Viral load is a significant prognostic factor for hepatitis B virus-associated hepatocellular carcinoma. Cancer 2002; 94: [PMID: DOI: /cncr.10557] 10 Hung IF, Poon RT, Lai CL, Fung J, Fan ST, Yuen MF. Recurrence of hepatitis B-related hepatocellular carcinoma is associated with high viral load at the time of resection. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 11 Chuma M, Hige S, Kamiyama T, Meguro T, Nagasaka A, Nakanishi K, Yamamoto Y, Nakanishi M, Kohara T, Sho T, Yamamoto K, Horimoto H, Kobayashi T, Yokoo H, Matsushita M, Todo S, Asaka M. The influence of hepatitis B DNA level and antiviral therapy on recurrence after initial curative treatment in patients with hepatocellular carcinoma. J Gastroenterol 2009; 44: [PMID: DOI: /s z] 12 Wu JC, Huang YH, Chau GY, Su CW, Lai CR, Lee PC, Huo TI, Sheen IJ, Lee SD, Lui WY. Risk factors for early and late recurrence in hepatitis B-related hepatocellular carcinoma. J Hepatol 2009; 51: [PMID: DOI: /j.jhep ] 13 Qu LS, Jin F, Huang XW, Shen XZ. High hepatitis B viral load predicts recurrence of small hepatocellular carcinoma after curative resection. J Gastrointest Surg 2010; 14: [PMID: DOI: /s ] 14 Kubo S, Nishiguchi S, Hamba H, Hirohashi K, Tanaka H, Shuto T, Kinoshita H, Kuroki T. Reactivation of viral replication after liver resection in patients infected with hepatitis B virus. Ann Surg 2001; 233: [PMID: DOI: / ] 15 Huang L, Li J, Lau WY, Yan J, Zhou F, Liu C, Zhang X, Shen J, Wu M, Yan Y. Perioperative reactivation of hepatitis B virus replication in patients undergoing partial hepatectomy for hepatocellular carcinoma. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: /j x] 16 Lao XM, Wang D, Shi M, Liu G, Li S, Guo R, Yuan Y, Chen M, Li J, Zhang Y, Lin X. Changes in hepatitis B virus DNA levels and liver function after transcatheter arterial chemoembolization of hepatocellular carcinoma. Hepatol Res 2011; 41: [PMID: DOI: /j X x] 17 Dan JQ, Zhang YJ, Huang JT, Chen MS, Gao HJ, Peng ZW, Xu L, Lau WY. Hepatitis B virus reactivation after radiofrequency ablation or hepatic resection for HBV-related small hepatocellular carcinoma: a retrospective study. Eur J Surg Oncol 2013; 39: [PMID: DOI: /j.ejso ] 18 Yang YF, Zhao W, Zhong YD, Xia HM, Shen L, Zhang N. Interferon therapy in chronic hepatitis B reduces progression to cirrhosis and hepatocellular carcinoma: a meta-analysis. J Viral Hepat 2009; 16: [PMID: DOI: / j x] 19 Miyake Y, Kobashi H, Yamamoto K. Meta-analysis: the effect of interferon on development of hepatocellular carcinoma in patients with chronic hepatitis B virus infection. J Gastroenterol 2009; 44: [PMID: DOI: /s z] 20 Dienstag JL, Goldin RD, Heathcote EJ, Hann HW, Woessner M, Stephenson SL, Gardner S, Gray DF, Schiff ER. Histological outcome during long-term lamivudine therapy. Gastroenterology 2003; 124: [PMID: DOI: /gast ] 21 Liaw YF, Sung JJ, Chow WC, Farrell G, Lee CZ, Yuen H, Tanwandee T, Tao QM, Shue K, Keene ON, Dixon JS, Gray DF, Sabbat J. Lamivudine for patients with chronic hepatitis B and advanced liver disease. N Engl J Med 2004; 351: [PMID: DOI: /NEJMoa033364] 22 Matsumoto A, Tanaka E, Rokuhara A, Kiyosawa K, Kumada H, Omata M, Okita K, Hayashi N, Okanoue T, Iino S, Tanikawa K. Efficacy of lamivudine for preventing hepatocellular carcinoma in chronic hepatitis B: A multicenter retrospective study of 2795 patients. Hepatol Res 2005; 32: [PMID: DOI: /j.hepres ] 23 Yuen MF, Seto WK, Chow DH, Tsui K, Wong DK, Ngai VW, Wong BC, Fung J, Yuen JC, Lai CL. Long-term lamivudine therapy reduces the risk of long-term complications of chronic hepatitis B infection even in patients without advanced disease. Antivir Ther 2007; 12: [PMID: ] 24 Hadziyannis SJ, Tassopoulos NC, Heathcote EJ, Chang TT, Kitis G, Rizzetto M, Marcellin P, Lim SG, Goodman Z, Ma J, Brosgart CL, Borroto-Esoda K, Arterburn S, Chuck SL. Long-term therapy with adefovir dipivoxil for HBeAg-negative chronic hepatitis B for up to 5 years. Gastroenterology 2006; 131: [PMID: DOI: /j.gastro ] 25 Schiff ER, Lee SS, Chao YC, Kew Yoon S, Bessone F, Wu SS, 8253 July 21, 2015 Volume 21 Issue 27

48 Kubo S et al. Management of HBV for HBV-related HCC Kryczka W, Lurie Y, Gadano A, Kitis G, Beebe S, Xu D, Tang H, Iloeje U. Long-term treatment with entecavir induces reversal of advanced fibrosis or cirrhosis in patients with chronic hepatitis B. Clin Gastroenterol Hepatol 2011; 9: [PMID: DOI: /j.cgh ] 26 Chang TT, Liaw YF, Wu SS, Schiff E, Han KH, Lai CL, Safadi R, Lee SS, Halota W, Goodman Z, Chi YC, Zhang H, Hindes R, Iloeje U, Beebe S, Kreter B. Long-term entecavir therapy results in the reversal of fibrosis/cirrhosis and continued histological improvement in patients with chronic hepatitis B. Hepatology 2010; 52: [PMID: DOI: /hep.23785] 27 Huang L, Li J, Yan J, Sun J, Zhang X, Wu M, Yan Y. Antiviral therapy decreases viral reactivation in patients with hepatitis B virus-related hepatocellular carcinoma undergoing hepatectomy: a randomized controlled trial. J Viral Hepat 2013; 20: [PMID: DOI: /jvh.12036] 28 Kardinal CG, Moertel CG, Wieand HS, Schutt AJ, O Connell MJ, Wright K, Wiesenfeld M, Tschetter LK, Krook JE. Combined doxorubicin and alpha-interferon therapy of advanced hepatocellular carcinoma. Cancer 1993; 71: [PMID: ] 29 Wong DK, Cheung AM, O Rourke K, Naylor CD, Detsky AS, Heathcote J. Effect of alpha-interferon treatment in patients with hepatitis B e antigen-positive chronic hepatitis B. A meta-analysis. Ann Intern Med 1993; 119: [PMID: DOI: / ] 30 Lin SM, Yu ML, Lee CM, Chien RN, Sheen IS, Chu CM, Liaw YF. Interferon therapy in HBeAg positive chronic hepatitis reduces progression to cirrhosis and hepatocellular carcinoma. J Hepatol 2007; 46: [PMID: DOI: / j.jhep ] 31 Cooksley WG, Piratvisuth T, Lee SD, Mahachai V, Chao YC, Tanwandee T, Chutaputti A, Chang WY, Zahm FE, Pluck N. Peginterferon alpha-2a (40 kda): an advance in the treatment of hepatitis B e antigen-positive chronic hepatitis B. J Viral Hepat 2003; 10: [PMID: DOI: / j x] 32 Niederau C, Heintges T, Lange S, Goldmann G, Niederau CM, Mohr L, Häussinger D. Long-term follow-up of HBeAg-positive patients treated with interferon alfa for chronic hepatitis B. N Engl J Med 1996; 334: [PMID: DOI: / NEJM ] 33 Ikeda K, Saitoh S, Suzuki Y, Kobayashi M, Tsubota A, Fukuda M, Koida I, Arase Y, Chayama K, Murashima N, Kumada H. Interferon decreases hepatocellular carcinogenesis in patients with cirrhosis caused by the hepatitis B virus: a pilot study. Cancer 1998; 82: [PMID: DOI: /(SICI) ( )82] 34 Lin SM, Sheen IS, Chien RN, Chu CM, Liaw YF. Long-term beneficial effect of interferon therapy in patients with chronic hepatitis B virus infection. Hepatology 1999; 29: [PMID: DOI: /hep ] 35 Oon CJ. Long-term survival following treatment of hepatocellular carcinoma in Singapore: evaluation of Wellferon in the prophylaxis of high-risk pre-cancerous conditions. Cancer Chemother Pharmacol 1992; 31 Suppl: S137-S142 [PMID: DOI: /BF ] 36 Lygidakis NJ, Pothoulakis J, Konstantinidou AE, Spanos H. Hepatocellular carcinoma: surgical resection versus surgical resection combined with pre- and post-operative locoregional immunotherapy-chemotherapy. A prospective randomized study. Anticancer Res 1995; 15: [PMID: ] 37 Lo CM, Liu CL, Chan SC, Lam CM, Poon RT, Ng IO, Fan ST, Wong J. A randomized, controlled trial of postoperative adjuvant interferon therapy after resection of hepatocellular carcinoma. Ann Surg 2007; 245: [PMID: DOI: /01. sla ] 38 Shen YC, Hsu C, Chen LT, Cheng CC, Hu FC, Cheng AL. Adjuvant interferon therapy after curative therapy for hepatocellular carcinoma (HCC): a meta-regression approach. J Hepatol 2010; 52: [PMID: DOI: / j.jhep ] 39 Sun HC, Tang ZY, Wang L, Qin LX, Ma ZC, Ye QH, Zhang BH, Qian YB, Wu ZQ, Fan J, Zhou XD, Zhou J, Qiu SJ, Shen YF. Postoperative interferon alpha treatment postponed recurrence and improved overall survival in patients after curative resection of HBV-related hepatocellular carcinoma: a randomized clinical trial. J Cancer Res Clin Oncol 2006; 132: [PMID: DOI: /s y] 40 Breitenstein S, Dimitroulis D, Petrowsky H, Puhan MA, Müllhaupt B, Clavien PA. Systematic review and meta-analysis of interferon after curative treatment of hepatocellular carcinoma in patients with viral hepatitis. Br J Surg 2009; 96: [PMID: DOI: /bjs.6731] 41 Lau WY, Lai EC, Lau SH. The current role of neoadjuvant/ adjuvant/chemoprevention therapy in partial hepatectomy for hepatocellular carcinoma: a systematic review. Hepatobiliary Pancreat Dis Int 2009; 8: [PMID: ] 42 Chen LT, Chen MF, Li LA, Lee PH, Jeng LB, Lin DY, Wu CC, Mok KT, Chen CL, Lee WC, Chau GY, Chen YS, Lui WY, Hsiao CF, Whang-Peng J, Chen PJ. Long-term results of a randomized, observation-controlled, phase III trial of adjuvant interferon Alfa-2b in hepatocellular carcinoma after curative resection. Ann Surg 2012; 255: 8-17 [PMID: DOI: / SLA.0b013e ff9] 43 Xu JB, Qi FZ, Xu G, Chen GF, Huang MD, Zhang JH. Adjuvant interferon therapy after surgical treatment for hepatitis B/C virusrelated hepatocellular carcinoma: A meta-analysis. Hepatol Res 2014; 44: [PMID: DOI: /hepr.12109] 44 Urata Y, Kubo S, Takemura S, Uenishi T, Kodai S, Shinkawa H, Sakae M, Kaneda K, Ohata K, Nozawa A, Suehiro S. Effects of antiviral therapy on long-term outcome after liver resection for hepatitis B virus-related hepatocellular carcinoma. J Hepatobiliary Pancreat Sci 2012; 19: [PMID: DOI: / s z] 45 Kubo S, Hirohashi K, Tanaka H, Tsukamoto T, Shuto T, Higaki I, Takemura S, Yamamoto T, Nishiguchi S, Kinoshita H. Virologic and biochemical changes and prognosis after liver resection for hepatitis B virus-related hepatocellular carcinoma. Dig Surg 2001; 18: [PMID: DOI: / ] 46 Chen CJ, Yang HI, Su J, Jen CL, You SL, Lu SN, Huang GT, Iloeje UH. Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 2006; 295: [PMID: DOI: /jama ] 47 Kubo S, Tanaka H, Takemura S, Yamamoto S, Hai S, Ichikawa T, Kodai S, Shinkawa H, Sakaguchi H, Tamori A, Habu D, Nishiguchi S. Effects of lamivudine on outcome after liver resection for hepatocellular carcinoma in patients with active replication of hepatitis B virus. Hepatol Res 2007; 37: [PMID: DOI: /j X x] 48 Kuzuya T, Katano Y, Kumada T, Toyoda H, Nakano I, Hirooka Y, Itoh A, Ishigami M, Hayashi K, Honda T, Goto H. Efficacy of antiviral therapy with lamivudine after initial treatment for hepatitis B virus-related hepatocellular carcinoma. J Gastroenterol Hepatol 2007; 22: [PMID: DOI: / j x] 49 Yoshida H, Yoshida H, Goto E, Sato T, Ohki T, Masuzaki R, Tateishi R, Goto T, Shiina S, Kawabe T, Omata M. Safety and efficacy of lamivudine after radiofrequency ablation in patients with hepatitis B virus-related hepatocellular carcinoma. Hepatol Int 2008; 2: [PMID: DOI: / s ] 50 Koda M, Nagahara T, Matono T, Sugihara T, Mandai M, Ueki M, Ohyama K, Hosho K, Okano J, Kishimoto Y, Kono M, Maruyama S, Murawaki Y. Necleotide analogs for patients with HBV-related hepatocellular carcinoma increase the survival rate through improved liver function. Inter Med 2009; 48: [DOI: / internalmedicine ] 51 Li N, Lai EC, Shi J, Guo WX, Xue J, Huang B, Lau WY, Wu MC, Cheng SQ. A comparative study of antiviral therapy after resection of hepatocellular carcinoma in the immune-active phase 8254 July 21, 2015 Volume 21 Issue 27

49 Kubo S et al. Management of HBV for HBV-related HCC of hepatitis B virus infection. Ann Surg Oncol 2010; 17: [PMID: DOI: /s z] 52 Chan AC, Chok KS, Yuen WK, Chan SC, Poon RT, Lo CM, Fan ST. Impact of antiviral therapy on the survival of patients after major hepatectomy for hepatitis B virus-related hepatocellular carcinoma. Arch Surg 2011; 146: [PMID: DOI: /archsurg ] 53 Wu CY, Chen YJ, Ho HJ, Hsu YC, Kuo KN, Wu MS, Lin JT. Association between nucleotide analogues and risk of hepatitis B virus-related hepatocellular carcinoma recurrence following liver resection. JAMA 2012; 308: [DOI: /2012. jama.11975] 54 Su CW, Chiou YW, Tsai YH, Teng RD, Chau GY, Lei HJ, Hung HH, Huo TI, Wu JC. The Influence of Hepatitis B Viral Load and Pre-S Deletion Mutations on Post-Operative Recurrence of Hepatocellular Carcinoma and the Tertiary Preventive Effects by Anti-Viral Therapy. PLoS One 2013; 8: e66457 [PMID: DOI: /journal.pone ] 55 Ke Y, Ma L, You XM, Huang SX, Liang YR, Xiang BD, Li LQ, Zhong JH. Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy. Cancer Biol Med 2013; 10: [PMID: ] 56 Yin J, Li N, Han Y, Xue J, Deng Y, Shi J, Guo W, Zhang H, Wang H, Cheng S, Cao G. Effect of antiviral treatment with nucleotide/ nucleoside analogs on postoperative prognosis of hepatitis B virusrelated hepatocellular carcinoma: a two-stage longitudinal clinical study. J Clin Oncol 2013; 31: [PMID: DOI: /JCO ] 57 Nishikawa H, Nishijima N, Arimoto A, Inuzuka T, Kita R, Kimura T, Osaki Y. Effect of nucleoside analog use in patients with hepatitis B virus-related hepatocellular carcinoma. Hepatol Res 2014; 44: [PMID: DOI: /hepr.12169] 58 Wong JS, Wong GL, Tsoi KK, Wong VW, Cheung SY, Chong CN, Wong J, Lee KF, Lai PB, Chan HL. Meta-analysis: the efficacy of anti-viral therapy in prevention of recurrence after curative treatment of chronic hepatitis B-related hepatocellular carcinoma. Aliment Pharmacol Ther 2011; 33: [PMID: DOI: /j x] 59 Qu LS, Liu JX, Kuai XL, Xu ZF, Jin F, Zhou GX. Significance of viral status on recurrence of hepatitis B-related hepatocellular carcinoma after curative therapy: A meta-analysis. Hepatol Res 2014; 44: [PMID: DOI: /hepr.12172] 60 Sun P, Dong X, Cheng X, Hu Q, Zheng Q. Nucleot(s)ide analogues for hepatitis B virus-related hepatocellular carcinoma after curative treatment: a systematic review and meta-analysis. PLoS One 2014; 9: e [PMID: DOI: / journal.pone ] 61 Wong GL, Chan HL, Chan HY, Tse PC, Tse YK, Mak CW, Lee SK, Ip ZM, Lam AT, Iu HW, Leung JM, Wong VW. Accuracy of risk scores for patients with chronic hepatitis B receiving entecavir treatment. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] P- Reviewer: Sonzogni A, Tziomalos K S- Editor: Qi Y L- Editor: A E- Editor: Liu XM 8255 July 21, 2015 Volume 21 Issue 27

50 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved Advances in Hepatocellular Carcinoma TOPIC HIGHLIGHT Grey zone in the Barcelona Clinic Liver Cancer Classification for hepatocellular carcinoma: Surgeons perspective Tian Yang, Wan-Yee Lau, Han Zhang, Bin Huang, Jun-Hua Lu, Meng-Chao Wu Tian Yang, Wan-Yee Lau, Han Zhang, Bin Huang, Jun-Hua Lu, Meng-Chao Wu, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai , China Wan-Yee Lau, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong, China Author contributions: Yang T, Zhang H, Huang B and Wu MC designed the research; Yang T, Lau WY and Lu JH wrote the paper; and Wu MC gave their critical comments. Supported by National Natural Science Foundation of China, No , No and No (to Tian Yang and Jun-Hua Lu). Conflict-of-interest statement: All authors declared no potential conflicts of interest. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Meng-Chao Wu, MD, Professor, Director of Eastern Hepatobiliary Surgery Hospital, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, No. 225, Changhai Road, Yangpu District, Shanghai , China. mengchao_wu@sina.com Telephone: Fax: Received: January 13, 2015 Peer-review started: January 14, 2015 First decision: April 13, 2015 Revised: April 29, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract Hepatocellular carcinoma (HCC) is the sixth most common cancer and the third most common cause of cancer-related deaths worldwide. The Barcelona Clinic Liver Cancer (BCLC) classification has been endorsed as the optimal staging system and treatment algorithm for HCC by the European Association for the Study of Liver Disease and the American Association for the Study of Liver Disease. However, in real life, the majority of patients who are not considered ideal candidates based on the BCLC guideline still were performed hepatic resection nowadays, which means many hepatic surgeons all around the world do not follow the BCLC guidelines. The accuracy and application of the BCLC classification has constantly been challenged by many clinicians. From the surgeons perspectives, we herein put forward some comments on the BCLC classification concerning subjectivity of the assessment criteria, comprehensiveness of the staging definition and accuracy of the therapeutic recommendations. We hope to further discuss with peers and colleagues with the aim to make the BCLC classification more applicable to clinical practice in the future. Key words: Hepatocellular carcinoma; Staging system; Barcelona Clinic Liver Cancer Classification; Treatment; Hepatectomy; Prognosis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: The accuracy and application of the Barcelona Clinic Liver Cancer (BCLC) classification for hepatocellular carcinoma has constantly been challenged by many clinicians. From the surgeons perspectives, we herein put forward some comments with an aim to make the BCLC classification more applicable to clinical practice in the future July 21, 2015 Volume 21 Issue 27

51 Yang T et al. Gray zone in BCLC classification Yang T, Lau WY, Zhang H, Huang B, Lu JH, Wu MC. Grey zone in the Barcelona Clinic Liver Cancer Classification for hepatocellular carcinoma: Surgeons perspective. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: Hepatocellular carcinoma (HCC) is the sixth most common cancer and the third most common cause of cancer-related deaths worldwide [1,2]. As HCC is usually associated with cirrhosis, the treatment is complex because of the need to be oncologically radical but liver parenchymal-destruction conservative [3]. Potentially curative treatments for HCC include liver resection, transplantation, or local ablative therapy [4]. The Barcelona Clinic Liver Cancer (BCLC) classification [5] has been endorsed as the optimal staging system and treatment algorithm for HCC by the European Association for the Study of Liver Disease (EASL) and the American Association for the Study of Liver Disease (AASLD) [6,7]. The main prognostic factors of this staging system are related to tumor status (defined by the number and size of nodules, the presence or absence of vascular invasion and the presence or absence of extrahepatic spread), liver function (defined by the Child-Pugh classification and portal hypertension), and general performance status defined by the Eastern Cooperative Oncology Group (ECOG). The BCLC classification links stage stratification with corresponding therapeutic recommendations, with liver resection recommended only to those patients harboring early-stage tumors (BCLC Stage A) [1,5,7]. However, a recent study published in Ann Surg [8] disclosed that in ten well-known hepatobiliary tertiary referral centers in the West and the East, 50% of patients harboring intermediate or advanced HCC still underwent surgery despite the BCLC guidelines recommend palliative treatments (chemoembolization or oral sorafenib). As liver surgeons, we would like to raise the following comments, which need to be discussed with and further clarified by the BCLC constitutors. First, judgment subjectivity exists in the BCLC classification to some extent, which takes root in the assessment of the ECOG PS itself (an important prognostic factor in this classification). According to the definition of the BCLC classification, patients with advanced HCC (i.e., BCLC stage C) include patients with cancer-related symptoms (PS 1-2), vascular invasion, extrahepatic spread, or a combination [1]. In other words, once the HCC patients have cancerrelated symptoms (PS 1 means still near fully ambulatory and PS 2 means less than 50% [9] ), they should be classified as advanced HCC (i.e., BCLC stage C). However, it is often difficult to judge whether atypical symptoms such as abdominal pain or malaise, are tumor-related or liver-related, as more than half of patients with HCC have cirrhosis at diagnosis. Actually, biases by physicians on subjective evaluation commonly exist in clinical practice, especially for those patients with a single HCC but with compensated cirrhosis (Child-Pugh A). In our opinion, even if the patient s symptoms are definitely tumor-related (i.e., PS 1-2), the diagnosis of advanced HCC in the BCLC classification is debatable. A female patient who complained of persistent right epigastric pain was diagnosed to harbor a single 3-cm HCC with compensated cirrhosis (Child- Pugh A). Her persistent abdominal pain (PS 2) was caused by an exophytic tumor growth compressing on the diaphragm (Figure 1). According to the BCLC classification, she had a BCLC stage C HCC. According to the BCLC guidelines, only oral sorafenib should be given. In actual fact curative HCC resection was successfully performed for this patient in August 2007, and she is still alive and disease-free. Additionally, although the BCLC constitutors tried very hard to take every possible situation into consideration, the truth is that in many HCC patients the situation is more complicated. For example, the BCLC classification gave full consideration of the presence of vascular invasion as an independent poor prognostic factor of HCC, but it never mentioned the presence of biliary invasion (Figure 2), which is a specific but not an uncommon type of HCC [10]. Previous studies has shown that the prognosis of HCC with biliary invasion with or without obstructive jaundice is as poor as HCC with vascular invasion despite treatment [11-13]. Should biliary invasion be included into the BCLC staging just like vascular invasion? It may be still a blind spot by the BCLC classification [14]. Another specific group of HCC patients who have never been mentioned in the BCLC classification is ruptured HCC (Figure 3), which happens in about 3%-15% of patients with HCC [15-18]. Once a patient develops acute spontaneous rupture of HCC (mostly PS 3-4 as a life-threatening complication), the patient should be classified according to the BCLC classification as having a terminal stage HCC (i.e., BCLC stage D). Should only supportive care be given to these patients in accordance with the BCLC guidelines? In numerous previously published studies, emergency transarterial embolization or liver resection (either emergency or staged) have been performed on these patients, and satisfactory results have been obtained, including saving lives in acute emergencies and even having occasional patients with long-term survival [15,16,18-22]. Thus, in our opinions, it is necessary for the BCLC classification to clarify this special but not uncommon situation of HCC so as to avoid some clinicians blindly adhering to the treatment guidelines. For most liver surgeons, it is not surprising that the authors of the recent study [8] stated that the BCLC treatment recommendation concerning surgery for HCC was too restrictive, and the authors suggested updating the EASL/AALSD therapeutic guidelines July 21, 2015 Volume 21 Issue 27

52 Yang T et al. Gray zone in BCLC classification A B Figure 1 Patient 1. A 55-year-old woman with a 30-year-history of hepatitis B virus infection presented with persistent right upper-quadrant pain. Her performance status was 2, her AFP was > 1000 μg/l and her liver function was Child-Pugh A. She was diagnosed with a Barcelona Clinic Liver Cancer stage C hepatocellular carcinoma (HCC) with compensated cirrhosis. A: MRI showed a single 3.0-cm tumor in segment 8 with exophytic growth towards the diaphragmatic dome; B: She underwent curative liver resection for HCC in August 2007, and is still alive and disease-free. A B Figure 2 Patient 2. A 42-year-old man presented with yellowish discoloration of skin. Liver function tests revealed obstructive jaundice. His performance status was 2, his AFP was 512 μg/l and his liver function was Child-Pugh B. He was diagnosed with a Barcelona Clinic Liver Cancer stage C hepatocellular carcinoma with biliary invasion. A: CT scan showed a 5.0-cm tumor with ill-defined margins in segment 6; B: MRCP showed a filling defect in the upper common bile duct. A B Figure 3 Patient 3. A 60-year-old man with documented hepatitis B virus infection complained of sudden right abdominal pain and temporary loss of consciousness. His performance status was 3 and his liver function was Child-Pugh A. He was diagnosed with hemorrhagic shock and a Barcelona Clinic Liver Cancer stage D hepatocellular carcinoma (HCC) presenting with spontaneous rupture. A and B: Magnetic resonance imaging showed a single 5.5-cm tumor in segment 6 and homogeneous liquid area around and below the right liver. He underwent emergency liver resection in January 2011 and subsequent abdominal wall metastasis resection in December He is still alive but he has developed intrahepatic recurrence of HCC. However, in two subsequent correspondences [23,24], Dr. Bruix (one of the BCLC constitutors) and other renowned scholars pointed out the misclassification between the BCLC stage A and B for some patients in the study. In the subsequent replies [25,26] by the authors, a large number of articles released by the BCLC constitutors [1,5-7,27-32] were listed which clearly indicated 5 cm was used as a cutoff point between the BCLC stages A and B (intermediate), and the variable of size was included as a criterion for the differentiation 8258 July 21, 2015 Volume 21 Issue 27

53 Yang T et al. Gray zone in BCLC classification A B Figure 4 Patient 4. A 54-year-old man with long-standing chronic hepatitis B virus (HBV) infection and cirrhosis was diagnosed with hepatocellular carcinoma (HCC) during an annual routine check-up. Six weeks before his hospitalization in our center, he received transcatheter arterial chemoembolization for HCC. His performance status was 0 and his liver function was Child-Pugh A. He was diagnosed with a Barcelona Clinic Liver Cancer stage A? B? HCC and HBV-related cirrhosis. A: Computed tomography scan showed a single 17.5-cm tumor in segments 5, 6, 7, and 8 with well-defined margins and sporadic lipiodol depositions within the tumor; H: He underwent curative liver resection of HCC in July 2012, and is still alive. between these two stages (Figure 4). Beyond any doubt, this is a high-level debate in academic circles because most of these participating scholars have published hundreds of academic papers in the field of HCC. What is worth reflecting on is why such a controversy on the BCLC classification should still exist among these top experts in HCC. Would it be even more confusing for the majority of ordinary clinicians? It seems incredible to us that this recent debate on which BCLC stage should a patient with HCC belong to is still on-going, as the BCLC classification has been proposed for 15 years [5] and it has passed through several sequential revisions [1,32,33]. Undoubtedly, HCC is one of the most complicated and heterogeneous disease which requires multidisciplinary management by a team of hepatologists, surgeons, interventional radiologists, oncologists, pathologists, and nurses. The purpose of formulation of a staging system is to provide accurate information for easy classification of patients into different risk groups. A precise staging helps to make therapeutic decisions and to estimate prognosis. Unfortunately, the best tool for staging HCC remains controversial. The lack of a consensus on an HCC staging system is mostly in part related to the heterogeneity in treatment modalities at diagnosis [34]. Therefore, as we think, it is necessary to establish specific HCC staging systems to assess prognosis, directed toward different treatment modalities, for example, for those patients with resectable or non-resectable HCC [35,36]. Considering the most complexities of HCC treatment among all malignancies, it was inadvisable and impractical to try conducting a specific or sole treatment modality for all HCCs by using a seemingly simple but uniform treatment algorithm just like the current BCLC guideline, which may well do more than good in the real life. Therefore, this should be the major intrinsic limitation of the BCLC classification, since this so-called authoritative guidance attempts generalize all probabilities of the treatment for patients with HCC. In addition, it should be noted that only surgery, radiofrequency ablation, TACE, oral sorafenib, and symptomatic treatment were recommended in the BCLC guideline, but many other effective or promising treatment modalities for HCC have never been mentioned by the BCLC treatment schedule, such as radiotherapy, Yttrium (90) radioembolization, cryotherapy, microwave coagulation therapy, laser therapy, traditional Chinese medicine, immunotherapy, and so on [37-41]. Therefore, it should be considered as biased and insufficient for the BCLC treatment guideline, which may also need to be further modified by the BCLC conductors in the future. It s worth mentioning that nowadays the majority of patients who are not considered ideal candidates based on the BCLC guideline still agree to undergo hepatic resection all around the world [8,42,43]. An international multicenter study by Roayaie et al [42] which reported a 5-year overall survival rate of > 30% in the candidates based on the current guidelines for HCC. This group of patients accounted for nearly 70% of all the patients who underwent hepatic resection during the study period. These figures tell us currently there are many hepatic surgeons who do not follow the guidelines for HCC according to the BCLC recommendation [44-46]. Are these surgeons irresponsible? Or have patients been misled by these surgeons to make a wrong decision? The superiority of the BCLC classification, when compared with other existing staging systems, is to provide treatment recommendations based on different stages of HCC. However, the validity of some of these recommendations requires further verification, since most of them are based on observational studies. Till now, there is still a lack of good high-level evidences in the field of HCC treatment (only fewer than one hundred RCTs on HCC have been published in the medical literature) [27]. Therefore, more clinical evidences need to be created and accumulated in the future. Admittedly, the evidences coming from RCTs 8259 July 21, 2015 Volume 21 Issue 27

54 Yang T et al. Gray zone in BCLC classification are more reliable and valuable than those coming from retrospective or prospective cohort studies, although it is not desirable to underestimate, or even deny, the true value of the latter types of studies. We should also recognize that it is difficult, sometimes even impossible to conduct a RCT, especially those involving surgery, as funding support for a surgical research is always the biggest obstacle compared with a new drug research. Adding to the complexity on therapeutic researches on HCC, whether multidisciplinary treatment is better than singly therapy, and whether personalized therapy would produce better results to an individual patient with HCC are questions which have not been answered. As Dr. Bruix [1] said, further refinement is still needed for the BCLC classification. We herein bring up our doubts and confusions about the BCLC classification. We hope to further discuss with peers and colleagues with an aim to make the BCLC classification more applicable to clinical practice in the future. REFERENCES 1 Forner A, Llovet JM, Bruix J. Hepatocellular carcinoma. Lancet 2012; 379: [PMID: DOI: / S (11) ] 2 Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, CA Cancer J Clin 2014; 64: 9-29 [PMID: DOI: / caac.21208] 3 El-Serag HB. Hepatocellular carcinoma. N Engl J Med 2011; 365: [PMID: DOI: /NEJMra ] 4 Maluccio M, Covey A. Recent progress in understanding, diagnosing, and treating hepatocellular carcinoma. CA Cancer J Clin 2012; 62: [PMID: DOI: /caac.21161] 5 Llovet JM, Brú C, Bruix J. Prognosis of hepatocellular carcinoma: the BCLC staging classification. Semin Liver Dis 1999; 19: [PMID: DOI: /s ] 6 Bruix J, Sherman M, Llovet JM, Beaugrand M, Lencioni R, Burroughs AK, Christensen E, Pagliaro L, Colombo M, Rodés J. Clinical management of hepatocellular carcinoma. Conclusions of the Barcelona-2000 EASL conference. European Association for the Study of the Liver. J Hepatol 2001; 35: [PMID: ] 7 Bruix J, Sherman M. Management of hepatocellular carcinoma: an update. Hepatology 2011; 53: [PMID: DOI: /hep.24199] 8 Torzilli G, Belghiti J, Kokudo N, Takayama T, Capussotti L, Nuzzo G, Vauthey JN, Choti MA, De Santibanes E, Donadon M, Morenghi E, Makuuchi M. A snapshot of the effective indications and results of surgery for hepatocellular carcinoma in tertiary referral centers: is it adherent to the EASL/AASLD recommendations?: an observational study of the HCC East-West study group. Ann Surg 2013; 257: [PMID: DOI: /SLA.0b013e b8] 9 Sørensen JB, Klee M, Palshof T, Hansen HH. Performance status assessment in cancer patients. An inter-observer variability study. Br J Cancer 1993; 67: [PMID: ] 10 Ikenaga N, Chijiiwa K, Otani K, Ohuchida J, Uchiyama S, Kondo K. Clinicopathologic characteristics of hepatocellular carcinoma with bile duct invasion. J Gastrointest Surg 2009; 13: [PMID: DOI: /s ] 11 Qin LX, Tang ZY. Hepatocellular carcinoma with obstructive jaundice: diagnosis, treatment and prognosis. World J Gastroenterol 2003; 9: [PMID: ] 12 Lai EC, Lau WY. Hepatocellular carcinoma presenting with obstructive jaundice. ANZ J Surg 2006; 76: [PMID: DOI: /j x] 13 Lau WY, Leung JW, Li AK. Management of hepatocellular carcinoma presenting as obstructive jaundice. Am J Surg 1990; 160: [PMID: ] 14 Yang T, Lin C, Zhai J, Shi S, Zhu M, Zhu N, Lu JH, Yang GS, Wu MC. Surgical resection for advanced hepatocellular carcinoma according to Barcelona Clinic Liver Cancer (BCLC) staging. J Cancer Res Clin Oncol 2012; 138: [PMID: DOI: /s ] 15 Lai EC, Lau WY. Spontaneous rupture of hepatocellular carcinoma: a systematic review. Arch Surg 2006; 141: [PMID: DOI: /archsurg ] 16 Liu CL, Fan ST, Lo CM, Tso WK, Poon RT, Lam CM, Wong J. Management of spontaneous rupture of hepatocellular carcinoma: single-center experience. J Clin Oncol 2001; 19: [PMID: ] 17 Yeh CN, Lee WC, Jeng LB, Chen MF, Yu MC. Spontaneous tumour rupture and prognosis in patients with hepatocellular carcinoma. Br J Surg 2002; 89: [PMID: ] 18 Buczkowski AK, Kim PT, Ho SG, Schaeffer DF, Lee SI, Owen DA, Weiss AH, Chung SW, Scudamore CH. Multidisciplinary management of ruptured hepatocellular carcinoma. J Gastrointest Surg 2006; 10: [PMID: ] 19 Lai EC, Wu KM, Choi TK, Fan ST, Wong J. Spontaneous ruptured hepatocellular carcinoma. An appraisal of surgical treatment. Ann Surg 1989; 210: [PMID: ] 20 Leung KL, Lau WY, Lai PB, Yiu RY, Meng WC, Leow CK. Spontaneous rupture of hepatocellular carcinoma: conservative management and selective intervention. Arch Surg 1999; 134: [PMID: ] 21 Yang T, Sun YF, Zhang J, Lau WY, Lai EC, Lu JH, Shen F, Wu MC. Partial hepatectomy for ruptured hepatocellular carcinoma. Br J Surg 2013; 100: [PMID: DOI: / bjs.9167] 22 Shimada R, Imamura H, Makuuchi M, Soeda J, Kobayashi A, Noike T, Miyagawa S, Kawasaki S. Staged hepatectomy after emergency transcatheter arterial embolization for ruptured hepatocellular carcinoma. Surgery 1998; 124: [PMID: ] 23 Mazzaferro V, Roayaie S, Poon R, Majno PE. Dissecting EASL/AASLD Recommendations With a More Careful Knife: A Comment on Surgical Misinterpretation of the BCLC Staging System. Ann Surg 2015; 262: e17-e18 [PMID: DOI: /SLA ] 24 Bruix J, Fuster J. A Snapshot of the Effective Indications and Results of Surgery for Hepatocellular Carcinoma in Tertiary Referral Centers: Is It Adherent to the EASL/AASLD Recommendations? An Observational Study of the HCC East-West Study Group. Ann Surg 2015; 262: e30 [PMID: DOI: /SLA ] 25 Torzilli G, Belghiti J, Kokudo N, Takayama T, Capussotti L, Nuzzo G, Vauthey JN, Choti MA, De Santibanes E, Donadon M, Makuuchi M. Reply to Letter: Dissecting EASL/AASLD Recommendations With a More Careful Knife: A Comment on Surgical Misinterpretation of the BCLC Staging System : Real Misinterpretation or Lack of Clarity Within the BCLC? Ann Surg 2015; 262: e18-e19 [PMID: DOI: / SLA ] 26 Torzilli G, Belghiti J, Kokudo N, Takayama T, Capussotti L, Nuzzo G, Vauthey JN, Choti MA, De Santibanes E, Donadon M, Makuuchi M. Reply to Letter: A Snapshot of the Effective Indications and Results of Surgery for Hepatocellular Carcinoma in Tertiary Referral Centers: Is It Adherent to the EASL/AASLD Recommendations? An Observational Study of the HCC East-West Study Group : When the Study Setting Ignores the Patients. Ann Surg 2015; 262: e30-e31 [PMID: DOI: / SLA ] 27 Bruix J, Sherman M. Management of hepatocellular carcinoma. Hepatology 2005; 42: [PMID: ] 28 European Association For The Study Of The Liver; European Organisation For Research And Treatment Of Cancer. EASL- EORTC clinical practice guidelines: management of hepatocellular 8260 July 21, 2015 Volume 21 Issue 27

55 Yang T et al. Gray zone in BCLC classification carcinoma. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 29 List MA, D Antonio LL, Cella DF, Siston A, Mumby P, Haraf D, Vokes E. The Performance Status Scale for Head and Neck Cancer Patients and the Functional Assessment of Cancer Therapy-Head and Neck Scale. A study of utility and validity. Cancer 1996; 77: [PMID: ] 30 Bruix J, Llovet JM. Prognostic prediction and treatment strategy in hepatocellular carcinoma. Hepatology 2002; 35: [PMID: DOI: /jhep ] 31 Bruix J, Llovet JM. Major achievements in hepatocellular carcinoma. Lancet 2009; 373: [PMID: DOI: /S (09) ] 32 de Lope CR, Tremosini S, Forner A, Reig M, Bruix J. Management of HCC. J Hepatol 2012; 56 Suppl 1: S75-S87 [PMID: DOI: /S (12) ] 33 Forner A, Reig ME, de Lope CR, Bruix J. Current strategy for staging and treatment: the BCLC update and future prospects. Semin Liver Dis 2010; 30: [PMID: DOI: / s ] 34 Chen CH, Hu FC, Huang GT, Lee PH, Tsang YM, Cheng AL, Chen DS, Wang JD, Sheu JC. Applicability of staging systems for patients with hepatocellular carcinoma is dependent on treatment method--analysis of 2010 Taiwanese patients. Eur J Cancer 2009; 45: [PMID: ] 35 Yang T, Zhang J, Lu JH, Yang LQ, Yang GS, Wu MC, Yu WF. A new staging system for resectable hepatocellular carcinoma: comparison with six existing staging systems in a large Chinese cohort. J Cancer Res Clin Oncol 2011; 137: [PMID: DOI: /s ] 36 op den Winkel M, Nagel D, Sappl J, op den Winkel P, Lamerz R, Zech CJ, Straub G, Nickel T, Rentsch M, Stieber P, Göke B, Kolligs FT. Prognosis of patients with hepatocellular carcinoma. Validation and ranking of established staging-systems in a large western HCC-cohort. PLoS One 2012; 7: e45066 [PMID: DOI: /journal.pone ] 37 Poon RT, Fan ST, Tsang FH, Wong J. Locoregional therapies for hepatocellular carcinoma: a critical review from the surgeon s perspective. Ann Surg 2002; 235: [PMID: ] 38 Poon D, Anderson BO, Chen LT, Tanaka K, Lau WY, Van Cutsem E, Singh H, Chow WC, Ooi LL, Chow P, Khin MW, Koo WH. Management of hepatocellular carcinoma in Asia: consensus statement from the Asian Oncology Summit Lancet Oncol 2009; 10: [PMID: DOI: /S (09) ] 39 Wu MC. [Traditional Chinese medicine in prevention and treatment of liver cancer: function, status and existed problems]. Zhongxiyi Jiehe Xuebao 2003; 1: [PMID: ] 40 Zhai XF, Chen Z, Li B, Shen F, Fan J, Zhou WP, Yang YK, Xu J, Qin X, Li LQ, Ling CQ. Traditional herbal medicine in preventing recurrence after resection of small hepatocellular carcinoma: a multicenter randomized controlled trial. J Integr Med 2013; 11: [PMID: DOI: /jintegrmed ] 41 Greten TF, Wang XW, Korangy F. Current concepts of immune based treatments for patients with HCC: from basic science to novel treatment approaches. Gut 2015; 64: [PMID: DOI: /gutjnl ] 42 Roayaie S, Jibara G, Tabrizian P, Park JW, Yang J, Yan L, Schwartz M, Han G, Izzo F, Chen M, Blanc JF, Johnson P, Kudo M, Roberts LR, Sherman M. The role of hepatic resection in the treatment of hepatocellular cancer. Hepatology 2015; Epub ahead of print [PMID: DOI: /hep.27745] 43 Vitale A, Burra P, Frigo AC, Trevisani F, Farinati F, Spolverato G, Volk M, Giannini EG, Ciccarese F, Piscaglia F, Rapaccini GL, Di Marco M, Caturelli E, Zoli M, Borzio F, Cabibbo G, Felder M, Gasbarrini A, Sacco R, Foschi FG, Missale G, Morisco F, Svegliati Baroni G, Virdone R, Cillo U. Survival benefit of liver resection for patients with hepatocellular carcinoma across different Barcelona Clinic Liver Cancer stages: a multicentre study. J Hepatol 2015; 62: [PMID: DOI: /j.jhep ] 44 Kokudo N. Is it a time to modify the BCLC guidelines in terms of the role of surgery? World J Surg 2015; 39: [PMID: DOI: /s ] 45 Zhong JH, Ke Y, Gong WF, Xiang BD, Ma L, Ye XP, Peng T, Xie GS, Li LQ. Hepatic resection associated with good survival for selected patients with intermediate and advanced-stage hepatocellular carcinoma. Ann Surg 2014; 260: [PMID: DOI: /SLA ] 46 Guglielmi A, Ruzzenente A, Conci S, Valdegamberi A, Vitali M, Bertuzzo F, De Angelis M, Mantovani G, Iacono C. Hepatocellular carcinoma: surgical perspectives beyond the barcelona clinic liver cancer recommendations. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] P- Reviewer: Schmidt L, Ling CQ S- Editor: Yu J L- Editor: A E- Editor: Liu XM 8261 July 21, 2015 Volume 21 Issue 27

56 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved Advances in Hepatocellular Carcinoma TOPIC HIGHLIGHT Clusterin: Review of research progress and looking ahead to direction in hepatocellular carcinoma Peng Xiu, Xiao-Feng Dong, Xin-Ping Li, Jie Li Peng Xiu, Xin-Ping Li, Jie Li, Department of General Surgery, Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan , Shandong Province, China Xiao-Feng Dong, Department of Hepatobiliary Surgery, The People s Hospital of Guangxi Zhuang Autonomous Region, Nanning , Guangxi Zhuang Autonomous Region, China Author contributions: Xiu P and Dong XF contributed equally to this work; Xiu P and Dong XF drafted the manuscript; Li XP retrieved the relevant literature; Li J designed the structure of this article and reviewed the final manuscript prior to submission. Supported by National Nature Science Foundation of China, No and No ; and Shandong Provincial Medicine and Health Science Technology Development Planning, China, No. 2013WS0145. Conflict-of-interest statement: The authors declare that they have no conflict of interest. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Jie Li, MD, PhD, Department of General Surgery, Shandong Provincial Qianfoshan Hospital, Shandong University, No Jingshi Road, Jinan , Shandong Province, China. lijie0503@126.com Telephone: Fax: Received: December 22, 2014 Peer-review started: December 23, 2014 First decision: March 10, 2015 Revised: April 1, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract Liver cancer, a large proportion of which is hepatocellular carcinoma (HCC), is diagnosed in more than people each year worldwide. Liver cancer is particularly prevalent in Asia, Sub-Saharan Africa and the South Pacific, where hepatitis B and hepatitis C infection rates are very high. However, due to resistance to chemotherapy, patients with intermediate and advanced-stage disease cannot benefit from this treatment. Clusterin, which is overexpressed in many different cancers, is a stress-induced cytoprotective protein that confers treatment resistance. Custirsen (OGX-011) is a novel 2 -methoxyethyl modified phosphorothioate antisense oligonucleotide that targets secretory clusterin protein expression and is currently in clinical trials for patients with different cancers. In recent years, a number of different clinical trials have been performed, and two phase Ⅲ clinical trials of custirsen evaluating combinations with chemotherapy in patients with metastatic castration-resistant prostate cancer and metastatic non-small cell lung cancer are currently in progress. The aims of this review are to summarize the current state of research on clusterin, predict future research directions and analyze the potential of the clinical application of custirsen in HCC. Key words: Hepatocellular carcinoma; Clusterin; Custirsen; Chemotherapy; Antisense oligonucleotides The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Resistance of liver cancer cells to chemotherapy continues to be a major clinical obstacle to extending the survival rate of patients with hepatocellular carcinoma (HCC). Custirsen, targeting secretory 8262 July 21, 2015 Volume 21 Issue 27

57 Xiu P et al. Clusterin in hepatocellular carcinoma clusterin protein expression, is currently in clinical trials for patients with different cancers and considered to play a role in chemosensitization. This review is to summarize the current state of research on clusterin, to predict future research directions and to analyze the potential of the clinical application of custirsen in HCC. Xiu P, Dong XF, Li XP, Li J. Clusterin: Review of research progress and looking ahead to direction in hepatocellular carcinoma. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8262.htm DOI: i INTRODUCTION Liver cancer is the sixth most common neoplasm and the second most frequent cause of cancer-related death worldwide, and hepatocellular carcinoma (HCC) accounts for 70%-90% of the total liver cancer burden [1-3]. HCC is often associated with liver cirrhosis resulting from major chronic liver diseases including chronic hepatitis B and C virus infections, alcoholic liver disease and non-alcoholic steatohepatitis. Despite improved diagnostic techniques and increased screening of high-risk patients in developed countries, only 20%-30% of patients with HCC are diagnosed in early stages and have the opportunity to receive potentially curative treatments (surgical resection, transplantation or local ablation). Another 20% of patients have multifocal intra-hepatic tumors. For these patients, trans-arterial chemoembolization (TACE) has been considered a standard treatment strategy. The remaining half of patients present with advanced disease and must receive systemic therapy without surgical treatment [4,5]. Decreasing tolerance to chemotherapy is the key to improving the curative effects of systemic therapy for HCC. Clusterin is a stress-induced cytoprotective chaperone that confers treatment resistance and is overexpressed in response to cellular stress across a number of cancers, including standard cancer treatments, such as hormone therapy, radiation therapy and chemotherapy. Custirsen (OGX-011) is a novel phosphorothioate antisense oligonucleotide (ASO) compound that targets expression of the secretory clusterin protein (sclu) [6,7]. This review aims to summarize important data and review research progress about the role of novel targeted agents in enhancing chemotherapy sensitivity and then indicate the potential research direction in HCC. CLUSTERIN GENE STRUCTURE AND FUNCTION The Clusterin (CLU) gene is a single-copy gene, located on chromosome 8p21-p12, where it is organized into nine exons, eight introns and a 5 -untranslated region, and it encodes three different transcriptional isoforms in humans [isoform 1, NM_001831, mrna (GenBank); isoform 2, NR_038335, non-coding RNA (GenBank); and isoform 3, NR_045494, non-coding RNA (GenBank)] [8]. The latest data from GenBank showed that isoform 1 encodes the functional protein and isoforms 2 and 3 represent non-coding RNAs due to the presence of an upstream ORF that is predicted to interfere with translation of the longest ORF. In humans, there are two proteins encoded by this gene: secretory CLU protein (sclu) (75-80 kda) and nuclear CLU protein (nclu) (55 kda) [9,10]. The CLU gene encodes for an mrna of 2877 bp, which translates to a 449-amino acid polypeptide. The first 22 amino acids of the secretory glycoprotein (75-80 kda) represent a classical hydrophobic leader signal sequence, and these acids are translated into a leader polypeptide that targets the protein to the endoplasmic reticulum (ER). There, the 22-mer peptide is removed through proteolytic processing, producing a 50-kDa precursor, which is further processed to a 60-kDa form in the ER. As the protein is transported to the Golgi complex, it is glycosylated and further proteolytically cleaved into two 40-kDa subunits, α- and b-chains. Then, the two subunits are assembled into a heterodimeric complex, which is linked by five disulfide bonds [9,11]. The nuclear CLU protein (55 kda) is synthesized from a truncated, alternatively spliced nuclear clusterin mrna, which lacks exon Ⅱ (containing the first AUG and encoding the ER-targeting secretion signal sequence). Exons Ⅰ and Ⅲ are spliced together, placing the second in-frame AUG in exon Ⅲ as the first available translation start site. Translation of the nuclear clusterin mrna produces a about 49-kDa pre-nuclear clusterin (pnclu) protein, which localizes in the cytoplasm and remains dormant, presumably by hiding the nuclear localization site (NSL) within the C-terminal portion of the protein. Following whole-body ionizing radiation (IR) or cell damage, the pnclu protein can be post-translationally modified to generate a mature about 55-kDa proapoptotic protein form (nclu), which has N-and C-terminal coiled-coil domains [10,12]. Multiple reports have shown that the sclu protein is cytoprotective and anti-apoptotic, whereas the nclu protein is proapoptotic [10,13]. Overexpression of sclu in human prostate cancer cells results in treatment resistance and cytoprotection against TNF, androgen withdrawal, and a variety of cytotoxic agents, such as paclitaxel, gemcitabine, cisplatin and docetaxel, whereas depletion of the sclu protein using sirna increases sensitivity to treatment [14-18]. Similar sclu properties have been observed in chemoresistance to various chemotherapeutic agents found in many other tumor types, including breast, lung, kidney and pancreas cancer cells [13,17,19-22]. Based on these results, targeting sclu to sensitize cancer cells to chemotherapy 8263 July 21, 2015 Volume 21 Issue 27

58 Xiu P et al. Clusterin in hepatocellular carcinoma has become an attractive new strategy for cancer treatment. CUSTIRSEN (OGX-011) IN CLINICAL TRIALS Antisense oligonucleotide (ASO) therapy is a method for inhibiting specifically targeted genes. ASOs are short synthetic analogues of natural nucleic acids, complementary to mrna regions of a targeted gene that induce selective degradation of the mrna or inhibit translation of the selected mrna into protein [23]. Custirsen is a second-generation 2 -MOE-modified phosphorothioate ASO, which is a 21-nucleoside complement to the clusterin gene exon Ⅱ mrna translation initiation site with one CpG motif. It is considered to be a potent inhibitor of sclu expression in vitro, in vivo and in human clinical trials, with no apparent effect on the expression of nclu [20]. Hence, custirsen plays the role of chemosensitization by influencing the anti-apoptotic protein sclu instead of the pro-apoptotic protein nclu. In preclinical studies, custirsen significantly increased the treatment effects of hormone therapy and chemotherapy in multiple tumors, including non-small cell lung, prostate, breast, bladder and kidney cancers [9,13,18]. Thus far, there have been three phase Ⅰ and six phase Ⅱ clinical trials, which have been completed with a total of 390 patients enrolled (101 patients in phase Ⅰ and 289 patients in phase Ⅱ) [24-29]. Phase Ⅰ clinical trials Twenty-five patients with localized prostate carcinoma and high-risk features (the first-in-humans phase Ⅰ trial), were treated with custirsen (40 mg, 80 mg, 160 mg, 320 mg, 640 mg) by 2-h intravenous infusion on days 1, 3, 5, 8, 15, 22, and 29 for one cycle. Then, radical prostatectomy was performed within 7 d of the last custirsen dose. In this trial, one subject was designated to determine the relationship between the plasma and prostate tissue concentration of custirsen and clusterin expression in prostate tissues and lymph nodes following dose-dependent custirsen treatments. Custirsen treatment in all of the patients was well tolerated and produced a custirsen distribution in the prostate tissues, with a dose-dependent decrease in clusterin expression and an associated increase in the apoptotic index. Furthermore, an effective biologic dose of 640 mg was established for phase Ⅱ trials, based on its ability to suppress clusterin mrna expression by > 90% [24]. In the subsequent phase Ⅰ trial [25], 40 patients with different malignancy types, including prostate, ovary, renal, non-small cell lung, bladder and breast cancers, were enrolled in two groups with treatments of escalating doses of custirsen (40 mg-640 mg) with weekly docetaxel (30 mg/m 2, intravenous) or docetaxel (75 mg/m 2, intravenous) every 3 wk. In this study, custirsen at a biologically active dose was shown to be viable when combined with standard doses of docetaxel. More importantly, although the incidence of gastrointestinal toxicity was higher for higher dose levels of custirsen, the overall toxicity of the combination was mild or moderate. Furthermore, the incidence and quality of these toxicities were considered consistent with those of single-agent docetaxel, and there was no significant worsening with dose escalation. In addition, a consistent decrease in serum clusterin level was observed at the 640 mg dose, which has been recommended as the biologically effective dose for subsequent phase Ⅱ trials. The third trial, registered in Clinical Trials.-Gov., was an openlabel, one-arm, one-sequence crossover drug-drug interaction study in advanced solid tumor subjects whose aim was to evaluate the potential effects of custirsen on the pharmacokinetics of paclitaxel. This trial started on December 9, 2011, and was completed in October The results of this trial are being analyzed, and thus for, no original articles have been published in PubMed (Table 1). Phase Ⅱ clinical trials Six phase Ⅱ clinical trials of custirsen were performed to further evaluate the safety and efficacy of custirsen in combination with various cancer therapies: three prostate cancer trials [26,27] ; one lung cancer trial [28] ; and one breast cancer trial [29]. In the breast cancer trial, five of fifteen patients had confirmed partial responses for an overall response rate of 33%, which was one of the primary objectives of this trial. The median duration of stable disease was 9.3 mo, and the toxic effects were similar to those with single-agent docetaxel. Serum clusterin levels as mean percentage changes (relative to baseline) decreased to 23.3%, 25.9% and 32.1% on days 8, 15, and 22, respectively, yet there was no relationship between the response rate and the serum clusterin [29]. Subsequently, in lung cancer trial, the results were confirmed by Laskin et al [28] In this trial, custirsen was administered for patients with NSCLC. Tumor response to custirsen in combination with gemcitabine/platinum occurred in 25 (31%) of 81 patients, and the 1- and 2-year survival rates were 54% and 30%, respectively. The toxicity of the combination was not obviously different from what has been reported for gemcitabine/platinum combinations. Serum CLU levels were significantly decreased after custirsen treatment by day 1 of cycle 2 or 3, with 52 of the 55 patients exhibiting a reduction in CLU during treatment compared with their baseline levels (Table 2). Then subsequently, a total of 82 patients with metastatic CRPC were enrolled in a multicenter trial to evaluate the clinical and biologic activity of custirsen in combination with standard docetaxel and prednisone treatment [26]. Median serum clusterin decreased by 26% in the custirsen plus docetaxel/prednisone arm (arm A, 41 patients) and increased by 0.9% in the 8264 July 21, 2015 Volume 21 Issue 27

59 Xiu P et al. Clusterin in hepatocellular carcinoma Table 1 Summary of the phase Ⅰ clinical trials of custirsen Clinical trial Notes Drugs Patients, n Phase OGX [24] Hormone therapy and OGX-011 before radical prostatectomy in treating patients with prostate cancer (NCT ) OGX [25] OGX-011 and docetaxel in treating patients with metastatic or locally recurrent solid tumors (NCT ) OGX A clinical study in cancer patients to investigate the potential impact of custirsen on the blood levels of the chemotherapeutic drug, paclitaxel, when given together as part of a treatment regimen (NCT ) Dose escalation, single-center study in patients receiving hormone therapy and custirsen prior to radical prostatectomy Dose escalation, multi-center, study with custirsen in combination with docetaxel in patients with CRPC, NSCLC, breast, ovarian, bladder or renal cancer Open-label, one arm, one-sequence crossover drugdrug interaction study in advanced solid tumors subjects to evaluate the potential effect of custirsen on the pharmacokinetics of paclitaxel Buserelin, custirsen sodium, flutamide Custirsen sodium, docetaxel Custirsen, paclitaxel and carboplatin 25 Ⅰ 40 Ⅰ 36 Ⅰ docetaxel/prednisone only arm (arm B, 41 patients). A PSA decrease of 50 was observed in 23 patients in arm A and 22 patients in arm B. The results from this trial also showed that the median PFS time and the median OS estimate were 7.3 mo and 23.8 mo in arm A and 6.1 mo and 16.9 mo in arm B, respectively. This trial demonstrated that clusterin is a useful therapeutic target, and it supported the conclusion of improved survival outcomes for patients treated with docetaxel and custirsen, so further evaluation of the combination (phase Ⅲ trial) is warranted. In a recent phase Ⅱ trial of custirsen, male patients were randomized to receive docetaxel/mitoxantrone in combination with custirsen to evaluate the safety and efficacy of two secondline treatments for mcrpc [27]. Twenty patients were treated with docetaxel plus custirsen (arm A), and twenty-two patients were treated with mitoxantrone plus custirsen (arm B). The overall survival rate and median time to pain progression were 15.8 mo and 10.0 mo in arm A and 11.5 mo and 5.2 mo in arm B, respectively. PSA decreases of 90% or more, 50% or more, and 30% or more occurred in 4, 8 and 11 patients, respectively, in arm A, and PSA decreases of 50% or more and 30% or more in 6 and 7 patients, respectively, in arm B. This trial provided the evidence that combining custirsen with chemotherapy is feasible in patients with progressive metastatic CRPC following first-line docetaxel therapy and that custirsen treatment significantly reduces the mean CLU level during treatment, compared with baseline. For the first time, this trial identified a correlation between serum levels and survival that supported further evaluation of serum CLU, which is being evaluated in phase Ⅲ studies of custirsen as a predictive biomarker. Another trial was designed to assess the effects of combined hormone ablation therapy and weekly treatment with custirsen prior to surgery in patients with localized prostate cancer. Twenty-four patients were enrolled in this trial and were treated with an LHRH agonist in combination with weekly custirsen treatment for 12 wk, with prostatectomy performed within 14 d of the last dose of custirsen. Decreased expression of clusterin and an increase in the apoptotic index of prostate tumor cells were observed, although neoadjuvant treatment was not associated with pathologic complete response. Ongoing phase Ⅲ clinical trials Currently, there are two randomized, global, phase Ⅲ trials of custirsen in combination with chemotherapy agents compared with chemotherapy agents alone. The AFFINITY trial (NCT ) aims to compare cabazitaxel/prednisone alone to a combination with custirsen for second-line chemotherapy in prostate cancer. This trial is a randomized, open-label, multicenter, international trial that was designed to confirm that adding custirsen to cabazitaxel/prednisone treatment can slow tumor progression and enhance survival outcomes compared to standard cabazitaxel/ prednisone treatment in men with metastatic CRPC. A total of approximately 630 patients will be randomized in equal numbers to the two arms. The estimated study completion date of this trial is December Another phase Ⅲ trial, known as ENSPIRIT (NCT ), has been designed to compare the overall survival of patients randomized to receiving custirsen in combination with docetaxel (arm A) to that of patients randomized to receive docetaxel alone (arm B). Eleven hundred patients with advanced or metastatic NSCLC who have failed platinum-based therapy will be required for this trial. This trial started in September 2012, and it is estimated to conclude in July 2017 (Table 3). One completed phase Ⅲ trial The phase Ⅲ SYNERGY trial was completed in April 2014, and was designed to confirm that adding custirsen to standard first-line docetaxel/prednisone treatment could slow tumor progression and enhance survival outcomes compared to standard firstline docetaxel/prednisone treatment alone. In this trial, 1000 male patients with prostate cancer were randomly assigned with equal probability to two arms. In the first half of 2014, the results from this trial were announced by the company OncoGenex 8265 July 21, 2015 Volume 21 Issue 27

60 Xiu P et al. Clusterin in hepatocellular carcinoma Table 2 Summary of the phase Ⅱ clinical trials of custirsen Clinical trial Notes Drugs Patients, n OGX [26] Docetaxel and prednisone with or without OGX-011 in treating patients with recurrent or metastatic prostate cancer that did not respond to previous hormone therapy (NCT ) 0GX Hormone ablation therapy in patients with localized prostate cancer OGX [28] A study of OGX-011/Gemcitabine/Platinum-based regimen in stage ⅢB/Ⅳ non-small cell lung cancer (NCT ) OGX [29] OGX-011 and docetaxel in treating women with locally advanced or metastatic breast cancer (NCT ) OGX [27] Evaluation of safety and feasibility of OGX-011 in combination with second line chemotherapy in patients with HRPC (NCT ) Assessing the effects of combined therapy with androgen ablation and OGX-011 given prior to radical prostatectomy on pathologic complete response rates in men with localized prostate cancer and high risk features (NCT ) Randomized, two-arm, open label, multicenter study in patients who received docetaxel/prednisone with/without custirsen A single-arm, open-label, single center study to assess the effects of combined hormone ablation therapy and weekly treatment with custirsen prior to surgical removal of the prostate gland An open-label trial to assess the safety and anti-tumor effect of OGX-011 when given to patients in combination with GEM and CIS/CARB To study how well giving OGX-011 together with docetaxel works in treating women with locally advanced or metastatic breast cancer A multicenter, open-label, randomized study evaluating the safety and feasibility of custirsen in combination with second line chemotherapy in patients with HRPC An open-label, non-blinded, phase Ⅱ clinical, tissue pharmacokinetic and pharmacodynamics study of weekly OGX-011 and neoadjuvant hormone therapy prior to radical prostatectomy in patients with localized prostate carcinoma and high risk features Custirsen sodium: 640 mg iv for 2 h-cycle 1: days 7, 5, 3, 1, 8, 15 (4 wk cycle) Docetaxel: 75 mg/m 2 iv for 1 h-day 1 every 3 wk (3 wk cycles) Prednisone: 5 mg PO bid LHRH agonist (hormone ablation) was given with weekly custirsen treatment for 12 wk and prostatectomy performed within 14 d of the last dose of custirsen Custirsen sodium: 640 mg iv for 2 h Cycle 1: days 7, 5, 3 and days 1, 8, 15 of every 21-d cycle GEM: days 1 and 8 Cisplatin/Carboplatin: day 1 6 cycle 2 Custirsen sodium: 640 mg iv for 2 h on days 7, 5, 3, 1, 8 and 15 of cycle 1 and on days 1, 8, 15 on the other cycle Docetaxel: 75 mg/m 2 iv for 1 h on days 1 and 8 Prednisone: 5 mg twice daily through completion of the final treatment cycle. Custirsen: 640 mg iv for 2 h on days 9 to 1 of every cycle Mitoxantrone: 12 mg/m 2, iv on day 1. Docetaxel: 75 mg/m 2, iv on day 1 Neoadjuvant hormone therapy: buserelin 9.9 mg subcutaneously 1 injection with flutamide 250 mg orally tid for the first 4 wk OGX-011: 640 mg by intravenous infusion over 2 h on days 1, 3, and Pharmaceuticals. The results suggested that custirsen plus standard first-line docetaxel/prednisone therapy did not display a statistically significant improvement in overall survival in male patients with metastatic CRPC, compared to docetaxel/prednisone alone (median survival: 23.4 mo and 22.2 mo, respectively). A thorough analysis of this trial must be performed to explore the potential key factors that might have contributed its results. Although the results of this phase Ⅲ trial were unexpected, there are still two phase Ⅲ trials and one phase Ⅱ trial ongoing. We need to await the results from the ongoing trials to perform a comprehensive analysis of data from completed trials (Table 3). Preclinical studies of sclu in HCC The CLU gene was first detected in ram rete testis fluid and was subsequently found in many different tissues [30-32]. Thus, at the beginning of study into the gene, it had many different names, such as SGP-2 [33], SP40-40 [31], TRPM-2 [34], and ApoJ [35]. After complete cdna cloning, sequencing and comparison, it was proved that SGP-2 and TRPM-2 were identical to CLU [36,37]. Today, this protein is officially named CLU. It was detected for the first time in HCC by Tobe et al [38], who found that SP40-40 could be expressed in hepatoma cells and also provided further evidence for the assignment of the human SP40-40 gene to chromosome 8. sclu is a unique glycoprotein thought to be involved in numerous physiological processes, including lipid transport, the regulation of complement function, programmed cell death and membrane recycling by regulating some potential pathways (Figure 1) [39]. The Burkey group found that human HCC cells (HepG2) could secrete Apo lipoprotein J (Apo-J), another name for sclu, in association with a significant amount of lipid, providing unequivocal evidence that Apo-J could transport lipids [35]. This research also demonstrated that Apo-J was a secreted lipid transport protein associated with all of the major lipid classes that could play an important role in lipid transportation. In addition, other researchers found that TRPM-2 mrna could be induced by heat shock treatment of the human culture cell line HepG2 [40] ; and this heat shock induction was observed in culture cells derived from different animal species. Because 8266 July 21, 2015 Volume 21 Issue 27

61 Xiu P et al. Clusterin in hepatocellular carcinoma Table 3 Summary of the phase Ⅲ clinical trials of custirsen Phase Ⅲ trial Treatment and Arms Patients, n Completion Date ENSPIRIT A multinational, randomized, open-label study of custirsen in patients with advanced or metastatic non-small cell lung cancer (NCT ) Arm A: Custirsen Docetaxel Custirsen: Three loading doses of custirsen 640 mg iv over 2 h administered in 5 to 9 d prior to day 1 of cycle 1, then custirsen 640 mg iv weekly every 21-d cycle Docetaxel: 75 mg/m 2 iv over 1 h on day 1 of every 21-d cycle Arm B: Docetaxel Docetaxel: 75 mg/m 2 iv over 1 h on day 1 of every 21-d cycle until disease progression, unacceptable toxicity, withdrawal of consent or protocol specified parameters to stop treatment 1100 July, 2017 AFFINITY Drugs: cabazitaxel, prednisone, custirsen sodium 630 December, 2015 Comparison of cabazitaxel/prednisone alone or in combination with custirsen for second line chemotherapy in prostate cancer (NCT ) SYNERGY Comparison of docetaxel/prednisone to docetaxel/prednisone in combination with OGX-011 in men with prostate cancer (NCT ) Following 2 loading doses of custirsen (640 mg iv), cabazitaxel (25 mg/2 iv) is administered on a 3-wk cycle with weekly custirsen (640 mg iv) and daily prednisone (10 mg PO) until disease progression, unacceptable toxicity, or completion of 10 cycles Drugs: cabazitaxel, prednisone Cabazitaxel (25 mg/m 2 iv) is administered on a 3-wk cycle with daily prednisone (10 mg PO) until disease progression, unacceptable toxicity, or completion of 10 cycles Drugs: custirsen sodium, docetaxel, prednisone Docetaxel/prednisone on a 3-wk cycle with weekly OGX mg infusions until disease progression, unacceptable toxicity, or completion of 10 cycles. Drugs: docetaxel, prednisone Docetaxel/prednisone on a 3-wk cycle until disease progression, unacceptable toxicity, or completion of 10 cycles 1023 April, 2014 there might be a relationship between heat shock and apoptosis [41], TRPM-2 might play a role in the process of apoptosis [40]. As research continued, sclu was found to be expressed in many human tumors, including breast, lung, bladder, kidney and prostate cancers. Its expression has been documented to lead to broad-based resistance to other unrelated chemotherapeutic agents such as doxorubicin and cisplatin [14-16,18]. To explore the expression of clusterin in HCC, Kang et al [42] examined 100 surgically resected HCCs using the tissue microarray method, and they found that a total of 89 HCCs exhibited clusterin overexpression, which was associated with poor Edmondson s histological grades and high TNM stages. Another group demonstrated that CLU overexpression was an important factor for metastasis and this might be related to YKL-40 in playing the metastatic role in HCC. However, the study by Aigelsreiter et al [43] found the opposite results after analysis, and the authors reported that the reasons for this discrepancy might be methodological differences or differences in antigen preservation. In addition, Hsieh et al [44] suggested that dysregulation of the clusterin gene in human hepatoma was most likely due to cellular responses to external stresses, particularly during sample collection procedures, rather than due to any correlations with hepatoma development or progression. External stresses or micro-environmental changes can greatly affect gene or protein expression. Although there is varying sclu protein expression in a number of different liver cancer tissues, sclu might also contribute to resistance of HCC to chemotherapy and could play a role in promoting HCC metastasis [45]. Our previous results demonstrated that overexpression of sclu abrogated OXA-induced inhibition of cell growth and cell apoptosis, but depletion of sclu synergized with OXA to inhibit cell growth and enhance cell apoptosis, by regulating the proteins involved in mitochondrial apoptosis pathways. sclu could be a novel molecular target for overcoming OXA resistance in HCC [21,22]. In recent years, an increasing number of reports have provided evidence that a proteomic approach is a promising method for discovering and identifying novel biomarkers for HCC. In Asako Kimura s research, three-step proteome analyses were performed in serum samples, and 83 up-regulated proteins, the most significantly overexpressed of which was sclu, were found in the serum of HCC patients. The overexpression of serum sclu was confirmed by ELISA using another group of HCC samples, and the author confirmed that sclu was a potential novel serum marker for HCC [46]. The same conclusion was also verified by another research center [47]. However, opposite conclusions were obtained from three different research groups [48-50], all of which demonstrated that serum sclu levels in HCC patients were significantly lower than those in healthy patients but statistically higher than in cirrhosis patients. The reasons for this discrepancy might include that the total number of cases was insufficient and that the selection criteria for patients were different. Therefore, a large number of clinical trials in different research centers are necessary to explore the potential of serum clusterin as a biomarker in HCC July 21, 2015 Volume 21 Issue 27

62 Xiu P et al. Clusterin in hepatocellular carcinoma Growth factors, Cytokines, etc Treatment stress IR IGFR Src Hypoxia Cytoplasm PI3K PTEN Hif-1α sclu Golgiosome MEK1/2 Akt Apoptosis Bax Bad Bcl-x1 Caspase 3 ERK1/2 Bax Bcl2 Cyto C Caspase 9 Apaf 1 PVHL Pro-apoptotic ER 449 amino acid Cytoplasm nclu Nucleus CLU promotor Figure 1 Potential mechanisms of secretory clusterin in tumors [21,22,39]. ER: Endoplasmic reticulum; Cyto C: Cytochrome c; IGFR: Insulin-like factor receptor. CONCLUSION Custirsen (OGX-011) is a second-generation antisense molecule designed to block the expression of the protein sclu, which is up-regulated in tumor cells in response to treatment interventions, such as chemotherapy, hormone ablation and radiation therapy. In recent years, studies of the Clusterin gene have led to the understanding of entirely new mechanisms of cancer drug resistance (Figure 1). Studies from multiple canters worldwide have indicated the potential for the development of therapeutic strategies that aim to overcome cancer cell drug resistance and the targeting of clusterin as an early diagnostic serum biomarker in HCC. However, in the coming years, questions remain regarding the role of Clusterin gene in HCC that must be explored. First, additional experiments exploring the expression of sclu in HCC tissues are required to confirm the relationships between sclu expression and clinicopathologic parameters in HCC patients, and more samples are needed from HCC patients with HBV or HCV infection from multiple research centers. Second, in recent years, an increasing number of reports have provided evidence that clusterin could be a novel biomarker for HCC. However, the research about the pertinence of sclu expression in tumor tissues and blood serum is limited. If we could find the relationship between the sclu expression in tumor tissues and blood serum, in other words, if the contents of sclu in blood serum could predict the expression of sclu in tumor tissues, there will be of great significance for the individualized treatment in HCC. Third, understanding the mechanisms and the signaling pathways regulated by sclu could be critical to unravelling the solution for multi-drug resistance in HCC. Then, further investigations should be targeted at the mechanisms and signaling pathways regulated by sclu in HCC. Furthermore, although additional 8268 July 21, 2015 Volume 21 Issue 27

63 Xiu P et al. Clusterin in hepatocellular carcinoma preclinical trials and clinical trials are necessary to explore the role of sclu in HCC, targeting the sclu with custirsen could also validate the approach as a systemic therapy to increase chemotherapy sensitivity. A deeper understanding of the mechanisms and the role of sclu in anticancer drug resistance might reveal that custirsen is a valuable therapeutic agent for overcoming anticancer drug resistance in advanced HCC. REFERENCES 1 Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, CA Cancer J Clin 2015; 65: [PMID: DOI: /caac.21262] 2 Scaggiante B, Kazemi M, Pozzato G, Dapas B, Farra R, Grassi M, Zanconati F, Grassi G. Novel hepatocellular carcinoma molecules with prognostic and therapeutic potentials. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20. i5.1268] 3 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011; 61: [PMID: DOI: /caac.20107] 4 Llovet JM, Bruix J. Systematic review of randomized trials for unresectable hepatocellular carcinoma: Chemoembolization improves survival. Hepatology 2003; 37: [PMID: DOI: /jhep ] 5 Chan SL, Yeo W. Targeted therapy of hepatocellular carcinoma: present and future. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: /j x] 6 Chi KN, Zoubeidi A, Gleave ME. Custirsen (OGX-011): a secondgeneration antisense inhibitor of clusterin for the treatment of cancer. Expert Opin Investig Drugs 2008; 17: [PMID: DOI: / ] 7 Zielinski R, Chi KN. Custirsen (OGX-011): a second-generation antisense inhibitor of clusterin in development for the treatment of prostate cancer. Future Oncol 2012; 8: [PMID: DOI: /fon ] 8 Wong P, Borst DE, Farber D, Danciger JS, Tenniswood M, Chader GJ, van Veen T. Increased TRPM-2/clusterin mrna levels during the time of retinal degeneration in mouse models of retinitis pigmentosa. Biochem Cell Biol 1994; 72: [PMID: ] 9 Zhang Q, Zhou W, Kundu S, Jang TL, Yang X, Pins M, Smith N, Jovanovic B, Xin D, Liang L, Guo Y, Lee C. The leader sequence triggers and enhances several functions of clusterin and is instrumental in the progression of human prostate cancer in vivo and in vitro. BJU Int 2006; 98: [PMID: DOI: /j X x] 10 Leskov KS, Araki S, Lavik JP, Gomez JA, Gama V, Gonos ES, Trougakos IP, Matsuyama S, Boothman DA. CRM1 proteinmediated regulation of nuclear clusterin (nclu), an ionizing radiation-stimulated, Bax-dependent pro-death factor. J Biol Chem 2011; 286: [PMID: DOI: /jbc. M ] 11 Araki S, Israel S, Leskov KS, Criswell TL, Beman M, Klokov DY, Sampalth L, Reinicke KE, Cataldo E, Mayo LD, Boothman DA. Clusterin proteins: stress-inducible polypeptides with proposed functions in multiple organ dysfunction. BJR supplement/bir 2005; 27: [DOI: /bjr/ ] 12 Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA. Synthesis and functional analyses of nuclear clusterin, a cell death protein. J Biol Chem 2003; 278: [PMID: DOI: /jbc.M ] 13 Kususda Y, Miyake H, Gleave ME, Fujisawa M. Clusterin inhibition using OGX-011 synergistically enhances antitumour activity of sorafenib in a human renal cell carcinoma model. Br J Cancer 2012; 106: [PMID: DOI: / bjc ] 14 Sintich SM, Steinberg J, Kozlowski JM, Lee C, Pruden S, Sayeed S, Sensibar JA. Cytotoxic sensitivity to tumor necrosis factor-alpha in PC3 and LNCaP prostatic cancer cells is regulated by extracellular levels of SGP-2 (clusterin). Prostate 1999; 39: [PMID: ] 15 Trougakos IP, So A, Jansen B, Gleave ME, Gonos ES. Silencing expression of the clusterin/apolipoprotein j gene in human cancer cells using small interfering RNA induces spontaneous apoptosis, reduced growth ability, and cell sensitization to genotoxic and oxidative stress. Cancer Res 2004; 64: [PMID: ] 16 Lee CH, Jin RJ, Kwak C, Jeong H, Park MS, Lee NK, Lee SE. Suppression of clusterin expression enhanced cisplatin-induced cytotoxicity on renal cell carcinoma cells. Urology 2002; 60: [PMID: ] 17 Tang Y, Liu F, Zheng C, Sun S, Jiang Y. Knockdown of clusterin sensitizes pancreatic cancer cells to gemcitabine chemotherapy by ERK1/2 inactivation. J Exp Clin Cancer Res 2012; 31: 73 [PMID: DOI: / ] 18 Gleave M, Miyake H. Use of antisense oligonucleotides targeting the cytoprotective gene, clusterin, to enhance androgen- and chemo-sensitivity in prostate cancer. World J Urol 2005; 23: [PMID: DOI: /s ] 19 Flanagan L, Whyte L, Chatterjee N, Tenniswood M. Effects of clusterin over-expression on metastatic progression and therapy in breast cancer. BMC Cancer 2010; 10: 107 [PMID: DOI: / ] 20 Cao C, Shinohara ET, Li H, Niermann KJ, Kim KW, Sekhar KR, Gleave M, Freeman M, Lu B. Clusterin as a therapeutic target for radiation sensitization in a lung cancer model. Int J Radiat Oncol Biol Phys 2005; 63: [PMID: DOI: / j.ijrobp ] 21 Xiu P, Dong X, Dong X, Xu Z, Zhu H, Liu F, Wei Z, Zhai B, Kanwar JR, Jiang H, Li J, Sun X. Secretory clusterin contributes to oxaliplatin resistance by activating Akt pathway in hepatocellular carcinoma. Cancer Sci 2013; 104: [PMID: DOI: /cas.12088] 22 Xiu P, Xu Z, Liu F, Li Z, Li T, Zou F, Sun X, Li J. Downregulating sclu enhances the sensitivity of hepatocellular carcinoma cells to gemcitabine by activating the intrinsic apoptosis pathway. Dig Dis Sci 2014; 59: [PMID: DOI: / s ] 23 Visser ME, Witztum JL, Stroes ES, Kastelein JJ. Antisense oligonucleotides for the treatment of dyslipidaemia. Eur Heart J 2012; 33: [PMID: DOI: /eurheartj/ ehs084] 24 Chi KN, Eisenhauer E, Fazli L, Jones EC, Goldenberg SL, Powers J, Tu D, Gleave ME. A phase I pharmacokinetic and pharmacodynamic study of OGX-011, a 2 -methoxyethyl antisense oligonucleotide to clusterin, in patients with localized prostate cancer. J Natl Cancer Inst 2005; 97: [PMID: DOI: /jnci/dji252] 25 Chi KN, Siu LL, Hirte H, Hotte SJ, Knox J, Kollmansberger C, Gleave M, Guns E, Powers J, Walsh W, Tu D, Eisenhauer E. A phase I study of OGX-011, a 2 -methoxyethyl phosphorothioate antisense to clusterin, in combination with docetaxel in patients with advanced cancer. Clin Cancer Res 2008; 14: [PMID: DOI: / CCR ] 26 Chi KN, Hotte SJ, Yu EY, Tu D, Eigl BJ, Tannock I, Saad F, North S, Powers J, Gleave ME, Eisenhauer EA. Randomized phase II study of docetaxel and prednisone with or without OGX-011 in patients with metastatic castration-resistant prostate cancer. J Clin Oncol 2010; 28: [PMID: DOI: / JCO ] 27 Saad F, Hotte S, North S, Eigl B, Chi K, Czaykowski P, Wood L, Pollak M, Berry S, Lattouf JB, Mukherjee SD, Gleave M, Winquist E. Randomized phase II trial of Custirsen (OGX-011) in combination with docetaxel or mitoxantrone as second-line therapy in patients with metastatic castrate-resistant prostate cancer progressing after first-line docetaxel: CUOG trial P-06c. Clin Cancer Res 2011; 17: [PMID: DOI: / CCR ] 8269 July 21, 2015 Volume 21 Issue 27

64 Xiu P et al. Clusterin in hepatocellular carcinoma 28 Laskin JJ, Nicholas G, Lee C, Gitlitz B, Vincent M, Cormier Y, Stephenson J, Ung Y, Sanborn R, Pressnail B, Nugent F, Nemunaitis J, Gleave ME, Murray N, Hao D. Phase I/II trial of custirsen (OGX-011), an inhibitor of clusterin, in combination with a gemcitabine and platinum regimen in patients with previously untreated advanced non-small cell lung cancer. J Thorac Oncol 2012; 7: [PMID: DOI: /JTO.0b013e31823f459c] 29 Chia S, Dent S, Ellard S, Ellis PM, Vandenberg T, Gelmon K, Powers J, Walsh W, Seymour L, Eisenhauer EA. Phase II trial of OGX-011 in combination with docetaxel in metastatic breast cancer. Clin Cancer Res 2009; 15: [PMID: DOI: / CCR ] 30 Fritz IB, Burdzy K, Sétchell B, Blaschuk O. Ram rete testis fluid contains a protein (clusterin) which influences cell-cell interactions in vitro. Biol Reprod 1983; 28: [PMID: ] 31 Choi NH, Mazda T, Tomita M. A serum protein SP40,40 modulates the formation of membrane attack complex of complement on erythrocytes. Mol Immunol 1989; 26: [PMID: ] 32 James RW, Hochstrasser AC, Borghini I, Martin B, Pometta D, Hochstrasser D. Characterization of a human high density lipoprotein-associated protein, NA1/NA2. Identity with SP-40,40, an inhibitor of complement-mediated cytolysis. Arterioscler Thromb 1991; 11: [PMID: ] 33 Collard MW, Griswold MD. Biosynthesis and molecular cloning of sulfated glycoprotein 2 secreted by rat Sertoli cells. Biochemistry 1987; 26: [PMID: ] 34 Montpetit ML, Lawless KR, Tenniswood M. Androgen-repressed messages in the rat ventral prostate. Prostate 1986; 8: [PMID: ] 35 Burkey BF, Stuart WD, Harmony JA. Hepatic apolipoprotein J is secreted as a lipoprotein. J Lipid Res 1992; 33: [PMID: ] 36 Bettuzzi S, Hiipakka RA, Gilna P, Liao ST. Identification of an androgen-repressed mrna in rat ventral prostate as coding for sulphated glycoprotein 2 by cdna cloning and sequence analysis. Biochem J 1989; 257: [PMID: ] 37 Cheng CY, Chen CL, Feng ZM, Marshall A, Bardin CW. Rat clusterin isolated from primary Sertoli cell-enriched culture medium is sulfated glycoprotein-2 (SGP-2). Biochem Biophys Res Commun 1988; 155: [PMID: ] 38 Tobe T, Minoshima S, Yamase S, Choi NH, Tomita M, Shimizu N. Assignment of a human serum glycoprotein SP-40,40 gene (CLI) to chromosome 8. Cytogenet Cell Genet 1991; 57: [PMID: ] 39 Zoubeidi A, Ettinger S, Beraldi E, Hadaschik B, Zardan A, Klomp LW, Nelson CC, Rennie PS, Gleave ME. Clusterin facilitates COMMD1 and I-kappaB degradation to enhance NF-kappaB activity in prostate cancer cells. Mol Cancer Res 2010; 8: [PMID: DOI: / MCR ] 40 Kimura K, Asami K, Yamamoto M. Effect of heat shock treatment on the production of variant testosterone-repressed prostate message-2 (TRPM-2) mrna in culture cells. Cell Biochem Funct 1997; 15: [PMID: DOI: /(SICI) (199712)15: ] 41 Mailhos C, Howard MK, Latchman DS. Heat shock protects neuronal cells from programmed cell death by apoptosis. Neuroscience 1993; 55: [PMID: ] 42 Kang YK, Hong SW, Lee H, Kim WH. Overexpression of clusterin in human hepatocellular carcinoma. Hum Pathol 2004; 35: [PMID: ] 43 Aigelsreiter A, Janig E, Sostaric J, Pichler M, Unterthor D, Halasz J, Lackner C, Zatloukal K, Denk H. Clusterin expression in cholestasis, hepatocellular carcinoma and liver fibrosis. Histopathology 2009; 54: [PMID: DOI: /j x] 44 Hsieh SY, Chen WY, Shih TC, Yeh JY, Jeng JT. Dys-regulation of clusterin in human hepatoma is not associated with tumorigenesis but is secondary to cell response to external tresses. Mol Carcinog 2005; 43: [PMID: DOI: /mc.20095] 45 Wang C, Jiang K, Kang X, Gao D, Sun C, Li Y, Sun L, Zhang S, Liu X, Wu W, Yang P, Guo K, Liu Y. Tumor-derived secretory clusterin induces epithelial-mesenchymal transition and facilitates hepatocellular carcinoma metastasis. Int J Biochem Cell Biol 2012; 44: [PMID: DOI: /j.biocel ] 46 Kimura A, Sogawa K, Satoh M, Kodera Y, Yokosuka O, Tomonaga T, Nomura F. The application of a three-step serum proteome analysis for the discovery and identification of novel biomarkers of hepatocellular carcinoma. Int J Proteomics 2012; 2012: [PMID: DOI: /2012/623190] 47 Nafee AM, Pasha HF, Abd El Aal SM, Mostafa NA. Clinical significance of serum clusterin as a biomarker for evaluating diagnosis and metastasis potential of viral-related hepatocellular carcinoma. Clin Biochem 2012; 45: [PMID: DOI: /j.clinbiochem ] 48 Comunale MA, Wang M, Rodemich-Betesh L, Hafner J, Lamontagne A, Klein A, Marrero J, Di Bisceglie AM, Gish R, Block T, Mehta A. Novel changes in glycosylation of serum Apo-J in patients with hepatocellular carcinoma. Cancer Epidemiol Biomarkers Prev 2011; 20: [PMID: DOI: / EPI ] 49 Zhao Y, Jia W, Sun W, Jin W, Guo L, Wei J, Ying W, Zhang Y, Xie Y, Jiang Y, He F, Qian X. Combination of improved (18)O incorporation and multiple reaction monitoring: a universal strategy for absolute quantitative verification of serum candidate biomarkers of liver cancer. J Proteome Res 2010; 9: [PMID: DOI: /pr ] 50 Wang Y, Liu YH, Mai SJ, He LJ, Liao YJ, Deng HX, Guan XY, Zeng YX, Kung HF, Xie D. Evaluation of serum clusterin as a surveillance tool for human hepatocellular carcinoma with hepatitis B virus related cirrhosis. J Gastroenterol Hepatol 2010; 25: [PMID: DOI: /j x] P- Reviewer: Lei M, Yang Y S- Editor: Yu J L- Editor: Wang TQ E- Editor: Liu XM 8270 July 21, 2015 Volume 21 Issue 27

65 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. REVIEW Effects of Yttrium-90 selective internal radiation therapy on non-conventional liver tumors Andrew Kuei, Sammy Saab, Sung-Ki Cho, Stephen T Kee, Edward Wolfgang Lee Andrew Kuei, Stephen T Kee, Edward Wolfgang Lee, Division of Interventional Radiology, Department of Radiology, UCLA Medical Center, David Geffen School of Medicine at UCLA, Los Angeles, CA 90024, United States Sammy Saab, Department of Medicine, Division of Hepatology, Pfleger Liver Institute, University of California at Los Angeles, Los Angeles, CA 90024, United States Sung-Ki Cho, Division of Interventional Radiology, Department of Radiology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul , South Korea Author contributions: All authors equally contributed to this paper with conception and design of the study, literature review and analysis, drafting and critical revision and editing, and final approval of the final version. Conflict-of-interest statement: No potential conflicts of interest. No financial support. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Edward Wolfgang Lee, MD, PhD, Division of Interventional Radiology, Department of Radiology, UCLA Medical Center, David Geffen School of Medicine at UCLA, 757 Westwood Plaza, Suite 2125 Los Angeles, CA 90024, United States. EdwardLee@mednet.ucla.edu Telephone: Received: January 5, 2015 Peer-review started: January 5, 2015 First decision: April 13, 2015 Revised: April 29, 2015 Accepted: June 16, 2015 Article in press: June 16, 2015 Published online: July 21, 2015 Abstract The liver is a common site of metastasis, with essentially all metastatic malignancies having been known to spread to the liver. Nearly half of all patients with extrahepatic primary cancer have hepatic metastases. The severe prognostic implications of hepatic metastases have made surgical resection an important first line treatment in management. However, limitations such as the presence of extrahepatic spread or poor functional hepatic reserve exclude the majority of patients as surgical candidates, leaving chemotherapy and locoregional therapies as next best options. Selective internal radiation therapy (SIRT) is a form of catheter-based locoregional cancer treatment modality for unresectable tumors, involving trans-arterial injection of microspheres embedded with a radioisotope Yttrium-90. The therapeutic radiation dose is selectively delivered as the microspheres permanently embed themselves within the tumor vascular bed. Use of SIRT has been conventionally aimed at treating primary hepatic tumors (hepatocellular carcinoma) or colorectal and neuroendocrine metastases. Numerous reviews are available for these tumor types. However, little is known or reviewed on non-colorectal or nonneuroendocrine primaries. Therefore, the aim of this paper is to systematically review the current literature to evaluate the effects of Yttrium-90 radioembolization on non-conventional liver tumors including those secondary to breast cancer, cholangiocarcinoma, ocular and percutaneous melanoma, pancreatic cancer, renal cell carcinoma, and lung cancer. Key words: Liver metastases; Breast cancer; Melanoma; Cholangiocarcinoma; Radioembolization; Selective internal radiation therapy; Selective internal radiation therapy; Transarterial radioembolization; Transarterial radioembolization; Yttrium-90 The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved July 21, 2015 Volume 21 Issue 27

66 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Core tip: Selective internal radiotherapy or transarterial radioembolization with Yttrium-90 microspheres is a targeted catheter-based therapy indicated for unresectable metastatic liver tumors. A number of reviews and meta-analyses have been written on the use of Yttrium-90 in the treatment of liver metastases, however few broadly investigate results from noncolorectal or non-neuroendocrine primaries. Our objective is to consolidate the current literature to better delineate the response and survival outcomes of Yttrium-90 radioembolization on non-conventional liver tumors including breast cancer, cholangiocarcinoma, ocular and percutaneous melanoma, pancreatic cancer, renal cell carcinoma and lung cancer. Kuei A, Saab S, Cho SK, Kee ST, Lee EW. Effects of Yttrium-90 selective internal radiation therapy on non-conventional liver tumors. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8271.htm DOI: i INTRODUCTION In the United States and Europe, metastases to the liver are forty times more common than primary liver tumors [1]. Nearly half of patients in the United States with extrahepatic primary cancer have hepatic metastasis [1]. The prevalence of metastatic liver disease is attributed physiologically to dual blood supplies to the liver and the easily penetrable nature of the fenestrated endothelium lining of the hepatic sinusoids [2]. Essentially all metastatic malignancies have been known to metastasize to the liver, with carcinomas being histologically most common, followed by lymphomas and sarcomas. Primary sites by frequency include upper gastrointestinal including stomach, pancreas, and gallbladder (44%-78%), colon (56%-58%), breast (52%-53%), lung (42%-43%), esophagus (30%-32%), genitourinary organs (24%-38%) [1]. Metastatic liver disease frequently originates from the gastrointestinal tract via the portal venous drainage. Another known but less common route of metastasis is through systemic arterial circulation. Lymphatic spread and peritoneal fluid extension is less common [1]. Surgical resection is the first line treatment of all liver metastasis, however the majority (over 75%) of patients are excluded as surgical candidates, leaving chemotherapy and locoregional therapies as the next best option [3]. Traditional contraindications to resection include extrahepatic disease, unfitness for surgery, and extensive liver involvement limiting the ability to leave adequate hepatic functional reserve [4]. Isolated liver metastases amenable to local therapy are more commonly associated with colorectal cancer, with 20%-30% of metastatic colon cancers being confined to the liver [5,6]. Most other tumors including gastric cancer, pancreatic cancer, breast cancer, lung cancer, neuroendocrine tumors, and melanoma commonly present with systemic, disseminated disease [7]. Numerous studies in the past on surgical resection of liver metastases have achieved improved survivability with colorectal and neuroendocrine primaries over other tumor types [8-11]. As such, the prognostic opportunity for colorectal and neuroendocrine liver metastases has attracted a majority of research in regional therapies for the treatment of unresectable disease. The role of regional therapy in treating non-conventional liver metastases remains less studied and more controversial. Selective internal radiotherapy (SIRT) or transarterial radioembolization (TARE) with Yttrium-90 microspheres is a targeted catheter-based therapy indicated for unresectable metastatic liver tumors. Its efficacy is centralized on two principles: (1) that hepatic tumors source over 90% of their blood supply from the hepatic artery; and (2) that tumor neovascularity is denser than the surrounding parenchyma [12]. During the procedure Yttrium-90 microspheres are trans-arterially infused into the liver. The beads penetrate and permanently embed themselves within the tumor vascular bed, selectively delivering the therapeutic radiation dose over two weeks [13-18]. Currently, Yttrium-90 microsphere products are commercially available in either glass (TheraSphere) or resin (SIR-Spheres). Therasphere is US Food and Drug Administration (FDA) approved under a Humanitarian Device Exemption in 1999 as radiation treatment or neoadjuvant to surgery for unresectable hepatocellular carcinoma. SIR-Spheres have received FDA approval in 2002 for unresectable metastatic colorectal cancer. Yttrium-90 radioembolization has also had documented off-label use in the treatment of metastatic liver disease with other known primaries. A number of reviews and meta-analyses have been written on the use of Yttrium-90 in the treatment of liver metastases, however few broadly investigate results from noncolorectal or non-neuroendocrine primaries [6,12,19-29]. Our objective is to consolidate the current literature to better delineate the response and survival outcomes of Yttrium-90 radioembolization on non-conventional liver tumors. LITERATURE RESEARCH A systematic literature search was conducted using PubMed, EMBASE, and Cochrane Library for Yttrium-90 and Y90 as well as synonyms for radioembolization and liver metastasis. A total of 28 studies containing non-conventional primaries undergoing Yttrium-90 radioembolization were included for review. Studies providing only unified results for multiple primary tumors were excluded. Of the studies with results distinguished by primary tumor, 10 studies contained 8272 July 21, 2015 Volume 21 Issue 27

67 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors breast, 6 contained melanoma, 8 contained cholangiocaricnoma, 3 contained pancreatic, 2 contained renal cell carcinoma, and 3 contained lung or thoracic [30-50]. BREAST CANCER Breast cancer is the most commonly diagnosed cancer in women, expected to account for 29% of all new cancers diagnosed among women [51]. Breast cancer confined to the primary site has a promising prognosis, with estimated 5-year survival rates exceeding 99% [51]. Overall survival has continued to steadily improve with risk of death decreasing 1%-2% annually [34,51]. The outlook significantly worsens for the estimated 20%-30% of patients who develop distant metastatic disease, with 5-year survival rates as low as 16%-25% [51-53]. Surveillance, Epidemiology, and End Results (SEER) data from the National Cancer Institute collected between 1973 and 1995 estimate cumulative survival with metastatic breast cancer at time of diagnosis is estimated at 18.5 mo [54]. Median survival in patients with unresectable, chemoresistant breast cancer liver metastases (BRCLM) ranges between 3-10 mo [55]. The majority of patients with fatal metastatic breast cancer (up to 60%) die of liver failure caused by hepatic metastasis [35,56,57]. Clinical management for breast cancer liver metastases has predominantly involved systemic chemotherapy over surgical resection for a multitude of reasons. First, effective chemotherapy has long been established before other metastatic tumor types such as colorectal cancer, where surgical resection was considered the first-line treatment early on. Second, liver metastases are considered an ominous sign of poor outcome relative to other metastatic sites [58]. Third, solitary liver metastases are rare in the setting of breast cancer (< 5%). Less than 20% of patients qualify as surgical candidates [58-60]. As a result, it is imperative that alternative therapies for patients with unresectable, chemoresistant BRCLM to be investigated. Among the therapies available are transarterial chemoembolization, transarterial radioembolization or SIRT, radiofrequency ablation, and stereotactic therapy. Of the studies on SIRT of non-conventional liver metastases, breast cancer is the most studied (Table 1). So far we found 7 exclusively BRCLM SIRT studies [31,33,35,39,47,48,50] in addition to 3 mixed primary studies that provide discrete response data on the patients with breast primaries [34,45,46]. The first study investigating survival of BRCLM patients undergoing SIRT was in 2007 by Bangash et al [31] who assessed 27 patients with progressing liver metastases on polychemotherapy. Of the 23 patients who made it to the 90-d follow-up computed tomography (CT) scan, 39.1% showed either complete or partial response by WHO criteria. 63% of all 27 patients showed positive tumor response on PET. Median survival for the 21 patients with tumor burden < 25% and 6 patients with tumor burden > 25% were 9.4 and 2.0 mo, respectively. The authors concluded that although the tumor response with SIRT was encouraging, the influence on survival remained unclear. A larger study in 2007 by Coldwell et al [35] included a total of 44 women with unresectable chemorefractory BRCLM. On 12-wk follow-up CT, 47% of 36 patients had a partial response by RECIST criteria. 95% of all 44 patients showed a response on PET scan. The patients had not met their median survivability at 14 mo, however 86% of patients were alive at that time. Patients non-responsive by CT or PET scan had a median survival of 3.6 mo. Based on an expected median survival of patients with advanced breast cancer responding to standard chemotherapy of 14 mo, the authors predicted the patients would demonstrate an increase in overall survival. In 2008, Jakobs et al [39] followed 30 unresectable chemorefractory BRCLM patients undergoing SIRT. Follow-up data available for 24 patients revealed a 61% partial response rate by RECIST criteria. Survivability in patients with no response correlated closely to Coldwell et al [35] at 5.7 mo vs 3.6 mo. The median overall survival of 11.7 mo corresponds closely to the 9.4 mo survival in patients with < 25% tumor burden in Bangash et al [31] considering the majority (23/30) of patients fell under that criteria. In 2013, the largest study to date reported SIRT of 77 unresectable chemorefractory BRCLM patients. Response rates were consistent with prior studies with a partial response rate of 56% by RECIST criteria. Median survival of 11.5 mo was nearly identical to that reported by Jakobs et al [39]. In patients ECOG 0, with < 25% tumor burden and no extrahepatic disease, median survival was promising at 14.3 mo [33]. Later that year, Saxena et al [47] reported their experience with 40 patients affected by unresectable, chemoresistant BRCLM. Response rates were lower than prior studies at 31% overall, however complete response was observed in 5% of patients. Conversely, median survival was slightly higher than prior studies at 13.6 mo. In 2014, Gordon et al [50] studied 75 patients with progressive chemorefractory breast cancer liver metastasis and stable extrahepatic disease reports a significantly lower median OS of 6.6 mo. The patient cohort consisted of over 40% of patients with tumor burden greater or equal to 25%, which is proportionally higher than the tumor burdens reported in other studies mentioned above. Partial response and stable disease was reported in 35.3% and 63.2% of patients respectively. In summary, multiple studies have demonstrated Yttrium-90 SIRT as an effective procedure for unresectable chemoresistant BRCLM. Collective analysis of current literature ranges response rates between 18%-61% and median overall survival between 6.6 to 13.6 mo. Though response rates and 8273 July 21, 2015 Volume 21 Issue 27

68 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Table 1 Breast cancer studies n (%) Author Type of microsphere Type Response criteria Response Median OS of mets (publish date and study (average dosage or activity) (patients) 1 st assessment Gordon et al [50] Therasphere Breast (75) RECIST and PET RECIST 6.6 mo (8/2014 Epub, RS) (mean mo (median) 24 (35.3) PR 43 (63.2) SD 1 (1.5) PD 7 lost PET 3 (12) CR 18 (72) PR or SD 4 (16) PD 50 lost Seyal et al [48] Unspecified Breast (21) RECIST lesions None (8/2014, RS) (no dosage info) 34 unspecified 6 (17.7) PR 27 (79.4) SD 1 (2.9) PD Saxena et al [47] SIR-Spheres Breast (40) RECIST 2 (5) CR 13.6 mo (12/2013, RS) (mean mo 10 (26) PR 15 (39) SD 11 (29) PD 2 lost Cianni et al [33] SIR-Spheres Breast (77) RECIST and PET 29 (56) PR 11.5 mo (1/2013, RS) (median mo 18 (35) SD 5 (10) PD 25 ineligible Jakobs et al [39] SIR-Spheres Breast (30) RECIST 14 (61) PR 11.7 mo (all) (5/2008, PC) (mean mo (median) 8 (35) SD 23.6 mo (responders) 1 (4) PD 5.7 mo (nonresponders) 7 lost Coldwell et al [35] SIR-Spheres Breast (44) RECIST and PET RECIST Median OS not reached (3/2007, RS) (median mo 17 (47) PR 17 (47) SD 86% 14-mo survival 2 PD (5) PD 8 lost PET scans 42 (95) response 2 (5) no response/progression Bangash et al [31] Therasphere Breast (27) WHO and PET WHO Median OS not given. (5/2007, PC) (median 1.70 Gbq, mean mo 9 (39.1) CR/PR 6.8 mo (ECOG 0) 12 (52.1) SD 2.6 mo (ECOG 1,2,3) 2 (8.8) PD 4 lost PET 17 (63) response 10 (37) no response 9.4 mo (< 25% tumor burden) 2.0 mo (> 25% tumor burden) Cianni et al [34] SIR-Spheres Breast RECIST 14 (44) CR/PR None (1/2010, RS) (mean 1.64 Gbq) (32, data 1.8 mo 11 (34) SD 7 (22) PD from larger study) Reiner et al [46] SIR-Spheres Breast RECIST (100) CR/PR None (1/2014, PC) (mean 1.5 Gbq) (1, 4 mo extracted from larger study) Pöpperl et al [45] SIR-Spheres Breast PET 3 (100) Regression None (4/2005, PC) (mean 2.27 Gbq) (4, data extracted from larger 3 mo 1 lost PC: Prospective cohort study; RS: Retrospective study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival; OR: Overall response July 21, 2015 Volume 21 Issue 27

69 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors survival outcomes vary significantly depending on selection criteria, they are generally improved over past controls. Breast cancer metastasis are often uniformly hypervascular and slow growing, which based on previous studies with colorectal carcinoma and neuroendocrine tumors make it an ideal target for SIRT [35,61,62]. BRCLMs also typically present numerous and widespread, placing limitations on what other therapies such as stereotactic radiotherapy or conventional chemoembolization can achieve while maintaining adequate liver function. Still, the tendency of BRCLM to present with extrahepatic involvement limits SIRT from a prognostic perspective. Although the number of studies on the effects of SIRT on breast cancer metastasis is gradually increasing, they have so far involved only relatively small, heterogenous patient cohorts. In order to validate SIRT as a potential first-line adjuvant to chemotherapy, larger multicenter randomized control studies are needed. The potentially synergistic relationship with post-treatment chemotherapy also warrants further investigation and careful consideration in select patients [47]. three more recent studies [72-74]. The first study by Mouli et al [74] expands on the pilot study by Ibrahim et al [69], adding 22 patients to the previous cohort. In the study, 25% of patients exhibited partial response by WHO criteria. Overall survival varied significantly between solitary (14.6 mo) and multifocal (5.7 mo) lesions [74]. The second study by Camacho et al [72] on 21 chemorefractory ICC patients reports a median survival of 16.3 mo. The last study by Filippi et al [73] on 18 ICC patients reports an 82.5% response rate by PET scan and a median overall survival of 14.8 mo. Survivability data from the 3 most recent reports are consistent with the 13.9 mo overall survival by metaanalysis reported by Beohm et al [63]. Yttrium-90 SIRT is considered at some centers a preferred first-line therapy for low-tumor burden ICC [74]. Reasons for this include the benefit of being able to downstage previously unresectable ICC for curative resection. Though median overall survival data is shorter than that of hepatic arterial infusion, Yttrium-90 therapy carries fewer risks including not having to implant a chemoinfusion port. CHOLANGIOCARCINOMA Intrahepatic cholangiocarcinoma (ICC) is the second most common primary liver malignancy after hepatocellular carcinoma. Incidence of ICC has been on the rise [63,64]. Median overall survival of patients for ICC patients is currently 22 mo. Untreated, median survival with ICC is significantly lower at 3-8 mo [65]. Curative resection is the mainstay of therapy in ICC, however few qualify mostly due to advanced hepatic disease. ICC is rapidly fatal for those with unresectable disease, though improvements in non-operative therapy have brought median survival in unresectable disease to 15 mo vs 6 mo before the year 2000 [66]. Treatment has traditionally involved systemic chemotherapy agents 5-flourouracil and leukovorin [67]. Newer palliative agents like floxuridine and gemcitabine as well as liver directed techniques like hepatic arterial infusion, transarterial chemoembolization, and transarterial radioembolization have been selectively implemented in the past decade. ICC has recently accumulated a small body of studies dedicated toward liver directed treatment with yttrium-90 SIRT (Table 2). Our literature search found 8 ICC-only SIRT studies, mostly published within the past two years ( ). A systematic review and meta-analysis by Boehm et al [63] draws conclusions from 5 of these studies [3,68-71]. In the metaanalysis, the highest median overall survival was with hepatic arterial infusion (22.8 mo) compared to transarterial radioembolization (13.9 mo), transarterial chemoembolization (12.4 mo), and drug-eluting transarterial chemoembolization (12.3 mo). The authors point out the results should be interpreted with caution due to potential selection bias. Not included in the analysis by Boehm et al are OCULAR AND CUTANEOUS MELANOMA Melanoma is a less common yet particularly lethal form of skin cancer, accounting for 75% of skin cancer related deaths. The most common types of melanoma are cutaneous (over 90%) and ocular (around 5%) [75,76]. Unlike most other cancer types, the incidence of cutaneous melanoma is on the rise [51]. Though ocular and cutaneous melanomas both arise from melanocytes, they have distinct patterns of disease progression. Ocular (uveal) melanomas have a tendency to metastasize to the liver (occurring in 95% of metastatic disease), whereas liver metastasis occurs in just 15%-20% of metastatic cutaneous melanomas. With either type of melanoma, liver metastasis is attributed to a grim prognosis and is often the cause of death [77,78]. Reported median overall survival is 2.4 mo with liver involvement, 7.2 mo with non-visceral metastases, and 11.4 mo with lung metastases [79]. As a first-line treatment, standard chemotherapy has been traditionally ineffective, though new research has shown improved survival with vemurafenib and new immunotherapies like ipilimumab [80,81]. For those with chemorefractory liver metastases, liver directed therapy is a preferred approach to reduce tumor burden and prolong overall survival. Surgical resection is not a viable option for the majority (91%) of patients based on extensive hepatic or extra-hepatic involvement [37]. Transcatheter therapy via transarterial infusion (TAI) chemotherapy and transarterial chemoembolization have had reported favorable response rates and improved clinical outcomes in those with unresectable liver metastases [49]. In addition, four studies have been done on yttrium-90 SIRT of melanoma liver metastases (Table 3). The first study in 2009 by Kennedy et al [40] on July 21, 2015 Volume 21 Issue 27

70 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Table 2 Cholangiocarcinoma studies n (%) Author Type of microsphere Type of mets Response criteria Response Median OS (publish date and (average dosage or activity) 1 st assessment study type) Ibrahim et al [69] Therasphere ICC (24) WHO 6 (27) PR 14.9 mo (10/2008, PC) (median mo 15 (68) SD 1 (5) PD 31.8 mo (solitary) 2 lost 6.1 mo (extrahepatic disease) Saxena et al [71] SIR-Spheres ICC (25) RECIST 6 (26) PR 9.3 mo (2/2010, PC) (mean mo (median) 11 (48) SD 5 (22) PD 2 lost Haug et al [68] SIR-Spheres ICC (26) RECIST 5 (22) PR 11.7 mo (6/2011, PC) (no dosage 2.8 mo 15 (65) SD 3 (13) PD 3 lost Hoffmann et al [3] SIR-Spheres ICC (33) RECIST 12 (36) PR 22 mo (2/2012, RS) (median mo 17 (52) SD 4 (12) PD Rafi et al [70] SIR-Spheres ICC (19) RECIST 2 (11) PR 11.5 mo (4/2013, PC) (mean mo 13 (68) SD 4 (21) PD Mouli et al [74] Therasphere ICC (46) WHO 11 (25) PR No median OS (8/2013, PC) (no dose info) Note: overlaps with Ibrahim et 1 mo 33 (73) SD 1 (2) PD 14.6 mo (solitary) 5.7 mo (multifocal) Camacho et al [72] SIR-Spheres ICC (21) RECIST RECIST 16.3 mo (2/2014, PC) (no dose info) mrecist 1 (4.7) PR EASL 16 (76.2) 1 mo 4 (19.1) PD mrecist 13 (62.0) PR 4 (19.0) SD 4 (19.0) PD EASL 2 (9.5) PR 15 (71.4) SD 4 (19.1) PD Filippi et al [73] SIR-Spheres ICC (18) PERCIST 14 (82.3) PR 14.8 mo (8/2014, PC) (not unspecified 3 (17.6) SD ICC: Intrahepatic cholangiocarcinoma; PC: Prospective cohort study; RS: Retrospective study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival; OR: Overall response. uveal melanoma patients reported a strikingly high response rate of 77% with a 1-year survival of 80%. One patient that failed 13 prior bland embolization procedures had complete response after one radioembolization treatment. In 2011, Gonsalves et al [37] studied a larger cohort consisting of 32 patients with hepatic metastasis of uveal melanoma. In contrast to the prior study by Kennedy et al [40] just 6% had treatment response by RECIST criteria. Median overall survival was 10.0 mo. The low response rate was attributed to the inclusion of salvage patients with bulky, treatment resistant progressive lesions and high tumor burden (7 patients above 25% hepatic tumor burden). Of note, median radiation treatment activity in the study by Gonsalves et al [37] was 1.08 Gbq vs 1.55 Gbq in Kennedy et al [40]. In 2014, Memon et al [42] published a mixed melanoma type study consisting of 7 ocular, 4 cutaneous, 3 rectal and 2 unknown melanomas. Response to therapy was 31% by RECIST criteria. Median overall survival was short at 7.6 mo, attributed to high tumor burden (56% of patients had > 25% tumor burden) and the presence of extrahepatic disease (63%) at presentation. The authors conclude that further investigations are needed to rationalize radioembolization over other forms of locoregional therapies. Later that year, Xing et al [49] published a slightly larger mixed melanoma type study consisting of 15 ocular and 13 cutaneous melanomas compared to a supportive care group of 30 patients. Two patients suffered yttrium-90 SIRT related mortality in the study. Though imaging response by RECIST criteria was comparable to prior studies at 21% (5/24 patients at follow up), median overall survival was relatively longer at 10.1 mo from time of SIRT therapy. Median overall survival between cutaneous and uveal metastatic melanoma is reported to be similar. The 8276 July 21, 2015 Volume 21 Issue 27

71 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Table 3 Melanoma studies n (%) Author Type of microsphere Type of mets (patients) Response criteria Response Median OS (publish date and study type) (average 1 st assessment Xing et al [49] SIR-Spheres Melanoma (28) RECIST 1.1 5/28 (21) PR 10.1 mo (8/2014, RS) (mean 1.86 Gbq) mo 9/28 (38) SD 15 ocular 10/28 (42) PD 4 lost Memon et al [42] Therasphere Melanoma (16) WHO, RECIST, and WHO 7.6 mo EASL (6/2014, RS) (median 1.87 Gbq) mo 5 (31) CR/PR 3 rectal 8 (50) SD 4 cutaneous 3 (19) PD 2 unknown RECIST 5 (31) CR/PR 8 (50) SD 3 (19) PD EASL 6 (38) CR/PR 7 (43) SD 3 (19) PD Gonsalves et al [37] SIR-Spheres Ocular melanoma (32) RECIST (3) CR 10.0 mo (2/2011, RS) (median mo 1 (3) PR 18 (56) SD 12 (38) PD Kennedy et al [40] SIR-Spheres Ocular melanoma (11) RECIST 1 (11) CR Median OS not (7/2009, RS) (median mo 6 (66) PR 1 (11) SD 1 (11) PD 2 lost reached Reiner et al [46] SIR-Spheres Melanoma (2, data extracted from RECIST (50) CR/PR None (1/2014, PC) (mean 1.5 Gbq) larger 4 mo 1 (50) SD/PD Lim et al [41] SIR-Spheres Ocular melanoma (1, data extracted RECIST 1 (100) PD None (4/2005, PC) (no dosage info) from larger 2 mo PC: Prospective cohort study; RS: Retrospective study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival; OR: Overall response. authors mentioned that the 19.9 mo median overall survival from time of hepatic metastases compares favorably over prior metastatic melanoma studies with other forms of treatment including systemic chemotherapy (12.0 mo), transarterial infusion (14.0 mo), transarterial chemoembolization (9.03 mo). Given the hypervascular and aggressive nature of melanoma liver metastases, locoregional treatment with SIRT appears to be a reasonable approach at reducing disease progression. Median overall survival ranges from 7.6 to 10.1 mo, substantially improved over the expected less than 3 mo reported decades ago [79]. As with many other tumor types, patients undergoing SIRT with less hepatic involvement and the absence of extrahepatic disease tend to achieve better survival rates. Based on the few small cohort studies so far, SIRT has been demonstrated to be safe and effective at prolonging survival, however without further comparative studies the ideal selection criteria and benefit over other regional therapies remains uncertain. PANCREATIC CANCER Metastatic pancreatic cancer carries a notoriously dismal prognosis [82]. Systemic chemotherapy centralized around Gemcitabine, the current mainstay of treatment, brings median overall survival to around 5-7 mo [83-85]. Initial reports with advanced pancreatic cancer using the novel chemotherapy regimen FOLFIRINOX introduced in 2010 documented a median overall survival of 11.1 mo, the most significant improvement in survival seen thus far [86]. Among the treatment options specific to pancreatic cancer liver metastases, surgical resection of liver disease at the time of pancreatic resection has had high complication rates and poor long-term outcomes [87-90]. Alternative locoregional therapies such as Yttrium 90 SIRT have been investigated as adjuncts for the purpose of slowing disease progression. A paucity of clinical data exists on Yttrium-90 SIRT for liver metastases of pancreatic cancer patients (Table 4). So far just 2 small cohort, single center studies 8277 July 21, 2015 Volume 21 Issue 27

72 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Table 4 Pancreatic cancer studies n (%) Author Type of microsphere Type of mets (patients) Response criteria Response Median OS (publish date and (average dosage or 1 st assessment study type) Michl et al [43] SIR-Spheres Pancreatic (19) RECIST 9/13 (64.3) PR 9 mo (12/2013, RS) ( mo (median) 4/13 (35.7) PD 6 lost Cao et al [32] SIR-Spheres Pancreatic (7) RECIST 2 (40) PR No median OS (11/2010, RS) (no dosage 1-2 mo 1 (20) SD 1 patient survived to 15 mo 2 (40) PD 2 lost Pöpperl et al [45] SIR-Spheres Pancreatic (1, data extracted PET 1 (100) None (4/2005, PC) (mean 2.27 Gbq) from larger 3 mo Regression PC: Prospective cohort study; RS: Retrospective study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival; OR: Overall response. have been published. The first small study in 2010 by Cao et al [32] included 7 pancreatic adenocarcinoma patients with liver metastases. 2 patients died prior to initial follow up. Two (40%) of the remaining 5 exhibited partial response by RECIST criteria. Average median survival is not provided, but the authors report that one patient survived nearly 15 mo after SIRT therapy [32]. A second, slightly larger study in 2014 by Michl et al [43] on 19 chemorefractory pancreatic patients with metastatic liver disease reports an encouraging median overall survival of 9.0 mo. 5 patients died and 1 patient was omitted for disease progression prior to initial follow up. Of the 13 patients at initial follow up, 64.3% exhibited partial response by RECIST criteria. 9 patients received adjuvant chemotherapy after surgery. The authors also found a correlation with serum markers CA 19-9 and CRP and shorter overall survival. Though the limited available data makes survivability benefits unclear, initial reports as a salvage treatment are encouraging. Median survival with the small cohort is attributed to a roughly 2-4 mo improvement over conventional gemcitabine combination therapy alone, however improvement over the new chemotherapy regimen FOLFIRINOX has yet to be demonstrated. Response rates by RECIST criteria are consistent with established response rates with colorectal and neuroendocrine metastatic liver disease. Further studies are needed to delineate the proper patient selection criteria for optimal patient outcome. RENAL CELL CARCINOMA Renal cell carcinoma (RCC) is currently responsible for 2%-3% of malignancies in the US. Incidence of RCC in the U.S. is on the rise, with an estimated over new cases and over deaths are expected in 2014 [51]. Cumulative 5-year survival rates for all US RCC patients have improved from 50% in to 73% in [51]. With the advent of newer targeted therapies including anti- VEGF and m-tor targeted agents, median overall survival has more than doubled to greater than 2 years [91]. Approximately 33%-50% of patients with renal cell carcinoma eventually develop metastatic disease [92,93]. Metastatic RCC is frequently unresponsive to external beam radiotherapy, high-dose IL-2 and systemic chemotherapy [93]. The most common site of metastases is the lung (45%-75%). Metastatic disease to the liver affects 20%-40% of patients, and the overwhelming majority (over 96%) are accompanied by widespread disease [93-96]. Patients with hepatic involvement have a reported median overall survival of 7.4 mo [97]. Though few patients qualify, the relatively uncommon procedure of surgical resection of hepatic metastases has shown promising survival outcomes at the cost of significant morbidity and mortality risks. Two-year overall survival for metastatic renal cell carcinoma with and without hepatectomy has been reported at 40% and 10%, respectively [93]. Experience with locoregional therapies like SIRT in the treatment of renal cell carcinoma liver metastases is very limited (Table 5). The pilot study for yttrium-90 SIRT of chemorefractory renal cell carcinoma liver metastases was in 2012 by Abdelmaksoud et al [30] Median overall survival for 6 patients was 12 mo. Of the 5 patients that made it to initial follow-up, 3 (60%) had complete response and 1 (20%) had partial response by RECIST criteria. Two patients died within 2 mo of treatment from unrelated extra-hepatic causes. A case report published in 2013 by Hamoui et al [38] on a 76-yearold woman with metastatic sarcomatoid renal cell carcinoma undergoing palliative SIRT was done on both a left renal tumor and the right hepatic lobe. CT scan at 8 wk and 3 mo both showed stability of the renal cell carcinoma and hepatic metastases. At past 9 mo, the patient subsequently developed worsening metastatic disease and died 23 mo after radioembolization. Like neuroendocrine tumors, the hypervascular nature of renal cell carcinoma makes for an attractive target for treatment of liver metastasis with SIRT [98]. Additionally, patients with numerous metastatic foci 8278 July 21, 2015 Volume 21 Issue 27

73 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Table 5 Renal cell carcinoma studies n (%) Author Type of microsphere Type of mets (patients) Response criteria Response Median OS (publish date and study type) (average dosage or 1 st assessment Abdelmaksoud et al [30] SIR-Spheres RCC (6) mrecist 3 CR (60) 12 mo (3/2012, RS) (median mo (mean) 1 PR (20) 1 PD (20) 1 lost Hamoui et al [38] Therasphere RCC (1) Unspecified 1 (100) SD Patient died 23 mo after SIRT (2/2013, case report) ( mo SIRT: Selective internal radiation therapy; RS: Retrospective study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival. Table 6 Lung or thoracic cancer studies n (%) Author Type of microsphere Type of mets (patients) Response criteria Response Median OS (publish date and study type) (average dosage or 1 st assessment Gaba et al [36] Therasphere Squamous cell lung cancer (2) PET CT 2 (100) CR Patient 1: Alive 11 mo after SIRT (8/2012, case report) ( mo Patient 2: Alive 2 mo after SIRT Murthy et al [44] SIR-Spheres Lung cancer (6) Unspecified 1 (17) PR 2.7 mo (2/2008, RS) (no dosage info) 2 carcinoids 3 unspecified 1 (17) minor response 1 small cell carcinoma 1 (17) SD 3 (50) PD Reiner et al [46] SIR-Spheres NSCLC (1, data extracted from RECIST (100) CR/PR None (1/2014, PC) (mean 1.5 Gbq) larger 4 mo SIRT: Selective internal radiation therapy; RS: Retrospective study; PC: Prospective cohort study; CR: Complete response; PR: Progressive response; PD: Progressive disease; SD: Stable disease; OS: Overall survival. difficult to treat by ablation and stereotactic techniques may be better off with treatment via transarterial infusion. Post-operative pain with SIRT is expected to be less than other embolization procedures like chemoembolization and bland embolization because SIRT doesn t cause large vessel occlusion [38]. In the treatment of liver metastasis from renal cell carcinoma, SIRT is limited by the rarity of liverdominant metastases and the known resistance to radiation [30]. However, based preliminary data on a handful of patients, initial reports are promising for the use of SIRT of hepatic metastases by renal cell carcinoma with a palliative rather than curative intent. LUNG CANCER Lung cancer is the leading cause of cancer death, with an estimated over lung cancer related deaths expected in At stage Ⅳ, non-small cell lung cancer and small cell lung cancer have a combined 4% chance of 5-survival [51]. Treatment of stage Ⅳ lung cancer is especially challenging and consists of predominantly palliative chemotherapy [99]. Surgical resection of liver metastases in the setting of metastatic lung cancer has been traditionally considered not worthwhile [100,101], though it has been performed successfully in select patients [102]. The value of yttrium-90 SIRT of lung cancer has been seldom looked into and the available data is extremely limited (Table 6). In 2008, Murthy et al [44] published a retrospective analysis of 6 patients with various lung cancers. Included were 3 adenocarcinomas, 2 carcinoids, and 1 small cell carcinoma. It is reported that 2 patients had partial response, 1 patient had stable disease, and 3 patients developed progressive disease. Median overall survival was 2.7 mo from radioembolization to death. A case report published in 2012 by Gaba et al [36] presents complete response after SIRT of liver metastases in two chemorefractory squamous cell lung cancer patients. At the time of the study, both patients were alive at 11 mo and 2 mo following SIRT therapy. The poor response to systemic chemotherapy and dismal survival rates with metastatic lung cancer emphasizes the need to further study alternative therapies. The few cases of yttrium-90 SIRT of lung cancer liver metastases so far demonstrate SIRT s potential as an effective salvage therapy. In lung cancer especially, clinicians must be mindful of nontarget radiation to the lungs due to potentially limited baseline pulmonary function. With further studies, the criteria in which SIRT becomes a worthwhile therapy in 8279 July 21, 2015 Volume 21 Issue 27

74 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors metastatic lung cancer can be better defined. CONCLUSION Although the indications for Yttrium-90 SIRT in nonconventional liver metastases are less welldefined, initial results of small studies are largely favorable. Overarching limitations include marked cohort heterogeneity, the absence of a gold standard in response criteria, and variations in treatment dosing. Disparities in median overall survival amongst tumor types may be explained by small cohort size and variations in tumor burden, progressiveness, time to first follow up, and presence of extra-hepatic disease. These studies demonstrate that whether or not Yttrium-90 SIRT provides a justifiable benefit to any given patient relies tremendously on both tumor type and patient status. With larger, multi-centered randomized controlled studies, established clinical guidelines can develop that ultimately improve patient outcomes. REFERENCES 1 Organization WH, Cancer IAfRo. Pathology and genetics of tumours of the digestive system. Oxford: IARC Press, Oxford University Press (distributor), Ananthakrishnan A, Gogineni V, Saeian K. Epidemiology of primary and secondary liver cancers. Semin Intervent Radiol 2006; 23: [PMID: DOI: /s ] 3 Hoffmann RT, Paprottka PM, Schön A, Bamberg F, Haug A, Dürr EM, Rauch B, Trumm CT, Jakobs TF, Helmberger TK, Reiser MF, Kolligs FT. Transarterial hepatic yttrium-90 radioembolization in patients with unresectable intrahepatic cholangiocarcinoma: factors associated with prolonged survival. Cardiovasc Intervent Radiol 2012; 35: [PMID: DOI: /s x] 4 Garden OJ, Rees M, Poston GJ, Mirza D, Saunders M, Ledermann J, Primrose JN, Parks RW. Guidelines for resection of colorectal cancer liver metastases. Gut 2006; 55 Suppl 3: iii1-iii8 [PMID: DOI: /gut ] 5 Khatri VP, Petrelli NJ, Belghiti J. Extending the frontiers of surgical therapy for hepatic colorectal metastases: is there a limit? J Clin Oncol 2005; 23: [PMID: DOI: / JCO ] 6 Mayo SC, Pawlik TM. Current management of colorectal hepatic metastasis. Expert Rev Gastroenterol Hepatol 2009; 3: [PMID: DOI: /egh.09.8] 7 Niederhuber JE. Abeloff s clinical oncology. Fifth edition ed. Philadelphia: Pennsylvania, Elsevier, Benevento A, Boni L, Frediani L, Ferrari A, Dionigi R. Result of liver resection as treatment for metastases from noncolorectal cancer. J Surg Oncol 2000; 74: [PMID: ] 9 Berney T, Mentha G, Roth AD, Morel P. Results of surgical resection of liver metastases from non-colorectal primaries. Br J Surg 1998; 85: [PMID: ] 10 Chen H, Hardacre JM, Uzar A, Cameron JL, Choti MA. Isolated liver metastases from neuroendocrine tumors: does resection prolong survival? J Am Coll Surg 1998; 187: 88-92; discussion [PMID: ] 11 van Ruth S, Mutsaerts E, Zoetmulder FA, van Coevorden F. Metastasectomy for liver metastases of non-colorectal primaries. Eur J Surg Oncol 2001; 27: [PMID: DOI: /ejso ] 12 Lewandowski RJ, Salem R. Yttrium-90 radioembolization of hepatocellular carcinoma and metastatic disease to the liver. Semin Intervent Radiol 2006; 23: [PMID: DOI: / s ] 13 Gates VL, Atassi B, Lewandowski RJ, Ryu RK, Sato KT, Nemcek AA, Omary R, Salem R. Radioembolization with Yttrium-90 microspheres: review of an emerging treatment for liver tumors. Future Oncol 2007; 3: [PMID: DOI: / ] 14 Riaz A, Kulik LM, Mulcahy MF, Lewandowski RJ, Salem R. Yttrium-90 radioembolization in the management of liver malignancies. Semin Oncol 2010; 37: [PMID: DOI: /j.seminoncol ] 15 Riaz A, Lewandowski RJ, Kulik L, Salem R. Yttrium-90 radioembolization using TheraSphere in the management of primary and secondary liver tumors. Q J Nucl Med Mol Imaging 2009; 53: [PMID: ] 16 Sato KT. Yttrium-90 radioembolization for the treatment of primary and metastatic liver tumors. Semin Roentgenol 2011; 46: [PMID: DOI: /j.ro ] 17 Murthy R, Kamat P, Nuñez R, Salem R. Radioembolization of yttrium-90 microspheres for hepatic malignancy. Semin Intervent Radiol 2008; 25: [PMID: DOI: / s ] 18 Kennedy A, Coldwell D, Sangro B, Wasan H, Salem R. Integrating radioembolization ((90)Y microspheres) into current treatment options for liver tumors: introduction to the international working group report. Am J Clin Oncol 2012; 35: [PMID: DOI: /COC.0b013e3181ec60b8] 19 Vente MA, Wondergem M, van der Tweel I, van den Bosch MA, Zonnenberg BA, Lam MG, van Het Schip AD, Nijsen JF. Yttrium-90 microsphere radioembolization for the treatment of liver malignancies: a structured meta-analysis. Eur Radiol 2009; 19: [PMID: DOI: /s ] 20 Saxena A, Bester L, Shan L, Perera M, Gibbs P, Meteling B, Morris DL. A systematic review on the safety and efficacy of yttrium-90 radioembolization for unresectable, chemorefractory colorectal cancer liver metastases. J Cancer Res Clin Oncol 2014; 140: [PMID: DOI: /s ] 21 Saxena A, Meteling B, Kapoor J, Golani S, Danta M, Morris DL, Bester L. Yttrium-90 radioembolization is a safe and effective treatment for unresectable hepatocellular carcinoma: a single centre experience of 45 consecutive patients. Int J Surg 2014; 12: [PMID: DOI: /j.ijsu ] 22 Raval M, Bande D, Pillai AK, Blaszkowsky LS, Ganguli S, Beg MS, Kalva SP. Yttrium-90 radioembolization of hepatic metastases from colorectal cancer. Front Oncol 2014; 4: 120 [PMID: DOI: /fonc ] 23 Paprottka PM, Hoffmann RT, Haug A, Sommer WH, Raessler F, Trumm CG, Schmidt GP, Ashoori N, Reiser MF, Jakobs TF. Radioembolization of symptomatic, unresectable neuroendocrine hepatic metastases using yttrium-90 microspheres. Cardiovasc Intervent Radiol 2012; 35: [PMID: DOI: / s ] 24 Gray BN, Burton MA, Kelleher DK, Anderson J, Klemp P. Selective internal radiation (SIR) therapy for treatment of liver metastases: measurement of response rate. J Surg Oncol 1989; 42: [PMID: ] 25 El Fouly A, Ertle J, El Dorry A, Shaker MK, Dechêne A, Abdella H, Mueller S, Barakat E, Lauenstein T, Bockisch A, Gerken G, Schlaak JF. In intermediate stage hepatocellular carcinoma: radioembolization with yttrium 90 or chemoembolization? Liver Int 2015; 35: [PMID: DOI: /liv.12637] 26 Hickey R, Mulcahy MF, Lewandowski RJ, Gates VL, Vouche M, Habib A, Kircher S, Newman S, Nimeiri H, Benson AB, Salem R. Chemoradiation of hepatic malignancies: prospective, phase 1 study of full-dose capecitabine with escalating doses of yttrium-90 radioembolization. Int J Radiat Oncol Biol Phys 2014; 88: [PMID: DOI: /j.ijrobp ] 27 Murthy R, Xiong H, Nunez R, Cohen AC, Barron B, Szklaruk J, Madoff DC, Gupta S, Wallace MJ, Ahrar K, Hicks ME. Yttrium 8280 July 21, 2015 Volume 21 Issue 27

75 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors 90 resin microspheres for the treatment of unresectable colorectal hepatic metastases after failure of multiple chemotherapy regimens: preliminary results. J Vasc Interv Radiol 2005; 16: [PMID: DOI: /01.RVI ] 28 Omed A, Lawrance JA, Murphy G, Laasch HU, Wilson G, Illidge T, Tipping J, Zivanovic M, Jeans S. A retrospective analysis of selective internal radiation therapy (SIRT) with yttrium-90 microspheres in patients with unresectable hepatic malignancies. Clin Radiol 2010; 65: [PMID: DOI: / j.crad ] 29 Stuart JE, Tan B, Myerson RJ, Garcia-Ramirez J, Goddu SM, Pilgram TK, Brown DB. Salvage radioembolization of liverdominant metastases with a resin-based microsphere: initial outcomes. J Vasc Interv Radiol 2008; 19: [PMID: DOI: /j.jvir ] 30 Abdelmaksoud MH, Louie JD, Hwang GL, Kothary N, Minor DR, Sze DY. Yttrium-90 radioembolization of renal cell carcinoma metastatic to the liver. J Vasc Interv Radiol 2012; 23: e1 [PMID: DOI: /j.jvir ] 31 Bangash AK, Atassi B, Kaklamani V, Rhee TK, Yu M, Lewandowski RJ, Sato KT, Ryu RK, Gates VL, Newman S, Mandal R, Gradishar W, Omary RA, Salem R. 90Y radioembolization of metastatic breast cancer to the liver: toxicity, imaging response, survival. J Vasc Interv Radiol 2007; 18: [PMID: DOI: /j.jvir ] 32 Cao C, Yan TD, Morris DL, Bester L. Radioembolization with yttrium-90 microspheres for pancreatic cancer liver metastases: results from a pilot study. Tumori 2010; 96: [PMID: ] 33 Cianni R, Pelle G, Notarianni E, Saltarelli A, Rabuffi P, Bagni O, Filippi L, Cortesi E. Radioembolisation with (90)Y-labelled resin microspheres in the treatment of liver metastasis from breast cancer. Eur Radiol 2013; 23: [PMID: DOI: /s ] 34 Cianni R, Urigo C, Notarianni E, Saltarelli A, D Agostini A, Iozzino M, Dornbusch T, Cortesi E. Radioembolisation using yttrium 90 (Y-90) in patients affected by unresectable hepatic metastases. Radiol Med 2010; 115: [PMID: DOI: /s ] 35 Coldwell DM, Kennedy AS, Nutting CW. Use of yttrium-90 microspheres in the treatment of unresectable hepatic metastases from breast cancer. Int J Radiat Oncol Biol Phys 2007; 69: [PMID: DOI: /j.ijrobp ] 36 Gaba RC, Lakhoo J. Yttrium-90 microsphere radioembolization for treatment of lung cancer hepatic metastases. Case Rep Oncol 2012; 5: [PMID: DOI: / ] 37 Gonsalves CF, Eschelman DJ, Sullivan KL, Anne PR, Doyle L, Sato T. Radioembolization as salvage therapy for hepatic metastasis of uveal melanoma: a single-institution experience. AJR Am J Roentgenol 2011; 196: [PMID: DOI: /AJR ] 38 Hamoui N, Gates VL, Gonzalez J, Lewandowski RJ, Salem R. Radioembolization of renal cell carcinoma using yttrium-90 microspheres. J Vasc Interv Radiol 2013; 24: [PMID: DOI: /j.jvir ] 39 Jakobs TF, Hoffmann RT, Fischer T, Stemmler HJ, Tatsch K, La Fougere C, Murthy R, Reiser MF, Helmberger TK. Radioembolization in patients with hepatic metastases from breast cancer. J Vasc Interv Radiol 2008; 19: [PMID: DOI: /j.jvir ] 40 Kennedy AS, Nutting C, Jakobs T, Cianni R, Notarianni E, Ofer A, Beny A, Dezarn WA. A first report of radioembolization for hepatic metastases from ocular melanoma. Cancer Invest 2009; 27: [PMID: DOI: / ] 41 Lim L, Gibbs P, Yip D, Shapiro JD, Dowling R, Smith D, Little A, Bailey W, Liechtenstein M. Prospective study of treatment with selective internal radiation therapy spheres in patients with unresectable primary or secondary hepatic malignancies. Intern Med J 2005; 35: [PMID: DOI: / j x] 42 Memon K, Kuzel TM, Vouche M, Atassi R, Lewandowski RJ, Salem R. Hepatic yttrium-90 radioembolization for metastatic melanoma: a single-center experience. Melanoma Res 2014; 24: [PMID: DOI: /CMR ] 43 Michl M, Haug AR, Jakobs TF, Paprottka P, Hoffmann RT, Bartenstein P, Boeck S, Haas M, Laubender RP, Heinemann V. Radioembolization with Yttrium-90 microspheres (SIRT) in pancreatic cancer patients with liver metastases: efficacy, safety and prognostic factors. Oncology 2014; 86: [PMID: DOI: / ] 44 Murthy R, Mutha P, Lee JH, Oh Y. Yttrium-90-labeled microsphere radioembolotherapy of liver-dominant metastases from thoracic malignancies. J Vasc Interv Radiol 2008; 19: [PMID: DOI: /j.jvir ] 45 Pöpperl G, Helmberger T, Münzing W, Schmid R, Jacobs TF, Tatsch K. Selective internal radiation therapy with SIR-Spheres in patients with nonresectable liver tumors. Cancer Biother Radiopharm 2005; 20: [PMID: DOI: / cbr ] 46 Reiner CS, Morsbach F, Sah BR, Puippe G, Schaefer N, Pfammatter T, Alkadhi H. Early treatment response evaluation after yttrium-90 radioembolization of liver malignancy with CT perfusion. J Vasc Interv Radiol 2014; 25: [PMID: DOI: /j.jvir ] 47 Saxena A, Kapoor J, Meteling B, Morris DL, Bester L. Yttrium-90 radioembolization for unresectable, chemoresistant breast cancer liver metastases: a large single-center experience of 40 patients. Ann Surg Oncol 2014; 21: [PMID: DOI: /s ] 48 Seyal AR, Parekh K, Velichko YS, Salem R, Yaghmai V. Tumor growth kinetics versus RECIST to assess response to locoregional therapy in breast cancer liver metastases. Acad Radiol 2014; 21: [PMID: DOI: /j.acra ] 49 Xing M, Prajapati HJ, Dhanasekaran R, Lawson DH, Kokabi N, Eaton BR, Kim HS. Selective Internal Yttrium-90 Radioembolization Therapy (90Y-SIRT) Versus Best Supportive Care in Patients With Unresectable Metastatic Melanoma to the Liver Refractory to Systemic Therapy: Safety and Efficacy Cohort Study. Am J Clin Oncol 2014; Epub ahead of print [PMID: DOI: /COC ] 50 Gordon AC, Gradishar WJ, Kaklamani VG, Thuluvath AJ, Ryu RK, Sato KT, Gates VL, Salem R, Lewandowski RJ. Yttrium-90 radioembolization stops progression of targeted breast cancer liver metastases after failed chemotherapy. J Vasc Interv Radiol 2014; 25: , 1532.e1-e2 [PMID: DOI: / j.jvir ] 51 Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, CA Cancer J Clin 2014; 64: 9-29 [PMID: DOI: / caac.21208] 52 Purushotham A, Shamil E, Cariati M, Agbaje O, Muhidin A, Gillett C, Mera A, Sivanadiyan K, Harries M, Sullivan R, Pinder SE, Garmo H, Holmberg L. Age at diagnosis and distant metastasis in breast cancer--a surprising inverse relationship. Eur J Cancer 2014; 50: [PMID: DOI: / j.ejca ] 53 O Shaughnessy J. Extending survival with chemotherapy in metastatic breast cancer. Oncologist 2005; 10 Suppl 3: [PMID: DOI: /theoncologist ] 54 Kato I, Severson RK, Schwartz AG. Conditional median survival of patients with advanced carcinoma: surveillance, epidemiology, and end results data. Cancer 2001; 92: [PMID: ] 55 Porkka K, Blomqvist C, Rissanen P, Elomaa I, Pyrhönen S. Salvage therapies in women who fail to respond to first-line treatment with fluorouracil, epirubicin, and cyclophosphamide for advanced breast cancer. J Clin Oncol 1994; 12: [PMID: ] 56 Nazario HE, Lepe R, Trotter JF. Metastatic breast cancer presenting as acute liver failure. Gastroenterol Hepatol (N Y) 2011; 7: [PMID: ] 57 Sharma RA, Decatris MP, Santhanam S, Roy R, Osman AE, 8281 July 21, 2015 Volume 21 Issue 27

76 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Clarke CB, Khanna S, O Byrne KJ. Reversibility of liver failure secondary to metastatic breast cancer by vinorelbine and cisplatin chemotherapy. Cancer Chemother Pharmacol 2003; 52: [PMID: DOI: /s ] 58 Mariani P, Servois V, De Rycke Y, Bennett SP, Feron JG, Almubarak MM, Reyal F, Baranger B, Pierga JY, Salmon RJ. Liver metastases from breast cancer: Surgical resection or not? A case-matched control study in highly selected patients. Eur J Surg Oncol 2013; 39: [PMID: DOI: / j.ejso ] 59 Adam R. Chemotherapy and surgery: new perspectives on the treatment of unresectable liver metastases. Ann Oncol 2003; 14 Suppl 2: ii13-ii16 [PMID: ] 60 Schneebaum S, Walker MJ, Young D, Farrar WB, Minton JP. The regional treatment of liver metastases from breast cancer. J Surg Oncol 1994; 55: 26-31; discussion 32 [PMID: ] 61 Kennedy AS, Coldwell D, Nutting C, Murthy R, Wertman DE, Loehr SP, Overton C, Meranze S, Niedzwiecki J, Sailer S. Resin 90Y-microsphere brachytherapy for unresectable colorectal liver metastases: modern USA experience. Int J Radiat Oncol Biol Phys 2006; 65: [PMID: DOI: / j.ijrobp ] 62 Memon K, Lewandowski RJ, Mulcahy MF, Riaz A, Ryu RK, Sato KT, Gupta R, Nikolaidis P, Miller FH, Yaghmai V, Gates VL, Atassi B, Newman S, Omary RA, Benson AB, Salem R. Radioembolization for neuroendocrine liver metastases: safety, imaging, and long-term outcomes. Int J Radiat Oncol Biol Phys 2012; 83: [PMID: DOI: / j.ijrobp ] 63 Boehm LM, Jayakrishnan TT, Miura JT, Zacharias AJ, Johnston FM, Turaga KK, Gamblin TC. Comparative effectiveness of hepatic artery based therapies for unresectable intrahepatic cholangiocarcinoma. J Surg Oncol 2015; 111: [PMID: DOI: /jso.23781] 64 Mavros MN, Economopoulos KP, Alexiou VG, Pawlik TM. Treatment and Prognosis for Patients With Intrahepatic Cholangiocarcinoma: Systematic Review and Meta-analysis. JAMA Surg 2014; Epub ahead of print [PMID: DOI: /jamasurg ] 65 Park J, Kim MH, Kim KP, Park do H, Moon SH, Song TJ, Eum J, Lee SS, Seo DW, Lee SK. Natural History and Prognostic Factors of Advanced Cholangiocarcinoma without Surgery, Chemotherapy, or Radiotherapy: A Large-Scale Observational Study. Gut Liver 2009; 3: [PMID: DOI: /gnl ] 66 Endo I, Gonen M, Yopp AC, Dalal KM, Zhou Q, Klimstra D, D Angelica M, DeMatteo RP, Fong Y, Schwartz L, Kemeny N, O Reilly E, Abou-Alfa GK, Shimada H, Blumgart LH, Jarnagin WR. Intrahepatic cholangiocarcinoma: rising frequency, improved survival, and determinants of outcome after resection. Ann Surg 2008; 248: [PMID: DOI: / SLA.0b013e318176c4d3] 67 Imber C, Stebbing J, Shankar A. Improving outcomes in cholangiocarcinomas. Gastrointest Cancer Res 2011; 4: [PMID: ] 68 Haug AR, Heinemann V, Bruns CJ, Hoffmann R, Jakobs T, Bartenstein P, Hacker M. 18F-FDG PET independently predicts survival in patients with cholangiocellular carcinoma treated with 90Y microspheres. Eur J Nucl Med Mol Imaging 2011; 38: [PMID: DOI: /s x] 69 Ibrahim SM, Mulcahy MF, Lewandowski RJ, Sato KT, Ryu RK, Masterson EJ, Newman SB, Benson A, Omary RA, Salem R. Treatment of unresectable cholangiocarcinoma using yttrium-90 microspheres: results from a pilot study. Cancer 2008; 113: [PMID: DOI: /cncr.23818] 70 Rafi S, Piduru SM, El-Rayes B, Kauh JS, Kooby DA, Sarmiento JM, Kim HS. Yttrium-90 radioembolization for unresectable standardchemorefractory intrahepatic cholangiocarcinoma: survival, efficacy, and safety study. Cardiovasc Intervent Radiol 2013; 36: [PMID: DOI: /s ] 71 Saxena A, Bester L, Chua TC, Chu FC, Morris DL. Yttrium-90 radiotherapy for unresectable intrahepatic cholangiocarcinoma: a preliminary assessment of this novel treatment option. Ann Surg Oncol 2010; 17: [PMID: DOI: /s x] 72 Camacho JC, Kokabi N, Xing M, Prajapati HJ, El-Rayes B, Kim HS. Modified response evaluation criteria in solid tumors and European Association for The Study of the Liver criteria using delayed-phase imaging at an early time point predict survival in patients with unresectable intrahepatic cholangiocarcinoma following yttrium-90 radioembolization. J Vasc Interv Radiol 2014; 25: [PMID: DOI: /j.jvir ] 73 Filippi L, Pelle G, Cianni R, Scopinaro F, Bagni O. Change in total lesion glycolysis and clinical outcome after (90)Y radioembolization in intrahepatic cholangiocarcinoma. Nucl Med Biol 2015; 42: [PMID: DOI: /j.nucmedbio ] 74 Mouli S, Memon K, Baker T, Benson AB, Mulcahy MF, Gupta R, Ryu RK, Salem R, Lewandowski RJ. Yttrium-90 radioembolization for intrahepatic cholangiocarcinoma: safety, response, and survival analysis. J Vasc Interv Radiol 2013; 24: [PMID: DOI: /j.jvir ] 75 Chang AE, Karnell LH, Menck HR. The National Cancer Data Base report on cutaneous and noncutaneous melanoma: a summary of 84,836 cases from the past decade. The American College of Surgeons Commission on Cancer and the American Cancer Society. Cancer 1998; 83: [PMID: ] 76 Markovic SN, Erickson LA, Rao RD, Weenig RH, Pockaj BA, Bardia A, Vachon CM, Schild SE, McWilliams RR, Hand JL, Laman SD, Kottschade LA, Maples WJ, Pittelkow MR, Pulido JS, Cameron JD, Creagan ET. Malignant melanoma in the 21st century, part 1: epidemiology, risk factors, screening, prevention, and diagnosis. Mayo Clin Proc 2007; 82: [PMID: DOI: / ] 77 Bakalian S, Marshall JC, Logan P, Faingold D, Maloney S, Di Cesare S, Martins C, Fernandes BF, Burnier MN. Molecular pathways mediating liver metastasis in patients with uveal melanoma. Clin Cancer Res 2008; 14: [PMID: DOI: / CCR ] 78 Feldman ED, Pingpank JF, Alexander HR. Regional treatment options for patients with ocular melanoma metastatic to the liver. Ann Surg Oncol 2004; 11: [PMID: ] 79 Balch CM, Soong SJ, Murad TM, Smith JW, Maddox WA, Durant JR. A multifactorial analysis of melanoma. IV. Prognostic factors in 200 melanoma patients with distant metastases (stage III). J Clin Oncol 1983; 1: [PMID: ] 80 Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, Dummer R, Garbe C, Testori A, Maio M, Hogg D, Lorigan P, Lebbe C, Jouary T, Schadendorf D, Ribas A, O Day SJ, Sosman JA, Kirkwood JM, Eggermont AM, Dreno B, Nolop K, Li J, Nelson B, Hou J, Lee RJ, Flaherty KT, McArthur GA. Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 81 Robert C, Thomas L, Bondarenko I, O Day S, Weber J, Garbe C, Lebbe C, Baurain JF, Testori A, Grob JJ, Davidson N, Richards J, Maio M, Hauschild A, Miller WH, Gascon P, Lotem M, Harmankaya K, Ibrahim R, Francis S, Chen TT, Humphrey R, Hoos A, Wolchok JD. Ipilimumab plus dacarbazine for previously untreated metastatic melanoma. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 82 Ghaneh P, Kawesha A, Evans JD, Neoptolemos JP. Molecular prognostic markers in pancreatic cancer. J Hepatobiliary Pancreat Surg 2002; 9: 1-11 [PMID: DOI: / s ] 83 Burris HA, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, Von Hoff DD. Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial. J Clin Oncol 1997; 15: [PMID: ] 84 Cunningham D, Chau I, Stocken DD, Valle JW, Smith D, 8282 July 21, 2015 Volume 21 Issue 27

77 Kuei A et al. Yttrium-90 SIRT on non-conventional liver tumors Steward W, Harper PG, Dunn J, Tudur-Smith C, West J, Falk S, Crellin A, Adab F, Thompson J, Leonard P, Ostrowski J, Eatock M, Scheithauer W, Herrmann R, Neoptolemos JP. Phase III randomized comparison of gemcitabine versus gemcitabine plus capecitabine in patients with advanced pancreatic cancer. J Clin Oncol 2009; 27: [PMID: DOI: / JCO ] 85 Moore MJ, Goldstein D, Hamm J, Figer A, Hecht JR, Gallinger S, Au HJ, Murawa P, Walde D, Wolff RA, Campos D, Lim R, Ding K, Clark G, Voskoglou-Nomikos T, Ptasynski M, Parulekar W. Erlotinib plus gemcitabine compared with gemcitabine alone in patients with advanced pancreatic cancer: a phase III trial of the National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 2007; 25: [PMID: DOI: / JCO ] 86 Conroy T, Desseigne F, Ychou M, Bouché O, Guimbaud R, Bécouarn Y, Adenis A, Raoul JL, Gourgou-Bourgade S, de la Fouchardière C, Bennouna J, Bachet JB, Khemissa-Akouz F, Péré- Vergé D, Delbaldo C, Assenat E, Chauffert B, Michel P, Montoto- Grillot C, Ducreux M. FOLFIRINOX versus gemcitabine for metastatic pancreatic cancer. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 87 Kitami CE, Kurosaki I, Koyama Y, Makino H, Hatakeyama K. Longterm survival after hepatectomy for hepatic recurrence of carcinoma of the papilla of Vater. J Hepatobiliary Pancreat Surg 2005; 12: [PMID: DOI: /s ] 88 Ko K, Fujioka S, Kato K, Machiki Y, Hashimoto M, Fujii K, Ishikawa A, Takamizawa J, Mizutani T. Resection of liver metastasis after a pancreatoduodenectomy for pancreatic cancer: a case report. Hepatogastroenterology 2001; 48: [PMID: ] 89 Lockhart AC, Rothenberg ML, Berlin JD. Treatment for pancreatic cancer: current therapy and continued progress. Gastroenterology 2005; 128: [PMID: ] 90 Yamada H, Hirano S, Tanaka E, Shichinohe T, Kondo S. Surgical treatment of liver metastases from pancreatic cancer. HPB (Oxford) 2006; 8: [PMID: DOI: / ] 91 Harshman LC, Xie W, Bjarnason GA, Knox JJ, MacKenzie M, Wood L, Srinivas S, Vaishampayan UN, Tan MH, Rha SY, Donskov F, Agarwal N, Kollmannsberger C, North S, Rini BI, Heng DY, Choueiri TK. Conditional survival of patients with metastatic renal-cell carcinoma treated with VEGF-targeted therapy: a population-based study. Lancet Oncol 2012; 13: [PMID: DOI: /S (12) ] 92 Flanigan RC, Campbell SC, Clark JI, Picken MM. Metastatic renal cell carcinoma. Curr Treat Options Oncol 2003; 4: [PMID: ] 93 Aloia TA, Adam R, Azoulay D, Bismuth H, Castaing D. Outcome following hepatic resection of metastatic renal tumors: the Paul Brousse Hospital experience. HPB (Oxford) 2006; 8: [PMID: DOI: / ] 94 Alves A, Adam R, Majno P, Delvart V, Azoulay D, Castaing D, Bismuth H. Hepatic resection for metastatic renal tumors: is it worthwhile? Ann Surg Oncol 2003; 10: [PMID: ] 95 Motzer RJ, Bander NH, Nanus DM. Renal-cell carcinoma. N Engl J Med 1996; 335: [PMID: DOI: / NEJM ] 96 McKay RR, Kroeger N, Xie W, Lee JL, Knox JJ, Bjarnason GA, MacKenzie MJ, Wood L, Srinivas S, Vaishampayan UN, Rha SY, Pal SK, Donskov F, Tantravahi SK, Rini BI, Heng DY, Choueiri TK. Impact of bone and liver metastases on patients with renal cell carcinoma treated with targeted therapy. Eur Urol 2014; 65: [PMID: DOI: /j.eururo ] 97 Motzer RJ, Mazumdar M, Bacik J, Berg W, Amsterdam A, Ferrara J. Survival and prognostic stratification of 670 patients with advanced renal cell carcinoma. J Clin Oncol 1999; 17: [PMID: ] 98 Ballarin R, Spaggiari M, Cautero N, De Ruvo N, Montalti R, Longo C, Pecchi A, Giacobazzi P, De Marco G, D Amico G, Gerunda GE, Di Benedetto F. Pancreatic metastases from renal cell carcinoma: the state of the art. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 99 Socinski MA, Evans T, Gettinger S, Hensing TA, Sequist LV, Ireland B, Stinchcombe TE. Treatment of stage IV non-small cell lung cancer: Diagnosis and management of lung cancer, 3rd ed: American College of Chest Physicians evidence-based clinical practice guidelines. Chest 2013; 143: e341s-e368s [PMID: DOI: /chest ] 100 Cobourn CS, Makowka L, Langer B, Taylor BR, Falk RE. Examination of patient selection and outcome for hepatic resection for metastatic disease. Surg Gynecol Obstet 1987; 165: [PMID: ] 101 Foster JH. Survival after liver resection for secondary tumors. Am J Surg 1978; 135: [PMID: ] 102 Di Carlo I, Grasso G, Patane D, Russello D, Latteri F. Liver metastases from lung cancer: is surgical resection justified? Ann Thorac Surg 2003; 76: [PMID: ] P- Reviewer: Kwok PCH, Petrucciani N S- Editor: Yu J L- Editor: A E- Editor: Liu XM 8283 July 21, 2015 Volume 21 Issue 27

78 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. REVIEW MicroRNAs potential utility in colon cancer: Early detection, prognosis, and chemosensitivity Michael Hollis, Kavitha Nair, Arpita Vyas, Lakshmi Shankar Chaturvedi, Sahil Gambhir, Dinesh Vyas Michael Hollis, Lakshmi Shankar Chaturvedi, Sahil Gambhir, Dinesh Vyas, Department of Surgery, College of Human Medicine, Michigan State University, East Lansing, MI 48912, United States Kavitha Nair, Department of Medicine, Emory University, Atlanta, Ga 30322, United States Arpita Vyas, Pediatrics, College of Human Medicine, Michigan State University, East Lansing, MI 49503, United States Author contributions: Hollis M and Vyas A contributed equally to this work; they designed research, analyzed data, and wrote the paper; Nair K and Gambhir S contributed in research; Vyas D contributed in data and conceptualization; all authors finally approved the manuscript. Conflict-of-interest statement: The authors declare no conflict of interests. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Dinesh Vyas, MD, MS, FICS, Department of Surgery, College of Human Medicine, Michigan State University, 1200 East Michigan Avenue, Suite 655, MI 48912, United States. dinesh.vyas@hc.msu.edu Telephone: Fax: Received: January 20, 2015 Peer-review started: January 20, 2015 First decision: March 10, 2015 Revised: March 24, 2015 Accepted: May 27, 2015 Article in press: May 27, 2015 Published online: July 21, 2015 Abstract Over the past decade, research has shown that aberrant expression of microrna (mirna) is involved in colorectal cancer development and progression. MicroRNAs are small sequences of non-coding RNA that regulate expression of genes involved in important cellular functions, such as cell differentiation, multiplication, and apoptosis. A specific mirna may display the effects of a tumor suppressor or oncogene. Altered mirna expression is found in colorectal cancer (CRC) and patterns of mirna expression correlate with CRC detection and outcome. Studies also have examined the use of circulating serum mirna and fecal mirna expression as non-invasive markers for early detection. Here, we review recent evidence demonstrating the potential role of mirna in CRC and the implications of its use in the diagnosis, prognosis, and management of CRC. Key words: Colorectal cancer; Microrna; Expression; Serum microrna; Fecal microrna; Diagnostic; Prognostic; Therapeutic The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Specific microrna (mirna) have potential to display the effects of a tumor suppressor or oncogene. Altered mirna expression is found in colon cancer and patterns of mirna expression correlate with its detection and outcome. Hollis M, Nair K, Vyas A, Chaturvedi LS, Gambhir S, Vyas D. MicroRNAs potential utility in colon cancer: Early detection, prognosis, and chemosensitivity. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8284.htm DOI: org/ /wjg.v21.i July 21, 2015 Volume 21 Issue 27

79 Hollis M et al. mirna in CRC detection and outcome INTRODUCTION Colorectal cancer (CRC) is currently ranked third in the world among the most common cancers in females and second in men [1]. Each year, approximately more than one million people acquire CRC and over half a million people die from CRC [2,3]. The incidence varies greatly worldwide, with differences dependent on lifestyle, environment, and genetics. Epidemiological studies have identified many risk factors for the development of CRC which include age, family history, inflammatory bowel disease, and preventable risk factors such as obesity, excess alcohol, excess red meat and processed meat consumption [4], high-fat diet, cigarette smoke, low socioeconomic status [5], and sedentary lifestyle [6]. The etiology of CRC is most commonly sporadic, but may also be hereditary as in familial adenomatous polyposis (FAP) and hereditary non-polyposis colorectal cancer (HNPCC). Regardless, the development of CRC involves genetic mutations leading to the progression of normal epithelial cells of the intestinal mucosa from adenoma to carcinoma. Due to this well-established sequential transformation, there are multiple opportunities to interfere with the natural course of the disease. This may take the form of screening, chemoprevention, chemotherapy, surgical resection, or palliative therapy. Prognosis depends on the cancer stage at the time of diagnosis. The Tumor Node Metastases (TNM) staging system of the American Joint Committee on Cancer/Union for International Cancer Control is the preferred staging system for CRC. Detection of early stage CRC may confer a 90% 5-year survival rate, compared to 12% if distant metastasis has occurred [7,8]. Given that symptoms are often not obvious, detection of CRC relies heavily on screening [9]. Over the past two decades, the introduction of screening programs such as endoscopy, fecal occult blood testing (FOBT), and barium enema have led to improved early detection of CRC, which has shown a reduction in CRC incidence and mortality in many countries [10]. Unfortunately, less than 40% of CRC patients are identified early enough in the disease when management is most efficacious [7]. In addition, adherence to such screening programs is insufficient at nearly 50% in high-risk patients [11]. Endoscopy is invasive and expensive, whereas the less invasive and less expensive FOBT had a sensitivity of only 47%-73% in case control studies [9,12]. Thus, there is a strong necessity for the development of accurate and non-invasive markers for the diagnosis and prognosis of CRC. Recent studies have implicated microrna (mirna) as serving a key part in the CRC progression and outcome. This article focuses on the utility of mirna in the diagnosis and prognosis of CRC, as well as its role in predicting sensitivity to chemotherapy. Micro-RNA In 1993, the first mirna known as lin-4 was identified in C. elegans [13,14]. According to a searchable online database, 2588 mature human mirnas have since been found in humans [15]. mirnas are small (18-25 nucleotides) RNA polymers, which are expressed as pre-mirna and enzymatically cleaved by the protein Dicer into the mature form of mirna [16]. They are estimated to regulate the expression of over 30% of human genes by directly engaging with and influencing the transcription of mrna molecules, ultimately regulating protein translation [17]. An mirna can accomplish this through integration with a RNA-induced silencing complex (RISC) and subsequently binding with a target mrna molecule. The mechanisms by which the mirna affects the processing of mrna most commonly involve binding to the mrna, resulting in either mrna degradation or inhibition of its translation. mrna transcripts are degraded if exact base-pairing occurs between mirna and mrna and silenced if the base-pairing is imperfect. Other mechanisms include directly binding to DNA open reading frames, epigenetic modifications such as methylation, and targeting mrna binding proteins. A single mirna can act on many mrnas, while a single mrna can be acted on by multiple mirnas [18]. Effect of the mirna is dependent on the function of the mrna with which it interacts. Therefore, elevated activities of mirnas that reduce tumor suppressor expression facilitate cell proliferation and are known as oncomirs. Depressed activity of mirnas functioning as tumor suppressors would also promote oncogenesis, and are known as tsmirs. Other mirnas regulate cell migration and invasion, and promote metastasis. MicroRNA genes are also often located within regions of the genome that are especially susceptible to loss of heterozygosity and amplification, at fragile sites, or other areas associated with genetic mutations. Since mirnas are known to regulate cell differentiation, apoptosis, and proliferations [19], alterations in their expression contribute to human disease, such as colorectal cancer. MICRO-RNA and Early Detection Successful treatment is best achieved when CRC is detected at its earliest stage. Specifically, detecting CRC and surgically resecting it before it has metastasized is considered the only curative therapy. The most widely used methods for diagnosing early CRC are fecal occult blood tests (FOBT) and colonoscopy. Although these tests have improved the survival rates for CRC, FOBT has a low sensitivity and colonoscopy is both expensive and invasive. In addition, certain foods and medications may lead to false-positive results of FOBT. In recent years, many studies have shown a relationship between mirna expression and CRC July 21, 2015 Volume 21 Issue 27

80 Hollis M et al. mirna in CRC detection and outcome Table 1 Summary of mirna and early detection mirna and early detection Micro RNA mir-135b Ref. New article [12,23] Summary Tumor initiation, progression mir-106a [24,25] Improves sensitivity of FOBT mir-431 [29] Diagnosis of colorectal adenocarcinoma mir-15b [29] Diagnosis of colorectal adenocarcinoma mir-139-3p [29] Diagnosis of colorectal adenocarcinoma mir-532-3p [29] Diagnosis of colorectal adenocarcinoma mir-331 [29] Diagnosis of colorectal adenocarcinoma mir-195 [29] Diagnosis of colorectal adenocarcinoma mir-17 [29] Diagnosis of colorectal adenocarcinoma mir-142-3p [29] Diagnosis of colorectal adenocarcinoma mir-15b [29] Diagnosis of colorectal adenocarcinoma mir-532 [29] Diagnosis of colorectal adenocarcinoma mir-652 [29] Diagnosis of colorectal adenocarcinoma mir193a-3p [30] Diagnosis of colorectal adenocarcinoma, expression levels in tumor mir-23a [30] Diagnosis of colorectal adenocarcinoma, expression levels in tumor mir-338-5p [30] Diagnosis of colorectal adenocarcinoma, expression levels in tumor mir-18a [32] Diagnosis of colorectal adenocarcinoma mir-20a [32] Diagnosis of colorectal adenocarcinoma mir-21 [32] Diagnosis of colorectal adenocarcinoma mir-29a [32] Diagnosis of colorectal adenocarcinoma mir-92a [32] Diagnosis of colorectal adenocarcinoma mir-106b [32] Diagnosis of colorectal adenocarcinoma mir-133a [32] Diagnosis of colorectal adenocarcinoma mir-143 [32] Diagnosis of colorectal adenocarcinoma mir-145 [32] Diagnosis of colorectal adenocarcinoma mir-1288 [33,34] Control for mirna in colorectal cancer FOBT: Fecal occult blood testing. Much of this work has suggested that mirna may serve as a reliable, non-invasive biomarker with high sensitivity for early detection of CRC (Table 1). Colonocytes of the gastrointestinal tract are continuously released into the intestinal lumen and can be evaluated in the feces. The first study to identify mirna in feces showed that fecal samples from CRC patients had elevated mirna. This data demonstrated a significant correlation with the histopathology of the patients tumor tissue samples [20]. A recent study by Ahmed et al [20] studied tumor tissue samples from different CRC mouse models and discovered that mir-135 is involved in a complex feedback loop. Mutations of molecular pathways commonly found in CRC involving APC and PTEN/PI3K facilitate the overexpression of mir-135b, which itself promotes tumor initiation and progression. Another study showed that mir-135b was elevated in CRC and adenomatous tissue samples in contrast to adjacent tissue without evidence of lesions. Stool samples demonstrated a trend of increasing mir-135b across the adenoma to carcinoma sequence compared to inflammatory bowel disease patients and healthy controls. Stool mir-135b was also shown to drop significantly after surgical resection of the CRC or advanced adenoma. The sensitivity of fecal mir-135b was 78% in CRC, 73% in advanced adenoma, and 65% in any adenoma; the specificity was found to be 68% [21]. Koga et al [22] found that fecal mir-106a was also of value in improving the sensitivity of FOBT screening. The authors extracted fecal RNA from the residuum of the FOBT to analyze for potential mirna markers. They showed that the sensitivity and specificity of fecal mir-106a was 34.2% and 97.2% compared to FOBT with 60.7% and 98.1%, respectively. Importantly, the addition of fecal mir-106a analysis to the FOBT results demonstrated a sensitivity and specificity of 70.9% and 96.3%, respectively. One quarter of the CRC patients with a false-negative were found to be a true-positive with the addition of the fecal mir- 106a analysis, greatly enhancing the sensitivity of the screening test. The authors use of the FOBT residuum was validated by their earlier study which found no significant difference in the quality or quantity of the mir-106a extracted from FOBT residuum after 5 d if stored at 4 degrees Celsius [23]. The most utilized CRC serum marker is currently carcinoembryonic antigen (CEA), but it has also been found to be elevated in other non-cancerous conditions such as inflammation of the intestines, liver, lung, and pancreas [24]. mirnas are found circulating in both serum and plasma. They are packaged into microvesicles and exosomes, thus resistant to degradation by RNase [25]. They are also stable in a variety of other conditions such as low/high ph, freeze-thaw cycles, boiling, and longterm storage [26]. In many recent studies, specific plasma mirnas were found to be either up- or down-regulated in patients with CRC versus controls and also discovered their utility for detecting patients with CRC and adenoma. Kanaan et al [27] identified a group of 8 plasma mirnas and a group of 3 plasma mirnas, which could precisely distinguish between patients with colorectal adenoma and patients without colorectal neoplasia. Their panels were also able to distinguish between patients with colorectal adenomas from all stages of CRC. Yong et al [28] also identified a group of 3 plasma mirnas whose levels were elevated in patients with CRC and were significantly correlated with their level of expression within their respective CRC tissue samples. They also illustrated an increasing trend of plasma levels from the early to late stages of CRC in comparison to control patients. Furthermore, as a biomarker for CRC detection, this triple mirna panel performed with a sensitivity of 80% and a specificity of 84.4%. Another 20 mirnas were either up-regulated or down-regulated, in which changes in their serum levels reliably differentiated between patients with stage Ⅳ CRC and controls. A follow-up study led to the development of a partial least squared regression model, which was able to correctly assign patients as stages Ⅰ or Ⅱ based on the 8286 July 21, 2015 Volume 21 Issue 27

81 Hollis M et al. mirna in CRC detection and outcome Table 2 Summary of mirna and prognosis mirna and prognosis Micro RNA Ref. Summary mir-200c [35-38] Increased expression level predicts worse prognosis mir-378 [46] Potential prognostic biomarker mir-126 [47] Potential prognostic biomarker mir-224 [48,49] Potential prognostic biomarker mir-429 [50] Potential prognostic biomarker mir-182 [51] Potential prognostic biomarker mir-32 [52] Potential prognostic biomarker mir-214 [53] Potential prognostic biomarker mir-182 [54] Potential prognostic biomarker mir-92a [55] Potential prognostic biomarker mir-124 [56] Potential prognostic biomarker mir-30b [57] Potential prognostic biomarker mir-625 [58] Potential prognostic biomarker mir-155 [37] Potential prognostic biomarker mir-210 [37] Potential prognostic biomarker mir-215 [59] Potential prognostic biomarker mir-130b [60] Potential prognostic biomarker mir-148b [61] Potential prognostic biomarker mir-148 [61] Potential prognostic biomarker mir-16 [62] Potential prognostic biomarker mir-21 [10,39-45,47,65-68] Upregulated in CRC, associated with tumor size, distant metastasis, poor survival and independent biomarker CRC: Colorectal cancer. serum mirna profile of stage Ⅳ CRC patients [29]. Luo et al [30] demonstrated the ability of 9 plasma mirnas to differentiate between patients with CRC and controls. Gopalan et al [31] discovered that expression of mir-1288 was correlated with not only stage, but also location within the gastrointestinal tract; higher mir-1288 expression was found in tumors located more distally within the colon. In the study of serum mirnas in CRC, a stable control is needed for the accurate measurement of circulating mirnas. Hu et al [32] found that mir-1228 was steadily expressed among patients with different cancer types, including CRC, and among patients with CRC at different stages. Therefore, they suggest that mir-1228 is the most stable endogenous control for studying circulating mirnas in CRC. MICRO RNA and Prognosis Although early detection of CRC promotes a reduction in mortality due to the disease, it is frequently diagnosed at a later stage when the prognosis is unfavorable. Current management of CRC relies on clinical and histopathologic factors including, but not limited to, extent of the tumor (T), the extent of spread to the lymph nodes (N), and the presence of metastasis (M) or TNM stage, tumor margin involvement, differentiation, and lymphovascular invasion. Increasing evidence supports the use of molecular markers in estimating prognosis and refining clinical management. Many studies demonstrate the utility of mirnas as prognostic biomarkers (Table 2). The first study to establish a relationship between mirnas and CRC prognosis found a connection between the levels of mirna-200c and survival [33]. Since then, multiple studies have shown that both decreased and increased levels of various mirnas are associated with poor outcome. A study by Toiyama et al [34] demonstrated elevated serum mir-200c in stage Ⅳ CRC compared to stages Ⅰ-Ⅲ, and showed that it served as a predictor for lymph node metastasis and recurrence. mir-200c was also found to serve as an independent indicator for CRC prognosis. Another study also found elevated mir-200c in the serum and tumor tissue of CRC patients compared to healthy controls [35]. Serum mir-200c was also compared among CRC patients treated with surgical resection and chemotherapy. The serum mir-200c levels returned to normal levels in those with good prognosis, whereas in those with recurrence or distant metastasis mir-200c either remained elevated or elevated again after a transient decline. Hur et al [36] identified elevated expression of mir-200c in liver metastasis tissue compared to the primary CRC tissue. The mir-200c was found to be epigenetically regulated. Another mirna with significant potential as a prognostic marker is mir-21. mir-21 is upregulated in six different forms of cancer, including CRC [37]. Previous studies have shown that tissue samples with elevated mir-21 expression were associated with lymph node and distant metastases; it was also correlated with clinical stage of CRC [38]. Another study found that serum mir-21 was significantly elevated in CRC patients [39]. Moreover, serum mir-21 accurately differentiated both adenoma and CRC patients from healthy controls. Elevated serum mir-21 was also 8287 July 21, 2015 Volume 21 Issue 27

82 Hollis M et al. mirna in CRC detection and outcome Table 3 Summary of mirna and chemosensitivity mirna and chemosensitivity Summary Micro RNA Ref. mir-21 [65-68] Increased expression causes decreased chemosensitivity mir-153 [69] Up regulation, increased resistance to oxaliplatin and cisplatin mir-19a [70] Up regulation leads to resistance of FOLFOX therapy mir-106a [71] Up regulation leads to resistance of 5-FU and oxalilatin mir-130b [71] Up regulation leads to resistance of 5-FU and oxalilatin mir-484 [71] Up regulation leads to resistance of 5-FU and oxalilatin mir-129 [72] Down regulation increases resistance to 5-FU, transfection of mirna into existing cells increase cytotoxic effect 5-FU mir-15b [73] Down regulation increases resistance to 5-FU mir-1915 [74] Down regulation decreases chemotherapy by modulating apoptotic pathway mir-122 [75] Down regulation increases resistant to 5-FU 5-FU: 5-fluorouracil. associated with tumor size, distant metastasis, and poor survival, and served as an independent biomarker for CRC prognosis. Schetter et al [40] reported a strong association between elevated mir-21 expression and CRC prognosis based on two patient cohorts, one comprised of 84 American CRC patents and the other of 113 Chinese CRC patients. Elevated expression conferred upon each cohort a worse prognosis and was independent of staging and other clinical characteristics. Subsequent studies performed on cohorts of patients from other ethnic populations has validated their findings and suggest that elevated mir-21 serves as a strong prognostic biomarker regardless of ethnicity [41-43]. Kjaer-Frifeldt et al [44] performed another cohort study demonstrating the use of mir-21 as a prognostic indicator in patients with stage Ⅱ CRC. The authors showed that mir-21 expression may be combined with traditional characteristics used to stratify patients as either high- or low-risk of disease recurrence. Their thinking was that patients that had high mir-21 expression, and therefore a high-risk of recurrence, would be more likely to benefit from adjuvant chemotherapy. However, Oue et al [45] found that in a cohort of Japanese patients with stage Ⅱ CRC, high expression of mir-21 was correlated with a poorer response to adjuvant chemotherapy. The authors showed instead that low mir-21 expressing patients had a positive response to adjuvant chemotherapy. Many other mirnas expression patterns have been discovered as potential prognostic biomarkers. The expression levels of the following mirnas have each been reportedly correlated with prognosis in at least one study: mir-378 [46], mir-126 [47], mir-224 [48,49], mir-429 [50], mir-182 [51], mir-32 [52], mir-214 [53], mir-182 [54], mir-92a [55], mir-124 [56], mir-30b [57], mir-625 [58], mir-155 and mir-210 [35], mir-215 [59], mir-130b [60], mir-148 [61], and mir-16 [62]. The RNA Ⅲ endonuclease known as Dicer is involved in the processing of mirna and its expression is associated with poor prognosis [63]. Iliou et al [64] showed that impairment of Dicer function lead to the downregulation of mirnas associated with the regulation of the stem cell marker, CD44, and epithelial-to-mesenchymal transition-inducing transcription factors. The authors also identified that such changes enhanced tumor initiation and liver metastasis. MICRO-RNA and Chemosensitivity In addition to serving as biomarkers for diagnosis and prognosis, several studies have identified the ability of mirnas to predict the sensitivity of CRC to chemotherapy. The response to chemotherapy varies between patients, the mechanisms for which are complex and poorly established. The use of mirnas to predict chemotherapy efficacy allows for a more personalized approach to the treatment of CRC (Table 3). A previous study has demonstrated that mir-21 expression correlates with poor prognosis and treatment response after 5-fluorouracil (5-FU) treatment [40]. This suggests that elevated mir-21 plays a role in the resistance to 5-FU. CRC tumor cell exposure to 5-FU facilitates an elevated expression of mir-21, perhaps as a means to overcoming the drug s cytotoxic effects [65]. Recently, Deng et al [66] demonstrated that forced overexpression of mir-21 in CRC cell lines increased resistance to 5-FU, which was reversed with genetic knockdown of mir-21 expression. This was also demonstrated by the effects of the dietary curcumin analog, difluorinated curcumin (CDF), on CRC cell lines resistant to treatment with 5-FU and oxaliplatin [67,68]. CDF was shown to inhibit growth of these cells when treated with 5-FU and oxaliplatin, while demonstrating a reduced expression of mir-21. The authors suggest that CDF leads to a decline in mir-21 expression, therefore sensitizing the cells to 5-FU and oxaliplatin treatment. Additional research has recognized several mi- RNAs whose expression patterns are associated with sensitivity to chemotherapeutic agents. For example, up-regulation of mir-153 was associated with increased resistance to oxaliplatin and cisplatin both in vivo and in vitro [69]. Additionally, mir-19a was found to be up-regulated in the serum of resistance-phase advanced CRC and was able to distinguish between patients who respond to FOLFOX therapy and those who are resistant [70]. Kjersem et al [71] identified 3 mirnas (mir-106a, mir-130b, and mir-484) whose up-regulation correlated with a lack of response to 5-FU and oxalilatin. Interestingly, this lack of response was 8288 July 21, 2015 Volume 21 Issue 27

83 Hollis M et al. mirna in CRC detection and outcome not associated with a reduction in progression-free or overall survival. Down-regulation of other mirnas has also been associated with chemoresistance. Reduced expression of mir-129 [72] and mir-15b [73] was found in CRC tissues resistant to 5-FU when compared to normal specimens. Transfection of mir-129 into resistant cells enhanced the cytotoxic effects of 5-FU [72]. mir-1915 was also found to play a role in multi-drug resistant CRC. Overexpression of Bcl-2 has been generally accepted as conferring drug resistance in multiple cancers, including CRC. A study by Xu et al [74] found reduced levels of mir-1915 and up-regulation of Bcl-2 in a multi-drug resistant CRC cell line. Through transfection of mir-1915, they discovered that increased expression of mir-1915 lead to a reduction in Bcl-2 protein levels and sensitized the cells to multiple chemotherapeutic drugs through modulation of apoptotic pathways. A recent study by He et al [75] illustrated the role of mirnas on the Warburg effect and chemoresistance. The Warburg effect is the observation that most cancer cells utilize high rates of glycolysis relative to oxidative phosphorylation when compared to normal cells. The study demonstrated that mir-122 directly targets the glycolytic enzyme pyruvate kinase type M2 (PKM2) and consequently, mir-122 is downregulated in 5-FU-resistant CRC cells. The resistance to 5-FU was found to be correlated with the increase in glycolytic glucose metabolism, evidenced by increased glucose consumption and lactate release and increased expression of PKM2, lactate dehydrogenase, and the GLUT-1 glucose transporter. Interestingly, overexpression of mir-122 was shown to suppress PKM2 and significantly improve the cytotoxic effects of 5-FU on these resistant cells. CONCLUSION The discovery of micrornas has since bolstered immense popularity in the scientific community and knowledge of their mechanisms continues to expand in the area of colorectal cancer. Certainly, mirna plays an important part in initiating and fostering the progression of colorectal cancer. Many studies report associations between mirna expression patterns and the diagnosis, prognosis, and sensitivity to chemotherapy. These studies indicate the utility of mirna as markers for early CRC detection and their use in directing the management of CRC at all stages. Further research must be conducted to validate these findings and, most importantly, determine if the results provide information that can be adapted in the clinical realm. Additionally, studies illustrate the potential therapeutic utility of mirnas. More research must be conducted to investigate strategies for the use of mirnas in CRC treatment such as mechanisms for the delivery of mirna into cells, enhanced mirna and mrna binding, and inhibition of endogenous mirnas. Research must also continue to develop a more detailed understanding of mirna biochemical mechanisms and improve precision in the detection, prognosis, and chemosensitivity of colorectal cancer. REFERENCES 1 Heavey PM, McKenna D, Rowland IR. Colorectal cancer and the relationship between genes and the environment. Nutr Cancer 2004; 48: [PMID: DOI: / s nc4802_2] 2 Terzić J, Grivennikov S, Karin E, Karin M. Inflammation and colon cancer. Gastroenterology 2010; 138: e5 [PMID: DOI: /j.gastro ] 3 Schetter AJ, Harris CC. Alterations of micrornas contribute to colon carcinogenesis. Semin Oncol 2011; 38: [PMID: DOI: /j.seminoncol ] 4 Chan DS, Lau R, Aune D, Vieira R, Greenwood DC, Kampman E, Norat T. Red and processed meat and colorectal cancer incidence: meta-analysis of prospective studies. PLoS One 2011; 6: e20456 [PMID: DOI: /journal.pone ] 5 Doubeni CA, Laiyemo AO, Major JM, Schootman M, Lian M, Park Y, Graubard BI, Hollenbeck AR, Sinha R. Socioeconomic status and the risk of colorectal cancer: an analysis of more than a half million adults in the National Institutes of Health-AARP Diet and Health Study. Cancer 2012; 118: [PMID: DOI: /cncr.26677] 6 Hrašovec S, Glavač D. MicroRNAs as Novel Biomarkers in Colorectal Cancer. Front Genet 2012; 3: 180 [PMID: ] 7 American Cancer Society. Colorectal Cancer Facts & Figures Atlanta: American Cancer Society, Available from: URL: colorectalcancerfactsfigures/colorectal-cancer-facts-figures page 8 American Cancer Society. Cancer Facts & Figures Atlanta: American Cancer Society; Available from: URL: cancer.org/research/cancerfactsstatistics/cancerfactsfigures2012/ 9 Kanaan Z, Rai SN, Eichenberger MR, Roberts H, Keskey B, Pan J, Galandiuk S. Plasma mir-21: a potential diagnostic marker of colorectal cancer. Ann Surg 2012; 256: [PMID: DOI: /SLA.0b013e318265bd6f] 10 American Cancer Society. Cancer Facts and Figures, American Cancer Society. Accessed April 13, Available from: URL: index 11 Burt RW, Barthel JS, Dunn KB, David DS, Drelichman E, Ford JM, Giardiello FM, Gruber SB, Halverson AL, Hamilton SR, Ismail MK, Jasperson K, Lazenby AJ, Lynch PM, Martin EW, Mayer RJ, Ness RM, Provenzale D, Rao MS, Shike M, Steinbach G, Terdiman JP, Weinberg D. NCCN clinical practice guidelines in oncology. Colorectal cancer screening. J Natl Compr Canc Netw 2010; 8: 8-61 [PMID: DOI: / MOG.0b013e32833d1733] 12 Burch JA, Soares-Weiser K, St John DJ, Duffy S, Smith S, Kleijnen J, Westwood M. Diagnostic accuracy of faecal occult blood tests used in screening for colorectal cancer: a systematic review. J Med Screen 2007; 14: [PMID: ] 13 Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 1993; 75: [PMID: DOI: / (93) ] 14 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998; 391: [PMID: DOI: /35888] 15 mirbase. [updated 2013 June; cited 2014 June 6]. Available from: URL: 16 Kim VN. MicroRNA biogenesis: coordinated cropping and dicing July 21, 2015 Volume 21 Issue 27

84 Hollis M et al. mirna in CRC detection and outcome Nat Rev Mol Cell Biol 2005; 6: [PMID: DOI: /nrm1644] 17 Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microrna targets. Cell 2005; 120: [PMID: DOI: /j.cell ] 18 Ciafrè SA, Galardi S. micrornas and RNA-binding proteins: a complex network of interactions and reciprocal regulations in cancer. RNA Biol 2013; 10: [PMID: DOI: /rna.24641] 19 Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression profiles classify human cancers. Nature 2005; 435: [PMID: DOI: /nature03702] 20 Ahmed FE, Jeffries CD, Vos PW, Flake G, Nuovo GJ, Sinar DR, Naziri W, Marcuard SP. Diagnostic microrna markers for screening sporadic human colon cancer and active ulcerative colitis in stool and tissue. Cancer Genomics Proteomics 2009; 6: [PMID: ] 21 Wu CW, Ng SC, Dong Y, Tian L, Ng SS, Leung WW, Law WT, Yau TO, Chan FK, Sung JJ, Yu J. Identification of microrna- 135b in stool as a potential noninvasive biomarker for colorectal cancer and adenoma. Clin Cancer Res 2014; 20: [PMID: DOI: / CCR ] 22 Koga Y, Yamazaki N, Yamamoto Y, Yamamoto S, Saito N, Kakugawa Y, Otake Y, Matsumoto M, Matsumura Y. Fecal mir- 106a is a useful marker for colorectal cancer patients with falsenegative results in immunochemical fecal occult blood test. Cancer Epidemiol Biomarkers Prev 2013; 22: [PMID: DOI: / EPI ] 23 Yamazaki N, Koga Y, Yamamoto S, Kakugawa Y, Otake Y, Hayashi R, Saito N, Matsumura Y. Application of the fecal microrna test to the residuum from the fecal occult blood test. Jpn J Clin Oncol 2013; 43: [PMID: DOI: /jjco/hyt068] 24 Spratlin JL, Hui D, Hanson J, Butts C, Au HJ. Community compliance with carcinoembryonic antigen: follow-up of patients with colorectal cancer. Clin Colorectal Cancer 2008; 7: [PMID: DOI: /CCC.2008.n.016] 25 Kosaka N, Iguchi H, Ochiya T. Circulating microrna in body fluid: a new potential biomarker for cancer diagnosis and prognosis. Cancer Sci 2010; 101: [PMID: DOI: /j x] 26 Ahmed FE, Vos PW, Jeffries C, Wiley JE, Weidner DA, Mota H, Bonnerup C, Sibata C, Allison RR. Differences in mrna and microrna microarray expression profiles in human colon adenocarcinoma HT-29 cells treated with either Intensitymodulated Radiation Therapy (IMRT), or Conventional Radiation Therapy (RT). Cancer Genomics Proteomics 2009; 6: [PMID: ] 27 Kanaan Z, Roberts H, Eichenberger MR, Billeter A, Ocheretner G, Pan J, Rai SN, Jorden J, Williford A, Galandiuk S. A plasma microrna panel for detection of colorectal adenomas: a step toward more precise screening for colorectal cancer. Ann Surg 2013; 258: [PMID: DOI: /SLA.0b013e3182a15bcc] 28 Yong FL, Law CW, Wang CW. Potentiality of a triple microrna classifier: mir-193a-3p, mir-23a and mir-338-5p for early detection of colorectal cancer. BMC Cancer 2013; 13: 280 [PMID: DOI: / ] 29 Hofsli E, Sjursen W, Prestvik WS, Johansen J, Rye M, Tranø G, Wasmuth HH, Hatlevoll I, Thommesen L. Identification of serum microrna profiles in colon cancer. Br J Cancer 2013; 108: [PMID: DOI: /bjc ] 30 Luo X, Stock C, Burwinkel B, Brenner H. Identification and evaluation of plasma micrornas for early detection of colorectal cancer. PLoS One 2013; 8: e62880 [PMID: DOI: /journal.pone ] 31 Gopalan V, Pillai S, Ebrahimi F, Salajegheh A, Lam TC, Le TK, Langsford N, Ho YH, Smith RA, Lam AK. Regulation of microrna-1288 in colorectal cancer: altered expression and its clinicopathological significance. Mol Carcinog 2014; 53 Suppl 1: E36-E44 [PMID: DOI: /mc.21993] 32 Hu J, Wang Z, Liao BY, Yu L, Gao X, Lu S, Wang S, Dai Z, Zhang X, Chen Q, Qiu SJ, Wu Y, Zhu H, Fan J, Zhou J, Wang J. Human mir-1228 as a stable endogenous control for the quantification of circulating micrornas in cancer patients. Int J Cancer 2014; 135: [PMID: DOI: /ijc.28757] 33 Xi Y, Formentini A, Chien M, Weir DB, Russo JJ, Ju J, Kornmann M, Ju J. Prognostic Values of micrornas in Colorectal Cancer. Biomark Insights 2006; 2: [PMID: ] 34 Toiyama Y, Hur K, Tanaka K, Inoue Y, Kusunoki M, Boland CR, Goel A. Serum mir-200c is a novel prognostic and metastasispredictive biomarker in patients with colorectal cancer. Ann Surg 2014; 259: [PMID: DOI: / SLA.0b013e3182a6909d] 35 Chen J, Wang W, Zhang Y, Chen Y, Hu T. Predicting distant metastasis and chemoresistance using plasma mirnas. Med Oncol 2014; 31: 799 [PMID: DOI: /s x] 36 Hur K, Toiyama Y, Takahashi M, Balaguer F, Nagasaka T, Koike J, Hemmi H, Koi M, Boland CR, Goel A. MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut 2013; 62: [PMID: DOI: /gutjnl ] 37 Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM. A microrna expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA 2006; 103: [PMID: DOI: /pnas ] 38 Slaby O, Svoboda M, Fabian P, Smerdova T, Knoflickova D, Bednarikova M, Nenutil R, Vyzula R. Altered expression of mir-21, mir-31, mir-143 and mir-145 is related to clinicopathologic features of colorectal cancer. Oncology 2007; 72: [PMID: DOI: / ] 39 Toiyama Y, Takahashi M, Hur K, Nagasaka T, Tanaka K, Inoue Y, Kusunoki M, Boland CR, Goel A. Serum mir-21 as a diagnostic and prognostic biomarker in colorectal cancer. J Natl Cancer Inst 2013; 105: [PMID: DOI: /jnci/djt101] 40 Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, Yuen ST, Chan TL, Kwong DL, Au GK, Liu CG, Calin GA, Croce CM, Harris CC. MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA 2008; 299: [PMID: DOI: /jama ] 41 Shibuya H, Iinuma H, Shimada R, Horiuchi A, Watanabe T. Clinicopathological and prognostic value of microrna-21 and microrna-155 in colorectal cancer. Oncology 2010; 79: [PMID: DOI: / ] 42 Kulda V, Pesta M, Topolcan O, Liska V, Treska V, Sutnar A, Rupert K, Ludvikova M, Babuska V, Holubec L, Cerny R. Relevance of mir-21 and mir-143 expression in tissue samples of colorectal carcinoma and its liver metastases. Cancer Genet Cytogenet 2010; 200: [PMID: DOI: / j.cancergencyto ] 43 Nielsen BS, Jørgensen S, Fog JU, Søkilde R, Christensen IJ, Hansen U, Brünner N, Baker A, Møller S, Nielsen HJ. High levels of microrna-21 in the stroma of colorectal cancers predict short disease-free survival in stage II colon cancer patients. Clin Exp Metastasis 2011; 28: [PMID: DOI: / s ] 44 Kjaer-Frifeldt S, Hansen TF, Nielsen BS, Joergensen S, Lindebjerg J, Soerensen FB, depont Christensen R, Jakobsen A; Danish Colorectal Cancer Group. The prognostic importance of mir-21 in stage II colon cancer: a population-based study. Br J Cancer 2012; 107: [PMID: DOI: / bjc ] 8290 July 21, 2015 Volume 21 Issue 27

85 Hollis M et al. mirna in CRC detection and outcome 45 Oue N, Anami K, Schetter AJ, Moehler M, Okayama H, Khan MA, Bowman ED, Mueller A, Schad A, Shimomura M, Hinoi T, Aoyagi K, Sasaki H, Okajima M, Ohdan H, Galle PR, Yasui W, Harris CC. High mir-21 expression from FFPE tissues is associated with poor survival and response to adjuvant chemotherapy in colon cancer. Int J Cancer 2014; 134: [PMID: DOI: /ijc.28522] 46 Zhang GJ, Zhou H, Xiao HX, Li Y, Zhou T. MiR-378 is an independent prognostic factor and inhibits cell growth and invasion in colorectal cancer. BMC Cancer 2014; 14: 109 [PMID: DOI: / ] 47 Hansen TF, Christensen Rd, Andersen RF, Sørensen FB, Johnsson A, Jakobsen A. MicroRNA-126 and epidermal growth factorlike domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial. Br J Cancer 2013; 109: [PMID: DOI: / bjc ] 48 Zhang GJ, Zhou H, Xiao HX, Li Y, Zhou T. Up-regulation of mir-224 promotes cancer cell proliferation and invasion and predicts relapse of colorectal cancer. Cancer Cell Int 2013; 13: 104 [PMID: DOI: / ] 49 Liao WT, Li TT, Wang ZG, Wang SY, He MR, Ye YP, Qi L, Cui YM, Wu P, Jiao HL, Zhang C, Xie YJ, Wang JX, Ding YQ. microrna-224 promotes cell proliferation and tumor growth in human colorectal cancer by repressing PHLPP1 and PHLPP2. Clin Cancer Res 2013; 19: [PMID: DOI: / CCR ] 50 Li J, Du L, Yang Y, Wang C, Liu H, Wang L, Zhang X, Li W, Zheng G, Dong Z. MiR-429 is an independent prognostic factor in colorectal cancer and exerts its anti-apoptotic function by targeting SOX2. Cancer Lett 2013; 329: [PMID: DOI: /j.canlet ] 51 Rapti SM, Kontos CK, Papadopoulos IN, Scorilas A. Enhanced mir-182 transcription is a predictor of poor overall survival in colorectal adenocarcinoma patients. Clin Chem Lab Med 2014; 52: [PMID: DOI: /cclm ] 52 Wu W, Yang P, Feng X, Wang H, Qiu Y, Tian T, He Y, Yu C, Yang J, Ye S, Zhou Y. The relationship between and clinical significance of MicroRNA-32 and phosphatase and tensin homologue expression in colorectal cancer. Genes Chromosomes Cancer 2013; 52: [PMID: DOI: /gcc.22108] 53 Chen DL, Wang ZQ, Zeng ZL, Wu WJ, Zhang DS, Luo HY, Wang F, Qiu MZ, Wang DS, Ren C, Wang FH, Chiao LJ, Pelicano H, Huang P, Li YH, Xu RH. Identification of microrna-214 as a negative regulator of colorectal cancer liver metastasis by way of regulation of fibroblast growth factor receptor 1 expression. Hepatology 2014; 60: [PMID: DOI: / hep.27118] 54 Liu H, Du L, Wen Z, Yang Y, Li J, Wang L, Zhang X, Liu Y, Dong Z, Li W, Zheng G, Wang C. Up-regulation of mir-182 expression in colorectal cancer tissues and its prognostic value. Int J Colorectal Dis 2013; 28: [PMID: DOI: /s ] 55 Zhou T, Zhang G, Liu Z, Xia S, Tian H. Overexpression of mir- 92a correlates with tumor metastasis and poor prognosis in patients with colorectal cancer. Int J Colorectal Dis 2013; 28: [PMID: DOI: /s ] 56 Wang MJ, Li Y, Wang R, Wang C, Yu YY, Yang L, Zhang Y, Zhou B, Zhou ZG, Sun XF. Downregulation of microrna-124 is an independent prognostic factor in patients with colorectal cancer. Int J Colorectal Dis 2013; 28: [PMID: DOI: /s ] 57 Liao WT, Ye YP, Zhang NJ, Li TT, Wang SY, Cui YM, Qi L, Wu P, Jiao HL, Xie YJ, Zhang C, Wang JX, Ding YQ. MicroRNA-30b functions as a tumour suppressor in human colorectal cancer by targeting KRAS, PIK3CD and BCL2. J Pathol 2014; 232: [PMID: DOI: /path.4309] 58 Lou X, Qi X, Zhang Y, Long H, Yang J. Decreased expression of microrna-625 is associated with tumor metastasis and poor prognosis in patients with colorectal cancer. J Surg Oncol 2013; 108: [PMID: DOI: /jso.23380] 59 Li S, Gao J, Gu J, Yuan J, Hua D, Shen L. MicroRNA-215 inhibits relapse of colorectal cancer patients following radical surgery. Med Oncol 2013; 30: 549 [PMID: DOI: / s ] 60 Colangelo T, Fucci A, Votino C, Sabatino L, Pancione M, Laudanna C, Binaschi M, Bigioni M, Maggi CA, Parente D, Forte N, Colantuoni V. MicroRNA-130b promotes tumor development and is associated with poor prognosis in colorectal cancer. Neoplasia 2013; 15: [PMID: DOI: /neo.13998] 61 Tsai HL, Yang IP, Huang CW, Ma CJ, Kuo CH, Lu CY, Juo SH, Wang JY. Clinical significance of microrna-148a in patients with early relapse of stage II stage and III colorectal cancer after curative resection. Transl Res 2013; 162: [PMID: DOI: /j.trsl ] 62 Qian J, Jiang B, Li M, Chen J, Fang M. Prognostic significance of microrna-16 expression in human colorectal cancer. World J Surg 2013; 37: [PMID: DOI: / s ] 63 Faber C, Horst D, Hlubek F, Kirchner T. Overexpression of Dicer predicts poor survival in colorectal cancer. Eur J Cancer 2011; 47: [PMID: DOI: /j.ejca ] 64 Iliou MS, da Silva-Diz V, Carmona FJ, Ramalho-Carvalho J, Heyn H, Villanueva A, Muñoz P, Esteller M. Impaired DICER1 function promotes stemness and metastasis in colon cancer. Oncogene 2014; 33: [PMID: DOI: /onc ] 65 Rossi L, Bonmassar E, Faraoni I. Modification of mir gene expression pattern in human colon cancer cells following exposure to 5-fluorouracil in vitro. Pharmacol Res 2007; 56: [PMID: DOI: /j.phrs ] 66 Deng J, Lei W, Fu JC, Zhang L, Li JH, Xiong JP. Targeting mir-21 enhances the sensitivity of human colon cancer HT-29 cells to chemoradiotherapy in vitro. Biochem Biophys Res Commun 2014; 443: [PMID: DOI: /j.bbrc ] 67 Roy S, Yu Y, Padhye SB, Sarkar FH, Majumdar AP. Difluorinatedcurcumin (CDF) restores PTEN expression in colon cancer cells by down-regulating mir-21. PLoS One 2013; 8: e68543 [PMID: DOI: /journal.pone ] 68 Yu Y, Sarkar FH, Majumdar AP. Down-regulation of mir-21 Induces Differentiation of Chemoresistant Colon Cancer Cells and Enhances Susceptibility to Therapeutic Regimens. Transl Oncol 2013; 6: [PMID: DOI: /tlo.12397] 69 Zhang L, Pickard K, Jenei V, Bullock MD, Bruce A, Mitter R, Kelly G, Paraskeva C, Strefford J, Primrose J, Thomas GJ, Packham G, Mirnezami AH. mir-153 supports colorectal cancer progression via pleiotropic effects that enhance invasion and chemotherapeutic resistance. Cancer Res 2013; 73: [PMID: DOI: / CAN ] 70 Chen Q, Xia HW, Ge XJ, Zhang YC, Tang QL, Bi F. Serum mir-19a predicts resistance to FOLFOX chemotherapy in advanced colorectal cancer cases. Asian Pac J Cancer Prev 2013; 14: [PMID: DOI: /APJCP ] 71 Kjersem JB, Ikdahl T, Lingjaerde OC, Guren T, Tveit KM, Kure EH. Plasma micrornas predicting clinical outcome in metastatic colorectal cancer patients receiving first-line oxaliplatin-based treatment. Mol Oncol 2014; 8: [PMID: DOI: /j.molonc ] 72 Karaayvaz M, Zhai H, Ju J. mir-129 promotes apoptosis and enhances chemosensitivity to 5-fluorouracil in colorectal cancer. Cell Death Dis 2013; 4: e659 [PMID: DOI: / cddis ] 73 Weirauch U, Beckmann N, Thomas M, Grünweller A, Huber K, Bracher F, Hartmann RK, Aigner A. Functional role and therapeutic potential of the pim-1 kinase in colon carcinoma. Neoplasia 2013; 15: [PMID: DOI: /neo.13172] 74 Xu K, Liang X, Cui D, Wu Y, Shi W, Liu J. mir-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drugsensitivity in human colorectal carcinoma cells. Mol Carcinog 8291 July 21, 2015 Volume 21 Issue 27

86 Hollis M et al. mirna in CRC detection and outcome 2013; 52: [PMID: DOI: /mc.21832] 75 He J, Xie G, Tong J, Peng Y, Huang H, Li J, Wang N, Liang H. Overexpression of microrna-122 re-sensitizes 5-FU-resistant colon cancer cells to 5-FU through the inhibition of PKM2 in vitro and in vivo. Cell Biochem Biophys 2014; 70: [PMID: DOI: /s x] P- Reviewer: Chiurillo MA, De Silva AP, Lorenzo-Zuniga V S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8292 July 21, 2015 Volume 21 Issue 27

87 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. REVIEW Lipid dysregulation in hepatitis C virus, and impact of statin therapy upon clinical outcomes Tracey G Simon, Adeel A Butt Tracey G Simon, Department of Medicine, Brigham and Women s Hospital, Boston, MA 02115, United States Tracey G Simon, Harvard Medical School, Boston, MA 02115, United States Adeel A Butt, VA Pittsburgh Healthcare System, Pittsburgh, PA 15240, United States Adeel A Butt, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213, United States Adeel A Butt, Hamad Healthcare Quality Institute, Doha 3050, Qatar Adeel A Butt, Hamad Medical Corporation, Doha 3050, Qatar Author contributions: Simon TG conducted the review of existing research, and drafted the manuscript; Butt AA oversaw the literature review, and also drafted and edited the final manuscript. Conflict-of-interest statement: The authors declare no conflict of interests. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Adeel A Butt, MD, University of Pittsburgh School of Medicine, 3601 Fifth Avenue, Suite 3A, Pittsburgh, PA 15213, United States. aabutt@pitt.edu Telephone: Fax: Received: February 13, 2015 Peer-review started: February 13, 2015 First decision: March 26, 2015 Revised: April 17, 2015 Accepted: June 10, 2015 Article in press: June 10, 2015 Published online: July 21, 2015 Abstract The hepatitis C virus (HCV) is one of the most common causes of chronic liver disease and the leading indication for liver transplantation worldwide. Every aspect of the HCV life cycle is closely tied to human lipid metabolism. The virus circulates as a lipid-rich particle, utilizing lipoprotein cell receptors to gain entry into the hepatocyte. It has also been shown to upregulate lipid biosynthesis and impair lipid degradation, resulting in significant intracellular lipid accumulation and circulating hypocholesterolemia. Patients with chronic hepatitis C (CHC) are at increased risk of hepatic steatosis, fibrosis, and cardiovascular disease including accelerated atherosclerosis. HMG CoA Reductase inhibitors, or statins, have been shown to play an important role in the modulation of hepatic steatosis and fibrosis, and recent attention has focused upon their potential therapeutic role in CHC. This article reviews the hepatitis C viral life cycle as it impacts host lipoproteins and lipid metabolism. It then describes the pathogenesis of HCV-related hepatic steatosis, hypocholesterolemia and atherosclerosis, and finally describes the promising anti-viral and anti-fibrotic effects of statins, for the treatment of CHC. Key words: Hepatitis C virus; Lipid profiles; Cholesterol; Statin; Fibrosis; Cirrhosis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: This article reviews the complex relationship between hepatitis C virus (HCV) infection and human lipid metabolism. It discusses the aspects of the hepatitis C viral life cycle that are entwined with cholesterol homeostasis, as well as the clinical implications of HCV July 21, 2015 Volume 21 Issue 27

88 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection mediated changes in human lipid profiles. Finally, it describes the current state of knowledge regarding the impact of statin medications on histological, virological and clinical outcomes, among patients with chronic hepatitis C. Simon TG, Butt AA. Lipid dysregulation in hepatitis C virus, and impact of statin therapy upon clinical outcomes. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: INTRODUCTION Hepatitis C virus (HCV) is a single-stranded RNA virus, of the genus Hepacivirus and the family Flaviviridae. Affecting 2% to 3% of the global population, HCV is one of the most common causes of chronic liver disease and the leading indication for liver transplantation worldwide [1,2]. Estimates suggest that over a period of twenty to thirty years, cirrhosis will develop in 10% to 25% of patients with untreated or relapsed chronic hepatitis C (CHC), and hepatocellular carcinoma (HCC) in 1% to 5% [2]. Hepatic steatosis is a common histopathological finding in patients with CHC. Various factors have been independently associated with steatosis, including obesity, diabetes, hyperlipidemia and alcohol consumption [3]. It has also been demonstrated that the hepatitis C virus possesses a unique relationship with host lipids and lipoproteins [4,5], and relies heavily on host lipoproteins, lipid droplets, and host cofactors for each step of the viral life cycle including the facilitation of viral replication [6-8]. At the same time, HCV causes profound lipid perturbations within the infected host, resulting in hepatic steatosis, circulating hypocholesterolemia and increased atherogenesis [6,8-12]. Statins, which inhibit the rate-limiting enzyme of the mevalonate pathway, HMG CoA Reductase, have been shown to play an important role in the modulation of hepatic steatosis and cholesterol metabolism, and recent attention has focused upon their potential therapeutic role for patients with CHC. This article reviews the molecular pathways of lipid homeostasis and the pathogenesis of hepatic steatosis as they relate to chronic hepatitis C infection, and then describes the potential impact of statin medications upon clinical, viral and histological outcomes. HCV viral life cycle and host lipoproteins HCV infection begins with attachment of the viral particle to the hepatocyte cell surface, in a process that requires many host proteins that are closely entwined with lipid metabolism [13-16]. To enter the cell, HCV must then associate with multiple cell surface receptors, three of which are closely linked to lipoprotein metabolism: the scavenger receptor class B member 1 (SRB1) protein, the Neimann-Pick C1 Like 1 (NPC1L1) receptor, and the low-density lipoprotein receptor (LDLR). The HCV viral life cycle is shown in Figures 1 and 2. SRB1 is a cell surface transmembrane protein, primarily expressed in the liver and steroidogenic tissues. Although its essential function is cholesteryl ester uptake from HDL, it also serves as a multi-ligand receptor for various lipoproteins, including VLDL, LDL and HDL [17]. Oxidized LDL and VLDL have been shown to inhibit HCV cell entry [18], while HDL enhances HCV entry in an SRB1-dependent process [19-21]. Changes in circulating lipid levels have indeed been shown to impact both viremia and treatment response: increased triglyceride levels have been linked to improved viral clearance [22], while elevated LDL and total cholesterol is associated with improved treatment response to interferon-based therapy [23]. The NPC1L1 receptor is a cholesterol receptor in the intestines and the liver, essential for dietary cholesterol absorption and biliary cholesterol reabsorption. It is thought to promote HCV cell entry via interaction with cholesterol of lipoviral particles and by modulation of cholesterol homeostasis, which in turn alters membrane composition and affects HCV cell entry [24]. In vitro, inhibition of NPC1L1 blocks initiation of HCV infection, via a cholesterol-dependent mechanism occurring before virion-cell membrane fusion [25]. A recent in vivo mouse model also showed that blockade of NPC1L1 with ezetimibe blocks viral cell entry [24]. LDLR is a transmembrane glycoprotein responsible for the uptake of serum lipoproteins [26]. Transcription of LDLR is upregulated by the sterol-regulatory element binding proteins (SREBPs) [26,27], and the signaling molecules PCSK9 [28,29], and inhibited by the inducible degrader of LDLR (IDOL) [30,31]. It has been shown that accumulation of HCV RNA within hepatocytes correlates with the expression of LDLR, and that antibodies directed against LDLR inhibit the cellular absorption of HCV [25,32]. HCV has also been shown to activate SREBP-mediated PI3-K/AKT and LXR pathways [10], resulting in further activation of LDLR, and thus enhancing viral infectivity. Once inside the cytoplasm, the uncoated viral genome is translated, and the polypeptide is cleaved into 10 viral proteins. The HCV structural proteins (E1, E2 and core) play important roles in viral replication and assembly, while the non-structural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B) are essential for the intracellular aspects of the viral life cycle [33]. Following translation, the viral genome is transcribed by the proteins NS3 and NS5B [34]. HCV core protein accumulates around lipid droplets (LD), which are stores of triacylglycerols and cholesterol esters [35], and has been shown to inhibit the activity of MTP (microsomal triacylglycerol transfer protein) and the subsequent secretion of very low-density lipoprotein 8294 July 21, 2015 Volume 21 Issue 27

89 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection HCV lipoviralparticle HCV Exchangeable apoproteins HDL ApoB LDL ApoB ApoE SR-B1 GAG RTKs SR-B1 LDLR Basolateral domain? HCV CDB1 CLDN1 Membrane fusion Tight junction (TJ) OCLN HCV NPC1L1 Apical (bile-canalicular) domain BILE Ezetimibe? TJ ABCG5/8 Cholesterol Basolateral domain Figure 1 hepatitis C virus viral life cycle. hepatitis C virus (HCV) entry into human hepatocytes is a complex, multi-step process that takes place at the basolateral region of polarized hepatocytes. It begins when the viral particle binds surface glycosaminoglycans (GAGs) and the low-density lipoprotein receptor (LDLR) via apolipoprotein E. This is followed by a complex series of interactions mediated by cellular factors including scavenger receptor class B type I (SR-BI), the tetraspanin CD81, claudin-1 (CLDN1), occludin (OCLN), the Niemann-Pick C1-like 1 (NPC1L1) receptor, as well as receptor tyrosine kinases (RTKs) that promote CD81- CLDN1 association and membrane fusion. The HCV particle is then internalized into the hepatocyte by clathrin-mediated endocytosis. This figure is reproduced with permission from the original article, published in Journal of Hepatology, Vol 57, Issue 1, by Lupberger J, Felmlee J and Baumert TF. Cholesterol Uptake and Hepatitis C virus entry, page , Copyright Elsevier, HCV protein expression SREBPs activation SREBP1c induction PPARα ROS MTP Lipid droplet rearrangement Upregulated lipid synthesis Reduced B-oxidation Impaired VLDL secretion Decreased cholesterol and lipoprotein export Lipid peroxidation Intracellular lipid accumulation Figure 2 hepatitis C virus-mediated perturbations in cholesterol metabolism. Hcv: Hepatitis C virus; ROS: Reactive oxygen species; VLDL: Very low-density lipoprotein. (VLDL) [36]. The functions of each viral protein and their interactions with host lipid metabolism are outlined in Table 1. HCV RNA replication and assembly of the LVP occur at the membranous web (MW), a specialized structure composed of clusters of viral vesicles and lipid droplets (LD) [37,38], on which the LVP and viral proteins converge [39,40]. The enzyme diacylglycerol transferase-1 (DGAT) facilitates the trafficking of core, NS5A and NS4B proteins to the LD [41,42], and results in inhibition of triglyceride lipolysis and lipid droplet turnover, thus increasing the concentration of available intracellular 8295 July 21, 2015 Volume 21 Issue 27

90 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection Table 1 Functions of hepatitis C virus structural and non-structural proteins Protein Function Association with Lipid Metabolism Structural proteins E1 Surface envelope protein of LVP Enriched around lipid droplet E2 Surface envelope protein of LVP, binds CD81 for viral fusion and cell entry Interacts with ApoE and SRB1 facilitating lipid transfers around LD Core Important for cell surface binding, replication and assembly Increases expression of SREBP, FASN. Colocalizes with apob Non-structural proteins P7 Creates transmembrane ion channel in membranous web, (viroporin) Assists in recruitment of core protein to LD by DGAT1 NS2 Cysteine protease Increases expression of FASN, SREBP NS3 Serine protease, RNA helicase, promotes viral protein processing with NS4A Unknown NS4A Protease; cofactor for NS3 Unknown NS4B Directs membrane rearrangements for formation of membranous web Activates fatty acid synthase, associates with DGAT1 and P14KA, facilitating creation of membranous web NS5A Phosphoprotein, required for replication, forms bridge to assembly Activates FASN; associates with P14KA, DGAT1 NS5B RNA-dependent RNA polymerase, for replication of viral genome Direct interaction with fatty acid synthase gene lipids, for the facilitation of further HCV replication [43]. To export new HCV virions, the virus co-opts the host VLDL synthesis and secretion pathways. Synthesis of VLDL involves the generation of a VLDL precursor, using the lipid transfer function of the microsomal triglyceride transfer protein (MTP), which lipidates nascent apolipoprotein B100 (apob100) [44]. The VLDL precursor is then targeted to the Golgi apparatus for export. The viral LVP is enriched in ApoE and ApoB, and thus possesses characteristics of a VLDL particle. This enables it to utilize the lipid transfer function of the MTP, and thus co-opt the VLDL secretion pathway and facilitate virion export [6,45-48]. Lipid changes in chronic hepatitis C infection Circulating hypocholesterolemia: Circulating lipid levels are altered in patients with HCV, regardless of the duration of infection. In a cohort of patients with acute HCV, early infection was associated with reduction in LDL and total cholesterol levels; following viral eradication through spontaneous clearance or successful anti-hcv treatment, the lipids of those patients returned to pre-infection levels [49]. Patients with CHC also have demonstrate reduced levels of circulating LDL, apolipoprotein B100 (apob) and total cholesterol, compared to healthy controls [50]. An inverse relationship has also been described between reduction in apob levels and HCV viral load, among those with non-genotype 1 infection [50]. These perturbations also seem to resolve after successful clearance of CHC [49], supporting the hypothesis that HCV has a direct cytopathic effect upon host lipid metabolism. The presence and degree of hypocholesterolemia carries important prognostic implications for patients with CHC. Elevated LDL and high-density lipoprotein (HDL) levels have been associated with improved rates of sustained virologic response (SVR) [51,52]. This may be related to the dependence of HCV upon LDL cholesterol concentrations and the LDLR for both cellular entry and viral replication. Hepatic steatosis: Hepatic steatosis is frequently observed in the setting of CHC [53], and is thought to result from a combination of viral-mediated activation of lipid biosynthesis pathways and reduced lipid export [54,55]. The presence of hepatic steatosis among patients with CHC has been associated with poor treatment response [lower sustained viral response (SVR) rates] and accelerated disease progression to advanced fibrosis and cirrhosis [56-58]. Both patientrelated factors and viral factors play important roles in the modulation of HCV-related steatosis. One important viral factor that impacts host lipid metabolism is viral genotype. Genotype 3 CHC is associated with the greatest degree of hepatic steatosis, and the most significant reductions in serum cholesterol levels [50,59]. In the fasting state, patients with genotype 3 demonstrate profoundly elevated cholesterol metabolites [60], as well as increased intracellular lipid accumulation [47,61,62], compared to all other HCV genotypes. In contrast, among patients infected with all other genotypes of CHC, metabolic risk factors, including insulin levels, diabetes and obesity, appear to play a more important role in progressive steatosis [63,64]. This was demonstrated in analyses linking hepatic steatosis to higher levels of circulating viremia, among genotype 3 patients [65] ; in those cohorts, the eradication of infection resulted in improvement or resolution of steatosis, a finding not seen in other genotypes [66]. Patient factors that modulate hepatic steatosis include genetic variations and metabolic dysregulation. Patients with a single nucleotide polymorphism (SNP) in the interleukin 28B (IL28B) gene (genotype CC) possess lower serum levels of triglycerides, higher LDL-C levels [67], and an overall reduced prevalence of hepatic steatosis [68]. The IL-28B CC genotype has also been associated with increased rates of SVR [69,70]. In addition, an independent genome-wide association study also determined that a single genetic variant (I148M) in the human patatin-like phospholipase domain containing 3 (PNPLA3) rs C>G SNP was the strongest genetic determinant of hepatic steatosis [71] July 21, 2015 Volume 21 Issue 27

91 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection In multiple subsequent candidate gene studies, PNPLA3 I148M has been shown to specifically influence hepatitis C-related liver fat accumulation [72-74], as well as NASH [75,76], fibrosis progression [77] and hepatocellular carcinoma [78]. However, unlike IL28B, PNPLA3 has consistently not been shown to influence SVR [73,79]. These findings were recently confirmed in a post-hoc analysis of a large randomized trial of patients with genotype 1 CHC, where PNPLA3 again was associated with progressive steatosis and development of fibrosis, but not with SVR [73]. Interestingly, the authors observed that this was modulated by the IL28B polymorphism, suggesting new complexity to the relationship between genotype variations and disease progression [73]. Further research will be needed to fully characterize the mechanisms that underpin the associations between these risk alleles and hepatic steatosis. Additional patient-related determinants of hepatic steatosis in CHC include alcohol use [74] and metabolic derangements, particularly insulin resistance, diabetes and the metabolic syndrome [64]. The link between hepatitis C and insulin resistance has also been supported in multiple population-based cohort studies, where adults with CHC were three to eleven times more likely to develop type 2 diabetes [80], compared to uninfected controls. Accelerated atherogenesis: Hypocholesterolemia and lower rates of systemic hypertension do not seem to protect patients with HCV infection from atherosclerosis. Ishizaka and colleagues first demonstrated a link between HCV and carotid artery plaque formation [81], and it has since been demonstrated that HCV seropositivity is an independent risk factor for coronary artery disease (CAD), over and above traditional risk factors including age, smoking status, hypertension, diabetes and hyperlipidemia [82,83]. Although some studies have yielded conflicting results, with some confirming [84] and others refuting [85] this link, convincing recent data has nevertheless shown excess cardiovascular mortality during the course of chronic HCV infection [86,87]. Indeed, a recent review concluded that HCV infection should be considered a risk factor for the development of atherosclerosis, and argued for more vigilant preventive cardiac screening in this population [88]. potential therapeutic role of statin medications 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins), are among the most commonly prescribed medications worldwide, and have been shown to be safe in chronic liver disease [89,90]. There is mounting evidence that statins exert powerful pleiotropic effects via both HMG-CoA dependent and independent pathways, modulating inflammation, angiogensis, apoptosis and cell growth [89,91-98]. Several studies have also shown that statins may inhibit HCV replication, and thus may exert powerful anti-hcv effects as well. Effect of statins on viral replication: Statins appear to block HCV replication by inhibiting de novo cholesterol and geranylgeranylated protein synthesis, thus reducing expression of key HCV viral proteins and inhibiting pro-inflammatory signaling pathways [99,100]. In early in vitro studies, cells cultured with lovastatin successfully inhibited HCV RNA replication [101,102]. This was confirmed in a high-throughput screen of small molecule modulators of HCV replication, with the strongest antiviral activity observed in atorvastatin, fluvastatin and simvastatin [103]. It is thought that the geranylgeranyl lipid product of the mevalonate pathway is necessary for HCV replication [7,104,105]. In experiments with lovastatin, the statin-mediated inhibition of HCV replication was overcome by the addition of geranylgeraniol, but not by farnesol or cholesterol [7,104], results which underscored the importance of the mevalonate pathway in HCV replication. Despite negative results from in vivo analyses of statin monotherapy [106,107], a great deal of evidence now suggests a beneficial role of statins upon virologic outcomes in patients treated with pegylated interferon (IFN) and ribavirin [52,108,109]. In a large retrospective cohort of 8293 veterans undergoing anti-hcv therapy, statin use was an independent predictor of SVR [108]. In a subsequent uncontrolled, prospective Japanese pilot study of patients infected with genotype 1b, fluvastatin also was associated with improved SVR [110]. Since that time several randomized controlled trials have demonstrated that statins increase SVR rates when combined with peginterferon and ribavirin in genotype 1 infection [111]. Despite this compelling evidence, the future importance of statins for the enhancement of SVR is uncertain as we enter the era of secondgeneration and novel direct acting antiviral (DAA) therapy for CHC, which yields SVR rates of over 90%. Anti-fibrotic effects of statins: It has also been postulated that statins may exert antifibrotic effects, although the data are more limited. Animal models show that statin use blocks the activation of hepatic myofibroblasts, inducing apoptosis and preventing both proliferation of hepatic stellate cells (HSCs) and their production of collagens [95,97,98, ]. Until recently, reports in humans consisted primarily of retrospective studies of laboratory markers of hepatotoxicity, and were limited by small sample sizes, lack of appropriate controls or histological data from liver biopsy, which remains the gold standard for the assessment of fibrosis [90,115,116]. However, in a recent post-hoc analysis of a large, prospective human trial of patients with advanced CHC followed with serial liver biopsies, it was demonstrated that statin use was associated with significantly reduced fibrosis scores [117,118]. HCC: Mounting evidence also suggests that statins offer chemoprevention against many malignancies, 8297 July 21, 2015 Volume 21 Issue 27

92 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection including HCC [91, ]. They inhibit cell growth, tumor spread, and appear to exert powerful antiproliferative, antiangiogenic and immunomodulatory effects [96-98]. One mechanism is via direct interference with lipid rafts, thus inhibiting cell signaling, tumor invasion and angiogenesis [124,125]. Via competitive inhibition of HMG-CoA reductase, statins prevent post-translational prenylation of the Ras/Rho superfamily, which are otherwise upregulated in approximately 30% of neoplasms [96,120]. By decreasing expression of MMP-14 and TIMP-2, statins also inhibit the PI3K/PTEN/AKT/ mtor pathway, blocking tumor cell spread [96-98,112]. In a recent population-based cohort of patients infected with HCV, statin users were shown to have a significant reduction in the incidence of HCC [126]. The results were statin-specific, and both dose and duration responses were seen, with a hazard ratio of 0.33 for HCC among those taking higher cumulative daily doses. These results are consistent with several other large observational studies [127,128]. Randomized data, however, does not appear to support the relationship between statins and reduced risk of HCC. In a pooled meta-analysis pooling of 7 observational cohorts and 26 randomized controlled trials, the authors found a 37% reduced risk of HCC among statin users in the observational studies (adjusted odds ratio 0.52, 95%CI: ), but no benefit attributable to statins in the randomized groups [123]. Such differences between observational studies and randomized trials may reflect length of follow-up, patient selection, lack of sufficient power to detect a difference, within a selected cohort. Statins in the era of DAA therapy: The role of statins as adjunctive therapy in HCV treatment has so far been limited to the previous standard of care, pegylated interferon and ribavirin. It is unknown what benefit, if any, statins may confer to those patients treated with the new DAA medications. Although statins have been shown to be independent predictors of SVR in both Boceprevir and Telepravir-based trials, with SVR rates > 90% in the majority of treated patients, the additive benefit of statin therapy is less substantial, than that seen with IFN and Ribavirin. Moreover, concerns have been raised about the potential for significant drug interactions between statins and DAAs [129] ; at this time, simvastatin, lovastatin and atorvastatin are contraindicated for use with telaprevir [130,131], and both simvastatin and lovastatin are contraindicated with boceprevir [132]. As noted above, there is likely little additive benefit with statins for SVR, as new DAAs demonstrate SVR rates above 95%, however future studies are needed to fully characterize the role of statins for delaying or preventing fibrosis, cirrhosis or the development of HCC. CONCLUSION Every aspect of the HCV life cycle is closely linked to human lipid metabolism. Not only does the virus itself circulate as a lipid-rich particle that mimics VLDL, it also utilizes cell surface receptors essential for lipid metabolism to gain entry into the hepatocyte. Once inside the cell, the virus upregulates intracellular lipid synthesis, impairs lipid degradation, and decreases catabolism and export of lipoproteins. As a result, it causes significant intracellular lipid accumulation as well as a relative circulating hypocholesterolemia. Patients with chronic HCV infection are at increased risk of developing hepatic steatosis, fibrosis, and cardiovascular disease including accelerated atherosclerosis. Statins, which inhibit the rate-limiting enzyme of the mevalonate pathway, HMG CoA Reductase, have been shown to play an important role in the modulation of hepatic steatosis and fibrosis, and it is postulated that they may also possess important anti-proliferative, antiangiogenic and antioxidant effects, with a potential protective role against the development of HCC. It remains to be seen to what degree statin medications will play a role in adjunctive management of patients with CHC in the era of new DAAs. REFERENCES 1 Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through Ann Intern Med 2006; 144: [PMID: ] 2 Thomas DL, Seeff LB. Natural history of hepatitis C. Clin Liver Dis 2005; 9: , vi [PMID: DOI: / j.cld ] 3 Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, Charlton M, Sanyal AJ; American Gastroenterological Association; American Association for the Study of Liver Diseases; American College of Gastroenterologyh. The diagnosis and management of non-alcoholic fatty liver disease: practice guideline by the American Gastroenterological Association, American Association for the Study of Liver Diseases, and American College of Gastroenterology. Gastroenterology 2012; 142: [PMID: DOI: /j.gastro ] 4 Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K, Habermann A, Kräusslich HG, Mizokami M, Bartenschlager R, Liang TJ. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 2005; 11: [PMID: DOI: /nm1268] 5 Lindenbach BD. Measuring HCV infectivity produced in cell culture and in vivo. Methods Mol Biol 2009; 510: [PMID: DOI: / _24] 6 Huang H, Sun F, Owen DM, Li W, Chen Y, Gale M, Ye J. Hepatitis C virus production by human hepatocytes dependent on assembly and secretion of very low-density lipoproteins. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 7 Ye J, Wang C, Sumpter R, Brown MS, Goldstein JL, Gale M. Disruption of hepatitis C virus RNA replication through inhibition of host protein geranylgeranylation. Proc Natl Acad Sci USA 2003; 100: [PMID: DOI: / 8298 July 21, 2015 Volume 21 Issue 27

93 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection pnas ] 8 Ye J. Reliance of host cholesterol metabolic pathways for the life cycle of hepatitis C virus. PLoS Pathog 2007; 3: e108 [PMID: DOI: /journal.ppat ] 9 Syed GH, Amako Y, Siddiqui A. Hepatitis C virus hijacks host lipid metabolism. Trends Endocrinol Metab 2010; 21: [PMID: DOI: /j.tem ] 10 Syed GH, Tang H, Khan M, Hassanein T, Liu J, Siddiqui A. Hepatitis C virus stimulates low-density lipoprotein receptor expression to facilitate viral propagation. J Virol 2014; 88: [PMID: DOI: /JVI ] 11 Gastaminza P, Cheng G, Wieland S, Zhong J, Liao W, Chisari FV. Cellular determinants of hepatitis C virus assembly, maturation, degradation, and secretion. J Virol 2008; 82: [PMID: DOI: /JVI ] 12 Chang KS, Jiang J, Cai Z, Luo G. Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture. J Virol 2007; 81: [PMID: DOI: /JVI ] 13 Ploss A, Dubuisson J. New advances in the molecular biology of hepatitis C virus infection: towards the identification of new treatment targets. Gut 2012; 61 Suppl 1: i25-i35 [PMID: DOI: /gutjnl ] 14 Jiang J, Cun W, Wu X, Shi Q, Tang H, Luo G. Hepatitis C virus attachment mediated by apolipoprotein E binding to cell surface heparan sulfate. J Virol 2012; 86: [PMID: DOI: /JVI ] 15 Dao DY, Seremba E, Ajmera V, Sanders C, Hynan LS, Lee WM; Acute Liver Failure Study Group. Use of nucleoside (tide) analogues in patients with hepatitis B-related acute liver failure. Dig Dis Sci 2012; 57: [PMID: DOI: / s ] 16 Ploss A, Evans MJ. Hepatitis C virus host cell entry. Curr Opin Virol 2012; 2: [PMID: DOI: /j.coviro ] 17 Rhainds D, Brissette L. The role of scavenger receptor class B type I (SR-BI) in lipid trafficking. defining the rules for lipid traders. Int J Biochem Cell Biol 2004; 36: [PMID: ] 18 von Hahn T, Rice CM. Hepatitis C virus entry. J Biol Chem 2008; 283: [PMID: DOI: /jbc.R ] 19 Zeisel MB, Koutsoudakis G, Schnober EK, Haberstroh A, Blum HE, Cosset FL, Wakita T, Jaeck D, Doffoel M, Royer C, Soulier E, Schvoerer E, Schuster C, Stoll-Keller F, Bartenschlager R, Pietschmann T, Barth H, Baumert TF. Scavenger receptor class B type I is a key host factor for hepatitis C virus infection required for an entry step closely linked to CD81. Hepatology 2007; 46: [PMID: DOI: /hep.21994] 20 Voisset C, Callens N, Blanchard E, Op De Beeck A, Dubuisson J, Vu-Dac N. High density lipoproteins facilitate hepatitis C virus entry through the scavenger receptor class B type I. J Biol Chem 2005; 280: [PMID: DOI: /jbc. M ] 21 Dreux M, Pietschmann T, Granier C, Voisset C, Ricard-Blum S, Mangeot PE, Keck Z, Foung S, Vu-Dac N, Dubuisson J, Bartenschlager R, Lavillette D, Cosset FL. High density lipoprotein inhibits hepatitis C virus-neutralizing antibodies by stimulating cell entry via activation of the scavenger receptor BI. J Biol Chem 2006; 281: [PMID: DOI: /jbc. M ] 22 Marzouk D, Sass J, Bakr I, El Hosseiny M, Abdel-Hamid M, Rekacewicz C, Chaturvedi N, Mohamed MK, Fontanet A. Metabolic and cardiovascular risk profiles and hepatitis C virus infection in rural Egypt. Gut 2007; 56: [PMID: DOI: /gut ] 23 Gopal K, Johnson TC, Gopal S, Walfish A, Bang CT, Suwandhi P, Pena-Sahdala HN, Clain DJ, Bodenheimer HC, Min AD. Correlation between beta-lipoprotein levels and outcome of hepatitis C treatment. Hepatology 2006; 44: [PMID: DOI: /hep.21261] 24 Sainz B, Barretto N, Martin DN, Hiraga N, Imamura M, Hussain S, Marsh KA, Yu X, Chayama K, Alrefai WA, Uprichard SL. Identification of the Niemann-Pick C1-like 1 cholesterol absorption receptor as a new hepatitis C virus entry factor. Nat Med 2012; 18: [PMID: DOI: /nm.2581] 25 Albecka A, Belouzard S, Op de Beeck A, Descamps V, Goueslain L, Bertrand-Michel J, Tercé F, Duverlie G, Rouillé Y, Dubuisson J. Role of low-density lipoprotein receptor in the hepatitis C virus life cycle. Hepatology 2012; 55: [PMID: DOI: /hep.25501] 26 Goldstein JL, Brown MS. The LDL receptor. Arterioscler Thromb Vasc Biol 2009; 29: [PMID: DOI: / ATVBAHA ] 27 Chappell DA, Medh JD. Receptor-mediated mechanisms of lipoprotein remnant catabolism. Prog Lipid Res 1998; 37: [PMID: ] 28 Molina S, Castet V, Fournier-Wirth C, Pichard-Garcia L, Avner R, Harats D, Roitelman J, Barbaras R, Graber P, Ghersa P, Smolarsky M, Funaro A, Malavasi F, Larrey D, Coste J, Fabre JM, Sa-Cunha A, Maurel P. The low-density lipoprotein receptor plays a role in the infection of primary human hepatocytes by hepatitis C virus. J Hepatol 2007; 46: [PMID: DOI: / j.jhep ] 29 Carrière M, Rosenberg AR, Conti F, Chouzenoux S, Terris B, Sogni P, Soubrane O, Calmus Y, Podevin P. Low density lipoprotein receptor transcripts correlates with liver hepatitis C virus RNA in patients with alcohol consumption. J Viral Hepat 2006; 13: [PMID: DOI: /j x] 30 Maxwell KN, Fisher EA, Breslow JL. Overexpression of PCSK9 accelerates the degradation of the LDLR in a post-endoplasmic reticulum compartment. Proc Natl Acad Sci USA 2005; 102: [PMID: DOI: /pnas ] 31 Zhang DW, Lagace TA, Garuti R, Zhao Z, McDonald M, Horton JD, Cohen JC, Hobbs HH. Binding of proprotein convertase subtilisin/kexin type 9 to epidermal growth factor-like repeat A of low density lipoprotein receptor decreases receptor recycling and increases degradation. J Biol Chem 2007; 282: [PMID: DOI: /jbc.M ] 32 Agnello V, Abel G, Elfahal M, Knight GB, Zhang QX. Hepatitis C virus and other flaviviridae viruses enter cells via low density lipoprotein receptor. Proc Natl Acad Sci USA 1999; 96: [PMID: ] 33 Moradpour D, Penin F, Rice CM. Replication of hepatitis C virus. Nat Rev Microbiol 2007; 5: [PMID: DOI: /nrmicro1645] 34 Lohmann V, Körner F, Koch J, Herian U, Theilmann L, Bartenschlager R. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 1999; 285: [PMID: ] 35 Moradpour D, Englert C, Wakita T, Wands JR. Characterization of cell lines allowing tightly regulated expression of hepatitis C virus core protein. Virology 1996; 222: [PMID: DOI: /viro ] 36 Perlemuter G, Sabile A, Letteron P, Vona G, Topilco A, Chrétien Y, Koike K, Pessayre D, Chapman J, Barba G, Bréchot C. Hepatitis C virus core protein inhibits microsomal triglyceride transfer protein activity and very low density lipoprotein secretion: a model of viral-related steatosis. FASEB J 2002; 16: [PMID: DOI: /fj com] 37 Miyanari Y, Atsuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 2007; 9: [PMID: DOI: /ncb1631] 38 Ohsaki Y, Cheng J, Suzuki M, Shinohara Y, Fujita A, Fujimoto T. Biogenesis of cytoplasmic lipid droplets: from the lipid ester globule in the membrane to the visible structure. Biochim Biophys Acta 2009; 1791: [PMID: DOI: / j.bbalip ] 8299 July 21, 2015 Volume 21 Issue 27

94 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection 39 Ogawa K, Hishiki T, Shimizu Y, Funami K, Sugiyama K, Miyanari Y, Shimotohno K. Hepatitis C virus utilizes lipid droplet for production of infectious virus. Proc Jpn Acad Ser B Phys Biol Sci 2009; 85: [PMID: ] 40 Depla M, Uzbekov R, Hourioux C, Blanchard E, Le Gouge A, Gillet L, Roingeard P. Ultrastructural and quantitative analysis of the lipid droplet clustering induced by hepatitis C virus core protein. Cell Mol Life Sci 2010; 67: [PMID: DOI: /s z] 41 Tanaka T, Kuroda K, Ikeda M, Wakita T, Kato N, Makishima M. Hepatitis C virus NS4B targets lipid droplets through hydrophobic residues in the amphipathic helices. J Lipid Res 2013; 54: [PMID: DOI: /jlr.M026443] 42 Camus G, Herker E, Modi AA, Haas JT, Ramage HR, Farese RV, Ott M. Diacylglycerol acyltransferase-1 localizes hepatitis C virus NS5A protein to lipid droplets and enhances NS5A interaction with the viral capsid core. J Biol Chem 2013; 288: [PMID: DOI: /jbc.M ] 43 Harris C, Herker E, Farese RV, Ott M. Hepatitis C virus core protein decreases lipid droplet turnover: a mechanism for coreinduced steatosis. J Biol Chem 2011; 286: [PMID: DOI: /jbc.M ] 44 Hussain MM, Rava P, Walsh M, Rana M, Iqbal J. Multiple functions of microsomal triglyceride transfer protein. Nutr Metab (Lond) 2012; 9: 14 [PMID: DOI: / ] 45 Nahmias Y, Goldwasser J, Casali M, van Poll D, Wakita T, Chung RT, Yarmush ML. Apolipoprotein B-dependent hepatitis C virus secretion is inhibited by the grapefruit flavonoid naringenin. Hepatology 2008; 47: [PMID: DOI: / hep.22197] 46 Goldwasser J, Cohen PY, Lin W, Kitsberg D, Balaguer P, Polyak SJ, Chung RT, Yarmush ML, Nahmias Y. Naringenin inhibits the assembly and long-term production of infectious hepatitis C virus particles through a PPAR-mediated mechanism. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 47 Counihan NA, Rawlinson SM, Lindenbach BD. Trafficking of hepatitis C virus core protein during virus particle assembly. PLoS Pathog 2011; 7: e [PMID: DOI: / journal.ppat ] 48 Jiang J, Luo G. Apolipoprotein E but not B is required for the formation of infectious hepatitis C virus particles. J Virol 2009; 83: [PMID: DOI: /JVI ] 49 Corey KE, Mendez-Navarro J, Barlow LL, Patwardhan V, Zheng H, Kim AY, Lauer GM, Chung RT. Acute hepatitis C infection lowers serum lipid levels. J Viral Hepat 2011; 18: e366-e371 [PMID: DOI: /j x] 50 Lambert JE, Bain VG, Ryan EA, Thomson AB, Clandinin MT. Elevated lipogenesis and diminished cholesterol synthesis in patients with hepatitis C viral infection compared to healthy humans. Hepatology 2013; 57: [PMID: DOI: /hep.25990] 51 Sheridan DA, Price DA, Schmid ML, Toms GL, Donaldson P, Neely D, Bassendine MF. Apolipoprotein B-associated cholesterol is a determinant of treatment outcome in patients with chronic hepatitis C virus infection receiving anti-viral agents interferonalpha and ribavirin. Aliment Pharmacol Ther 2009; 29: [PMID: DOI: /j x] 52 Harrison SA, Rossaro L, Hu KQ, Patel K, Tillmann H, Dhaliwal S, Torres DM, Koury K, Goteti VS, Noviello S, Brass CA, Albrecht JK, McHutchison JG, Sulkowski MS. Serum cholesterol and statin use predict virological response to peginterferon and ribavirin therapy. Hepatology 2010; 52: [PMID: DOI: /hep.23787] 53 Goodman ZD, Ishak KG. Histopathology of hepatitis C virus infection. Semin Liver Dis 1995; 15: [PMID: DOI: /s ] 54 Fujino T, Nakamuta M, Yada R, Aoyagi Y, Yasutake K, Kohjima M, Fukuizumi K, Yoshimoto T, Harada N, Yada M, Kato M, Kotoh K, Taketomi A, Maehara Y, Nakashima M, Enjoji M. Expression profile of lipid metabolism-associated genes in hepatitis C virusinfected human liver. Hepatol Res 2010; 40: [PMID: DOI: /j X x] 55 Abid K, Pazienza V, de Gottardi A, Rubbia-Brandt L, Conne B, Pugnale P, Rossi C, Mangia A, Negro F. An in vitro model of hepatitis C virus genotype 3a-associated triglycerides accumulation. J Hepatol 2005; 42: [PMID: DOI: /j.jhep ] 56 Castéra L, Hézode C, Roudot-Thoraval F, Bastie A, Zafrani ES, Pawlotsky JM, Dhumeaux D. Worsening of steatosis is an independent factor of fibrosis progression in untreated patients with chronic hepatitis C and paired liver biopsies. Gut 2003; 52: [PMID: ] 57 Cross TJ, Quaglia A, Hughes S, Joshi D, Harrison PM. The impact of hepatic steatosis on the natural history of chronic hepatitis C infection. J Viral Hepat 2009; 16: [PMID: DOI: /j x] 58 Lok AS, Everhart JE, Chung RT, Kim HY, Everson GT, Hoefs JC, Greenson JK, Sterling RK, Lindsay KL, Lee WM, Di Bisceglie AM, Bonkovsky HL, Ghany MG, Morishima C. Evolution of hepatic steatosis in patients with advanced hepatitis C: results from the hepatitis C antiviral long-term treatment against cirrhosis (HALT-C) trial. Hepatology 2009; 49: [PMID: DOI: /hep.22865] 59 Rubbia-Brandt L, Quadri R, Abid K, Giostra E, Malé PJ, Mentha G, Spahr L, Zarski JP, Borisch B, Hadengue A, Negro F. Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. J Hepatol 2000; 33: [PMID: ] 60 Clark PJ, Thompson AJ, Vock DM, Kratz LE, Tolun AA, Muir AJ, McHutchison JG, Subramanian M, Millington DM, Kelley RI, Patel K. Hepatitis C virus selectively perturbs the distal cholesterol synthesis pathway in a genotype-specific manner. Hepatology 2012; 56: [PMID: DOI: /hep.25631] 61 Roingeard P, Hourioux C. Hepatitis C virus core protein, lipid droplets and steatosis. J Viral Hepat 2008; 15: [PMID: DOI: /j x] 62 Piodi A, Chouteau P, Lerat H, Hézode C, Pawlotsky JM. Morphological changes in intracellular lipid droplets induced by different hepatitis C virus genotype core sequences and relationship with steatosis. Hepatology 2008; 48: [PMID: DOI: /hep.22288] 63 Hui JM, Kench J, Farrell GC, Lin R, Samarasinghe D, Liddle C, Byth K, George J. Genotype-specific mechanisms for hepatic steatosis in chronic hepatitis C infection. J Gastroenterol Hepatol 2002; 17: [PMID: ] 64 Fartoux L, Chazouillères O, Wendum D, Poupon R, Serfaty L. Impact of steatosis on progression of fibrosis in patients with mild hepatitis C. Hepatology 2005; 41: [PMID: DOI: /hep.20519] 65 Lonardo A, Lombardini S, Scaglioni F, Carulli L, Ricchi M, Ganazzi D, Adinolfi LE, Ruggiero G, Carulli N, Loria P. Hepatic steatosis and insulin resistance: does etiology make a difference? J Hepatol 2006; 44: [PMID: DOI: / j.jhep ] 66 Kumar D, Farrell GC, Fung C, George J. Hepatitis C virus genotype 3 is cytopathic to hepatocytes: Reversal of hepatic steatosis after sustained therapeutic response. Hepatology 2002; 36: [PMID: DOI: /jhep ] 67 Li JH, Lao XQ, Tillmann HL, Rowell J, Patel K, Thompson A, Suchindran S, Muir AJ, Guyton JR, Gardner SD, McHutchison JG, McCarthy JJ. Interferon-lambda genotype and low serum low-density lipoprotein cholesterol levels in patients with chronic hepatitis C infection. Hepatology 2010; 51: [PMID: DOI: /hep.23592] 68 Tillmann HL, Patel K, Muir AJ, Guy CD, Li JH, Lao XQ, Thompson A, Clark PJ, Gardner SD, McHutchison JG, McCarthy JJ. Beneficial IL28B genotype associated with lower frequency of hepatic steatosis in patients with chronic hepatitis C. J Hepatol 2011; 55: [PMID: DOI: / 8300 July 21, 2015 Volume 21 Issue 27

95 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection j.jhep ] 69 Thompson AJ, Muir AJ, Sulkowski MS, Ge D, Fellay J, Shianna KV, Urban T, Afdhal NH, Jacobson IM, Esteban R, Poordad F, Lawitz EJ, McCone J, Shiffman ML, Galler GW, Lee WM, Reindollar R, King JW, Kwo PY, Ghalib RH, Freilich B, Nyberg LM, Zeuzem S, Poynard T, Vock DM, Pieper KS, Patel K, Tillmann HL, Noviello S, Koury K, Pedicone LD, Brass CA, Albrecht JK, Goldstein DB, McHutchison JG. Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus. Gastroenterology 2010; 139: e18 [PMID: DOI: /j.gastro ] 70 Asselah T, De Muynck S, Broët P, Masliah-Planchon J, Blanluet M, Bièche I, Lapalus M, Martinot-Peignoux M, Lada O, Estrabaud E, Zhang Q, El Ray A, Vidaud D, Ripault MP, Boyer N, Bedossa P, Valla D, Vidaud M, Marcellin P. IL28B polymorphism is associated with treatment response in patients with genotype 4 chronic hepatitis C. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 71 Romeo S, Kozlitina J, Xing C, Pertsemlidis A, Cox D, Pennacchio LA, Boerwinkle E, Cohen JC, Hobbs HH. Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease. Nat Genet 2008; 40: [PMID: DOI: / ng.257] 72 Cai T, Dufour JF, Muellhaupt B, Gerlach T, Heim M, Moradpour D, Cerny A, Malinverni R, Kaddai V, Bochud M, Negro F, Bochud PY; Swiss Hepatitis C Cohort Study Group. Viral genotypespecific role of PNPLA3, PPARG, MTTP, and IL28B in hepatitis C virus-associated steatosis. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 73 Clark PJ, Thompson AJ, Zhu Q, Vock DM, Zhu M, Patel K, Harrison SA, Naggie S, Ge D, Tillmann HL, Urban TJ, Shianna K, Fellay J, Goodman Z, Noviello S, Pedicone LD, Afdhal N, Sulkowski M, Albrecht JK, Goldstein DB, McHutchison JG, Muir AJ. The association of genetic variants with hepatic steatosis in patients with genotype 1 chronic hepatitis C infection. Dig Dis Sci 2012; 57: [PMID: DOI: /s y] 74 Valenti L, Colombo M, Fargion S. Modulation of the effect of PNPLA3 I148M mutation on steatosis and liver damage by alcohol intake in patients with chronic hepatitis C. J Hepatol 2011; 55: ; author reply [PMID: DOI: /j.jhep ] 75 Sookoian S, Pirola CJ. Meta-analysis of the influence of I148M variant of patatin-like phospholipase domain containing 3 gene (PNPLA3) on the susceptibility and histological severity of nonalcoholic fatty liver disease. Hepatology 2011; 53: [PMID: DOI: /hep.24283] 76 Ampuero J, Del Campo JA, Rojas L, García-Lozano JR, Solá R, Andrade R, Pons JA, Navarro JM, Calleja JL, Buti M, González- Escribano MF, Forns X, Diago M, García-Samaniego J, Romero- Gómez M. PNPLA3 rs causes steatosis according to viral & amp; IL28B genotypes in hepatitis C. Ann Hepatol 2014; 13: [PMID: ] 77 Petit JM, Guiu B, Masson D, Duvillard L, Jooste V, Buffier P, Bouillet B, Brindisi MC, Robin I, Gambert P, Verges B, Cercueil JP, Hillon P. PNPLA3 polymorphism influences liver fibrosis in unselected patients with type 2 diabetes. Liver Int 2011; 31: [PMID: DOI: /j x] 78 Guyot E, Sutton A, Rufat P, Laguillier C, Mansouri A, Moreau R, Ganne-Carrié N, Beaugrand M, Charnaux N, Trinchet JC, Nahon P. PNPLA3 rs738409, hepatocellular carcinoma occurrence and risk model prediction in patients with cirrhosis. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 79 Valenti L, Aghemo A, Stättermayer AF, Maggioni P, De Nicola S, Motta BM, Rumi MG, Dongiovanni P, Ferenci P, Colombo M, Fargion S. Implications of PNPLA3 polymorphism in chronic hepatitis C patients receiving peginterferon plus ribavirin. Aliment Pharmacol Ther 2012; 35: [PMID: DOI: /j x] 80 Mehta SH, Brancati FL, Strathdee SA, Pankow JS, Netski D, Coresh J, Szklo M, Thomas DL. Hepatitis C virus infection and incident type 2 diabetes. Hepatology 2003; 38: [PMID: DOI: /jhep ] 81 Ishizaka N, Ishizaka Y, Takahashi E, Tooda Ei, Hashimoto H, Nagai R, Yamakado M. Association between hepatitis C virus seropositivity, carotid-artery plaque, and intima-media thickening. Lancet 2002; 359: [PMID: ] 82 Vassalle C, Masini S, Bianchi F, Zucchelli GC. Evidence for association between hepatitis C virus seropositivity and coronary artery disease. Heart 2004; 90: [PMID: ] 83 Butt AA, Xiaoqiang W, Budoff M, Leaf D, Kuller LH, Justice AC. Hepatitis C virus infection and the risk of coronary disease. Clin Infect Dis 2009; 49: [PMID: DOI: /599371] 84 Targher G, Bertolini L, Padovani R, Rodella S, Arcaro G, Day C. Differences and similarities in early atherosclerosis between patients with non-alcoholic steatohepatitis and chronic hepatitis B and C. J Hepatol 2007; 46: [PMID: DOI: /j.jhep ] 85 Arcari CM, Nelson KE, Netski DM, Nieto FJ, Gaydos CA. No association between hepatitis C virus seropositivity and acute myocardial infarction. Clin Infect Dis 2006; 43: e53-e56 [PMID: DOI: /507031] 86 Guiltinan AM, Kaidarova Z, Custer B, Orland J, Strollo A, Cyrus S, Busch MP, Murphy EL. Increased all-cause, liver, and cardiac mortality among hepatitis C virus-seropositive blood donors. Am J Epidemiol 2008; 167: [PMID: DOI: / aje/kwm370] 87 El-Kamary SS, Jhaveri R, Shardell MD. All-cause, liver-related, and non-liver-related mortality among HCV-infected individuals in the general US population. Clin Infect Dis 2011; 53: [PMID: DOI: /cid/cir306] 88 Adinolfi LE, Zampino R, Restivo L, Lonardo A, Guerrera B, Marrone A, Nascimbeni F, Florio A, Loria P. Chronic hepatitis C virus infection and atherosclerosis: clinical impact and mechanisms. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] 89 Schuppan D, Afdhal NH. Liver cirrhosis. Lancet 2008; 371: [PMID: DOI: /S (08) ] 90 Lewis JH, Mortensen ME, Zweig S, Fusco MJ, Medoff JR, Belder R; Pravastatin in Chronic Liver Disease Study Investigators. Efficacy and safety of high-dose pravastatin in hypercholesterolemic patients with well-compensated chronic liver disease: Results of a prospective, randomized, doubleblind, placebo-controlled, multicenter trial. Hepatology 2007; 46: [PMID: DOI: /hep.21848] 91 Kuoppala J, Lamminpää A, Pukkala E. Statins and cancer: A systematic review and meta-analysis. Eur J Cancer 2008; 44: [PMID: DOI: /j.ejca ] 92 Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest 2003; 112: [PMID: DOI: /JCI20530] 93 Kisseleva T, Brenner DA. Mechanisms of fibrogenesis. Exp Biol Med (Maywood) 2008; 233: [PMID: DOI: /0707-MR-190] 94 Iwaisako K, Brenner DA, Kisseleva T. What s new in liver fibrosis? The origin of myofibroblasts in liver fibrosis. J Gastroenterol Hepatol 2012; 27 Suppl 2: [PMID: DOI: /j x] 95 Shirin H, Sharvit E, Aeed H, Gavish D, Bruck R. Atorvastatin and rosuvastatin do not prevent thioacetamide induced liver cirrhosis in rats. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i2.241] 96 Sun HY, Singh N. Antimicrobial and immunomodulatory attributes of statins: relevance in solid-organ transplant recipients. Clin Infect Dis 2009; 48: [PMID: DOI: /597039] 8301 July 21, 2015 Volume 21 Issue 27

96 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection 97 Wu J, Wong WW, Khosravi F, Minden MD, Penn LZ. Blocking the Raf/MEK/ERK pathway sensitizes acute myelogenous leukemia cells to lovastatin-induced apoptosis. Cancer Res 2004; 64: [PMID: DOI: / CAN ] 98 Rao S, Porter DC, Chen X, Herliczek T, Lowe M, Keyomarsi K. Lovastatin-mediated G1 arrest is through inhibition of the proteasome, independent of hydroxymethyl glutaryl-coa reductase. Proc Natl Acad Sci USA 1999; 96: [PMID: ] 99 Dimitroulakos J, Lorimer IA, Goss G. Strategies to enhance epidermal growth factor inhibition: targeting the mevalonate pathway. Clin Cancer Res 2006; 12: 4426s-4431s [PMID: DOI: / CCR ] 100 Zhao TT, Le Francois BG, Goss G, Ding K, Bradbury PA, Dimitroulakos J. Lovastatin inhibits EGFR dimerization and AKT activation in squamous cell carcinoma cells: potential regulation by targeting rho proteins. Oncogene 2010; 29: [PMID: DOI: /onc ] 101 Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 1990; 343: [PMID: DOI: /343425a0] 102 Peng LF, Schaefer EA, Maloof N, Skaff A, Berical A, Belon CA, Heck JA, Lin W, Frick DN, Allen TM, Miziorko HM, Schreiber SL, Chung RT. Ceestatin, a novel small molecule inhibitor of hepatitis C virus replication, inhibits 3-hydroxy-3-methylglutarylcoenzyme A synthase. J Infect Dis 2011; 204: [PMID: DOI: /infdis/jir303] 103 Kim SS, Peng LF, Lin W, Choe WH, Sakamoto N, Kato N, Ikeda M, Schreiber SL, Chung RT. A cell-based, high-throughput screen for small molecule regulators of hepatitis C virus replication. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 104 Zhang FL, Casey PJ. Protein prenylation: molecular mechanisms and functional consequences. Annu Rev Biochem 1996; 65: [PMID: DOI: /annurev.bi ] 105 Wang C, Gale M, Keller BC, Huang H, Brown MS, Goldstein JL, Ye J. Identification of FBL2 as a geranylgeranylated cellular protein required for hepatitis C virus RNA replication. Mol Cell 2005; 18: [PMID: DOI: /j.molcel ] 106 Patel K, Jhaveri R, George J, Qiang G, Kenedi C, Brown K, Cates C, Zekry A, Tillmann HL, Elliott L, Kilaru R, Albrecht J, Conrad A, McHutchison JG. Open-label, ascending dose, prospective cohort study evaluating the antiviral efficacy of Rosuvastatin therapy in serum and lipid fractions in patients with chronic hepatitis C. J Viral Hepat 2011; 18: [PMID: DOI: / j x] 107 O Leary JG, Chan JL, McMahon CM, Chung RT. Atorvastatin does not exhibit antiviral activity against HCV at conventional doses: a pilot clinical trial. Hepatology 2007; 45: [PMID: DOI: /hep.21554] 108 Rao GA, Pandya PK. Statin therapy improves sustained virologic response among diabetic patients with chronic hepatitis C. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 109 Kondo C, Atsukawa M, Tsubota A, Itokawa N, Fukuda T, Matsushita Y, Kidokoro H, Kobayashi T, Narahara Y, Nakatsuka K, Kanazawa H, Sakamoto C. An open-label randomized controlled study of pegylated interferon/ribavirin combination therapy for chronic hepatitis C with versus without fluvastatin. J Viral Hepat 2012; 19: [PMID: DOI: / j x] 110 Sezaki H, Suzuki F, Akuta N, Yatsuji H, Hosaka T, Kobayashi M, Suzuki Y, Arase Y, Ikeda K, Miyakawa Y, Kumada H. An open pilot study exploring the efficacy of fluvastatin, pegylated interferon and ribavirin in patients with hepatitis C virus genotype 1b in high viral loads. Intervirology 2009; 52: [PMID: DOI: / ] 111 Zhu Q, Li N, Han Q, Zhang P, Yang C, Zeng X, Chen Y, Lv Y, Liu X, Liu Z. Statin therapy improves response to interferon alfa and ribavirin in chronic hepatitis C: a systematic review and metaanalysis. Antiviral Res 2013; 98: [PMID: DOI: /j.antiviral ] 112 Trebicka J, Hennenberg M, Odenthal M, Shir K, Klein S, Granzow M, Vogt A, Dienes HP, Lammert F, Reichen J, Heller J, Sauerbruch T. Atorvastatin attenuates hepatic fibrosis in rats after bile duct ligation via decreased turnover of hepatic stellate cells. J Hepatol 2010; 53: [PMID: DOI: / j.jhep ] 113 Miyaki T, Nojiri S, Shinkai N, Kusakabe A, Matsuura K, Iio E, Takahashi S, Yan G, Ikeda K, Joh T. Pitavastatin inhibits hepatic steatosis and fibrosis in non-alcoholic steatohepatitis model rats. Hepatol Res 2011; 41: [PMID: DOI: / j x x] 114 Marcelli M, Cunningham GR, Haidacher SJ, Padayatty SJ, Sturgis L, Kagan C, Denner L. Caspase-7 is activated during lovastatininduced apoptosis of the prostate cancer cell line LNCaP. Cancer Res 1998; 58: [PMID: ] 115 Avins AL, Manos MM, Ackerson L, Zhao W, Murphy R, Levin TR, Watson DJ, Hwang PM, Replogle A, Levine JG. Hepatic effects of lovastatin exposure in patients with liver disease: a retrospective cohort study. Drug Saf 2008; 31: [PMID: ] 116 Henderson LM, Patel S, Giordano TP, Green L, El-Serag HB. Statin therapy and serum transaminases among a cohort of HCV-infected veterans. Dig Dis Sci 2010; 55: [PMID: DOI: /s ] 117 Simon TG, King LY, Zheng H, Chung RT. Statin use is associated with a reduced risk of fibrosis progression in chronic hepatitis C. J Hepatol 2015; 62: [PMID: DOI: / j.jhep ] 118 Butt AA, Shaikh O, Rogal S. Statins improve SVR, reduce fibrosis progression and HCC among HCV persons. 22nd Conference on Retroviruses and Opportunistic Infections. Seattle: WA, Kisseleva T, Brenner DA. Anti-fibrogenic strategies and the regression of fibrosis. Best Pract Res Clin Gastroenterol 2011; 25: [PMID: DOI: /j.bpg ] 120 Demierre MF, Higgins PD, Gruber SB, Hawk E, Lippman SM. Statins and cancer prevention. Nat Rev Cancer 2005; 5: [PMID: DOI: /nrc1751] 121 Welzel TM, Graubard BI, Zeuzem S, El-Serag HB, Davila JA, McGlynn KA. Metabolic syndrome increases the risk of primary liver cancer in the United States: a study in the SEER-Medicare database. Hepatology 2011; 54: [PMID: DOI: /hep.24397] 122 Bonovas S, Filioussi K, Tsavaris N, Sitaras NM. Statins and cancer risk: a literature-based meta-analysis and meta-regression analysis of 35 randomized controlled trials. J Clin Oncol 2006; 24: [PMID: DOI: /JCO ] 123 Singh S, Singh PP, Singh AG, Murad MH, Sanchez W. Statins are associated with a reduced risk of hepatocellular cancer: a systematic review and meta-analysis. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] 124 Ishihara Y, Ohmori K, Mizukawa M, Hasan AU, Noma T, Kohno M. Beneficial direct adipotropic actions of pitavastatin in vitro and their manifestations in obese mice. Atherosclerosis 2010; 212: [PMID: DOI: /j.atherosclerosis ] 125 Clendening JW, Penn LZ. Targeting tumor cell metabolism with statins. Oncogene 2012; 31: [PMID: DOI: /onc ] 126 Tsan YT, Lee CH, Ho WC, Lin MH, Wang JD, Chen PC. Statins and the risk of hepatocellular carcinoma in patients with hepatitis C virus infection. J Clin Oncol 2013; 31: [PMID: DOI: /JCO ] 127 El-Serag HB, Johnson ML, Hachem C, Morgana RO. Statins are associated with a reduced risk of hepatocellular carcinoma in a large cohort of patients with diabetes. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 8302 July 21, 2015 Volume 21 Issue 27

97 Simon TG et al. Lipid dysregulation in chronic hepatitis C infection 128 Nielsen SF, Nordestgaard BG, Bojesen SE. Statin use and reduced cancer-related mortality. N Engl J Med 2012; 367: [PMID: DOI: /NEJMoa ] 129 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 130 Kiser JJ, Burton JR, Anderson PL, Everson GT. Review and management of drug interactions with boceprevir and telaprevir. Hepatology 2012; 55: [PMID: DOI: / hep.25653] 131 Lee JE, van Heeswijk R, Alves K, Smith F, Garg V. Effect of the hepatitis C virus protease inhibitor telaprevir on the pharmacokinetics of amlodipine and atorvastatin. Antimicrob Agents Chemother 2011; 55: [PMID: DOI: /AAC ] 132 Seden K, Back D. Directly acting antivirals for hepatitis C and antiretrovirals: potential for drug-drug interactions. Curr Opin HIV AIDS 2011; 6: [PMID: DOI: / COH.0b013e32834b54dc] P- Reviewer: Gangl A, Said ZNA S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8303 July 21, 2015 Volume 21 Issue 27

98 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Acupuncture and regulation of gastrointestinal function REVIEW Hui Li, Tian He, Qian Xu, Zhe Li, Yan Liu, Fang Li, Bo-Feng Yang, Cun-Zhi Liu Hui Li, Tian He, Qian Xu, Zhe Li, Cun-Zhi Liu, Acupuncture and Moxibustion Department, Beijing Hospital of Traditional Chinese Medicine Affiliated to Capital Medical University, Beijing , China Hui Li, Yan Liu, Fang Li, Bo-Feng Yang, Tianjin University of Traditional Chinese Medicine, Tianjin , China Author contributions: Li H wrote the initial draft and revised the manuscript; He T and Xu Q revised the initial manuscript; Li Z, Liu Y and Yang BF conducted the literature review; Li F edited the language; Liu CZ contributed to the overall focus and content and helped revise the paper; all authors read and approved the final manuscript. Supported by National Natural Science Foundation of China, No and No ; Beijing Natural Science Foundation, No ; Beijing Municipal Administration of Hospitals Clinical Medicine Development of Special Funding Support, No. ZYLX201412; financially supported by 973 Program under Grant, No. 2014CB Conflict-of-interest statement: All authors have no conflict of interest related to the manuscript. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Dr. Cun-Zhi Liu, Acupuncture and Moxibustion Department, Beijing Hospital of Traditional Chinese Medicine Affiliated to Capital Medical University, No. 23 Meishuguanhou Street, Dongcheng District, Beijing , China. lcz623780@126.com Telephone: Fax: Received: January 14, 2015 Peer-review started: January 16, 2015 First decision: March 10, 2015 Revised: March 26, 2015 Accepted: May 4, 2015 Article in press: May 4, 2015 Published online: July 21, 2015 Abstract In China, acupuncture has been considered an effective method for treating gastrointestinal (GI) dysfunction diseases for thousands of years. In fact, acupuncture has gained progressive acceptance from both practitioners and patients worldwide. However, the therapeutic effects and underlying mechanisms in treating GI dysfunction have not yet been established due to a lack of systematic and comprehensive review articles. Therefore, the aim of this review is to discuss the efficacy of acupuncture as a treatment for GI dysfunction and the associated underlying mechanisms. A search of PubMed was conducted for articles that were published over the past 10 years using the terms acupuncture, gastrointestine, and other relevant keywords. In the following review, we describe the effect and underlying mechanisms of acupuncture on GI function from the perspectives of GI motility, visceral sensitivity, the GI barrier, and the brain-gut axis. The dual regulatory effects of acupuncture may manifest by promoting gastric peristalsis in subjects with low initial gastric motility, and suppressing peristalsis in subjects with active initial motility. In addition, the regulation of acupuncture on gastric motility may be intensitydependent. Our findings suggest that further studies are needed to investigate the effects and more systematic mechanisms in treating GI dysfunction, and to promote the application of acupuncture for the treatment of GI diseases. Key words: Acupuncture; Gastrointestinal motility; Gastrointestinal barrier; Visceral sensitivity; Brain-gut axis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved July 21, 2015 Volume 21 Issue 27

99 Li H et al. Acupuncture for treating GI dysfunction Core tip: Acupuncture has been used as an appropriate adjunctive treatment for gastrointestinal (GI) dysfunction diseases. However, the therapeutic effects and underlying mechanisms in treating GI dysfunction have not yet been established due to a lack of systematic and comprehensive review articles. This review clarifies the effects and underlying mechanisms of acupuncture on GI function from various perspectives including GI motility, visceral sensitivity, the GI barrier, and the braingut axis. In addition, the dual regulatory effects and the intensity-dependent nature of acupuncture on GI motility are discussed. Li H, He T, Xu Q, Li Z, Liu Y, Li F, Yang BF, Liu CZ. Acupuncture and regulation of gastrointestinal function. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: INTRODUCTION Acupuncture has been an integral part of traditional Chinese medicine (TCM), with a history tracing back more than 3000 years [1]. In principle, acupuncture is a method by which yin and yang can come into balance with one another and qi can flow harmoniously throughout the body [2]. In addition, De-qi, a composite of unique needle sensations in patients, including soreness, numbness, heaviness, fullness, warmth, coolness, tingling, and dull pain, is an efficacy predictor and parameter for assessing clinical effectiveness of acupuncture [3]. However, only when qi is achieved will acupuncture be recognized as effective in the process of treating diseases. In China, acupuncture, a therapy that involves inserting the tips of thin, stainless steel needles through the skin at specific points, has been widely used in clinical practice to treat various diseases and physiological disorders. The procedure can be accomplished by manual manipulation or electrical stimulation. Manual acupuncture involves the manipulation of the inserted needles by hand, such as lifting, thrusting, twisting, twirling, or other complex combinations [4]. Electroacupuncture (EA) is a modification of the traditional acupuncture and involves stimulating acupoints with an electrical pulse instead of manual manipulations [5]. Gastrointestinal (GI) diseases are a significant burden to society. In 2004, GI diseases were reported to affect an estimated 60 to 70 million United States citizens, and to total approximately $142 billion in direct and indirect costs [6]. To alleviate this burden, it is necessary to identify an economical means of treating GI diseases. Consequently, increased attention has been paid to studying the efficacy and related mechanisms of acupuncture in treating GI diseases. Acupuncture is beneficial as an alternative therapy for the management of chemotherapy-induced nausea [7], postoperative nausea and vomiting [8,9], peptic ulcer disease [10] and postoperative ileus [11], as well as other functional disorders [12-14] including irritable bowel syndrome (IBS) [15], constipation [16], and diarrhea [17]. These effects of acupuncture occur through regulation of GI motility, protection of the stomach mucosa, and a decrease in visceral sensitivity [18-20]. For example, acupuncture at zusanli (ST-36), a classic acupoint, may improve upper and lower abdominal symptoms and restore impaired gastric slow waves, which are induced by rectal distension (RD), via the vagal pathway [21]. Moreover, EA at Foot-Yangming meridian (SMFY) may enhance gastric motility and improve gastric mucosal blood flow by regulating the concentration of motilin and somatostatin in sinus ventriculi and bulbus medullae [22]. A search of PubMed articles published between the beginning of 2005 and 2015 was conducted using the search term acupuncture in combination with the terms gastrointestinal motility, gastric mucosa, intestinal mucosa, intestinal barrier, visceral sensitivity, brain-gut axis, or brain-gut peptide. Sixty-five articles associated with acupuncture and GI regulation were selected from the publications obtained through the conduct of the literature search. In this review, four aspects of the regulatory effects of acupuncture on the GI tract are discussed including the modulation of GI motility, the GI barrier, visceral sensitivity, and the brain-gut axis. ACUPUNCTURE AND MODULATION OF GI MOTILITY GI motility maintains healthy digestive function through the contraction and expansion of smooth muscle in different sections of the GI tract [23,24]. The characteristic motility pattern in the interdigestive period is referred to as an interdigestive migrating contraction [25]. In research, gastric myoelectrical activity (GMA), multichannel electrogastrography (EGG), and gastric pressure are often used to assess GI motility [26-30]. Acupuncture may have regulatory effects on GI motility, especially on the motility of the stomach and colon (Table 1). Effect of acupuncture stimulation on GI motility According to TCM, one characteristic of acupuncture is that it has opposite regulatory effects during different physiological conditions. For example, acupuncture may promote gastric peristalsis in subjects with low initial gastric motility, but it may suppress peristalsis in subjects with active initial motility [31]. One study involving 65 healthy volunteers found that manual acupuncture at ST-36 and neiguan (PC-6) decreased normogastria and increased bradygastria; however, the study did not provide evidence to support that acupuncture was more effective than sham 8305 July 21, 2015 Volume 21 Issue 27

100 Li H et al. Acupuncture for treating GI dysfunction Table 1 Effect of acupuncture on gastric and colonic motility Organ Subjects Methods Findings Ref. Stomach Normal mice EA at ST-36 ST-36-gastric motility [48] EA at CV-12 CV-12-gastric motility Rats with gastric mucosal damage EA at acupoints in Gastric motility [22] Foot-Yangming Meridian Normal mice EA at CV-12 Gastric motility [29] Normal rats EA at ST-36 Gastric motility [30] Dogs with impaired gastric motility EA at ST-36 Gastric motility [18] induced by RD Healthy human Manual acupuncture at Normogastria [32] both PC-6 and ST-36 Bradygastria Colon Conscious dogs Manual acupuncture at acupoints in large Only GV-1-colonic motility [37] intestine meridian or ST-25, BL-25, GV-1 Conscious rats EA at ST-36 Colonic motility [50] Rats with stress EA at ST-36 Colonic motility [35], increase;, decrease. EA: Electro-acupuncture; ST-36: Zusanli; CV-12: Zhongwan; PC-6: Neiguan; RD: Rectal distension; GV-1: Changqiang; ST-25: Tianshu; BL-25: Dachangshu. Table 2 Mechanisms of acupuncture on gastrointestinal motility Function Subjects Stimulation Result Mechanism Ref. Method Region Gastric motility Dogs with RD EA ST-36 Increase Vagal activity [18] opioid pathway Healthy volunteers MA ST-36 Increase Vagal pathway [21] Rats EA Foot-Yangming Meridian Increase Brain-gut peptide [22] Wild-type mice EA CV-12 Decrease TRPV1 receptor [29] Rats EA ST-36 Increase NMDA receptors [30] Colonic motility Rats EA ST-36 Increase Parasympathetic efferent pathway [50] Rats TENS Hind limbs Decrease OXT expression [54] MA: Manual acupuncture; EA: Electro-acupuncture; ST-36: Zusanli; RD: Rectal distension; CV-12: Zhongwan; NMDA: N-methyl-D-aspartate; TRPV1: Transient receptor potential vanilloid-1; TENS: Transcutaneous electrical nerve stimulation; OXT: Oxytocin. acupuncture [32]. Moreover, the results of several clinical studies indicated that acupuncture at hegu (LI-4) and PC-6 inhibited the excessive GI motility induced by mosapride citrate, and enhanced the suppression of loperamide-induced conditions, but these effects were not observed under normal conditions [33-35]. Similar outcomes have been noted in laboratory settings. Acupuncture applied at PC-6 or ST-36 in rats significantly enhanced gastric motility, while stimulating zhongwan (CV-12) significantly suppressed gastric motility [36]. Iwa et al [37] suggested that in rats, EA at ST-36 not only promoted gastric peristalsis, but also inhibited the acceleration of stress-induced colonic transit due to restraint. When acupuncture was applied at the changqiang acupoint (GV-1), colonic motility was also inhibited in healthy dogs through a decrease in the total duration and frequency of the contractions [38]. The results of these studies indicate that acupuncture has a dual regulatory effect on GI motility and supports the TCM theory that acupuncture restores the balance between the yin and yang [39]. Mechanisms by which acupuncture regulates GI motility The pathways, transmitters, and modulators of the nervous system are important factors in the regulation of GI motility (Table 2). In diabetic rats, EA at ST-36 has been shown to normalize contractions of the gastric antrum. This effect was partly related to an enhanced SCF/c-kit pathway which plays a critical role in maintaining the survival and proliferation of cells of Cajal (ICCs) [40,41]. ICCs, which act as a pacemaker in the GI tract, play a crucial role in the generation of slow waves and the control of gastric movements [42]. In rats with burns, EA at ST-36 improved postprandial gastric dysrhythmia, and delayed gastric liquid emptying via the enhancement of vagal activity, which indicated that the accelerative effect of EA on gastric motility might be blocked after a vagotomy [43]. Acupuncture at the acupoints in the limb promoted gastric motility via a supra-spinal reflex that activated the vagal nerve fibers, while the same stimulus to the abdomen resulted in the reverse effect via a spinal reflex that activated sympathetic nerve fibers [44-46]. Moreover, EA at ST-36 has been found to enhance gastric motility via the efferent parasympathetic pathway, whereas stimulating CV-12 has been found to inhibit GI motility via the efferent sympathetic pathway [47,48]. Furthermore, the inhibitory effect of EA on gastric motility may be intensity-dependent. In wild-type mice, EA at an intensity of 1 ma at CV-12 produced no 8306 July 21, 2015 Volume 21 Issue 27

101 Li H et al. Acupuncture for treating GI dysfunction significant effect on gastric motility. In contrast, gastric motility was significantly inhibited by EA stimulation at intensities of 2 ma and 4 ma. However, the intensitydependent characteristic disappeared following the blockage of the TRPV1 channel, which indicated that TRPV1 was partially involved in the EA modulation of gastric motility [29]. Strong manual acupuncture stimulation applied in rats at ST-36 or CV-12 produced a more significant enhancement or inhibition on gastric motility compared with slight stimulation. In this case, the intensity of manual acupuncture stimulation depended on the twisting frequency of needle manipulations and De-qi sensation. And the effect was more likely to be mediated via A-delta and C-afferent fibers [49]. Similarly, Iwa et al [50] reported that EA applied in freely moving conscious rats might promote distal colonic motility and accelerate colonic transit via a sacral efferent parasympathetic pathway. The stimulatory effect of EA on stress-induced delayed gastric emptying was blocked by pretreatment with an intracerebroventricular injection of kynurenic acid, a glutamate receptor antagonist, which suggested that the glutamate receptor was involved in the regulation of gastric motility [51]. Glutamatergic receptors are classified as either N-methyl-D-aspartate (NMDA) receptors or non-nmda receptors [52]. NMDA receptors, which are associated with vagal afferent nerve fibers, may play a critical role in mediating gastric motility. When anesthetized rats were microinjected with AP5, an antagonist of NMDA receptors, the increased gastric pressure that was induced by low frequency electric stimulation at ST-36 significantly decreased [30,53]. In addition, acupuncture could improve the GI symptoms associated with stress by up-regulating the expression of hypothalamic oxytocin (OXT), which is an antistressor agent [54]. ACUPUNCTURE AND MODULATION OF GI BARRIER FUNCTION The GI barrier, which is a component of GI defense, protects the epithelium from harmful microbes and toxins [55]. Impairment of the mucosal barrier primarily results from mucosal ischemia/reperfusion injury, inflammatory response, excess gastric acid secretion and bacterial infection [56-60]. Acupuncture may be helpful in restoring GI barrier injury by regulating the neuron-endocrineimmune system and antagonizing the inflammatory response. In duodenal ulcer patients, acupuncture has been shown to reduce the acid output and to achieve symptomatic relief [61]. EA at ST-36 provided protective effects against gut injury and mucosal barrier dysfunction in hemorrhaged rats by activating the cholinergic anti-inflammatory-dependent pathway and enteric glial cells which are known to secrete proepidermal growth factor and thereby increase epithelial restitution [62-65]. The anti-inflammatory effect of acupuncture has the potential to significantly prevent postoperative intra-abdominal adhesion formation, which is a leading cause of small bowel obstruction [66]. The loss of intestinal barrier function and epithelial cell integrity induced by gut ischemia/reperfusion injury could promote the systemic production of various inflammatory mediators and activate leukocytes, which may lead to remote organ injury [67]. In rats with ischemia/reperfusion injury, the anti-inflammatory effect of EA at ST-36 has been shown to prevent the injury to the intestinal barrier and remote organs via the activation of the α7 subunit of nicotinic receptor and the cholinergic anti-inflammatory-dependent pathway [68]. Stress-induced mucosal diseases occur with local ischemia [69]. In rats with stress-induced gastric ulcers, EA at ST-36 aided in the repair of the stomach mucosa by increasing the concentration of epidermal growth factor in gastric mucosal tissue [70,71]. The protective effect of EA on the gastric mucosa may be related to an increase in the expression of the intestinal trefoil factor gene and SS-R1mRNA in gastric mucosal tissue, which may promote mucosal restoration [20,72,73]. As a neurotransmitter, nitric oxide (NO) has both protective and deleterious effects on the gastric mucosa, depending on the type of nitric oxide synthase (NOS, i.e., NOS1, NOS2, or NOS3) [74]. EA applied at ST-36 in rats has been shown to increase the expression of NOS1, but decrease the expression of NOS2 and NOS3, resulting in the protection of the gastric mucous [75]. Prior research has indicated that excess gastric acid secretion may cause GI mucosal lesions [60]. Furthermore, plasma beta-endorphin (β-ep) and somatostatin (SS) inhibit acid secretion [76,77]. Following the intragastric administration of a mixed amino acid meal to dogs, EA at ST-36, PC-6, and pishu (BL-20) suppressed acid secretion and significantly increased β-ep and SS simultaneously. Moreover, the inhibition of acid secretion by EA was significantly greater than inhibition observed following sham EA [78]. ACUPUNCTURE AND MODULATION OF VISCERAL SENSITIVITY IBS is characterized by chronic or recurrent abdominal pain, discomfort, and/or altered bowel habits (i.e., diarrhea, constipation or both) that often interfere with the daily life of a patient [79,80]. Clinically, acupuncture has been acknowledged as an effective treatment for abdominal pain in IBS patients, although some acupuncture trials failed to demonstrate superiority over a placebo treatment in patients who have IBS [81-83]. Chronic visceral hypersensitivity (CVH) is an important and characteristic feature of IBS. In rats, EA at bilateral points of ST-36 and shangjuxu (ST-37) significantly attenuated CVH that was induced by neonatal colon irritation. This effect was not observed 8307 July 21, 2015 Volume 21 Issue 27

102 Li H et al. Acupuncture for treating GI dysfunction following sham-ea at ST-36 and ST-37 without electrical stimulation, or following EA at control points, shenmai (BL-62), and the tail, which not only confirmed the acupoint specificity but also accounted for the placebo effect of EA [84]. The antihyperalgesic effect of acupuncture may be mediated via the opioidergic, adrenergic, and serotonergic pathways in both the central and peripheral nervous systems. In rats with heterotypic intermittent stress (HIS), EA delivered at acupoint ST-36 for 30 min in both hind limbs significantly attenuated the hypersensitive responses to colorectal distention compared with sham EA treatment. In contrast, the analgesic effects were blocked by pretreatment with naloxone, an opioid receptor antagonist, which suggested that the opioid pathway was involved in the regulation of visceral hypersensitivity by acupuncture [85]. Serotonin (5-HT) hyperactivity is known to increase visceral sensitivity in the enteric nervous system. This is supported by the effectiveness of the 5-HT3 receptor antagonist in treating IBS [86]. Several studies have shown that EA at ST-36 decreased visceral sensitivity and produced an analgesic effect in rats with CVH via the serotonergic pathway [87,88]. In response to colorectal distension, Chu et al [89] used the abdominal electromyogram (EMG) as the measurement index for visceral hypersensitivity in rats with CVH, and found that the inhibitory effect of EA at ST-36 on visceral hypersensitivity may be mediated by the 5-HT3 receptor in colon tissue. However, a study performed by Liu et al [90] suggested that EA at tianshu (ST-25) and ST-37 reduced the concentration of 5-HT by activating the 5-HT4 receptor, which indicated that the 5-HT3 receptor may not be involved in the regulation of the visceral pain threshold in CVH rats. These conflicting results may be partially due to the application of different acupuncture points in the two experiments. When EA was applied at ST-36 and ST-37 in CVH rats, the abdominal withdrawal reflex (AWR) decreased, and the pain threshold pressure (PTP) increased. Furthermore, the high expression levels of phosphorylated NMDA receptor subunit (pnr1) in the spinal cords (L4-L5 segments) of CVH rats was markedly attenuated by EA treatment [84]. Aside from the peripheral nervous system, the central nervous system plays an important role in the regulation of visceral sensitivity by EA. Corticotropin-releasing hormone (CRH) has been shown to increase rectal sensitivity, which was inhibited by the administration of α-helical CRH, an antagonist of the CRH receptor [91,92]. In IBS model rats, EA at ST-37 significantly decreased the visceral sensitivity and hypothalamic CRH levels compared with the untreated IBS model rats. Therefore, it is possible that EA can moderate visceral sensitivity by regulating the hypothalamic CRH concentrations in the rodent IBS model [93]. ACUPUNCTURE AND MODULATION OF BRAIN-GUT AXIS The brain-gut axis is a bridge that connects the CNS and GI tract [94]. By means of the brain-gut axis, signals from the brain influence the sensory, motor, and secretory modalities, as well as the microbiota of the gut. Conversely, visceral messages from the microbiota may influence brain functions [95]. The brain-gut axis involves the CNS, autonomic nervous system (ANS), hypothalamic-pituitary axis (HPA) and brain-gut peptides. A functional magnetic resonance imaging (fmri) study of the human brain demonstrated that manual acupuncture at ST-36 modulated neural activity at multiple levels in the cerebro-cerebellar and limbic systems [96]. Further, the anterior cingulate cortex, prefrontal cortices, and the caudate tail may play a role in processing gastric perceptions in functional dyspepsia (FD) patients. Acupuncture could deactivate the primary somatosensory area and the cerebella, and could activate the visual-related cortex [97]. Brain-gut peptides, which are distributed along the GI tract and in the central nervous system, are involved in the modulation of GI tract processing [22,94]. Tachykinins, as exemplified by substance P (SP), participate in important physiological processes in GI systems including smooth muscle contractility, epithelial secretion, and proliferation [98]. A reduction in the secretion of SP and vasoactive intestinal polypeptide (VIP), an inhibitor of GI motility, could contribute to the major effects of EA when treating rats with IBS [99]. Motilin and cholecystokinin (CCK) are peptides that are known to be potent regulators of GI motility. In a study by Niu et al [47], EA at ST-36 significantly increased the secretion of motilin and CCK, which could be the mechanism by which acupuncture enhanced the GI myoelectrical activity of conscious rabbits [100]. Further, evidence suggested that the orexigenic peptides, including ghrelin and neuropeptide Y (NPY), could be down-regulated by EA and could stimulate decreased food intake in rats [101]. CONCLUSION Although acupuncture has been used as an appropriate adjunctive treatment for GI dysfunction diseases, the underlying mechanisms have not been clearly understood. Currently, there are no systematic and comprehensive review articles that clarify the regulatory effect of acupuncture on GI function. In this review, we discuss the regulation on GI function through acupuncture from the perspectives of GI motility, the GI barrier, visceral sensitivity, and the brain-gut axis. The results of studies in both humans (Table 3) and animals suggest that acupuncture has 8308 July 21, 2015 Volume 21 Issue 27

103 Li H et al. Acupuncture for treating GI dysfunction Table 3 Clinical trials associated with acupuncture and gastrointestinal Regulation Trial design Subjects Method Acupoints Result Ref. Randomized controlled trial Healthy persons administered Manual acupuncture LI-4 and PC-6 GI motility [32] with mosapride citrate Non-randomized controlled trial Healthy persons administered Manual acupuncture LI-4 and PC-6 GI motility [33] with loperamide Non-randomized controlled trial Healthy persons Manual acupuncture LI-4 and PC-6 Intestinal motility - [34] Randomized controlled trial Healthy volunteers Manual acupuncture ST-36 GI motility [21] Randomized controlled trial Healthy volunteers Manual acupuncture ST-36 and PC-6 Normogastria [31] Bradygastria, increase;, decrease; -: No effect. GI: Gastrointestinal; RCT: Randomized controlled trial; LI-4: Hegu; PC-6: Neiguan; ST-36: Zusanli. PC-6 12 cun 4 cun 4 cun 2 8 cun 4 4 CV-12 ST-25 acupoints. The duration and frequency of acupuncture manipulation are important parameters for the success of the therapy. Thus future studies should incorporate optimized methodologies that account for the selection of acupoints and stimulation parameters. The mechanisms underlying the beneficial effects of acupuncture may be associated with the pathways and transmitters of the nervous system. However, the mechanisms behind the involvement of brain-gut peptides in acupuncture and GI regulation have not been established because there are no known antagonists available to serve as controls in experimental studies. Although manual acupuncture and EA are both effective in regulating GI disorders, it is still unclear which method is more effective in certain conditions. Further investigation of the efficacy of acupuncture on multiple targets may be more likely to inspire scientific interest. Furthermore, to elucidate the roles and mechanisms of acupuncture in GI regulation and new therapeutic approaches for treating various GI diseases, proper controls are required in future studies. REFERENCES 3 8 cun cun ST-36 ST-37 Figure 1 Location of acupoints often used in gastrointestinal regulation. the potential to treat GI disorders by regulating GI motility, the GI barrier, visceral sensitivity, and the brain-gut axis. In addition, the dual regulatory effects and the intensity-dependent nature of acupuncture on GI motility are discussed. According to classical acupuncture theory, acupoints are important reflex points of visceral dysfunction. Different acupoints have various therapeutic effects. ST-36, PC-6, ST-37, CV-12, and ST-25 are the primary acupoints used in the treatment of patients or animals with GI disorders (Figure 1), which suggests the specificity of 1 Han JS, Ho YS. Global trends and performances of acupuncture research. Neurosci Biobehav Rev 2011; 35: [PMID: DOI: /j.neubiorev ] 2 Kaptchuk TJ. Acupuncture: theory, efficacy, and practice. Ann Intern Med 2002; 136: [PMID: ] 3 Kong J, Gollub R, Huang T, Polich G, Napadow V, Hui K, Vangel M, Rosen B, Kaptchuk TJ. Acupuncture de qi, from qualitative history to quantitative measurement. J Altern Complement Med 2007; 13: [PMID: DOI: /acm ] 4 Xing W, Li Q. Effects of different manipulations of acupuncture on electrical activity of stomach in humans. J Tradit Chin Med 1998; 18: [PMID: ] 5 Hsieh CL, Lin JG, Li TC, Chang QY. Changes of pulse rate and skin temperature evoked by electroacupuncture stimulation with different frequency on both Zusanli acupoints in humans. Am J Chin Med 1999; 27: [PMID: ] 6 Everhart JE, Ruhl CE. Burden of digestive diseases in the United States part I: overall and upper gastrointestinal diseases. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 7 Anders EF, Findeisen A, Lode HN, Usichenko TI. Acupuncture for treatment of acute vomiting in children with gastroenteritis and pneumonia. Klin Padiatr 2012; 224: [PMID: DOI: /s ] 8 Liodden I, Howley M, Grimsgaard AS, Fønnebø VM, Borud EK, Alraek T, Norheim AJ. Perioperative acupuncture and 8309 July 21, 2015 Volume 21 Issue 27

104 Li H et al. Acupuncture for treating GI dysfunction postoperative acupressure can prevent postoperative vomiting following paediatric tonsillectomy or adenoidectomy: a pragmatic randomised controlled trial. Acupunct Med 2011; 29: 9-15 [PMID: DOI: /aim ] 9 Glickman-Simon R, Tessier J. Guided imagery for postoperative pain, energy healing for quality of life, probiotics for acute diarrhea in children, acupuncture for postoperative nausea and vomiting, and animal-assisted therapy for mental disorders. Explore (NY) 2014; 10: [PMID: DOI: / j.explore ] 10 Wang H, Wang CY, Zhang JS, Sun L, Sun JP, Tian QH, Jin XL, Yin L. Acupuncture therapy for experimental stomach ulcer and c-fos expression in rats. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 11 Ng SS, Leung WW, Mak TW, Hon SS, Li JC, Wong CY, Tsoi KK, Lee JF. Electroacupuncture reduces duration of postoperative ileus after laparoscopic surgery for colorectal cancer. Gastroenterology 2013; 144: e1 [PMID: DOI: /j.gastro ] 12 Chon TY, Lee MC. Acupuncture. Mayo Clin Proc 2013; 88: [PMID: DOI: /j.mayocp ] 13 Zeng F, Qin W, Ma T, Sun J, Tang Y, Yuan K, Li Y, Liu J, Liu X, Song W, Lan L, Liu M, Yu S, Gao X, Tian J, Liang F. Influence of acupuncture treatment on cerebral activity in functional dyspepsia patients and its relationship with efficacy. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ] 14 Ma TT, Yu SY, Li Y, Liang FR, Tian XP, Zheng H, Yan J, Sun GJ, Chang XR, Zhao L, Wu X, Zeng F. Randomised clinical trial: an assessment of acupuncture on specific meridian or specific acupoint vs. sham acupuncture for treating functional dyspepsia. Aliment Pharmacol Ther 2012; 35: [PMID: DOI: /j x] 15 MacPherson H, Bland M, Bloor K, Cox H, Geddes D, Kang ombe A, Reynolds J, Stamuli E, Stuardi T, Tilbrook H, Torgerson D, Whorwell P. Acupuncture for irritable bowel syndrome: a protocol for a pragmatic randomised controlled trial. BMC Gastroenterol 2010; 10: 63 [PMID: DOI: / X-10-63] 16 Li Y, Zheng H, Zeng F, Zhou SY, Zhong F, Zheng HB, Chen M, Jing XH, Cai YY, Jia BH, Zhu B, Liu ZS. Use acupuncture to treat functional constipation: study protocol for a randomized controlled trial. Trials 2012; 13: 104 [PMID: DOI: / ] 17 Sun JH, Wu XL, Xia C, Xu LZ, Pei LX, Li H, Han GY. Clinical evaluation of Soothing Gan and invigorating Pi acupuncture treatment on diarrhea-predominant irritable bowel syndrome. Chin J Integr Med 2011; 17: [PMID: DOI: / s z] 18 Chen J, Song GQ, Yin J, Koothan T, Chen JD. Electroacupuncture improves impaired gastric motility and slow waves induced by rectal distension in dogs. Am J Physiol Gastrointest Liver Physiol 2008; 295: G614-G620 [PMID: DOI: / ajpgi ] 19 Xu GY, Winston JH, Chen JD. Electroacupuncture attenuates visceral hyperalgesia and inhibits the enhanced excitability of colon specific sensory neurons in a rat model of irritable bowel syndrome. Neurogastroenterol Motil 2009; 21: 1302-e125 [PMID: DOI: /j x] 20 Li XP, Yan J, Yi SX, Chang XR, Lin YP, Yang ZB, Huang A, Hu R. Effect of electroacupunture on gastric mucosal intestinal trefoil factor gene expression of stress-induced gastric mucosal injury in rats. World J Gastroenterol 2006; 12: [PMID: DOI: /wjg.v12.i ] 21 Liu J, Huang H, Xu X, Chen JD. Effects and possible mechanisms of acupuncture at ST36 on upper and lower abdominal symptoms induced by rectal distension in healthy volunteers. Am J Physiol Regul Integr Comp Physiol 2012; 303: R209-R217 [PMID: DOI: /ajpregu ] 22 Lin YP, Yi SX, Yan J, Chang XR. Effect of acupuncture at Foot- Yangming Meridian on gastric mucosal blood flow, gastric motility and brain-gut peptide. World J Gastroenterol 2007; 13: [PMID: DOI: /wjg.v13.i ] 23 Yin J, Chen JD. Roles of interstitial cells of Cajal in regulating gastrointestinal motility: in vitro versus in vivo studies. J Cell Mol Med 2008; 12: [PMID: DOI: / j x] 24 Sallam HS, McNearney TA, Chen JD. Acupuncture-based modalities: novel alternative approaches in the treatment of gastrointestinal dysmotility in patients with systemic sclerosis. Explore (NY) 2014; 10: [PMID: DOI: / j.explore ] 25 Kusano M, Hosaka H, Kawada A, Kuribayashi S, Shimoyama Y, Zai H, Kawamura O, Yamada M. Gastrointestinal motility and functional gastrointestinal diseases. Curr Pharm Des 2014; 20: [PMID: DOI: / ] 26 Ruckebusch Y, Pairet M, Becht JL. Origin and characterization of migrating myoelectric complex in rabbits. Dig Dis Sci 1985; 30: [PMID: ] 27 McNearney T, Lin X, Shrestha J, Lisse J, Chen JD. Characterization of gastric myoelectrical rhythms in patients with systemic sclerosis using multichannel surface electrogastrography. Dig Dis Sci 2002; 47: [PMID: ] 28 Wang SB, Chen SP, Gao YH, Luo MF, Liu JL. Effects of electroacupuncture on cardiac and gastric activities in acute myocardial ischemia rats. World J Gastroenterol 2008; 14: [PMID: DOI: /wjg ] 29 Yu Z, Cao X, Xia Y, Ren B, Feng H, Wang Y, Jiang J, Xu B. Electroacupuncture Stimulation at CV12 Inhibits Gastric Motility via TRPV1 Receptor. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/294789] 30 Gao X, Qiao Y, Jia B, Jing X, Cheng B, Wen L, Tan Q, Zhou Y, Zhu B, Qiao H. NMDA Receptor-Dependent Synaptic Activity in Dorsal Motor Nucleus of Vagus Mediates the Enhancement of Gastric Motility by Stimulating ST36. Evid Based Complement Alternat Med 2012; 2012: [PMID: DOI: /2012/438460] 31 Ren BB, Yu Z, Xu B. [Overview of the two-way regulatory effect of acupuncture on gastrointestinal motility]. Zhongguo Zhenjiu 2012; 32: [PMID: ] 32 Witt CM, Meissner K, Pach D, Thiele C, Lüdtke R, Ghadiyali Z, Deter HC, Zimmermann-Viehoff F. Stimulation of gastric slow waves with manual acupuncture at acupuncture points ST36 and PC6--a randomized single blind controlled trial. Neurogastroenterol Motil 2012; 24: , e211-e212 [PMID: DOI: /j x] 33 Shin KM, Park JE, Lee S, Choi SM, Ahn YC, Lee JW, Kim JH, Son CG. Effect of siguan acupuncture on gastrointestinal motility: a randomized, sham-controlled, crossover trial. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/918392] 34 DS Oh, SY Jung, AR Kim, WC Kang, JE Park, CM Koo, JY Choi, HJ Jung, SM Choi, CG Son. A crossover clinical trial to determine the effect of Siguan (four gates) points on GI motility suppressed by loperamide administration. J Korean Oriental Med 2008; 29: Yim YK, Kang WC, Cho JH, Shin JW, Lee NH, Choi SM, Koo ST, Park KS, Son CG. Crossover clinical trial to determine the effect of manual acupuncture at Siguan points (bilateral LI4 and LR3) on intestinal motility in healthy subjects. Am J Chin Med 2007; 35: [PMID: DOI: /S X ] 36 Yang ZK, Wu ML, Xin JJ, He W, Su YS, Shi H, Wang XY, Hu L, Jing XH, Litscher G. Manual acupuncture and laser acupuncture for autonomic regulations in rats: observation on heart rate variability and gastric motility. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/276320] 37 Iwa M, Nakade Y, Pappas TN, Takahashi T. Electroacupuncture elicits dual effects: stimulation of delayed gastric emptying and 8310 July 21, 2015 Volume 21 Issue 27

105 Li H et al. Acupuncture for treating GI dysfunction inhibition of accelerated colonic transit induced by restraint stress in rats. Dig Dis Sci 2006; 51: [PMID: ] 38 Kim HY, Hahm DH, Pyun KH, Lee HJ, Nam TC, Shim I. Effect of traditional acupuncture on proximal colonic motility in conscious dogs. J Vet Med Sci 2006; 68: [PMID: DOI: /jvms ] 39 Takahashi T. Mechanism of acupuncture on neuromodulation in the gut--a review. Neuromodulation 2011; 14: 8-12; discussion 12 [PMID: DOI: /j x] 40 Herlin T, Ternowitz T, Kragballe K. Calcium efflux changes in neutrophils from patients with severe atopic dermatitis. Acta Derm Venereol Suppl (Stockh) 1985; 120: [PMID: DOI: /S X ] 41 Tong W, Jia H, Zhang L, Li C, Ridolfi TJ, Liu B. Exogenous stem cell factor improves interstitial cells of Cajal restoration after blockade of c-kit signaling pathway. Scand J Gastroenterol 2010; 45: [PMID: DOI: / ] 42 Hirst GD, Edwards FR. Electrical events underlying organized myogenic contractions of the guinea pig stomach. J Physiol 2006; 576: [PMID: DOI: /jphysiol ] 43 Song J, Yin J, Sallam HS, Bai T, Chen Y, Chen JD. Electroacupuncture improves burn-induced impairment in gastric motility mediated via the vagal mechanism in rats. Neurogastroenterol Motil 2013; 25: 807-e635 [PMID: DOI: / nmo.12183] 44 Noguchi E. Acupuncture regulates gut motility and secretion via nerve reflexes. Auton Neurosci 2010; 156: [PMID: DOI: /j.autneu ] 45 Li YQ, Zhu B, Rong PJ, Ben H, Li YH. Neural mechanism of acupuncture-modulated gastric motility. World J Gastroenterol 2007; 13: [PMID: DOI: /wjg.v13. i5.709] 46 Sato A, Sato Y, Suzuki A, Uchida S. Neural mechanisms of the reflex inhibition and excitation of gastric motility elicited by acupuncture-like stimulation in anesthetized rats. Neurosci Res 1993; 18: [PMID: DOI: / (93) Y] 47 Niu WX, He GD, Liu H, Qin XY. Effects and probable mechanisms of electroacupuncture at the Zusanli point on upper gastrointestinal motility in rabbits. J Gastroenterol Hepatol 2007; 22: [PMID: ] 48 Su YS, He W, Wang C, Shi H, Zhao YF, Xin JJ, Wang XY, Shang HY, Hu L, Jing XH, Zhu B. Intensity-response effects of electroacupuncture on gastric motility and its underlying peripheral neural mechanism. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/535742] 49 Su YS, Yang ZK, Xin JJ, He W, Shi H, Wang XY, Hu L, Jing XH, Zhu B. Somatosensory Nerve Fibers Mediated Generation of Deqi in Manual Acupuncture and Local Moxibustion-Like Stimuli- Modulated Gastric Motility in Rats. Evid Based Complement Alternat Med 2014; 2014: [PMID: DOI: /2014/673239] 50 Iwa M, Matsushima M, Nakade Y, Pappas TN, Fujimiya M, Takahashi T. Electroacupuncture at ST-36 accelerates colonic motility and transit in freely moving conscious rats. Am J Physiol Gastrointest Liver Physiol 2006; 290: G285-G292 [PMID: ] 51 Iwa M, Nakade Y, Pappas TN, Takahashi T. Electroacupuncture improves restraint stress-induced delay of gastric emptying via central glutaminergic pathways in conscious rats. Neurosci Lett 2006; 399: 6-10 [PMID: DOI: /j.neulet ] 52 Travagli RA, Gillis RA, Rossiter CD, Vicini S. Glutamate and GABA-mediated synaptic currents in neurons of the rat dorsal motor nucleus of the vagus. Am J Physiol 1991; 260: G531-G536 [PMID: ] 53 Bouzioukh F, Tell F, Jean A, Rougon G. NMDA receptor and nitric oxide synthase activation regulate polysialylated neural cell adhesion molecule expression in adult brainstem synapses. J Neurosci 2001; 21: [PMID: ] 54 Yoshimoto S, Babygirija R, Dobner A, Ludwig K, Takahashi T. Antistress effects of transcutaneous electrical nerve stimulation (TENS) on colonic motility in rats. Dig Dis Sci 2012; 57: [PMID: DOI: /s ] 55 Boltin D, Niv Y. Pharmacological and alimentary alteration of the gastric barrier. Best Pract Res Clin Gastroenterol 2014; 28: [PMID: DOI: /j.bpg ] 56 Chang JX, Chen S, Ma LP, Jiang LY, Chen JW, Chang RM, Wen LQ, Wu W, Jiang ZP, Huang ZT. Functional and morphological changes of the gut barrier during the restitution process after hemorrhagic shock. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 57 Zhang LH, Yao CB, Gao MQ, Li HQ. Gastric mucosal injury due to hemorrhagic reperfusion and efficacy of Salvia miltiorrhizae extract F and cimetidine. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 58 Verbeke L, Farre R, Verbinnen B, Covens K, Vanuytsel T, Verhaegen J, Komuta M, Roskams T, Chatterjee S, Annaert P, Vander Elst I, Windmolders P, Trebicka J, Nevens F, Laleman W. The FXR agonist obeticholic acid prevents gut barrier dysfunction and bacterial translocation in cholestatic rats. Am J Pathol 2015; 185: [PMID: DOI: / j.ajpath ] 59 Schuster AT, Homer CR, Kemp JR, Nickerson KP, Deutschman E, Kim Y, West G, Sadler T, Stylianou E, Krokowski D, Hatzoglou M, de la Motte C, Rubin BP, Fiocchi C, McDonald C, Longworth MS. Chromosome-associated protein d3 promotes bacterial clearance in human intestinal epithelial cells by repressing expression of amino Acid transporters. Gastroenterology 2015; 148: e3 [PMID: DOI: /j.gastro ] 60 Schubert ML. Gastric secretion. Curr Opin Gastroenterol 2014; 30: [PMID: DOI: /MOG ] 61 Sodipo JO, Falaiye JM. Acupuncture and gastric acid studies. Am J Chin Med 1979; 7: [PMID: 44432] 62 Du MH, Luo HM, Hu S, Lv Y, Lin ZL, Ma L. Electroacupuncture improves gut barrier dysfunction in prolonged hemorrhagic shock rats through vagus anti-inflammatory mechanism. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i ] 63 Shi X, Zhong Y, Yao J, Hu S, Wang L, Litscher G. The influence of zusanli and nonmeridian acupuncture points on the survival rate and intestinal tissue features after fatal hemorrhagic shock in rats. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/750620] 64 Hu S, Zhao ZK, Liu R, Wang HB, Gu CY, Luo HM, Wang H, Du MH, Lv Y, Shi X. Electroacupuncture activates enteric glial cells and protects the gut barrier in hemorrhaged rats. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i5.1468] 65 Van Landeghem L, Chevalier J, Mahé MM, Wedel T, Urvil P, Derkinderen P, Savidge T, Neunlist M. Enteric glia promote intestinal mucosal healing via activation of focal adhesion kinase and release of proegf. Am J Physiol Gastrointest Liver Physiol 2011; 300: G976-G987 [PMID: DOI: / ajpgi ] 66 Du MH, Luo HM, Tian YJ, Zhang LJ, Zhao ZK, Lv Y, Xu RJ, Hu S. Electroacupuncture ST36 prevents postoperative intra-abdominal adhesions formation. J Surg Res 2015; 195: [PMID: DOI: /j.jss ] 67 Wu R, Dong W, Ji Y, Zhou M, Marini CP, Ravikumar TS, Wang P. Orexigenic hormone ghrelin attenuates local and remote organ injury after intestinal ischemia-reperfusion. PLoS One 2008; 3: e2026 [PMID: DOI: /journal.pone ] 68 Hu S, Du MH, Luo HM, Wang H, Lv Y, Ma L, Lin ZL, Shi X, Gaischek I, Wang L, Litscher G. Electroacupuncture at Zusanli (ST36) Prevents Intestinal Barrier and Remote Organ Dysfunction following Gut Ischemia through Activating the Cholinergic Anti- Inflammatory-Dependent Mechanism. Evid Based Complement 8311 July 21, 2015 Volume 21 Issue 27

106 Li H et al. Acupuncture for treating GI dysfunction Alternat Med 2013; 2013: [PMID: DOI: /2013/592127] 69 Laine L, Takeuchi K, Tarnawski A. Gastric mucosal defense and cytoprotection: bench to bedside. Gastroenterology 2008; 135: [PMID: DOI: /j.gastro ] 70 Shi JJ, Huang LF. [Effects of transcutaneous electrical acupoint stimulation of Zusanli (ST 36) on gastric mucosal injury in exercise stress-induced gastric ulcer rats]. Zhenci Yanjiu 2013; 38: [PMID: ] 71 Yang ZB, Yan J, Zou XP, Yi SX, Chang XR, Lin YP, Li XP. Enhanced expression of epidermal growth factor receptor gene in gastric mucosal cells by the serum derived from rats treated with electroacupuncture at stomach meridian acupoints. World J Gastroenterol 2006; 12: [PMID: DOI: /wjg.v12.i ] 72 Hoffmann W. Trefoil factors TFF (trefoil factor family) peptidetriggered signals promoting mucosal restitution. Cell Mol Life Sci 2005; 62: [PMID: DOI: / s ] 73 Cho CH. Current roles of nitric oxide in gastrointestinal disorders. J Physiol Paris 2001; 95: [PMID: DOI: / S (01) ] 74 Sun JP, Pei HT, Jin XL, Yin L, Tian QH, Tian SJ. Effects of acupuncturing Tsusanli (ST36) on expression of nitric oxide synthase in hypothalamus and adrenal gland in rats with cold stress ulcer. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 75 Fykse V, Coy DH, Waldum HL, Sandvik AK. Somatostatinreceptor 2 (sst2)-mediated effects of endogenous somatostatin on exocrine and endocrine secretion of the rat stomach. Br J Pharmacol 2005; 144: [PMID: DOI: / sj.bjp ] 76 Lenz HJ, Klapdor R, Hester SE, Webb VJ, Galyean RF, Rivier JE, Brown MR. Inhibition of gastric acid secretion by brain peptides in the dog. Role of the autonomic nervous system and gastrin. Gastroenterology 1986; 91: [PMID: ] 77 Jin HO, Zhou L, Lee KY, Chang TM, Chey WY. Inhibition of acid secretion by electrical acupuncture is mediated via beta-endorphin and somatostatin. Am J Physiol 1996; 271: G524-G530 [PMID: ] 78 Bouin M, Plourde V, Boivin M, Riberdy M, Lupien F, Laganière M, Verrier P, Poitras P. Rectal distention testing in patients with irritable bowel syndrome: sensitivity, specificity, and predictive values of pain sensory thresholds. Gastroenterology 2002; 122: [PMID: DOI: /gast ] 79 Thompson WG, Longstreth GF, Drossman DA, Heaton KW, Irvine EJ, Müller-Lissner SA. Functional bowel disorders and functional abdominal pain. Gut 1999; 45 Suppl 2: II43-II47 [PMID: DOI: /gut ii43] 80 Lembo AJ, Conboy L, Kelley JM, Schnyer RS, McManus CA, Quilty MT, Kerr CE, Drossman D, Jacobson EE, Davis RB. A treatment trial of acupuncture in IBS patients. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 81 Schneider A, Enck P, Streitberger K, Weiland C, Bagheri S, Witte S, Friederich HC, Herzog W, Zipfel S. Acupuncture treatment in irritable bowel syndrome. Gut 2006; 55: [PMID: DOI: /gut ] 82 Xing J, Larive B, Mekhail N, Soffer E. Transcutaneous electrical acustimulation can reduce visceral perception in patients with the irritable bowel syndrome: a pilot study. Altern Ther Health Med 2004; 10: [PMID: ] 83 Rafiei R, Ataie M, Ramezani MA, Etemadi A, Ataei B, Nikyar H, Abdoli S. A new acupuncture method for management of irritable bowel syndrome: A randomized double blind clinical trial. J Res Med Sci 2014; 19: [PMID: ] 84 Tian SL, Wang XY, Ding GH. Repeated electro-acupuncture attenuates chronic visceral hypersensitivity and spinal cord NMDA receptor phosphorylation in a rat irritable bowel syndrome model. Life Sci 2008; 83: [PMID: DOI: / j.lfs ] 85 Zhou YY, Wanner NJ, Xiao Y, Shi XZ, Jiang XH, Gu JG, Xu GY. Electroacupuncture alleviates stress-induced visceral hypersensitivity through an opioid system in rats. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 86 Camilleri M, Northcutt AR, Kong S, Dukes GE, McSorley D, Mangel AW. Efficacy and safety of alosetron in women with irritable bowel syndrome: a randomised, placebo-controlled trial. Lancet 2000; 355: [PMID: DOI: / S (00)02033-X] 87 Tian XY, Bian ZX, Hu XG, Zhang XJ, Liu L, Zhang H. Electroacupuncture attenuates stress-induced defecation in rats with chronic visceral hypersensitivity via serotonergic pathway. Brain Res 2006; 1088: [PMID: DOI: / j.brainres ] 88 Wu JC, Ziea ET, Lao L, Lam EF, Chan CS, Liang AY, Chu SL, Yew DT, Berman BM, Sung JJ. Effect of electroacupuncture on visceral hyperalgesia, serotonin and fos expression in an animal model of irritable bowel syndrome. J Neurogastroenterol Motil 2010; 16: [PMID: DOI: / jnm ] 89 Chu D, Cheng P, Xiong H, Zhang J, Liu S, Hou X. Electroacupuncture at ST-36 relieves visceral hypersensitivity and decreases 5-HT(3) receptor level in the colon in chronic visceral hypersensitivity rats. Int J Colorectal Dis 2011; 26: [PMID: DOI: /s ] 90 Liu HR, Wang XM, Zhou EH, Shi Y, Li N, Yuan LS, Wu HG. Acupuncture at both ST25 and ST37 improves the pain threshold of chronic visceral hypersensitivity rats. Neurochem Res 2009; 34: [PMID: DOI: /s ] 91 Lembo T, Plourde V, Shui Z, Fullerton S, Mertz H, Tache Y, Sytnik B, Munakata J, Mayer E. Effects of the corticotropinreleasing factor (CRF) on rectal afferent nerves in humans. Neurogastroenterol Motil 1996; 8: 9-18 [PMID: ] 92 Sagami Y, Shimada Y, Tayama J, Nomura T, Satake M, Endo Y, Shoji T, Karahashi K, Hongo M, Fukudo S. Effect of a corticotropin releasing hormone receptor antagonist on colonic sensory and motor function in patients with irritable bowel syndrome. Gut 2004; 53: [PMID: DOI: /gut ] 93 Wu HG, Liu HR, Zhang ZA, Zhou EH, Wang XM, Jiang B, Shi Z, Zhou CL, Qi L, Ma XP. Electro-acupuncture relieves visceral sensitivity and decreases hypothalamic corticotropin-releasing hormone levels in a rat model of irritable bowel syndrome. Neurosci Lett 2009; 465: [PMID: DOI: /j.neulet ] 94 Bonaz B, Sabate JM. [Brain-gut axis dysfunction]. Gastroenterol Clin Biol 2009; 33 Suppl 1: S48-S58 [PMID: DOI: /S (09) ] 95 Bonaz B. Inflammatory bowel diseases: a dysfunction of braingut interactions? Minerva Gastroenterol Dietol 2013; 59: [PMID: ] 96 Hui KK, Liu J, Marina O, Napadow V, Haselgrove C, Kwong KK, Kennedy DN, Makris N. The integrated response of the human cerebro-cerebellar and limbic systems to acupuncture stimulation at ST 36 as evidenced by fmri. Neuroimage 2005; 27: [PMID: DOI: /j.neuroimage ] 97 Zeng F, Song WZ, Liu XG, Xie HJ, Tang Y, Shan BC, Liu ZH, Yu SG, Liang FR. Brain areas involved in acupuncture treatment on functional dyspepsia patients: a PET-CT study. Neurosci Lett 2009; 456: 6-10 [PMID: DOI: /j.neulet ] 98 Steinhoff MS, von Mentzer B, Geppetti P, Pothoulakis C, Bunnett NW. Tachykinins and their receptors: contributions to physiological control and the mechanisms of disease. Physiol Rev 2014; 94: [PMID: DOI: /physrev ] 99 Wu HG, Jiang B, Zhou EH, Shi Z, Shi DR, Cui YH, Kou ST, Liu HR. Regulatory mechanism of electroacupuncture in irritable bowel syndrome: preventing MC activation and decreasing SP 8312 July 21, 2015 Volume 21 Issue 27

107 Li H et al. Acupuncture for treating GI dysfunction VIP secretion. Dig Dis Sci 2008; 53: [PMID: DOI: /s ] 100 Crawley JN, Corwin RL. Biological actions of cholecystokinin. Peptides 1994; 15: [PMID: DOI: / (94)90104-X] 101 Tian N, Wang F, Tian DR, Zou Y, Wang SW, Guan LL, Shi YS, Chang JK, Yang J, Han JS. Electroacupuncture suppresses expression of gastric ghrelin and hypothalamic NPY in chronic food restricted rats. Peptides 2006; 27: [PMID: DOI: /j.peptides ] P- Reviewer: Hu S, Kuai L S- Editor: Yu J L- Editor: Wang TQ E- Editor: Liu XM 8313 July 21, 2015 Volume 21 Issue 27

108 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Basic Study ORIGINAL ARTICLE TLR4-HMGB1-, MyD88- and TRIF-dependent signaling in mouse intestinal ischemia/reperfusion injury Jie Wang, Gui-Zhen He, Yu-Kang Wang, Qian-Kun Zhu, Wei Chen, Tai Guo Jie Wang, Gui-Zhen He, Yu-Kang Wang, Qian-Kun Zhu, Wei Chen, Department of Parenteral and Enteral Nutrition, Peking Union Medical College Hospital, Centre for Translational Medicine, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing , China Tai Guo, National Institutes for Food and Drug Control, Beijing , China Author contributions: Wang J, Wang YK, Zhu QK, Chen W, and Guo T performed the animal experiments; Wang J and Chen W performed the research; Zhu QK collected the data; Wang J analyzed the data and wrote the paper; He GZ designed the research and was also involved in editing the manuscript. Supported by National Natural Science Foundation of China, No ; and the Natural Sciences Foundation of Beijing, No Institutional review board statement: The study was reviewed and approved by the Academic Committee of Chinese Academy of Medical Sciences and Peking Union Medical College Hospital Institutional Review Board. Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the Academic Committee of Chinese Academy of Medical Sciences and Peking Union Medical College Hospital (IACUC protocol number: XHDW ). Conflict-of-interest statement: The authors declare no conflict of interests. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Gui-Zhen He, Professor, Department of Parenteral and Enteral Nutrition, Peking Union Medical College Hospital, Centre for Translational Medicine, Chinese Academy of Medical Sciences and Peking Union Medical College, No.1 ShuaifuyuanWangfujing, Dongcheng District, Beijing , China. hgzpumc@163.com Telephone: Fax: Received: December 22, 2014 Peer-review started: December 23, 2014 First decision: February 10, 2015 Revised: April 1, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract AIM: To characterize high-mobility group protein 1-toll-like receptor 4 (HMGB1-TLR4) and downstream signaling pathways in intestinal ischemia/reperfusion (I/ R) injury. METHODS: Forty specific-pathogen-free male C57BL/6 mice were randomly divided into five groups (n = 8 per group): sham, control, anti-hmgb1, anti-myeloid differentiation gene 88 (MyD88), and anti-translocatingchain-associating membrane protein (TRIF) antibody groups. Vehicle with the control IgG antibody, anti- HMGB1, anti-myd88, or anti-trif antibodies (all 1 mg/kg, 0.025%) were injected via the caudal vein 30 min prior to ischemia. After anesthetization, the abdominal wall was opened and the superior mesenteric artery was exposed, followed by 60 min mesenteric ischemia and then 60 min reperfusion. For the sham group, the abdominal wall was opened for 120 min without I/R. Levels of serum nuclear factor (NF)-κB p65, interleukin (IL)-6, and tumor necrosis factor (TNF)-α were measured, along with myeloperoxidase activity in the lung and liver. In 8314 July 21, 2015 Volume 21 Issue 27

109 Wang J et al. Signaling in ischemia/reperfusion injury addition,morphologic changes that occurred in the lung and intestinal tissues were evaluated. Levels of mrna transcripts encoding HMGB1 and NF-κB were measured by real-time quantitative PCR, and levels of HMGB1 and NF-κB protein were measured by Western blot. Results were analyzed using one-way analysis of variance. RESULTS: Blocking HMGB1, MyD88, and TRIF expression by injecting anti-hmgb1, anti-myd88, or anti-trif antibodies prior to ischemia reduced the levels of inflammatory cytokines in serum; NF-κB p65: ± 11.89, ± 24.85, ± 33.63, ± 13.22, and ± (P < 0.05); IL-6: ± 6.33, ± 31.18, ± 6.73, ± 17.37, and ± 7.38 (P < 0.05); TNF-α, ± 4.18, ± 6.97, ± 5.71, ± 5.47, and ± 4.63 (P < 0.05) for the sham, control, anti-hmgb1, anti-myd88, and anti-trif groups, respectively (all in pg/ml). Antibodies also alleviated tissue injury in the lung and small intestine compared with the control group in the mouse intestinal I/R model. The administration of anti- HMGB1, anti-myd88, and anti-trif antibodies markedly reduced damage caused by I/R, for which anti-hmgb1 antibody had the most obvious effect. CONCLUSION: HMGB1 and its downstream signaling pathway play important roles in the mouse intestinal I/R injury, and the effect of the TRIF-dependent pathway is slightly greater. Key words: C57BL/6 mouse; High-mobility group protein 1; Intestinal ischemia-reperfusion injury; Myeloid differentiation gene 88; Nuclear factor-κb translocatingchain-associating membrane protein The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Intestinal mucosal barrier injury induced by intestinal ischemia/reperfusion is often the basis for a poor prognosis in many diseases. Despite extensive investigative efforts,the underlying mechanism remains a subject of debate, and there are currently no effective methods for its prevention or control. The findings reported here suggest that the high-mobility group protein 1-toll-like receptor 4 axis and the two downstream signaling pathways play important roles in ischemia/reperfusion injury and show potential therapeutic value for their blockade. This study has an important clinical significance, which could improve the survival rate and reduce complications in critically ill patients. Wang J, He GZ,Wang YK, Zhu QK, Chen W, Guo T. TLR4- HMGB1-, MyD88- and TRIF-dependent signaling in mouse intestinal ischemia/reperfusion injury. World J Gastroenterol 2015; 21(27): Available from: URL: wjgnet.com/ /full/v21/i27/8314.htm DOI: org/ /wjg.v21.i INTRODUCTION Ischemia/reperfusion (I/R) injury is a syndrome in which serious cellular structural damage and functional metabolic disorders occur and organ function is further aggravated when blood flow that was halted curing ischemia is restored after a period of time [1-4]. The gut is an important functional organ for the immune and endocrine systems, and it also serves as a protective barrier. Intestinal I/R injury is one of the main triggers that can lead to a systemic inflammatory response syndrome, acute lung injury, acute respiratory distress syndrome, and multiple organ dysfunction syndrome [5-8]. Although extensive investigative efforts have focused on characterizing the pathogenesis of distant organ injury induced by intestinal I/R, the underlying mechanism remains the subject of debate, and there are currently no effective methods for its prevention or control. Recently, studies have suggested that I/R injury could be caused by interactions between toll-like receptor 4 (TLR4) and high-mobility group protein 1 (HMGB1), an endogenous TLR4 ligand. HMGB1 can activate TLR4, which can subsequently trigger downstream signal-transduction pathways [9]. The downstream signal transduction pathways initiated by TLR4 and HMGB1 are thought to include myeloid differentiation gene 88(MyD88)/TIR domain-containing adaptor protein (TIRAP)- and TIR domain-containing adaptor inducing interferon (IFN)-β (TRIF)/translocatingchain-associating membrane protein (TRAM)-dependent pathways [10]. In the process whereby TLR4 stimulates the release of inflammatory cytokines induced by endotoxin, MyD88- and TRIF-dependent pathways both play critical roles [11]. However, only a few studies have examined these pathways in aseptic/noninfectious I/R injury. Furthermore, whether intestinal I/R induces local and distant organ injury via these pathways has been poorly characterized. This study aimed to determine whether administering HMGB1 antibody could reduce tissue damage induced by intestinal I/R and to characterize the role of the HMGB1-TLR4 axis in I/R injury by administrating anti- HMGB1 antibody to block the binding of HMGB1 and TLR4 using a mouse intestinal I/R model. Additionally, to further investigate the MyD88/TIRAP or TRIF/TRAM pathways, we went on to characterize whether one pathway serves a dominant function in inducing a systemic inflammatory response and distant organ injury following intestinal I/R (Figure 1). This study has an important clinical significance that will inform efforts to identify an effective targeted therapy, which could improve the survival rate and reduce complications in critically ill patients. MATERIALS AND METHODS Animals Forty, male C57BL/6 mice that were specific-pathogen July 21, 2015 Volume 21 Issue 27

110 Wang J et al. Signaling in ischemia/reperfusion injury MyD88 antibody TLR4 + HMGB1 HMGB1 antibody TRIF antibody for 60 min with a noninvasive artery clamp, followed by reperfusion for 60 min (according to the results of preliminary experiment). In the sham group, the abdominal cavity was only opened for 120 min without I/R. All animals were euthanized by barbiturate overdose (150 mg/kg pentobarbital sodium, ip) for tissue collection. MyD88 dependent TRIF dependent Specimen collection Blood: After the operation, blood was collected from the eye socket vein and centrifuged at 3000 rpm for 15 min at 4. Next, serum was separated and stored at -80 for further analysis. NF-κB TNF, ILs NF-κB IFNs, ILs Figure 1 High-mobility group protein 1-toll-like receptor 4 and downstream signaling pathways. IFN: Interferon; IL: Interluekin; MyD88: Myeloid differentiation gene 88; NF-κB: Nuclear factor-κb; TNF: Tumor necrosis factor; TRIF: Translocating-chain-associating membrane protein; HMGB1: Highmobility group protein 1; TLR4: Toll-like receptor 4. free grade and weighed 24-26g were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd (scxk ). The mice were housed under barrier-sustained conditions at a temperature of 25 and 50% humidity with 12 h light/dark cycles, and had free access to water and food for 2 wk prior to the operation. The mice were randomly divided into five groups (n = 8 for each group): sham, control (injected vehicle with the control IgG antibody), anti- HMGB1 (injected anti-hmgb1 antibody), anti-myd88 (injected anti-myd88 antibody), and anti-trif (injected anti-trif antibody). All mice were maintained in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals. The research protocols were approved by the Academic Committee of Chinese Academy of Medical Sciences and Peking Union Medical College. Intestinal I/R Prior to the operation, all mice were fasted overnight, but were allowed access to water ad libitum. Vehicle with the control IgG antibody (Abcam, Cambridge, United Kingdom), anti-hmgb1(abcam), anti-myd88(abcam), or anti-trif (Biolegend, San Diego, CA, United States) antibodies (all 1 mg/kg, 0.025%) were injected via the caudal vein 30 min prior to ischemia [12,13]. The dose used was based on references and the results of a preliminary experiment. The mice were anesthetized with an injection of 1% sodium pentobarbital (50 mg/ kg, ip). A midline incision was performed to bluntly separate the superior mesenteric artery(sma). In addition to the sham group, the SMA was occluded Tissue: After mice were sacrificed, the left lower lobe of the lung, a 3-cm proximal section of the jejunum, and a 3-cm distal section of the ileum were excised, rinsed in ice-cold normal saline, and dried on filter paper for histologic examination. The right liver, left upper lobe, right lung, a 6-cm proximal section of the jejunum, and a 6-cm distal section of the ileum were stored at -80 after being quickly immersed in liquid nitrogen for all other measurements. Hematoxylin and eosin staining of mice tissue slices Samples of the intestine and lung were fixed in 10% formalin solution and sectioned (4 μm) after dehydration, cleaning, and paraffin embedding. The sections were flattened, mounted, and heated on blank glass slides. Histologic evaluations were performed by hematoxylin and eosin staining and pathologic examination. Lung histologic scoring system was applied as described [14]. Lung injury was scored in each sample according to the following four items: alveolar congestion, hemorrhage, infiltration or aggregation of neutrophils in the airspace or vessel wall, and thickness of the alveolar wall. A score of 0 represented normal findings and scores of 1, 2, 3, and 4 represented mild (< 25%), moderate (25%-50%), severe (50%-75%), and very severe (> 75%) lung involvement, respectively. The overall score was based on the sum of all scores. The degree of intestinal injury was evaluated according to the scoring system developed by Anthony Stallion et al [15] (Table 1).The scale ranges from 0 to 4. No injury is scored as 0, with grade 4 depicting transmural necrosis of the intestine. The important components of injury include loss of villus height, infiltration of lymphocytes, and degree of necrosis. Measurement of tissue myeloperoxidase (MPO) activity Tissue MPO activity was determined in the lung and liver. The left upper lobe of lung and liver were harvested, rinsed, blotted dry, and frozen at -80. The samples were measured using an MPO detection assay according to the supplier s specifications (Jiancheng Bio, Nanjing, China). Tissue MPO activity is 8316 July 21, 2015 Volume 21 Issue 27

111 Wang J et al. Signaling in ischemia/reperfusion injury Table 1 Histologic grading of intestinal ischemia-reperfusion injury Grade Features 0 Normal,villus to crypt ratio 5-6:1, minimal number of lymphocytes and plasma cells, tall columnar surface epithelial cells 1 Epithelial cell degenerative changes (cuboidal,vacuolated) but intact, mild increase of lymphocytes and plasma cells in lamina propria 2 Decreased villus height, yielding villus to crypt ratio 1, epithelial cell necrosis or erosions, more chronic inflammation in lamina propria ± neutrophils, glandular dilatation 3 Villi effaced (flat surface), epithelial cell necrosis or erosions, pseudomembrane may appear on surface, glandular destruction, inflammation extending deep to muscle layer 4 Transmural changes (all of above plus change in muscle layer) expressed as activity units per gram of protein. Cytokines assay The serum concentrations of interleukin (IL)-6,tumor necrosis factor (TNF)-α, and nuclear factor (NF)-κB p65 were determined using ELISA kits (ME044,ME055, and ME053, respectively; ebioscience Inc., San Diego, CA, United States) according to the manufacturer s protocols. Quantitative real-time reverse transcriptase- PCR for HMGB1and NF-κB in terminal ileum and lung Total RNA was extracted from terminal ileum and lung tissue specimens using E.Z.N.A. Total RNA KitII (Omega Bio-Tek Inc., Norcross, GA, United States). The purity of RNA was tested by spectrophotometric analysis. Reverse transcription PCR amplification was conducted with MyCycler PCR (Bio-Rad Laboratories, Inc., Hercules, CA, United States), in accordance with the illustrations of the GoScript TM Reverse Transcription System (A5000; Promega, Madison, WI, United States). Utilizing 2 μl of reverse transcriptase products, realtime quantitative PCR was performed in a final volume of 20 μl using the gene-specific primers. The following primers designed with Primer Express Software were used: 5 -TTAGTCCCAGCGAAGGCTAT-3 (forward) and 5 -CAAGTTTCCTGAGCAATCCA-3 (reverse) for mouse HMGB1; 5 -GCTACACAGAGGCCATTGAA-3 (forward) and 5 -GTGGAGGAAGACGAGAGAGG-3 (reverse) for mouse NF-κB; 5 -GGCATTTCACTGCTTGATGT-3 (forward) and 5 -TGACATTCCCATGAAACCTC-3 (reverse) for mouse MyD88; 5 -TCAGAGAGTCCATCATTCGG-3 (forward) and5 -TACACGCCCACTCTTCTGAG-3 (reverse) for mouse TRIF; 5 -GCAAGTTCAACGGCACAG-3 (forward) and 5 -CGCCAGTAGACTCCACGAC-3 (reverse) for mouse GAPDH. Amplification was processed on Roche LightCycler 480 as follows: 10 min at 95, followed by 40 cycles of 15 s at 95, 60 s at 60, and then the melting curve was determined. Gene transcripts were quantified with SYBR green PCR master mix (Applied Biosystems of Thermo Fisher Scientific, Waltham, MA, United States). Data were calculated by the 2 - CT method and presented as fold change of transcripts for the HMGB1 and NF-κB in the ileum and lung tissue of other groups compared with shamoperated mice (defined as 1.0-fold). Mouse GAPDH was used as an internal control. The relative expression of the target gene was normalized to the level of GAPDH in the same cdna. Western blots for detection of HMGB1 and NF-κB protein in jejunum, ileum, and lung Total protein extract was prepared, and samples were separated using 10% SDS-PAGE. Proteins were then transferred to nitrocellulose membranes, which were then blocked for 2 h in 5% nonfat dry milk. The membranes were then incubated overnight in anti-hmgb1 (1:1000; Abcam), NF-κB (1:1000; Cell Signaling Technology, Inc.,Danvers,MA, United States) and β-actin (1:1000; Santa Cruz Biotechnology, Inc., Dallas, TX,United States) primary antibodies. Membranes were washed in PBST and incubated in horseradish-peroxidase-conjugated mouse secondary antibody in 5% nonfat milk (1:10000; Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. Protein bands were visualized by chemiluminescence. Statistical analysis Quantitative data are presented as mean ± SD. Statistical software SPSS l9.0(ibm Corp., Armonk, NY, United States)was used to test the homogeneity of variance. Multiple comparisons were performed with one-way analyses of variance followed by a leastsignificant difference tests.statistical significance was determined by analyzing the data with the nonparametric Kruskal-Wallis test, followed by the Mann-Whitney test for the histologic score. Statistical significance was set at P < The statistical methods of this study were reviewed by Hai-Long Li from Department of Health Statistics of Peking Union Medical College. RESULTS Serum levels of inflammatory factors Serum levels of IL-6, TNF-α and NF-κB p65 in the control, anti-hmgb1, anti-myd88, and anti-trif groups were significantly higher than in the sham group (P < 0.05) (Table 2). However, the increased levels of inflammatory cytokines in the anti-hmgb1, anti- MyD88, and anti-trif groups were significantly lower than in the control group (P < 0.05). Furthermore, the degrees of reduction in the anti-myd88 and anti-trif groups were lower than in the anti-hmgb1 group (P < 0.05). There was a slight but nonsignificant increase in the anti-myd88 group compared with the anti-trif group. Levels of MPO activity in the liver and lung The levels of MPO activity (an enzyme marker for activated neutrophils) in the liver and lung in the control 8317 July 21, 2015 Volume 21 Issue 27

112 Wang J et al. Signaling in ischemia/reperfusion injury Table 2 Concentrations of inflammatory factors in serum (mean ± SD) Group (n = 8) p65 (pg/ml) IL-6 (pg/ml) TNF-α (pg/ml) Sham ± ± ± 4.18 Control ± a ± a ± 6.97 a Anti-HMGB ± a,b ± 6.73 a,b ± 5.71 a,b Anti-MyD ± a,b,c ± a,b,c ± 5.47 a,b,c Anti-TRIF ± a,b,c ± 7.38 a,b,c ± 4.63 a,b,c a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti- HMGB1 group. HMGBI: High-mobility group protein 1; IL: Interleukin; MyD88: Myeloid differentiation gene 88; TNF-α: Tumor necrosis factor-α; TRIF: Translocating-chain-associating membrane protein. A MPO activity of lung (U/g tissue) B MPO activity of liver (U/g tissue) a a,b a,b,c a,b,c S C H M T a a,b a,b,c a,b,c S C H M T Figure 2 Levels of myeloperoxidase activity in the lung and liver. S: Sham group; C: Control group; H: Anti-high-mobility group protein 1 group; M: Antimyeloid differentiation gene 88 group; T: Anti-translocating-chain-associating membrane protein group; n = 4; a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti-hmgb1 group. MPO: Myeloperoxidase. and antibody-treatment groups were significantly higher than in the sham group (P < 0.05) (Figure 2, Table 3). The MPO levels in the three antibody-treatment groups were lower than in the control group (P < 0.05). The anti-hmgb1 group, which showed the largest reduction among the three experimental groups, showed a significant difference compared with the anti-myd88 and anti-trif groups (P < 0.05). However, there was no significant change between the anti-myd88 and anti- TRIF groups. Histopathologic evaluation Pathologic changes of lung: As shown in Figure 3A, mice in the sham group had normal lung tissue Table 3 Levels of myeloperoxidase activity in the lung and liver (mean ± SD) Group (n = 4) Lung Liver Sham 0.30 ± ± 0.03 Control 0.76 ± 0.06 a 0.68 ± 0.08 a Anti-HMGB ± 0.06 a,b 0.40 ± 0.07 a,b Anti-MyD ± 0.03 a,b,c 0.55 ± 0.03 a,b,c Anti-TRIF 0.57 ± 0.06 a,b,c 0.50 ± 0.04 a,b,c a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti- HMGB1 group. HMGBI: High-mobility group protein 1; MyD88: Myeloid differentiation gene 88; TRIF: Translocating-chain-associating membrane protein. with a complete and clear alveolar structure; neither edema nor alveolar hemorrhage was observed. Lung tissue from the control group showed features of substantial lung injury, including alveolar epithelial damage, fracture and fusion, alveolar septal thickening, interstitial and intra-alveolar edema with patchy hemorrhage, vascular congestion and some collapsed alveoli, as well as notable inflammatory cell infiltration (Figure 3B). Compared with the control group, tissue injury was markedly attenuated by HMGB1 antibody administration. Alveoli were well aerated and a mild neutrophil infiltration in the interstitium could be observed (Figure 3C). The degree of tissue injury in the anti-myd88 and anti-trif treated groups was significantly lower than in the control group (P < 0.05), but was markedly more serious than in the anti-hmgb1 group (Figure 3D, E, Table 4). There was a trend towards a reduction in lung injury in the anti- TRIF group compared with the anti-myd88 group, but this difference was not statistically significant. Pathologic changes of the jejunum and ileum: By light microscopy, small intestine specimens of the sham group showed unchanged morphologic structures with an integrated mucosal epithelial, clear tissue layers, no congestion, and inflammatory cell infiltration. Compared with the sham group, the control group showed obvious tissue injury based on mucosal necrosis, erosion, edema, and hyperemia, as well as the reduction of intestinal villi height and mucosal thickness, regional bleeding in the mucosa and lamina propria, and a large amount of inflammatory cell infiltration. However, the anti-hmgb1 group showed slight damage in the villus apex and less inflammatory cell infiltration in the mucosa. The anti-hmgb1 group showed obvious attenuation of small intestinal injury compared with the control group. Our findings for intestinal injury in the anti-myd88 and anti-trif groups were in accordance with the findings in lung (Figure 4, Table 5). Expression of HMGB1, NF-κB, MyD88, and TRIF mrna in ileum and HMGB1 and NF-κB mrna in lung The mrna expression of HMGB1 and NF-κB in the lung and the ileum in the control and antibody-treatment 8318 July 21, 2015 Volume 21 Issue 27

113 Wang J et al. Signaling in ischemia/reperfusion injury A B C D E Figure 3 Hematoxylin and eosin staining of lungs in all groups (magnification 400). A: Sham group; B: Control group; C: Anti-high-mobility group protein 1 group; D: Anti-myeloid differentiation gene 88 group; E: Anti-translocating-chain-associating membrane protein group (magnification 400; scale bars = 50 μm). Table 4 Lung injury score in all groups (mean ± SD) Group (n = 6) Alveolar congestion Hemorrhage Neutrophil infiltration Alveolar wall thickness Total score Sham 1.18 ± ± ± ± ± 0.64 Control 3.82 ± ± ± ± ± 0.73 a Anti-HMGB ± ± ± ± ± 0.60 a,b Anti-MyD ± ± ± ± ± 0.77 a,b,c Anti-TRIF 2.93 ± ± ± ± ± 0.62 a,b,c a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti-hmgb1 group. HMGBI: High-mobility group protein 1; MyD88: Myeloid differentiation gene 88; TRIF: Translocating-chain-associating membrane protein. groups were all significantly higher than the sham group (all P < 0.05) (Tables 6 and 7). The increase in the control group was the most obvious, and was significantly higher than the anti-hmgb1 group (P < 0.05). The levels in the anti-myd88 and anti-trif groups were significantly lower than in the control group (P < 0.05), but were the lowest in the anti-hmgb1 group. There was a slight increase in the anti-myd88 group compared with the anti-trif group, but this was not significant. The mrna expression of MyD88 in ileum in the anti-hmgb1 group and the anti-myd88 group were all significantly lower than in the control group and the anti-trif group (P < 0.05); The mrna expression of TRIF in ileum in the anti-hmgb1 group and the anti- TRIF group were all significantly lower than in the control group and the anti-myd88 group (P < 0.05). Protein levels of HMGB1 and NF-κB in lung, jejunum, and ileum After intestinal I/R injury, protein levels of HMGB1 and 8319 July 21, 2015 Volume 21 Issue 27

114 Wang J et al. Signaling in ischemia/reperfusion injury A1 B1 C1 D1 E1 A2 B2 C2 D2 E2 Figure 4 Hematoxylin and eosin staining of the jejunum and ileum in all groups (magnification 100). Representative images from jejunum (A1-E1) and ileum (A2-E2). A: Sham group; B: Control group; C: Anti-high-mobility group protein 1 group; D: Anti-myeloid differentiation gene 88 group; E: Anti-translocating-chainassociating membrane protein group (magnification 100; scale bars = 200 μm). Table 5 Intestine injury score in all groups (mean ± SD) Group (n = 6) Jejunum Ileum Sham 0.17 ± ± 0.12 Control 2.97 ± 0.16 a 3.15 ± 0.32 a Anti-HMGB ± 0.23 a,b 1.32 ± 0.27 a,b Anti-MyD ± 0.22 a,b,c 2.18 ± 0.29 a,b,c Anti-TRIF 2.08 ± 0.17 a,b,c 2.05 ± 0.27 a,b,c a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti- HMGB1 group. HMGBI: High-mobility group protein 1; MyD88: Myeloid differentiation gene 88; TRIF: Translocating-chain-associating membrane protein. NF-κB in the lung, jejunum, and ileum in the control and antibody-treatment groups were significantly increased compared with the sham group, but were significantly lower in the anti-hmgb1, anti-myd88, and anti-trif groups compared with the control group (all P < 0.05) (Figure 5). The degrees of reduced injury in the anti-myd88 and anti-trif groups were lower than in the anti-hmgb1 group (P < 0.05), and there was no significant difference between the anti-myd88 and anti-trif groups,though there was a slight trend towards attenuation in the anti-trif group compared with the anti-myd88 group. DISCUSSION Surgery, trauma, shock, transplantation, and many other diseases often induce tissue I/R. I/R results in the recruitment and activation of a number of downstream adaptor proteins and signaling kinases [16]. Previous studies have shown that high levels of molecular oxygen and overproduction of toxic oxygen radicals play critical roles in the pathologic process of I/R injury [17]. Wu et al [18] summarized that during renal I/R injury, reactive oxygen species not only directly inhibit the reperfusion of renal tissue, but more importantly induce and amplify inflammatory responses via oxidative stress, thereby increasing renal injury and apoptosis. In additional, the study by Quesnelle et al [19] shows that hepatic I/R injury involves numerous pathophysiologic processes July 21, 2015 Volume 21 Issue 27

115 Wang J et al. Signaling in ischemia/reperfusion injury Table 6 HMGB1and NF-κB mrna expression in lungs from all groups (mean ± SD) Group (n = 6) HMGB1 NF-κB Sham 1.04 ± ± 0.21 Control 2.67 ± 0.30 a 2.04 ± 0.29 a Anti-HMGB ± 0.18 a,b 1.42 ± 0.23 a,b Anti-MyD ± 0.31 a,b,c 1.77 ± 0.18 a,b,c Anti-TRIF 2.29 ± 0.28 a,b,c 1.70 ± 0.13 a,b,c a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti- HMGB1 group. HMGBI: High-mobility group protein 1; MyD88: Myeloid differentiation gene 88; NF-κB: Nuclear factor-κb; TRIF: Translocatingchain-associating membrane protein. Table 7 HMGB1, NF-κB, MyD88, and TRIF mrna expression in ileum from all groups (mean ± SD) Group (n = 6) HMGB1 NF-κB MyD88 TRIF Sham 1.04 ± ± ± ± 0.11 Control 2.67 ± 0.30 a 2.04 ± 0.29 a 2.55 ± 0.16 a 3.05 ± 0.10 a Anti-HMGB ± 0.18 a,b 1.42 ± 0.23 a,b 2.37 ± 0.08 a,b 2.90 ± 0.13 a,b Anti-MyD ± 0.31 a,b,c 1.77 ± 0.18 a,b,c 2.30 ± 0.16 a,b 3.04 ± 0.13 a,c Anti-TRIF 2.29 ± 0.28 a,b,c 1.70 ± 0.13 a,b,c 2.53 ± 0.07 a,c,d 2.85 ± 0.12 a,b,d a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti- HMGB1 group; d P < 0.05 vs anti-myd88 group. HMGBI: High-mobility group protein 1; MyD88: Myeloid differentiation gene 88; NF-κB: Nuclear factor-κb; TRIF: Translocating-chain-associating membrane protein. For example, during I/R injury, reactive oxygen species are generated in excess, which leads to oxidative stress and results in cell injury and death. Furthermore, reactive oxygen species, along with oxidative stress, are an essential mediator in the release of HMGB1. As the gut is sensitive to ischemia, intestinal mucosal barrier injury induced by intestinal I/R can often be the basis for a poor prognosis in many diseases, but its specific mechanism remains unclear. Recently, studies have found that the expression of HMGB1 and TLR4 in heart, brain, liver, and kidney are increased during I/R and the HMGB1-TLR4 axis might be the most important trigger of the inflammatory response to I/R injury in many organs [20-23]. TLRs, which can recognize molecules such as danger-associated molecular patterns, are a family of transmembrane proteins that can bind to a range of microbial products and can also recognize endogenous ligands to mediate the secretion of cytokines and the generation of natural immune responses [24-26]. HMGs were originally identified as a type of highly conserved DNA binding proteins that are widely expressed in mammals. Within the nucleus, HMGs participate in the construction and stability of nucleosomes and also regulate gene transcription; outside the nucleus, HMGs mediate inflammatory reactions, and promote cell differentiation and tumor growth [27,28]. Among HMGs, HMGB1 has the closest association with I/R injury. HMGB1 can be released by monocytes/macrophages, and has been shown to bind to TLR4 after I/R [29,30]. The results of the current study show that the protein and mrna levels of HMGB1 in the small intestine and lung and levels of serum inflammatory cytokines, including TNF-α and IL-6, in mice subjected to intestinal I/R were increased significantly compared with shamoperated mice. Administering HMGB1 antibody prior to ischemia resulted in the marked attenuation of protein and mrna levels of HMGB1 and inflammatory factors compared with the control group. These findings confirm that the HMGB1-TLR4 axis plays an important role in local and distant organ damage induced by I/R. The HMGB1-TLR4-mediated signaling pathway mainly activates NF-κB, which plays a critical role in the release of inflammatory factors through two downstream pathways, including MyD88- and TRIFdependent pathways [31,32]. The MyD88/TIRAP pathway causes the release of various inflammatory factors, such as IL-1, IL-6, IL-8, IL-10, IL-12, IL-18, and TNF-α, mainly through the activation of NF-κB [32]. The TRIF/ TRAM pathway mainly depends on the activation of IFN regulatory factor 3, followed by the expression of IFN-β and IFN-induced genes (such as IP-10) and the activation of transcription factors (NF-κB) that induce the synthesis and release of inflammatory factors [32]. In the present study, the mrna levels of MyD88 and TRIF in ileum of mice subjected to I/R were obviously increased, and the MyD88/TIRAP and TRIF/TRAM pathways could be blocked effectively by injecting anti- MyD88 or anti-trif antibody, respectively. Previous studies reported that the contribution of these two downstream pathways is not equivalent in organ I/R injury. For example, the MyD88-dependent pathway was confirmed to play a key role in kidney I/R injury by comparing renal tubular epithelial cells between MyD88-deficient and wildtype animals [33]. Furthermore, the MyD88-dependent pathway might play a more important role in aseptic inflammatory reactions, such as rheumatoid arthritis. However, the TRIF-dependent pathway might play a dominant role in the process of nerve cell degeneration induced by brain I/R [34,35]. However, in intestinal I/R injury, whether there is a dominant pathway activated by TLR4 that drives pathology has not been reported. The results of the current study demonstrate that the serum levels of inflammatory cytokines IL-6, TNF-α, and NF-κB p65 in anti-hmgb1, anti-myd88, and anti-trif groups were significantly lower than in the control group. Additionally, the degree of reduction in the anti-hmgb1 group was the most obvious (perhaps because HMGB1 has an essential role, and downstream molecules MyD88 and TRIF might have partial redundancy). However, there was a slight increase in the anti- MyD88 group compared with the anti-trif group, but this difference was not significant. Consistent changes were observed in lung and small intestinal morphology and levels of MPO activity in the liver and lung. Thus, we can make some preliminary conclusions.first, HMGB1-TLR4 plays an important function in intestinal 8321 July 21, 2015 Volume 21 Issue 27

116 Wang J et al. Signaling in ischemia/reperfusion injury A1 S C H M T B1 S C H M T HMGB NF-kB β-actin β-actin a 2.0 a HMGB1 in lung a,b a,b,c a,b,c NF-κB in lung a,b a,b,c a,b,c 0.0 S C H M T 0.0 S C H M T A2 S C H M T B2 S C H M T HMGB NF-kB β-actin β-actin HMGB1 in jejunum a a,b a,b,c a,b,c NF-κB in jejunum a a,b a,b,c a,b,c 0.0 S C H M T 0.0 S C H M T A3 S C H M T B3 S C H M T HMGB NF-kB β-actin β-actin a 1.5 HMGB1 in ileum a,b a,b,c a,b,c NF-κB in ileum a a,b a,b,c a,b,c 0.0 S C H M T 0.0 S C H M T Figure 5 Expression of HMGB1 and NF-κB in lung, jejunum, and ileum in all groups. HMGB1 expression in: Lung (A1); Jejunum (A2); and Ileum (A3); respectively, in all groups; NF-κB expression in: Lung (B1); Jejunum (B2); and Ileum (B3). S: Sham group; C: Control group; H: Anti-HMGB1 group; M: Anti-myeloid differentiation gene 88 group; T: Anti-translocating-chain-associating membrane protein group. n = 4, a P < 0.05 vs sham group; b P < 0.05 vs control group; c P < 0.05 vs anti-hmgb1 group. HMGB1: High-mobility group protein 1; NF-κB: Nuclear factor-κb July 21, 2015 Volume 21 Issue 27

117 Wang J et al. Signaling in ischemia/reperfusion injury I/R injury in mice by triggering MyD88- and TRIFdependent downstream signaling pathways.second, these two downstream signaling pathways both play important roles, but the effect of the TRIF-dependent pathway might be slightly greater.finally, the tissue damage caused by I/R was obviously alleviated by antibody administration. The NF-κB family contains important transcription factors that play critical roles in regulating the expression of groups of genes involved in immune and inflammatory responses [36]. MyD88- and TRIFdependent pathways can both activate NF-κB to induce the release of inflammatory cytokines. The results of the present study show that the mrna levels of NF-κB in the lung and ileum in the anti-hmgb1, anti-myd88, and anti-trif groups were significantly lower than those in the control group. The degrees of reduction in the anti-myd88 and anti-trif groups were lower than that in the anti-hmgb1 group. Measurements of NF-κB protein levels were in accordance with those of mrna expression. These findings further suggest that HMGB1-TLR4 is key in local and distant tissue injury induced by intestinal I/R, and that the two downstream pathways both affect protein and mrna expression. The protein and mrna levels of HMGB1 in lung and small intestine were markedly attenuated by administration of anti-hmgb1, anti-myd88, and anti- TRIF antibodies. There are several possible reasons for this finding. HMGB1 can stimulate the secretion of inflammatory factors, such as TNF-α, IL-6, IL-1β, and IL-8.In addition, inflammatory factors secreted after HMGB1 stimulation could promote monocyte/ macrophage secretion of HMGB1. Therefore, HMGB1 could form a positive feedback loop to cause inflammatory signal cascade amplification [33]. Blocking the MyD88/TIRAP and TRIF/TRAM pathways by injecting anti-myd88 and anti-trif antibodies, respectively, can partially inhibit the expression of inflammatory factors (e.g., NF-κB, IL-6, and TNF-α), and the reduction these, in some contexts, can attenuate levels of HMGB1 expression. Blocking HMGB1, MyD88 and TRIF expression by injecting anti-hmgb1, anti-myd88, or anti-trif antibodies prior to ischemia can significantly reduce the levels of inflammatory cytokines in serum, including TNF-α, IL-6 and NF-κB, and can also alleviate tissue injury in the lung and small intestine compared with the control group in the mouse intestinal I/R model. The findings presented here also suggest that the HMGB1- TLR4 axis and the two downstream signaling pathways all play important roles in I/R injury and show the potential therapeutic value of blocking these pathways. Interventions to prevent the release of HMGB1 and to block the two downstream signaling pathways could become a new clinical therapeutic method to reduce intestinal I/R injury in the future. In conclusion, HMGB1 and its downstream signaling pathways play important roles in the mouse intestinal I/R injury, and the effect of the TRIF-dependent pathway tends to be slightly larger. The administration of anti-hmgb1, anti-myd88, and anti-trif antibodies significantly reduce the damage caused by I/R, and the effect of the anti-hmgb1 antibody is the most obvious. ACKNOWLEDGMENTS We sincerely thank our technician Mr. De-Tian Wang for help with pathology and Mrs. Ya-Ling Dou for help with PCR. We also express our thanks to Zhang Rui, Jiong-Xian Yang,and Zi-Jian Li for help with the animal experiments. COMMENTS Background The intestine is an important organ with immune, endocrine, and barrier functions. Intestinal ischemia reperfusion (I/R) injury is believed to lead to systemic inflammatory response syndrome, acute lung injury, acute respiratory distress syndrome, and multiple organ dysfunction syndrome, but the specific mechanism remains controversial. The interaction of toll like receptor 4(TLR4) and high-mobility group protein1 (HMGB1) and the two downstream signaling pathways have gained attention in organ injury induced by I/R. Research frontiers Recently, studies have found that the expression of HMGB1 and TLR4 in heart, brain, liver, and kidney are increased during I/R, and the HMGB1-TLR4 axis might be the most important trigger of the inflammatory response to I/R injury in many organs. Innovations and breakthroughs Only a few studies have examined TLR4-HMGB1 axis and the downstream signaling pathway in aseptic/noninfectious I/R injury. Furthermore, whether intestinal I/R induces local and distant organ injury via these pathways has been poorly characterized. This study aimed to determine whether administering an HMGB1 antibody could reduce tissue damage induced by intestinal I/R and to characterize the role of the HMGB1-TLR4 axis in I/R injury by administrating an anti-hmgb1 antibody. Additionally, to further investigate the myeloid differentiation gene 88(MyD88)/TIR domain-containing adaptor protein- and TIR domain-containing adaptor inducing interferon (IFN)-β/translocating-chainassociating membrane protein-dependent pathways, the authors went on to characterize whether one pathway serves a dominant function in inducing a systemic inflammatory response and distant organ injury following intestinal I/R. Applications The study results suggest that interventions to prevent the release of HMGB1 and to block the two downstream signaling pathways could become a new clinical therapeutic method to reduce intestinal I/R injury in the future. Furthermore, it has an important clinical significance that could improve the survival rate and reduce complications in critically ill patients. Terminology Intestinal I/R injury is associated with severe trauma, acute necrotizing pancreatitis, major surgery, extensive burns, and other stresses.hmgb1 is one of the endogenous ligands which can be recognized by and combine with TLR4, and is also the key factor of inflammation of aseptic injury. The MyD88- dependent pathway is the downstream signaling pathway of TLR4-HMGB1 axis in I/R injury and causes the release of various inflammatory factors, through the activation of nuclear factor-κb.the TIR domain-containing adaptor inducing IFN-β-dependent pathway is the other downstream signaling pathway of TLR4-HMGB1 axis in I/R injury and mainly depends on the activation of IFN regulatory factor 3, followed by the expression of IFN-β and IFN-induced genes (such as IP-10) and the activation of transcription factors (NF-κB). Peer-review This is a good descriptive study in which authors show that HMGB1 and its downstream signaling pathways play important roles in the mouse intestinal I/R injury. The results are interesting and suggest that interventions to prevent the release of HMGB1 and to block the two downstream signaling pathways could become a new clinical therapeutic method to reduce intestinal I/R injury in the 8323 July 21, 2015 Volume 21 Issue 27

118 Wang J et al. Signaling in ischemia/reperfusion injury future. REFERENCES 1 Elias-Miró M, Jiménez-Castro MB, Rodés J, Peralta C. Current knowledge on oxidative stress in hepatic ischemia/reperfusion. Free Radic Res 2013; 47: [PMID: DOI: / ] 2 Liao YF, Zhu W, Li DP, Zhu X. Heme oxygenase-1 and gut ischemia/reperfusion injury: A short review. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19. i ] 3 Kougias P, Lau D, El Sayed HF, Zhou W, Huynh TT, Lin PH. Determinants of mortality and treatment outcome following surgical interventions for acute mesenteric ischemia. J Vasc Surg 2007; 46: [PMID: DOI: / j.jvs ] 4 Slone EA, Fleming SD. Membrane lipid interactions in intestinal ischemia/reperfusion-induced Injury. Clin Immunol 2014; 153: [PMID: DOI: /j.clim ] 5 Ding HS, Yang J, Chen P, Yang J, Bo SQ, Ding JW, Yu QQ. The HMGB1-TLR4 axis contributes to myocardial ischemia/reperfusion injury via regulation of cardiomyocyte apoptosis. Gene 2013; 527: [PMID: DOI: /j.gene ] 6 Yang Z, Deng Y, Su D, Tian J, Gao Y, He Z, Wang X. TLR4 as receptor for HMGB1-mediated acute lung injury after liver ischemia/reperfusion injury. Lab Invest 2013; 93: [PMID: DOI: /labinvest ] 7 Sánchez-Miralles A, Castellanos G, Badenes R, Conejero R. [Abdominal compartment syndrome and acute intestinal distress syndrome]. Med Intensiva 2013; 37: [PMID: DOI: /j.medin ] 8 Guzel A, Kanter M, Guzel A, Yucel AF, Erboga M. Protective effect of curcumin on acute lung injury induced by intestinal ischaemia/reperfusion. Toxicol Ind Health 2013; 29: [PMID: DOI: / ] 9 Reino DC, Pisarenko V, Palange D, Doucet D, Bonitz RP, Lu Q, Colorado I, Sheth SU, Chandler B, Kannan KB, Ramanathan M, Xu da Z, Deitch EA, Feinman R. Trauma hemorrhagic shock-induced lung injury involves a gut-lymph-induced TLR4 pathway in mice. PLoS One 2011; 6: e14829 [PMID: DOI: / journal.pone ] 10 Moresco EM, LaVine D, Beutler B. Toll-like receptors. Curr Biol 2011; 21: R488-R493 [PMID: DOI: / j.cub ] 11 O Neill LA, Bowie AG. The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nat Rev Immunol 2007; 7: [PMID: DOI: /nri2079] 12 Kojima M, Tanabe M, Shinoda M, Yamada S, Miyasho T, Suda K, Hibi T, Obara H, Itano O, Kawachi S, Kitajima M, Maruyama I, Kitagawa Y. Role of high mobility group box chromosomal protein 1 in ischemia-reperfusion injury in the rat small intestine. J Surg Res 2012; 178: [PMID: DOI: / j.jss ] 13 Sawa H, Ueda T, Takeyama Y, Yasuda T, Shinzeki M, Nakajima T, Kuroda Y. Blockade of high mobility group box-1 protein attenuates experimental severe acute pancreatitis. World J Gastroenterol 2006; 12: [PMID: DOI: /wjg.v12.i ] 14 Kim DH, Chung JH, Son BS, Kim YJ, Lee SG. Effect of a neutrophil elastase inhibitor on ventilator-induced lung injury in rats. J Thorac Dis 2014; 6: [PMID: DOI: /j.issn ] 15 Stallion A, Kou TD, Latifi SQ, Miller KA, Dahms BB, Dudgeon DL, Levine AD. Ischemia/reperfusion: a clinically relevant model of intestinal injury yielding systemic inflammation. J Pediatr Surg 2005; 40: [PMID: DOI: / j.jpedsurg ] 16 Merry HE, Phelan P, Doak MR, Zhao M, Hwang B, Mulligan MS. Role of toll-like receptor-4 in lung ischemia-reperfusion injury. Ann Thorac Surg 2015; 99: [PMID: DOI: /j.athoracsur ] 17 Yapca OE, Borekci B, Turan MI, Gulapoglu M. The effect of agomelatine on oxidative stress induced with ischemia/reperfusion in rat ovaries. Adv Clin Exp Med 2014; 23: [PMID: ] 18 Wu K, Li H, Tian J, Lei W. Protective effect of baicalein on renal ischemia/reperfusion injury in the rat. Ren Fail 2015; 37: [PMID: DOI: / X ] 19 Quesnelle KM, Bystrom PV, Toledo-Pereyra LH. Molecular responses to ischemia and reperfusion in the liver. Arch Toxicol 2015; 89: [PMID: ] 20 He GZ, Zhou KG, Zhang R, Wang YK, Chen XF. Impact of intestinal ischemia/reperfusion and lymph drainage on distant organs in rats. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 21 Zhang YX, Zhang JR, Wang ZG. Mycophenolate mofetil affects monocyte Toll-like receptor 4 signaling during mouse renal ischemia/reperfusion injury. Chin Med J (Engl) 2013; 126: [PMID: DOI: /cma.j.issn ] 22 Zhang J, Wu Y, Weng Z, Zhou T, Feng T, Lin Y. Glycyrrhizin protects brain against ischemia-reperfusion injury in mice through HMGB1-TLR4-IL-17A signaling pathway. Brain Res 2014; 1582: [PMID: DOI: /j.brainres ] 23 Hu X, Zhang K, Xu C, Chen Z, Jiang H. Anti-inflammatory effect of sodium butyrate preconditioning during myocardial ischemia/ reperfusion. Exp Ther Med 2014; 8: [PMID: DOI: /etm ] 24 Li XQ, Lv HW, Tan WF, Fang B, Wang H, Ma H. Role of the TLR4 pathway in blood-spinal cord barrier dysfunction during the bimodal stage after ischemia/reperfusion injury in rats. J Neuroinflammation 2014; 11: 62 [PMID: DOI: / ] 25 Cotroneo TM, Nemzek-Hamlin JA, Bayliss J, Su GL. Lipopolysaccharide binding protein inhibitory peptide alters hepatic inflammatory response post-hemorrhagic shock. Innate Immun 2012; 18: [PMID: DOI: / ] 26 Szatmary Z. Molecular biology of toll-like receptors. Gen Physiol Biophys 2012; 31: [PMID: DOI: / gpb_2012_048] 27 Fan J, Li Y, Levy RM, Fan JJ, Hackam DJ, Vodovotz Y, Yang H, Tracey KJ, Billiar TR, Wilson MA. Hemorrhagic shock induces NAD(P)H oxidase activation in neutrophils: role of HMGB1-TLR4 signaling. J Immunol 2007; 178: [PMID: DOI: /jimmunol ] 28 Tsung A, Tohme S, Billiar TR. High-mobility group box-1 in sterile inflammation. J Intern Med 2014; 276: [PMID: DOI: /joim.12276] 29 Levy RM, Mollen KP, Prince JM, Kaczorowski DJ, Vallabhaneni R, Liu S, Tracey KJ, Lotze MT, Hackam DJ, Fink MP, Vodovotz Y, Billiar TR. Systemic inflammation and remote organ injury following trauma require HMGB1. Am J Physiol Regul Integr Comp Physiol 2007; 293: R1538-R1544 [PMID: DOI: /ajpregu ] 30 Doi K, Ishizu T, Tsukamoto-Sumida M, Hiruma T, Yamashita T, Ogasawara E, Hamasaki Y, Yahagi N, Nangaku M, Noiri E. The high-mobility group protein B1-Toll-like receptor 4 pathway contributes to the acute lung injury induced by bilateral nephrectomy. Kidney Int 2014; 86: [PMID: DOI: /ki ] 31 Ding HS, Yang J, Gong FL, Yang J, Ding JW, Li S, Jiang YR. High mobility group [corrected] box 1 mediates neutrophil recruitment in myocardial ischemia-reperfusion injury through toll like receptor 4-related pathway. Gene 2012; 509: [PMID: DOI: /j.gene ] 32 Zhao H, Perez JS, Lu K, George AJ, Ma D. Role of Toll-like receptor-4 in renal graft ischemia-reperfusion injury. Am J Physiol Renal Physiol 2014; 306: F801-F811 [PMID: DOI: /ajprenal ] 33 Lu YC, Yeh WC, Ohashi PS. LPS/TLR4 signal transduction 8324 July 21, 2015 Volume 21 Issue 27

119 Wang J et al. Signaling in ischemia/reperfusion injury pathway. Cytokine 2008; 42: [PMID: DOI: /j.cyto ] 34 Hosmane S, Tegenge MA, Rajbhandari L, Uapinyoying P, Kumar NG, Thakor N, Venkatesan A. Toll/interleukin-1 receptor domain-containing adapter inducing interferon-β mediates microglial phagocytosis of degenerating axons. J Neurosci 2012; 32: [PMID: DOI: / JNEUROSCI ] 35 Kawamoto T, Ii M, Kitazaki T, Iizawa Y, Kimura H. TAK-242 selectively suppresses Toll-like receptor 4-signaling mediated by the intracellular domain. Eur J Pharmacol 2008; 584: [PMID: DOI: /j.ejphar ] 36 Shi Z, Lian A, Zhang F. Nuclear factor-κb activation inhibitor attenuates ischemia reperfusion injury and inhibits Hmgb1 expression. Inflamm Res 2014; 63: [PMID: DOI: /s x] P- Reviewer: Hei ZQ, Liu QL, Senturk GE, Yu LCH S- Editor: Yu J L- Editor: AmEditor E- Editor: Liu XM 8325 July 21, 2015 Volume 21 Issue 27

120 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Basic Study ORIGINAL ARTICLE Givinostat inhibition of hepatic stellate cell proliferation and protein acetylation Yu-Gang Wang, Ling Xu, Ting Wang, Jue Wei, Wen-Ying Meng, Na Wang, Min Shi Yu-Gang Wang, Ling Xu, Ting Wang, Jue Wei, Wen-Ying Meng, Na Wang, Min Shi, Department of Gastroenterology, Shanghai Tongren Hospital, Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai , China Author contributions: Wang YG, Shi M, and Xu L designed the study; Wang YG, Wang N, Shi M, Wei J, Xu L, and Wang T carried out the study; Wang N, Shi M, Wei J, and Wang T contributed new reagents/analytic tools; Wei J, Wang YG, and Meng WY analyzed the data; and Shi M and Wang YG wrote the paper. Supported by Shanghai Municipal Health Bureau Key Disciplines Grant, No. ZK2012A05; bootstrap class project Foundation of the Science and Technology Commission of Shanghai Municipality, No ; and Shanghai Municipal Health Bureau, No Institutional review board statement: In vivo experiments were approved by the Shanghai Tongren Hospital affiliated to Shanghai Jiao Tong University School of Medicine Ethics Committee. Institutional animal care and use committee statement: In vivo experiments were approved by the Shanghai Tongren Hospital affiliated to Shanghai Jiao Tong University School of Medicine Institutional animal care and use committee. Conflict-of-interest statement: The authors declare no conflicts of interest. Data sharing statement: No additional unpublished data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Min Shi, MD, PhD, Professor, Department of Gastroenterology, Shanghai Tongren Hospital, Affiliated to Shanghai Jiao Tong University School of Medicine, 1111 Xianxia Street, Shanghai , China. shimingdyx@yeah.net Telephone: Fax: Received: January 19, 2015 Peer-review started: January 20, 2015 First decision: February 26, 2015 Revised: March 2, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract AIM: To explore the effect of the histone deacetylase inhibitor givinostat on proteins related to regulation of hepatic stellate cell proliferation. METHODS: The cell counting kit-8 assay and flow cytometry were used to observe changes in proliferation, apoptosis, and cell cycle in hepatic stellate cells treated with givinostat. Western blot was used to observe expression changes in p21, p57, CDK4, CDK6, cyclind1, caspase-3, and caspase-9 in hepatic stellate cells exposed to givinostat. The scratch assay was used to analyze the effect of givinostat on cell migration. Effects of givinostat on the reactive oxygen species profile, mitochondrial membrane potential, and mitochondrial permeability transition pore opening in JS-1 cells were observed by laser confocal microscopy. RESULTS: Givinostat significantly inhibited JS-1 cell proliferation and promoted cell apoptosis, leading to cell cycle arrest in G0/G1 phases. Treatment with givinostat downregulated protein expression of CDK4, CDK6, and cyclin D1, whereas expression of p21 and p57 was significantly increased. The givinostat-induced apoptosis of hepatic stellate cells was mainly mediated 8326 July 21, 2015 Volume 21 Issue 27

121 Wang YG et al. Mechanisms of givinostat against liver fibrosis through p38 and extracellular signal-regulated kinase 1/2. Givinostat treatment increased intracellular reactive oxygen species production, decreased mitochondrial membrane potential, and promoted mitochondrial permeability transition pore opening. Acetylation of superoxide dismutase (acetyl K68) and nuclear factorκb p65 (acetyl K310) was upregulated, while there was no change in protein expression. Moreover, the notable beneficial effect of givinostat on liver fibrosis was also confirmed in the mouse models. CONCLUSION: Givinostat has antifibrotic activities via regulating the acetylation of nuclear factor-κb and superoxide dismutase 2, thus inhibiting hepatic stellate cell proliferation and inducing apoptosis. Key words: Givinostat; Hepatic stellate cells; Histone deacetylase inhibitor; Nuclear factor-κb; Superoxide dismutase The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: There is currently no effective therapeutic treatment for liver fibrosis. Inhibition of hepatic stellate cell activation and proliferation or induction of apoptosis is the mainstream strategy for the treatment of liver fibrosis. This study demonstrates that a histone deacetylase inhibitor, givinostat, has antifibrotic activities both in vivo and in vitro, which might be achieved by regulating the acetylation of nuclear factor-κb and superoxide dismutase, thus stimulating oxidative stress, activating mitochondrial pathways, inhibiting hepatic stellate cell proliferation, and inducing apoptosis. These results may provide new directions and evidence in the research and development of novel drugs for liver fibrosis. Wang YG, Xu L, Wang T, Wei J, Meng WY, Wang N, Shi M. Givinostat inhibition of hepatic stellate cell proliferation and protein acetylation. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8326.htm DOI: org/ /wjg.v21.i INTRODUCTION Liver fibrosis is a major cause of morbidity and mortality worldwide due to chronic viral hepatitis and, more recently, from fatty liver disease associated with obesity [1]. Activation of hepatic stellate cells (HSCs) is the central event in liver fibrosis and often serves as a trigger [1,2]. HSCs are activated and transdifferentiated into myofibroblasts in event of hepatic injury. The main changes include proliferation, migration, and enhanced contractility, as well as synthesis of large amounts of cytokines and extracellular matrix [3-5]. Persistent injury can cause chronic inflammation, resulting in replacement of liver parenchymal cells by scar tissue. Moreover, long-term fibrotic reaction leads to endstage liver disease, cirrhosis, and hepatocellular carcinoma. In fact, the incidence of hepatocellular carcinoma has steadily increased worldwide. Thus, in addition to management of the causes of disease, inhibition of HSC activation and proliferation, as well as induction of apoptosis, has been the mainstream strategy for the treatment of liver fibrosis. HSC activation after stimulation is recognized as a process involving multiple cytokines and is coregulated by various cell-signaling pathways at different levels [6,7]. Although no well-established medication or regimen has been available for the treatment of liver fibrosis, an increasing number of molecularly targeted drugs have promising efficacy [8]. Recent studies [9-11] have shown that protein acetylation plays an important role during HSC activation; imbalanced histone acetylation due to histone deacetylase (HDAC) overexpression is closely associated with the occurrence and development of liver fibrosis [9]. The HDAC inhibitors trichostatin A [10] and valproic acid [9] can prevent the transdifferentiation of static HSCs into myofibroblasts and suppress α-smooth muscle actin (SMA) and collagen Ⅰ gene expression in vitro. As a novel hydroxamate-derived HDAC inhibitor [12], givinostat (also known as ITF2357) is characterized by its significant targeted anticancer activities and low toxicity profiles [13-15]. Moreover, givinostat has anti-inflammatory activity and can suppress lipopolysaccharide (LPS)-induced cytokines such as tumor necrosis factor-α, interleukin-1 and -6, and interferon [16-18]. The phase Ⅱ clinical trials on the roles of givinostat in treating juvenile idiopathic arthritis, Hodgkin s lymphoma, and polycythemia vera were finished in In the current study, the antifibrotic activities of givinostat were assessed both in vivo and in vitro to understand the mechanism of liver fibrosis and to provide new directions and evidence for novel drug development. MATERIALS AND METHODS Reagents The murine HSC line JS-1 was provided courtesy of Xu Lieming from Shanghai University of Traditional Chinese Medicine. Givinostat was purchased from Selleck (Houston, TX, United States). The following were purchased from Thermo Fisher Scientific (Waltham, MA, United States): Ham s F12 medium, Dulbecco s Modified Eagle s medium (DMEM), trypsin- EDTA solution, fetal bovine serum, and the Pierce BCA Protein Assay Kit. The Cell Counting Kit-8 (CCK-8) was purchased from Dojindo (Kumamoto, Japan). JC-1 staining solution, 2,7 -dichlorofluorescein diacetate (DCFH-DA), calcein-am, and CoCl2 were 8327 July 21, 2015 Volume 21 Issue 27

122 Wang YG et al. Mechanisms of givinostat against liver fibrosis obtained from Sigma-Aldrich (St. Louis, MO, United States). The Annexin V-FITC Apoptosis Detection Kit and FACSCalibur Flow Cytometer were purchased from BD Pharmingen (San Diego, CA, United States), and Amersham ECL plus Western Blotting Detection System was purchased from GE (Little Chalfont, United Kingdom. The confocal laser-scanning microscope used was the FluoView FV1200 from Olympus (Tokyo, Japan). Other reagents were from Abcam (Cambridge, United Kingdom). CCK-8 assay After the JS-1 cell line was cultured in DMEM with 10% fetal bovine serum for 24 h, 30 wells of JS-1 cells were divided into two groups. In the first group, the culture medium was replaced by complete medium with final givinostat concentrations of 0 nmol/l, 125 nmol/l, 250 nmol/l, 500 nmol/l, and 1000 nmol/l. In the second group, givinostat of relevant concentrations was added concomitantly with 100 nmol/l of LPS solution. Three replicates were performed for each group. After inoculation at 37 and 5% CO2 for 24 h, each well (100 µl) was incubated with 10 µl of CCK-8 solution. The plates were incubated at 37 for 1 h and the absorbance was measured at 450 nm using a microplate reader. Detection of apoptosis and cell cycle by flow cytometry The JS-1 cells were inoculated in 10 ml complete medium in three 100-mm culture dishes ( cells/well). After incubation for 24 h, the medium was changed to complete medium with final concentrations of 0 nmol/l, 125 nmol/l, and 250 nmol/l givinostat if normal cell growth was observed. Following incubation for another 48 h, the cells were harvested and treated thoroughly with the appropriate amount of tryptic digestion to afford a single-cell suspension. Then, resuspended cells were collected and centrifuged at 1000 rpm for 5 min. The supernatant was discarded. The residue was resuspended with 100 µl Annexin V binding buffer, and then transferred into a 5-mL culture tube. Then, 5 µl Annexin V-FITC and propidium iodide (PI) was added, and the mixture was incubated at in darkness for 15 min. Next, 400 µl of Annexin V binding buffer was added immediately before flow cytometry. The Annexin V-FITC showed green fluorescence, while PI showed red fluorescence. Flow cytometry with 488-nm laser excitation was used. The FITC fluorescein was detected using a 515-nm long-pass filter, and the PI fluorescein was detected using a filter at a wavelength > 560 nm. Moreover, after treatment with 1 ml of prechilled 70% ethanol for cell immobilization, the cell pellet was washed and centrifuged twice in 0.5 ml PBS containing 50 µg/ml PI. The cells were resuspended with 100 µg/ml RNase A, and then inoculated in the dark at 37 for 30 min before the flow cytometer was used to determine the cell cycles. Western blotting The JS-1 cells were inoculated in 100-mm culture dishes containing complete medium ( cells/ well). After 24 h, the cells in one dish were treated with tryptic digestion and harvested as the 0-h sample if normal cell growth was observed. The other four dishes were incubated with complete medium containing a final concentration of 250 nmol/l givinostat. After the culture medium was replaced by serum-free culture medium, the mixtures were inoculated for 12 h using the above described method. Two dishes were incubated with givinostat (final concentration: nmol/l), and the resultant mixtures were incubated for 1 h before addition of LPS (final concentration: 100 ng/ml). One of the other two dishes was incubated with LPS (final concentration: 100 ng/ml), and the cells were harvested after 15 min. All preparations were subjected to Western blotting. The preparation was incubated in a 37 /5% CO2 incubator for 48 h, treated with tryptic digestion to harvest the cells, and then washed twice with PBS. The mixture was centrifuged to remove the supernatant, and the collected cells were placed on ice before lysis. The proteins were quantified using the BCA method. SDS-PAGE, membrane transfer, immunoreactions, development, and gel electrophoresis image analysis was performed for the target genes. Determination of the effect of givinostat on cell migration by scratch assay JS-1 cells were inoculated on a 12-well plate ( cells/well) and then incubated in a 37 /5% CO2 incubator. After incubation for 24 h, if the cell morphology was normal, a single-cell suspension was prepared and scratches were made using the tip of a 200-µL pipette tip. Complete medium containing serum was replaced by serum-free DMEM. The cells were pretreated with 100 nmol/l givinostat for 2 h, and LPS solution (100 ng/ml) was added for the cell migration assay. The preparation was incubated for another 24 h before analysis. Laser confocal microscopy Detection of reactive oxygen species (ROS) using fluorescent probe DCFH-DA: JS-1 cells were inoculated in two 20-mm Falcon confocal dishes containing 2 ml of relevant complete medium ( cells/dish). After 24 h, if normal cell growth was observed, the medium was removed and 1 ml of diluted DCFH-DA was added. The preparation was incubated in a 37 incubator for 15 min and washed three times with serum-free medium. Then, 2 ml of complete medium containing givinostat (0 nmol/l or 500 nmol/l final concentration) was added to these two dishes, which were then incubated in a 37 /5% CO2 incubator for 30 min. Under an excitation wavelength of 488 nm and an emission wavelength of 525 nm, the fluorescence intensity of the two dishes 8328 July 21, 2015 Volume 21 Issue 27

123 Wang YG et al. Mechanisms of givinostat against liver fibrosis was determined at time intervals of 0 min, 10 min, 20 min, and 30 min using a laser confocal microscope. Detection of mitochondrial membrane potential using the JC-1 method: Reference ROS were prepared before the assay. Then, 2 ml of complete medium containing givinostat (final concentrations: 0 nmol/l, 250 nmol/l, 500 nmol/l, or 1000 nmol/l) was added to each of the four dishes. The mixture was incubated for another 2 h, washed, 1 ml of JC-1 staining solution (final concentration: 2 µg/ml) was added, and the mixture was incubated at 37 for 20 min. The supernatant was discarded and the residue was washed twice. After 2 ml of DMEM complete medium was added, red and green fluorescence was detected through the Cy3 and FITC channels, respectively, and photographed within 20 min using a laser confocal microscope. Detection of mitochondrial permeability transition pore (mptp) opening by coloading with calcein-am and CoCl2: Reference ROS were prepared before the assay. After the cells were washed with serum-free DMEM medium once, 1 ml of serumfree DMEM staining solution containing calcein- AM (final concentration: 1 µmol/l) and CoCl2 (final concentration: 5 mmol/l) was added before incubation at 37 for 15 min. The supernatant was discarded and the residue was washed twice. Two dishes were incubated with 2 ml of CoCl2 (final concentration: 5 mmol/l), followed by complete medium containing 0 nmol/or 500 L givinostat. The green fluorescence was examined using the FITC channel using a laser confocal microscope. The fluorescence intensities of two dishes were determined at 0 min, 10 min, 20 min, and 30 min. The fluorescence intensity of the regions of interest randomly selected from multiple intracellular mitochondria were analyzed by Image J to quantitate any mptp opening events. Establishment of animal models Fifty 5-wk-old specific-pathogen-free Balb/C male mice weighing 20 ± 5 g were supplied by Shanghai Experimental Animal Center, Chinese Academy of Sciences [License No.: SCXK (Shanghai) ]. They were randomly divided into three groups: control group (n = 10), liver fibrosis group (n = 20), and givinostat treatment group (n = 20). In the control group, mice were fed a normal diet and administered saline (i.p., amounts equivalent to other groups) every 3 d. In the liver fibrosis group, mice were fed a highfat diet containing 0.5% cholesterol and received i.p. administration of the working solution prepared from four portions of CCl4 and six of olive oil and sacrificed to harvest the liver tissues. In the givinostat treatment group, mice were fed a high-fat diet containing 0.5% cholesterol and received ip administration of the working solution prepared from four portions of CCl4 and six of olive oil (at a dose of 3 ml/kg CCl4), and givinostat (5 mg/kg) was administered by gavage (0.1 ml) on the next day until week 5, when the mice were sacrificed to harvest liver tissues. For liver histopathologic examination, the liver tissues were fixed in formalin, embedded in paraffin, and thin sections were stained with the Masson s Trichrome Stain Kit. Damage to liver cells and deposition of collagen fibers were observed under a light microscope. Collagen fibers, muscle fibers, and red blood cells were stained green, red and orange, respectively. In vivo experiments were approved by the Shanghai Tongren Hospital affiliated to Shanghai Jiao Tong University School of Medicine Ethics Committee. Statistical analysis The data were analyzed with SPSS version 13.0 statistical software (SPSS Inc., Chicago, IL, United States), and expressed as mean ± SD. Multiple groups were analyzed with one-way analysis of variance, pairwise comparison was conducted using a least significant difference t-test, and different groups were compared using a t-test. P < 0.05 was considered statistically significant. RESULTS Suppressive effects of givinostat on proliferation and migration of JS-1 cells As shown by the CCK-8 assay, givinostat inhibited JS-1 cell proliferation in a concentration-dependent manner. The cell suppression rates markedly differed after treatment with givinostat at different concentrations (ranging from 0 nmol/l to 1000 nmol/l) (Figure 1A). Treatment with givinostat 500 nmol/l was associated with significant inhibition of JS-1 cell proliferation (P < 0.01). Also, the cell inhibition rate significantly differed between the group cotreated with givinostat 250 nmol/l plus LPS and the group without LPS treatment (same givinostat concentration) (P < 0.05). As demonstrated by scratch assay (Figure 1B), the area of cell migration was significantly reduced in JS-1 cells cotreated with givinostat plus LPS in comparison to the controls (P < 0.05), suggesting givinostat treatment markedly decreased LPS-activated JS-1 cell migration. Western blotting showed that the protein expression of α-sma, transforming growth factor β 1, and vascular endothelial growth factor in JS-1 cells significantly decreased 24 h and 48 h after givinostat treatment (all P < 0.05) (Figure 1C). Effects of givinostat on apoptosis and cell cycle of JS-1 cells In the bivariate scatter plots of flow cytometry, after treatment with givinostat (concentration gradient: 0 nmol/l, 125 nmol/l, and 250 nmol/l), the numbers of apoptotic and necrotic JS-1 cells markedly increased, suggesting givinostat induced JS-1 cell apoptosis 8329 July 21, 2015 Volume 21 Issue 27

124 Wang YG et al. Mechanisms of givinostat against liver fibrosis A 1.2 Cell viability (fold of control) LPS (100 ng/ml) Givinostat (nmol/l) B 24 h 0 h LPS (100 ng/ml) Givinostat (nmol/l) C Time (h) Givinostat a-sma TGF-b1 VEGF b-actin 8330 July 21, 2015 Volume 21 Issue 27

125 Wang YG et al. Mechanisms of givinostat against liver fibrosis 1.5 a-sma TGF-b1 Relative expression of proteins a a a b a VEGF b 0.0 Time (h) Givinostat Figure 1 Effects of givinostat in suppressing proliferation and migration of JS-1 cells. A: Givinostat inhibits JS-1 cell proliferation in a concentration-dependent manner. The cell inhibition rate significantly differed between the group cotreated with givinostat 250 nmol/l plus lipopolysaccharide (LPS) and the group without LPS treatment (same givinostat concentration) (P < 0.05); B: The cell migration area significantly decreased in the group cotreated with givinostat plus LPS (P < 0.05); C: Compared with the control group, treatment with givinostat for 24 h or 48 h significantly suppressed expression of a-smooth muscle actin (SMA), transforming growth factor (TGF)-b1 and Vascular endothelial growth factor (VEGF). a P < 0.05, b P < 0.01 vs control group. in a concentration-dependent manner (Figure 2A). According to the cell cycle plot of flow cytometry, the JS-1 cells were arrested at the G0/G1 phase after givinostat treatment (Figure 2A). Western blotting showed that prolonged givinostat treatment was significantly associated with decreased protein expression of cyclin-dependent kinase (CDK)4, CDK 6, and cyclin D1, and with increased expression of p21 and p57 (compared with the untreated group) (all P < 0.05) (Figure 2B). As shown by Western blotting, givinostat activated caspase-3 and caspase-9 in JS-1 cells in a concentration-dependent manner (Figure 2C), without causing any changes in the precursors of these two proteins. Effects of givinostat on the ROS profile, mitochondrial membrane potential, and mptp opening in JS-1 cells The effects of givinostat treatment on the ROS profile of JS-1 cells were examined using laser confocal microscopy (Figure 3A). As shown by the green fluorescence that represented intracellular ROS, givinostat treatment markedly increased ROS production. Changes in mitochondrial membrane potential were examined using JC-1 as the fluorescent probe and laser confocal microscopy (Figure 3B), with green and red fluorescence denoting low and high membrane potentials, respectively. It was found that givinostat treatment induced a concentrationdependent decrease in mitochondrial membrane potential. The mptp opening was detected by coloading with calcein-am and CoCl2 (Figure 3C). The mitochondria of normal JS-1 cells had intense green fluorescence, with a granular appearance. In the givinostat treatment group, however, there was considerable mptp opening, along with decreased intensity of fluorescence in comparison to that of the control group. Changes in histone acetylation and regulation of LPSactivated mitogen-activated protein kinase signaling in givinostat-treated JS-1 cells The effects of givinostat on the post-translational modifications of superoxide dismutase (SOD)2, p53, nuclear factor (NF)-κB, and p65 were analyzed by Western blotting (Figure 4A), which showed that SOD2 (acetyl K68) acetylation was upregulated, while the expression profile of SOD2 protein showed no significant change. Acetylation of NF-κB p65 (acetyl K310) was upregulated, while its protein expression showed no significant change. There were no obvious changes in the expression profiles of p53, p53 (acetyl K382), and p53 (acetyl K120). Change in the mitogen-activated protein kinase (MAPK) signaling-pathway-related protein expression was examined after givinostat treatment of LPSactivated JS-1 cells, which showed that expression of extracellular signal-regulated kinase (ERK)1/2, phosphorylated ERK1/2, p38, and phosphorylated p38 increased following LPS activation; givinostat suppressed LPS-induced upregulation of ERK1/2 and phosphorylated p38 in a time-dependent manner, but showed no effect on the expression of C-Jun N-terminal kinase (JNK)1/2 and phosphorylated JNK1/2 (Figure 4B). Pathologic changes of liver tissue in mouse models of liver fibrosis induced by givinostat treatment The hepatic lobules of healthy mice were clear in structure, with only a small amount of collagen deposited in the portal area. In the mouse models of liver fibrosis induced by CCl4 treatment, however, liver cell degeneration was concomitant with a large amount of collagen deposition in the portal area. Some of them exhibited fiber spacing, with visible pseudolobules. In contrast, the givinostat treatment group had markedly 8331 July 21, 2015 Volume 21 Issue 27

126 Wang YG et al. Mechanisms of givinostat against liver fibrosis A PE-Texas Red-A PE-Texas Red-A PE-Texas Red-A FITC-A FITC-A FITC-A Givinostat (nmol/l) Non affected cells Early apoptosis The cell percent (%) b a a b b b Later apoptosis Necrosis a 0 Givinostat (nmol/l) Cells Cells Cells FL2-A FL2-A FL2-A Givinostat (nmol/l) G1/G0 Cell cycle distribution (%) b b a b b S G2/M b 0 Givinostat (nmol/l) July 21, 2015 Volume 21 Issue 27

127 Wang YG et al. Mechanisms of givinostat against liver fibrosis B Time (h) Givinostat CDK4 CDK4 CDK6 Cyclin D1 P21 Relative expression of proteins 2 1 CDK6 CyclinD1 P21 P57 b a a b b a b b b b a b b P57 0 b-actin Time (h) Givinostat C 2.5 Cleaved-caspase-9/Pro-caspase-9 Time (h) Cleaved-caspase-3/Pro-caspase-3 b Givinostat Pro-caspase-9 Cleaved-caspase-9 Pro-caspase-3 Cleaved-caspase Relative expression of proteins b a b b-actin 0.0 Time (h) Givinostat Figure 2 Effects of givinostat on apoptosis and cell cycle of JS-1 cells. A: Flow cytometry shows that the givinostat treatment induces JS-1 cell apoptosis in a concentration-dependent manner. The numbers of apoptotic and necrotic cells progressively increased when the concentration of givinostat increased; B: Givinostat arrested the JS-1 cells at G0/G1 phase; C: Givinostat activated caspase-3 and caspase-9 in JS-1 cells without causing changes in the precursors of these two proteins. a P < 0.05, b P < 0.01 vs the control group. less collagen deposition and improved fibrosis. Collagen area percent was significantly reduced in givinostat group compared to the model group (p < 0.01) (Figure 5). DISCUSSION As demonstrated in the current study, givinostat, an HDAC inhibitor, has marked antifibrotic activity. In the in vitro experiment, givinostat markedly suppressed proliferation of HSCs (JS-1 cell line), and such an inhibitory effect was even more obvious among LPSactivated HSCs. Givinostat induced apoptosis of mouse HSCs and arrested these cells at G0/G1 phase. The protein expression profiles of α-sma, transforming growth factor β 1, and vascular endothelial growth factor in HSCs significantly decreased after givinostat treatment. Moreover, the notable beneficial effect of givinostat on liver fibrosis was also confirmed in the mouse models. Further study on the G0/G1 arrest suggested that such an effect was achieved by regulating the expression of some cell-cycle-related proteins. Givinostat downregulated protein expression of CDK4, CDK6, and cyclin D1, whereas expression of p21 and p57 was significantly increased. These findings are consistent with the results of previous HDACinhibitor-related studies [19-22]. For the induction of mouse HSC apoptosis, givinostat activates caspase-3 and caspase-9 in JS-1 cells, which is consistent with previous studies [23-25]. As suggested by laser confocal microscopy in the current study, givinostat treatment increased intracellular ROS production, decreased mitochondrial membrane potential, and promoted mptp opening. Moreover, mptp opening promotes the uncoupling between mitochondrial electron transport chain and oxidative phosphorylation, decreases membrane potential, reduces ATP production and 8333 July 21, 2015 Volume 21 Issue 27

128 Wang YG et al. Mechanisms of givinostat against liver fibrosis A Givinostat (500 nmol/l) Givinostat (0 nmol/l) 200 μm 200 μm 200 μm 200 μm 200 μm 200 μm 200 μm 200 μm Time (min) B Green Red 200 μm 200 μm Givinostat (nmol/l) C Givinostat (0 nmol/l) Merge 20 μm 20 μm 20 μm 20 μm 8334 July 21, 2015 Volume 21 Issue 27

129 Wang YG et al. Mechanisms of givinostat against liver fibrosis Givinostat (500 nmol/l) mptp Merge 20 μm 20 μm 20 μm 20 μm Hoechst 20 μm 20 μm Time (min) Figure 3 Effects of givinostat on the reactive oxygen species profile, mitochondrial membrane potential, and mitochondrial permeability transition pore opening in JS-1 cells. A: Effects of givinostat on reactive oxygen species (ROS) in JS-1 cells were determined by 2,7 -dichlorofluorescein diacetate. Green fluorescence represents the intracellular ROS. Givinostat significantly increased ROS production, in particular at 30 min (P < 0.01); B: Mitochondrial membrane potential was detected using the fluorescent probe JC-1. The green and red fluorescence represented the low and high membrane potentials, respectively. Givinostat reduced mitochondrial membrane potential in a concentration-dependent manner, particularly at 1000 nmol/l (P < 0.01); C: The mitochondrial permeability transition pore (mptp) opening was detected by coloading with calcein-am and CoCl2. In the givinostat treatment group, considerable mptp opening was observed, along with decreased intensity of fluorescence in comparison to that of the control group. A Time (h) Givinostat SOD2(K68) SOD2 P53(K120) P53(K382) Relative expression of proteins SOD2(K68)/SOD2 P53(K120)/P53 P53(K382)/P53 P65(K310)/P65 P P65(K310) Time (h) Givinostat P65 b-actin 8335 July 21, 2015 Volume 21 Issue 27

130 Wang YG et al. Mechanisms of givinostat against liver fibrosis B LPS (100 ng/ml) Givinostat (nmol/l) perk1/2 3 perk1/erk1 perk2/erk2 pjnk1/jnk1 ERK1/2 pjnk1/2 JNK1/2 pp38 Relative expression of proteins 2 1 pjnk2/jnk2 pp38/p38 p38 0 LPS (100 ng/ml) Givinostat (nmol/l) b-actin Figure 4 Changes in histone acetylation and regulation of lipopolysaccharide-activated mitogen-activated protein kinase signaling in givinostat-treated JS-1 cells. A: Effects of givinostat on the post-translational modifications of superoxide dismutase (SOD)2, p53, nuclear factor (NF)-kB, and p65 were analyzed by Western blotting. SOD2 (acetyl K68) acetylation was upregulated, while the expression profile of SOD2 protein showed no significant change. The ratios show a significant difference when compared with those in the control group, in particular at 24 h. Similarly, acetylation of NF-kB p65 (acetyl K310) was upregulated, while its protein expression showed no significant change. There were no obvious changes in the expression profiles of p53, p53 (acetyl K382), and p53 (acetyl K120); B: Expression of extracellular signal-regulated kinase (ERK)1/2, phosphorylated ERK1/2, p38, and phosphorylated p38 was upregulated after lipopolysaccharide (LPS) treatment; in contrast, givinostat inhibited the upregulated expression of phosphorylated ERK1/2 and phosphorylated P38 induced by LPS in a time-dependent manner, while no obvious effect on c-jun N-terminal kinase (JNK)1/2 and phosphorylated JNK1/2 was found. glutathione, and increases intracellular ROS. As a result, the mitochondrial matrix becomes swollen, along with a decrease in its outer membrane folds and surface area; thus, the mitochondria become fragile and susceptible to rupture, causing the release of proapoptotic proteins from the intermembrane spaces. Ultimately, apoptosis occurs. As a signaling molecule, ROS is involved in the regulation of multiple cellular functions such as cell growth, differentiation, apoptosis, and immune responses [26]. ROS has both positive and negative effects on cell survival and apoptosis. ROS can exert an antiapoptotic effect by activating NF-κB or Akt/activation of apoptosis signal-regulating kinase [27,28]. However, it is also a key link in the apoptosis process [29]. ROS can induce apoptosis through multiple mechanisms. For instance, they can cause damage to DNA, lipids and proteins, or they can regulate apoptosis via the redoxinsensitive MAPK pathways including JNK, p38, and ERK1/2 [30]. In the current study, the givinostat-induced HSC apoptosis was mainly mediated through p38 and ERK1/2 rather than JNK. The mitochondrial respiratory chain is a key site responsible for the production of free radicals. As a SOD in mitochondria, SOD2 is a key enzyme responsible for eliminating mitochondrial superoxide anions in the mitochondria [31]. Approximately 90% of intracellular ROS can be explained by the electron leakage that occurs in the mitochondrial electron transport chain, while SIRT3-induced deacetylation of SOD2 can eliminate most of the intracellular ROS. Apoptosis induced by mitochondrial damage may be associated with a decrease in oxygen radical scavenging capacity [32,33]. SIRT3 deacetylates two critical lysine residues on SOD2 and promotes its antioxidative activity [34,35]. In our current study, however, upregulation of SOD2 (acetyl K68) acetylation induced by givinostat might be one of the key mechanisms responsible for the decrease in oxygen radical scavenging capacity. Many studies have found that the NF-κB activity is correlated with liver fibrosis [36,37]. Suppression of NF-κB binding affinity or blockade of NF-κB stimulation may induce HSC apoptosis, thus alleviating the liver fibrosis caused by multiple etiologies; therefore, the NF-κB pathway may be a useful way for drugs to exert their efficacy in fighting against injuries or fibrosis. In the nucleus, the inactivated or activated status of NF-κB is determined by its acetylation. By regulating histone acetylation, the HDAC controls a series of intranuclear biologic processes induced by NF-κB. Kuo et al [38] have reported that acetylation and deacetylation of histones are closely correlated to regulation of gene transcription in eukaryotic cells. A study on synovial fibroblasts found that HDAC inhibitors block the activation of NF-κB p65 and thus induce apoptosis [39]. Similarly, in the current study, givinostat treatment upregulated NF-κB p65 (acetyl K310) acetylation but showed no obvious effect on protein expression of NFκB p65. In summary, as an HDAC inhibitor, givinostat has 8336 July 21, 2015 Volume 21 Issue 27

131 Wang YG et al. Mechanisms of givinostat against liver fibrosis Control group (Saline) Model group (CCl4) Givinostat group (CCl4+) Magnification 200 Masson staining Magnification 40 Liver specimens 15 P = P > 0.05 P = Stained collagen area (%) Control group Model group Givinostat group Figure 5 Pathologic changes of liver tissue in mouse models of liver fibrosis induced by CCl4 treatment. Control group: The hepatic lobules had integrated structures, with only a small number of stained collagen fibers in the portal area. There was no obvious collagen deposition, and no degeneration, necrosis, or inflammatory cell infiltration. Model group: The normal hepatic lobules were damaged, along with the markedly increased collagen in liver tissue. The collagen fibers extended along the portal area or outwards to the inflammatory necrosis area, forming fiber spacing with varied thickness. Pseudolobules were visible. Givinostat group: compared with the model group, the structure of liver tissue was markedly improved, along with the obviously decreased collagen deposition. Collagen area percent was significantly reduced in givinostat group compared to the model group (P = 0.005). antifibrotic activities both in vivo and in vitro, which might be achieved by regulating the acetylation of NFκB and SOD2, stimulating oxidative stress, activating mitochondrial pathways, inhibiting proliferation of 8337 July 21, 2015 Volume 21 Issue 27

132 Wang YG et al. Mechanisms of givinostat against liver fibrosis mouse HSCs (JS-1 cell line), and inducing apoptosis. The current study may provide new directions and evidence in the research and development of novel drugs for liver fibrosis. COMMENTS Background At present, there is no effective therapeutic means for the treatment of liver fibrosis. Activation of hepatic stellate cells (HSCs) is the central event in liver fibrosis and often serves as a trigger. Inhibition of HSC activation and proliferation or induction of apoptosis is the mainstream strategy for the treatment of liver fibrosis. Research frontiers Recent studies have shown that protein acetylation plays an important role during HSC activation; imbalanced histone acetylation due to histone deacetylase overexpression is closely correlated to the occurrence and development of liver fibrosis. Innovations and breakthroughs Givinostat has antifibrotic activities, which might be achieved by regulating the acetylation of nuclear factor-κb (NF-κB) and superoxide dismutase 2, inhibiting proliferation of HSCs, and inducing apoptosis. The study is the first to examine the differential acetylation of specific proteins before and after HSCs are exposed to givinostat and to explore the effect on regulating HSC proliferation. Applications The study provides an experimental basis for future studies on exploring additional histone deacetylase inhibitors and their targets for the development of new drugs for liver fibrosis. Terminology Acetylation is an important modification of proteins in cell biology, and proteomics studies have identified thousands of acetylated mammalian proteins. Peer-review These authors explored givinostat and found it can inhibit HSC proliferation. NF-κB and superoxide dismutase 2 were acetylated after givinostat treatment. Simultaneously, the authors imaged the acetylated proteins and modified sites in HSC cells. The paper is well presented and the results are interesting. REFERENCES 1 Hernandez-Gea V, Friedman SL. Pathogenesis of liver fibrosis. Annu Rev Pathol 2011; 6: [PMID: DOI: /annurev-pathol ] 2 Kocabayoglu P, Friedman SL. Cellular basis of hepatic fibrosis and its role in inflammation and cancer. Front Biosci (Schol Ed) 2013; 5: [PMID: ] 3 Sato M, Suzuki S, Senoo H. Hepatic stellate cells: unique characteristics in cell biology and phenotype. Cell Struct Funct 2003; 28: [PMID: ] 4 Friedman SL. Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol Rev 2008; 88: [PMID: DOI: /physrev ] 5 Atta H, El-Rehany M, Hammam O, Abdel-Ghany H, Ramzy M, Roderfeld M, Roeb E, Al-Hendy A, Raheim SA, Allam H, Marey H. Mutant MMP-9 and HGF gene transfer enhance resolution of CCl4-induced liver fibrosis in rats: role of ASH1 and EZH2 methyltransferases repression. PLoS One 2014; 9: e [PMID: DOI: /journal.pone ] 6 Chen SL, Zheng MH, Shi KQ, Yang T, Chen YP. A new strategy for treatment of liver fibrosis: letting MicroRNAs do the job. BioDrugs 2013; 27: [PMID: DOI: / s ] 7 Sánchez-Valle V, Chávez-Tapia NC, Uribe M, Méndez-Sánchez N. Role of oxidative stress and molecular changes in liver fibrosis: a review. Curr Med Chem 2012; 19: [PMID: ] 8 Shiha G, Sarin SK, Ibrahim AE, Omata M, Kumar A, Lesmana LA, Leung N, Tozun N, Hamid S, Jafri W, Maruyama H, Bedossa P, Pinzani M, Chawla Y, Esmat G, Doss W, Elzanaty T, Sakhuja P, Nasr AM, Omar A, Wai CT, Abdallah A, Salama M, Hamed A, Yousry A, Waked I, Elsahar M, Fateen A, Mogawer S, Hamdy H, Elwakil R. Liver fibrosis: consensus recommendations of the Asian Pacific Association for the Study of the Liver (APASL). Hepatol Int 2009; 3: [PMID: DOI: /s x] 9 Mannaerts I, Nuytten NR, Rogiers V, Vanderkerken K, van Grunsven LA, Geerts A. Chronic administration of valproic acid inhibits activation of mouse hepatic stellate cells in vitro and in vivo. Hepatology 2010; 51: [PMID: DOI: /hep.23334] 10 Niki T, Rombouts K, De Bleser P, De Smet K, Rogiers V, Schuppan D, Yoshida M, Gabbiani G, Geerts A. A histone deacetylase inhibitor, trichostatin A, suppresses myofibroblastic differentiation of rat hepatic stellate cells in primary culture. Hepatology 1999; 29: [PMID: DOI: / hep ] 11 Qin L, Han YP. Epigenetic repression of matrix metalloproteinases in myofibroblastic hepatic stellate cells through histone deacetylases 4: implication in tissue fibrosis. Am J Pathol 2010; 177: [PMID: DOI: /ajpath ] 12 Leoni F, Fossati G, Lewis EC, Lee JK, Porro G, Pagani P, Modena D, Moras ML, Pozzi P, Reznikov LL, Siegmund B, Fantuzzi G, Dinarello CA, Mascagni P. The histone deacetylase inhibitor ITF2357 reduces production of pro-inflammatory cytokines in vitro and systemic inflammation in vivo. Mol Med 2005; 11: 1-15 [PMID: DOI: / Dinarello] 13 Armeanu S, Pathil A, Venturelli S, Mascagni P, Weiss TS, Göttlicher M, Gregor M, Lauer UM, Bitzer M. Apoptosis on hepatoma cells but not on primary hepatocytes by histone deacetylase inhibitors valproate and ITF2357. J Hepatol 2005; 42: [PMID: DOI: /j.jhep ] 14 Pathil A, Armeanu S, Venturelli S, Mascagni P, Weiss TS, Gregor M, Lauer UM, Bitzer M. HDAC inhibitor treatment of hepatoma cells induces both TRAIL-independent apoptosis and restoration of sensitivity to TRAIL. Hepatology 2006; 43: [PMID: DOI: /hep.21054] 15 Golay J, Cuppini L, Leoni F, Micò C, Barbui V, Domenghini M, Lombardi L, Neri A, Barbui AM, Salvi A, Pozzi P, Porro G, Pagani P, Fossati G, Mascagni P, Introna M, Rambaldi A. The histone deacetylase inhibitor ITF2357 has anti-leukemic activity in vitro and in vivo and inhibits IL-6 and VEGF production by stromal cells. Leukemia 2007; 21: [PMID: DOI: /sj.leu ] 16 Leoni F, Zaliani A, Bertolini G, Porro G, Pagani P, Pozzi P, Donà G, Fossati G, Sozzani S, Azam T, Bufler P, Fantuzzi G, Goncharov I, Kim SH, Pomerantz BJ, Reznikov LL, Siegmund B, Dinarello CA, Mascagni P. The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc Natl Acad Sci USA 2002; 99: [PMID: DOI: / pnas ] 17 Carta S, Tassi S, Semino C, Fossati G, Mascagni P, Dinarello CA, Rubartelli A. Histone deacetylase inhibitors prevent exocytosis of interleukin-1beta-containing secretory lysosomes: role of microtubules. Blood 2006; 108: [PMID: DOI: /blood ] 18 Furlan A, Monzani V, Reznikov LL, Leoni F, Fossati G, Modena D, Mascagni P, Dinarello CA. Pharmacokinetics, safety and inducible cytokine responses during a phase 1 trial of the oral histone deacetylase inhibitor ITF2357 (givinostat). Mol Med 2011; 17: [PMID: DOI: /molmed ] 19 Hirsch CL, Bonham K. Histone deacetylase inhibitors regulate p21waf1 gene expression at the post-transcriptional level in HepG2 cells. FEBS Lett 2004; 570: [PMID: DOI: /j.febslet ] 20 Anh TD, Ahn MY, Kim SA, Yoon JH, Ahn SG. The histone deacetylase inhibitor, Trichostatin A, induces G2/M phase arrest and apoptosis in YD-10B oral squamous carcinoma cells July 21, 2015 Volume 21 Issue 27

133 Wang YG et al. Mechanisms of givinostat against liver fibrosis Oncol Rep 2012; 27: [PMID: DOI: / or ] 21 Wang YG, Wang N, Li GM, Fang WL, Wei J, Ma JL, Wang T, Shi M. Mechanisms of trichostatin A inhibiting AGS proliferation and identification of lysine-acetylated proteins. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19. i ] 22 An JH, Jang SM, Kim JW, Kim CH, Song PI, Choi KH. The expression of p21 is upregulated by forkhead box A1/2 in p53-null H1299 cells. FEBS Lett 2014; 588: [PMID: DOI: /j.febslet ] 23 Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov 2006; 5: [PMID: DOI: /nrd2133] 24 Maiso P, Carvajal-Vergara X, Ocio EM, López-Pérez R, Mateo G, Gutiérrez N, Atadja P, Pandiella A, San Miguel JF. The histone deacetylase inhibitor LBH589 is a potent antimyeloma agent that overcomes drug resistance. Cancer Res 2006; 66: [PMID: DOI: / CAN ] 25 Rosato RR, Grant S. Histone deacetylase inhibitors: insights into mechanisms of lethality. Expert Opin Ther Targets 2005; 9: [PMID: DOI: / ] 26 Ray PD, Huang BW, Tsuji Y. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell Signal 2012; 24: [PMID: DOI: / j.cellsig ] 27 Chen AC, Arany PR, Huang YY, Tomkinson EM, Sharma SK, Kharkwal GB, Saleem T, Mooney D, Yull FE, Blackwell TS, Hamblin MR. Low-level laser therapy activates NF-kB via generation of reactive oxygen species in mouse embryonic fibroblasts. PLoS One 2011; 6: e22453 [PMID: DOI: /journal.pone ] 28 Corcoran A, Cotter TG. Redox regulation of protein kinases. FEBS J 2013; 280: [PMID: DOI: / febs.12224] 29 Simon HU, Haj-Yehia A, Levi-Schaffer F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000; 5: [PMID: ] 30 Son Y, Kim S, Chung HT, Pae HO. Reactive oxygen species in the activation of MAP kinases. Methods Enzymol 2013; 528: [PMID: DOI: /B ] 31 Ying YL, Balaban CD. Regional distribution of manganese superoxide dismutase 2 (Mn SOD2) expression in rodent and primate spiral ganglion cells. Hear Res 2009; 253: [PMID: DOI: /j.heares ] 32 Orr AL, Ashok D, Sarantos MR, Shi T, Hughes RE, Brand MD. Inhibitors of ROS production by the ubiquinone-binding site of mitochondrial complex I identified by chemical screening. Free Radic Biol Med 2013; 65: [PMID: DOI: /j.freeradbiomed ] 33 Klein LE, Cui L, Gong Z, Su K, Muzumdar R. A humanin analog decreases oxidative stress and preserves mitochondrial integrity in cardiac myoblasts. Biochem Biophys Res Commun 2013; 440: [PMID: DOI: /j.bbrc ] 34 Qiu X, Brown K, Hirschey MD, Verdin E, Chen D. Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell Metab 2010; 12: [PMID: DOI: /j.cmet ] 35 Bell EL, Guarente L. The SirT3 divining rod points to oxidative stress. Mol Cell 2011; 42: [PMID: DOI: /j.molcel ] 36 Luedde T, Schwabe RF. NF-κB in the liver--linking injury, fibrosis and hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol 2011; 8: [PMID: DOI: /nrgastro ] 37 Ji L, Xue R, Tang W, Wu W, Hu T, Liu X, Peng X, Gu J, Chen S, Zhang S. Toll like receptor 2 knock-out attenuates carbon tetrachloride (CCl4)-induced liver fibrosis by downregulating MAPK and NF-κB signaling pathways. FEBS Lett 2014; 588: [PMID: DOI: /j.febslet ] 38 Kuo MH, Allis CD. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 1998; 20: [PMID: ] 39 Choo QY, Ho PC, Tanaka Y, Lin HS. Histone deacetylase inhibitors MS-275 and SAHA induced growth arrest and suppressed lipopolysaccharide-stimulated NF-kappaB p65 nuclear accumulation in human rheumatoid arthritis synovial fibroblastic E11 cells. Rheumatology (Oxford) 2010; 49: [PMID: DOI: /rheumatology/keq108] P- Reviewer: Atta H, Marcos R S- Editor: Ma YJ L- Editor: AmEditor E- Editor: Ma S 8339 July 21, 2015 Volume 21 Issue 27

134 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Basic Study ORIGINAL ARTICLE Potential protective effects of Clostridium butyricum on experimental gastric ulcers in mice Fang-Yan Wang, Jia-Ming Liu, Hai-Hua Luo, Ai-Hua Liu, Yong Jiang Fang-Yan Wang, Hai-Hua Luo, Ai-Hua Liu, Yong Jiang, State Key Laboratory of Organ Failure Research, Nanfang Hospital, Guangzhou , Guangdong Province, China Fang-Yan Wang, Hai-Hua Luo, Ai-Hua Liu, Yong Jiang, Key Laboratory of Transcriptomics and Proteomics of Ministry of Education of China, Key Laboratory of Proteomics of Guangdong Province, Guangzhou , Guangdong Province, China Fang-Yan Wang, Hai-Hua Luo, Ai-Hua Liu, Yong Jiang, Department of Pathophysiology, Southern Medical University, Guangzhou , Guangdong Province, China Fang-Yan Wang, Department of Pathophysiology, Wenzhou Medical University, Wenzhou , Zhejiang Province, China Jia-Ming Liu, School of Environmental Science and Public Health, Wenzhou Medical University, Wenzhou , Zhejiang Province, China Author contributions: Wang FY and Jiang Y conceived and designed the experiments; Wang FY, Liu JM and Luo HH performed the experiments; Wang FY, Luo HH and Liu AH analyzed the data; Wang FY and Jiang Y wrote the paper. Supported by grants from The National Key Basic Research (973) Program of China, No. 2010CB (to Jiang Y); the National Natural Science Foundation of China, No , and No (to Jiang Y); the Guangdong Provincial Natural Science Foundation (S ) (to Liu A); and the Program of Wenzhou Sci-tech Museum, No. Y (to Wang FY). Institutional animal care and use committee statement: All the animal procedures carried out in the present study were in accordance with the guidelines of the Animal Ethics Committee of Wenzhou Medical University. Conflict-of-interest statement: The authors declare that no competing interests exist. Data sharing statement: Technical appendix, statistical code, and dataset available from the corresponding author at jiang48231@163.com. Participants gave informed consent for data sharing. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Yong Jiang, MD, PhD, Department of Pathophysiology, Southern Medical University, No Shatai South Road, Guangzhou , Guangdong Province, China. jiang48231@163.com Telephone: Fax: Received: January 15, 2015 Peer-review started: January 16, 2015 First decision: April 13, 2015 Revised: April 20, 2015 Accepted: May 7, 2015 Article in press: May 7, 2015 Published online: July 21, 2015 Abstract AIM: To investigate the effects of Clostridium butyricum (C. butyricum ) on experimental gastric ulcers (GUs) induced by alcohol, restraint cold stress, or pyloric ligation in mice, respectively. METHODS: One hundred and twenty mice were randomly allocated into three types of gastric ulcer models (n = 40 each), induced by alcohol, restraint cold stress, or pyloric ligation. In each GU model, 40 mice were allocated into four groups (n = 10 each): the sham control group; model group (GU induction without pretreatment); C. butyricum group (GU induction with C. butyricum pretreatment); and Omeprazole group (GU induction with Omeprazole pretreatment). The 8340 July 21, 2015 Volume 21 Issue 27

135 Wang FY et al. Effects of C. butyricum on gastric ulcers effects of C. butyricum were evaluated by examining the histological changes in the gastric mucosal erosion area, the activities of superoxide dismutase (SOD) and catalase (CAT), the level of malondialdehyde (MDA), and the contents of interleukin (IL)-1b, tumor necrosis factor (TNF)-α, leukotriene B4 (LTB4) and 6-keto-PGF-1α (degradation product of PGI2) in the gastric tissue. RESULTS: Our data showed that C. butyricum significantly reduced the gastric mucosal injury area and ameliorated the pathological conditions of the gastric mucosa. C. butyricum not only minimized the decreases in activity of SOD and CAT, but also reduced the level of MDA in all three GU models used in this study. The accumulation of IL1-β, TNF-α and LBT4 decreased, while 6-keto-PGF-1α increased with pretreatment by C. butyricum in all three GU models. CONCLUSION: Our data demonstrated the protective effects of pretreatment with C. butyricum on antioxidation and anti-inflammation in different types of GU models in mice. Further studies are needed to explore its potential clinical benefits. Key words: Inflammation; Probiotics; Oxidative stress; Clostridium butyricum ; Gastric ulcer The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In this study, we reported that the probiotic Clostridium butyricum (C. butyricum ) pretreatment obviously attenuated gastric mucosal lesions induced by different stimulations. The oxidative stress- and inflammation-related parameters detected in this study showed that anti-oxidation and anti-inflammation participate in the underlying mechanism of C. butyricum protective effect on gastric mucosa. Our findings provide a potential protective method for the gastric mucosa and a novel application for C. butyricum in the clinic. Wang FY, Liu JM, Luo HH, Liu AH, Jiang Y. Potential protective effects of Clostridium butyricum on experimental gastric ulcers in mice. World J Gastroenterol 2015; 21(27): Available from: URL: i27/8340.htm DOI: INTRODUCTION The stomach is an important organ for food digestion. In some cases, however, its digestive function may become too aggressive, resulting in self-digestion and gastric ulcers (GU) [1]. GU is commonly caused by an exposure to excessive amounts of various endogenous or exogenous factors, including excess secretion of gastric acids and pepsin, reactive oxygen species (ROS), stress, alcohol, non-steroidal anti-inflammatory drugs (NSAIDs), Helicobacter pylori (H. pylori) infection and smoking [2]. Although an estimated 10% of population in the world suffers from this disease [3], its severity is often not recognized, possibly because of its quick clinical recovery if timely treatment is started. Despite considerable progress with extensive application of gastroprotective agents, such as protonpump inhibitor (PPI) and eradication therapy for H. pylori, some issues remain in the current therapy of GU. First, drug resistance of H. pylori may require changes in the treatment regimens [3]. Furthermore, antibiotics administered orally alter intestinal flora [4,5] and may cause drug resistance in some bacteria, leading to unexpected difficulties in the treatment of a variety infectious diseases. Second, the recurrence rate of GU is high with current therapies [6]. While the causes for GU relapses are complicated, infection by H. pylori may be an important contributor [5,7]. The weakened defensive barrier may also be a key factor contributing to recurrence [6]. However, only a few drugs are available that promote the repair of gastric mucosa. Third, knowledge of adverse effects of current drugs used to treat ulcers is accumulating [8]. For example, extended use of PPIs appears to cause an increased risk of fractures [9,10], hepatitis [11,12] and bacterial pneumonia [13,14]. Therefore, it is necessary to explore new therapies to prevent and treat GU. Clostridium butyricum (C. butyricum) has been used as a probiotic to treat and prevent non-antimicrobialinduced or antimicrobial-associated diarrhea [15,16]. Its in vivo inhibition on H. pylori was reported by Takahashi et al [17]. The direct protective effects of C. butyricum on GU, however, are not clear. This study was designed to test the hypothesis that pretreatment with C. butyricum could prevent lesions in the gastric mucosa. Clinical GU cases are often induced by alcohol overuse, stress, and excess of gastric acid and pepsin; therefore, we developed and used three GU models in mice induced by alcohol, cold stress or pylorus ligation, in this study. In each model, the pretreatment effects were evaluated by comparisons with no pretreatment and standard pretreatment with Omeprazole. MATERIALS AND METHODS Drugs and chemicals C. butyricum was purchased from Miyarisan Pharmaceutical Co., Ltd (Nagano, Japan). Trypticasephytone-yeast extract (TPY) liquid culture medium (Table 1) was obtained from Hope Bio-Technology Co., Ltd (Qingdao, China). Omeprazole was from Aosaikang Pharmaceutical Co., Ltd (Jiangsu, China). Detection kits for superoxide dismutase (SOD) and catalase (CAT) were purchased from Jiancheng Bioengineering Institute (Nanjing, China). The kits for malondialdehyde (MDA) detection and bicinchoninic acid (BCA) protein assay were bought from Beyotime Institute of Biotechnology (Shanghai, China). Enzymelinked immunosorbent assay (ELISA) kits for IL-1β, TNF-α, leukotriene B4 (LTB4) and 6-keto-PGF-1α were 8341 July 21, 2015 Volume 21 Issue 27

136 Wang FY et al. Effects of C. butyricum on gastric ulcers Table 1 Trypticase-phytone-yeast extract liquid culture medium composition Components Weight (g/l) Casein hydrolysate 1.0 Soya bean peptone 5.0 Yeast powder 2.0 Glucose 5.0 L-Cysteine 0.5 K2HPO4 2.0 MgCl2 0.5 ZnSO CaCl FeCl Tween ph 6.5 ± 0.1 obtained from Westang Bio-tech Co., Ltd (Shanghai, China). Animals and GU models Male Institute for Cancer Research (ICR) mice, weighing g, were provided by the Experimental Animal Center of Wenzhou Medical University (Wenzhou, China). All the animal procedures carried out in the present study were in accordance with the guidelines of the Animal Ethics Committee of Wenzhou Medical University. Animals were given free access to tap water and food in air-conditioned animal quarters under a 12 h light-12 h dark cycle. 120 mice were randomly allocated into three types of gastric ulcer models (n = 40 each), induced by alcohol, restraint cold stress or pyloric ligation. All the models are classical and stable for the study of molecular mechanisms and screening of therapeutic or preventive drugs of GU [18-20]. Following the indicated pretreatments (see next paragraph), in the alcohol-induced GU model, mice were orally administered with pure alcohol 0.01 ml/g body weight (bw) and sacrificed by cervical dislocation 1 h later before the stomach tissues were collected for analysis [18]. In the cold-restraint stress-induced GU model, mice were lightly anesthetized by pentobarbital anesthesia (30 mg/kg bw, intraperitoneally) and fixed solidly to immobilization the mice. The bodies of mice under xiphoid were subjected to cold water (21 ) for 20 h to induce a cold stress [19]. In the pylorus ligation-induced GU model [20], the abdomen of mouse was opened under light anesthesia with pentobarbital and the stomach was taken out under sterile conditions. The pyloric end was then isolated and ligated, followed by suture of the abdominal wall. The animals were sacrificed after the ligation for 20 h. Animal pretreatments In each GU model and before induction, 40 mice were allocated into four groups (n = 10 each): sham control group; GU model group (GU induction without pretreatment); C. butyricum group (GU induction with C. butyricum pretreatment); and Omeprazole group (GU induction with Omeprazole pretreatment). The sham control group animals received only the culture medium, and the GU group animals received the culture medium and alcohol administration, restraint cold stress or pylorus ligation, without any pretreatment. In the C. butyricum group, the animals received C. butyricum pretreatment before GU model preparation. C. butyricum was cultured with TPY liquid culture medium in an anaerobic incubator. Ten hours later, C. butyricum at the logarithmic phase was used for intragastric administration of mice in C. butyricum group (dose = CFU/mouse) for 5 d via an orogastric tube. In the Omeprazole group, the animals were intraperitoneally administered with Omeprazole (13 mg/kg bw), 30 min before replication of GU models. The mice were sacrificed by cervical dislocation followed by isolation of the stomach from surrounding organs without any substantial connective tissues or vessels. The gastric specimens were used for lesion assessment, pathological observation and determination of parameters of oxidative stress and inflammation. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by Laboratory Animal Ethics Committee of Wenzhou Medical University (Permit number: wydw ). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. Quantification of gastric hemorrhagic ulcer area and histological study The stomachs of mice were fixed by injection of 1 ml 10% formalin solution, and digital images were taken by photo scanning. The ratio of gastric hemorrhagic ulcer area and total gastric area was calculated by the Image- Pro Plus (IPP) 6.0 software from Media Cybernetics (Bethesda, CA, United States). The specimens were embedded in paraffin, sectioned and stained with hematoxylin and eosin (HE). Pathological changes were identified under a Nikon Eclipse SOi light microscope (Nikon Co., Japan). Preparation of tissue samples The stomachs of mice were washed mildly to remove food debris and then weighed using an electronic balance. Ice-cold normal saline with a volume corresponding to 9 the tissue weight was added. As extensive lesions of the gastric mucosa existed in the acute GU models, the whole stomach was homogenized with a Potter-Elvehjem glass homogenizers, and centrifuged at 2400 g for 15 min. The supernatant 8342 July 21, 2015 Volume 21 Issue 27

137 Wang FY et al. Effects of C. butyricum on gastric ulcers Sham Model C. butyricum Omeprazole A B C D Alcohol E F G H Cold stress Figure 1 Macroscopic morphology of the gastric mucosa following alcohol or cold stress treatments. The gross morphology of gastric mucosa was observed in gastric ulcer (GU) mice challenged with alcohol (A-D) or cold stress (E-H). In alcohol or cold stress-induced GU model, 40 mice were evenly divided into Sham control group (A, E), Model group (without pretreatment) (B, F), Clostridium butyricum (C. butyricum) pretreatment group (C, G) and omeprazole pretreatment group (D, H), respectively. was collected for the assays of SOD, CAT and MDA. Measurement of SOD activity The activity of total SOD of gastric tissue was measured from gastric homogenate by the method of xanthine oxidase [21], with absorbance at 550 nm using a 722N spectrophotometer from the Scientific Instrument Co., Ltd (Shanghai, China). The activity of SOD in per mg of tissue protein was calculated according to the formula supplied by the manufacturer. Determination of CAT activity The activity of CAT was determined at 405 nm with a 722N spectrophotometer from the Scientific Instrument Co., Ltd (Shanghai, China), through the ammonium molybdate colorimetric method [22], according to the formula provided by the manufacturer. Measurement of MDA Lipid peroxidation in stomach samples was determined by measuring thiobarbituric acid reactive substances, as described by Ohkawa et al [23]. The absorbance at 532 nm was measured with an ELx800 absorbance microplate reader (BioTek Instruments, Inc., Winooski, VT, United States). The concentration of thiobarbituric acid reactive substances was measured using a standard curve of malondialdehyde, and the results were expressed as μmol MDA /g protein. Detection of IL-1b, TNF-α, LTB4 and 6-keto-PGF-1α IL-1b, TNF-α, LTB4 and 6-keto-PGF-1α of the gastric tissue were quantitated by the ELISA method. Briefly, 100 μl of homogenate was added to a 96-well plate that was coated with a corresponding primary antibody, and incubated for 3 h. The plate was washed twice with Phosphate Buffered Saline Tween-20 (PBST) and 100 μl of biotin conjugate was added to the plate, followed by an incubation of 45 min at room temperature. After washing to remove the non-specific binding, 100 μl of streptavidin-hrp was added and incubated for 45 min. Then the plate was washed with PBST and 100 μl of Chromogen was added to each well. Twenty minutes later, the reaction was stopped with stop solution. The absorbance was measured at 450 nm using an ELx800 absorbance microplate reader (BioTek Instruments). The levels of IL-1b, TNF-α, LTB4 and 6-keto-PGF-1α were calculated using standard curves, according to the instructions from the manufacturer. Protein assay of stomach samples The protein contents of stomach samples were detected by the bicinchoninic acid assay (BCA) method. The absorbance at 562 nm was detected by BioTek ELx800 Absorbance Microplate Reader (BioTek Instruments) according to the manufacturer s instruction. The protein concentration of the samples was calculated using a protein standard curve, and used to normalize the parameters of oxidative stress or inflammation in the stomach tissue. Statistical analysis All values were expressed as the mean ± SD. Statistical differences were evaluated by Fisher s Least Significant Difference (LSD) test followed by a Dunnett s T3 multiple comparison test. A P value less than 0.05 was considered statistically significant. RESULTS Histopathological observations The effects of pretreatment with C. butyricum were 8343 July 21, 2015 Volume 21 Issue 27

138 Wang FY et al. Effects of C. butyricum on gastric ulcers Ulcer area (%) Ulcer model C. butyricum Omeprazole a Alcohol a Cold stress Figure 2 Effects of Clostridium butyricum on the area of gastric ulcers induced by alcohol or cold stress. Gastric ulcer (GU) models were induced by alcohol and cold stress, and the gastric ulcer area was measured for the comparison among different groups, i.e., Model group (without pretreatment), C. butyricum pretreatment group and Omeprazole pretreatment group. The data were expressed as mean ± SD (n = 4). a P < 0.01 vs Model group. compared macroscopically to non-treated (Model group) and those pretreated with Omeprazole (Omeprazole group) (Figure 1). Quantitative comparisons of the gross morphology (Figure 1) were determined using the ratio of hemorrhagic area to total gastric area by the IPP 6.0 software (Figure 2). Alcohol overuse induced substantial gastric mucosal lesions, including many hemorrhagic injuries along the vessels of gastric mucosa. In some mice, shrinkage of the gastric wall was also observed. Restraint cold stress, also caused severe pathological changes within a larger hemorrhagic area, with a dark red appearance and excessive shrinkage. Pretreatment with C. butyricum pretreatment significantly reduced gastric lesions in both alcohol and cold induced GU models (Figure 2, P < 0.01), with a comparable protective effect to Omeprazole, a standard treatment drug (Figure 2). The pylorus ligation model was not included in the comparison because the mucosal lesions were diffused in the group, which made it difficult to evaluate extent of injury and the effects of pretreatment. To further examine the morphological lesions, we performed the conventional HE staining. Histological examination showed that the epithelial lining was intact, and the glandular cavity was clear and without any inflammatory cell infiltration in the gastric mucosa in sham control mice (Figure 3A, 3E and 3I). In the three GU models without pretreatments, marked histological changes were observed, including infiltration of neutrophils, lymphocytes and many erythrocytes into the mucosa. Some secretory glands were broken and many deciduous cells were observed in the glandular cavities (Figure 3B, 3F and 3J). Even mucosal desquamation was found in some gastric tissues from GU mice. Among the three GU models without pretreatments, the histological lesions in cold stress ulcer model were the worst (Figure 3F). Pretreatment a a with C. butyricum alleviated the pathological changes (Figure 3C, 3G and 3K), with comparable results to pretreatment with Omeprazole (Figure 3D, 3H and 3L). All the results were consistent with the macroscopical changes described above. Oxidative stress in the gastric mucosa from GU mice Oxidative stress is a main contributor to the development of gastric mucosa lesions [24]. Figure 4 shows the changes in the activities of SOD and CAT, and the content of MDA, in gastric tissues, which were used to evaluate the extent of oxidative stress. The data showed that in all three GU models, the activities of SOD and CAT decreased and the level of MDA increased (P < 0.01). Pretreatment with C. butyricum attenuated those changes (Figure 4, P < 0.01), indicating that pretreatment with C. butyricum reduced oxidative stress in GU mice. With pretreatment of Omeprazole, changes in the oxidative parameters were similar to those from pretreatment of C. butyricum, although the activity of SOD in C. butyricum group was higher than that of the Omeprazole group in the pylorus ligation model (P < 0.01, Figure 4G). Inflammation status of GU Excessive inflammation plays an important role in the development of gastric mucosal lesions induced by various proinflammatory stimuli; therefore, we performed cytokine detection to investigate the underlying mechanism of the protective effects of C. butyricum on gastric mucosa. Changes of IL-1b, TNF-α and LTB4 in gastric tissues in three models with different pretreatments are shown in Figure 5. The levels of IL-1b, TNF-α and LTB4 were significantly elevated, by different magnitudes, in all three GU models. Pretreatment with C. butyricum attenuated this elevation of proinflammatory factors (P < 0.01) (Figure 5). Overall, the effects of C. butyricum pretreatment were similar to those of Omeprazole, despite a lower level of LTB4 in C. butyricum group in the pylorus ligation GU mice (P < 0.01) (Figure 5). These data indicated that C. butyricum ameliorated inflammatory reactions in the development of gastric mucosal lesions induced by different stresses in mice. PGI2 content of gastric tissue during GU As PGE2 and PGI2 are not stable under physiological conditions; therefore, the stable metabolite of PGI2, 6-keto-PGF-1α, was used to reflect changes in proinflammatory factors. Figure 6 shows that 6-keto- PGF-1α was initially at a high level under normal conditions whereas the different ulcer-inducing stress factors significantly reduced the level of 6-keto-PGF-1α in the gastric mucosa. Pretreatment with C. butyricum markedly attenuated the decrease 6-keto-PGF-1α induced by stressful stimulations (P < 0.01), with 8344 July 21, 2015 Volume 21 Issue 27

139 Wang FY et al. Effects of C. butyricum on gastric ulcers Sham Model C. butyricum Omeprazole A B C D Alcohol E F G H Pylorus ligation Cold stress I J K L Figure 3 Histological assessment of the effect of Clostridium butyricum on acute gastric mucosal injuries in mice challenged with alcohol, cold stress or pylorus ligation. Three different gastric ulcer (GU) models were induced by alcohol (A-D), cold stress (E-H) or pylorus ligation (I-L), and gastric tissue sections were prepared for the observation under microscope at 40 and 100 magnifications. For each gastric ulcer (GU) model, mice were evenly divided into a Sham control group (A, E, I), Model group (without pretreatment) (B, F, J), Clostridium butyricum (C. butyricum) pretreatment group (C, G, K) and Omeprazole pretreatment group (D, H, L). The results represent three independent experiments (n = 4). similar effects to Omeprazole (Figure 6). DISCUSSION C. butyricum was discovered by Dr. Miyairi in 1933 [16]. It has been reported to have therapeutical effects on colitis in rats [25], inhibitory cytotoxic effects from Clostridium difficile in vitro [16], and suppression of colonization by H. pylori in vivo [17]. C. butyricum has been used clinically to treat antibiotic associated diarrhea caused by H. pylori eradication therapy [26], possibly through the recovery of intestinal microbiota balance. To investigate whether C. butyricum has a potential protective effect from gastric mucosal lesions, we assessed the effects of C. butyricum pretreatments on gastric mucosa from injuries induced by alcohol, stress or excessive gastric acid and digestive enzymes. Our data showed that C. butyricum pretreatment effectively attenuated the oxidative stress and inflammatory responses, as well as reduced severity of gastric lesions from three experimental GU models in mice. Previous studies demonstrated that the injury of gastric mucosa is to a large extent attributed to oxidative stress [24]. Accordingly, we wanted to find out whether C. butyricum could protect gastric mucosa from lesions by alleviating oxidative stress. The antioxidases, such as SOD and CAT, are important protective factors in oxidative damage [24]. MDA, which is a lipid peroxidation product, is stable and is used as a typical parameter to reflect oxidative injuries [27]. Our data showed that pretreatment with C. butyricum alleviated the level of MDA and improved the activities of SOD and CAT in different GU models of mice. On the other hand, inflammation is an important factor involved in gastric injury. In the current study, IL-1b, TNF-α and LTB4 were increased in GUs induced by alcohol, cold stress and pylorus ligation. This is consistent with previous reports [28-30]. Administration of C. butyricum dramatically inhibited the elevation of IL-1b, TNF-α and LTB4, indicating that C. butyricum exerted potential protective effects on gastric mucosa by restraining excessive inflammation in GUs. Prostaglandins (PGs) are important proinflammatory factors with complicated functions in the body. However, some PGs, such as PGE2 and PGI2, are critical in the mucosal defense of the stomach [1,31] and play a key role in protecting gastric mucosa from injury in the development of GUs [32-34]. NSAIDs cause gastric mucosal lesions, which may be explained by inhibiting the activity of cyclooxygenases (COXs) and thus reducing the production of PGs. Since PGI2 is the main subtype of PGs in gastric tissue, we quantified the contents of 6-keto-PGF-1α, a stable degradation product of PGI2 [35,36] in the current study. Our results 8345 July 21, 2015 Volume 21 Issue 27

140 Wang FY et al. Effects of C. butyricum on gastric ulcers A B C SOD (U/mg prot) c a a CAT (U/mg prot) c a a MDA (μmol/g prot) c a a D E F SOD (U/mg prot) c a a CAT (U/mg prot) c a a MDA (μmol/g prot) c a a G H I c SOD (U/mg prot) c a,b a CAT (U/mg prot) c a a MDA (μmol/g prot) a a Figure 4 Effect of Clostridium butyricum on the activities of superoxide dismutase, catalase and the content of malondialdehyde in the gastric mucosa of mice with gastric ulcers induced by alcohol, cold stress or pylorus ligation. Gastric ulcer models were induced by alcohol (A-C), cold stress (D-F) or pylorus ligation (G-I), respectively. The activities of superoxide dismutase (SOD) (A, D, G) and catalase (CAT) (B, E, H), and the content of malondialdehyde (MDA) (C, F, I) in the gastric tissues of different gastric ulcers (GU) mice were detected. For each GU model, there were four different groups: Sham control group (1), Model group (without pretreatment) (2), C. butyricum pretreatment group (3) and Omeprazole pretreatment group (4). The data were expressed as mean ± SD (n = 6). a P < 0.01 vs Model group; b P < 0.01 vs Omeprazole group; c P < 0.01 vs Sham control group. showed that the 6-keto-PGF-1α level was reduced in three different GU models. Pretreatment with C. butyricum significantly attenuated the decrease of 6-keto-PGF-1α, suggesting possible protective effects of C. butyricum. Therefore, it is possible that C. butyricum provides protection for gastric mucosa against injuries by reducing oxidative stresses, attenuating proinflammatory cytokines and increasing the level of PGI2. Further studies are needed to test this hypothesis. To further assess the effects of C. butyricum, the general conditions and behavior of mice in different GU models were observed and compared. We found that the behavior of alcohol-induced GU mice was improved by the pretreatment with C. butyricum, while the mice without pretreatment lay at the bottom of cage. In the cold-induced GU mice, pretreatment of C. butyricum alleviated the depression induced by cold stress. Similarly, in the pylorus ligation GU mice, pretreatment with C. butyricum eliminated the odor of gastric juice in these mice. Previous studies have shown that C. butyricum prevents inflammation-related diseases via its metabolites [25,37]. It is reasonable to speculate that the metabolites of C. butyricum may play a role in protection of the gastric mucosa. Butyrate and hydrogen are the two major metabolic products of C. butyricum. As a primary energy source of colonic epithelial cells, butyrate promotes water and sodium absorption, tightens the junctions between epithelial cells and accelerates the repair of damaged epithelial cells [38,39] in vitro. Butyrate has been reported to ameliorate inflammation in diversion colitis [40-42], and attenuate 8346 July 21, 2015 Volume 21 Issue 27

141 Wang FY et al. Effects of C. butyricum on gastric ulcers A B C IL-1b (ng/mg) c a a TNF-α (pg/mg) c a a LTB4 (pg/mg) c a a D E F IL-1b (ng/mg) 1600 c a 600 a TNF-α (pg/mg) 40 c 30 a 20 a LTB4 (pg/mg) c a a G H I IL-1b (ng/mg) c a a TNF-α (pg/mg) c a a LTB4 (pg/mg) c a,b a Figure 5 Effect of Clostridium butyricum on the levels of IL-1b, TNF-α and LTB4 in the gastric mucosa of mice with gastric ulcers induced by alcohol, cold stress or pylorus ligation. Gastric ulcer models were induced by alcohol (A-C), cold stress (D-F) or pylorus ligation (G-I), respectively. The levels of IL-1b (A, D, G), TNF-α (B, E, H) and LTB4 (C, F, I) in gastric tissue of different GU mice were quantified. For each GU model, there were four different groups: Sham control group (1), Model group (without pretreatment) (2), Clostridium butyricum (C. butyricum) pretreatment group (3) and Omeprazole pretreatment group (4). The data were expressed as mean ± SD (n = 6). a P < 0.01 vs Model group; b P < 0.01 vs Omeprazole group; c P < 0.01 vs Sham control group. A B C a keto-PGF-1a (pg/mg) c a a 6-keto-PGF-1a (pg/mg) c a 6-keto-PGF-1a (pg/mg) c a a Figure 6 Effect of Clostridium butyricum on 6-keto-PGF-1α in the gastric mucosa of mice with gastric ulcers induced by alcohol, cold stress or pylorus ligation. Gastric ulcer models were induced by alcohol (A), cold stress (B) or pylorus ligation (C), respectively. The content of 6-keto-PGF-1α in gastric tissue of different gastric ulcers (GU) mice was measured. For each GU model, there were four different groups: Sham control group (1), Model group (without pretreatment) (2), Clostridium butyricum (C. butyricum) pretreatment group (3) and Omeprazole pretreatment group (4). The data were expressed as mean ± SD (n = 6). a P < 0.01 vs Model (without pretreatment) group; c P < 0.01 vs Sham control group July 21, 2015 Volume 21 Issue 27

142 Wang FY et al. Effects of C. butyricum on gastric ulcers C. butyricum Metabolic products Hydrogen Butyrate H. pylori SOD, CAT, MDA IL-1b, TNF-α, LTB4, PGI2 Anti-oxidation Anti-inflammation Gastric ulcers Figure 7 The hypothetical model of Clostridium butyricum protective effect on gastric ulcers induced by stressful stimuli. In addition to competitive inhibition of Helicobacter pylori, as reported by previous studies [17], Clostridium butyricum (C. butyricum) protects gastric mucosa from lesions through at least two different mechanisms: anti-oxidation and anti-inflammation. The metabolites of C. butyricum, such as butyrate and hydrogen [52], enhance the activity of antioxidases [superoxide dismutase (SOD) and catalase (CAT)], reduce the production of proinflammatory factors [interleukin (IL)-1b, tumor necrosis factor (TNF)-α, leukotriene B4 (LTB4)] and promote the production of anti-inflammatory prostaglandins (PGI2), thus exerting protective effect on gastric ulcers by resolving peroxidation and alleviating exaggerated inflammation induced by various stresses. ROS production [43] in intestinal epithelial Caco-2 cells stimulated by lipopolysaccharide and colonic mucosa from patients with Crohn s disease. In addition, butyrate was shown to increase the expression and activity of COXs in human monocytes [44] and ROS 17/2.8 osteoblastic cells [45], as well as human colon tumor tissue [46]. In this study, we showed that C. butyricum reduced oxidative stress and inflammatory responses in different GU models. Furthermore, our other study (unpublished data) demonstrated that butyrate exerted protective effects on gastric mucosa challenged with ulcer-inducing stimuli, which provides an explanation for the anti-gu effect of C. butyricum. C. butyricum is capable of producing a large amount of hydrogen; therefore, it has been used as a clean energy resource of hydrogen [47-49]. Recently, hydrogen was used in therapeutics of various diseases as an anti-inflammatory gas [50,51], which opens an exciting approach for the treatment of inflammatory diseases. For example, a recent study showed that hydrogen could alleviate injury in stress-induced GU in mice [52]. Thus, hydrogen might be a contributor to C. butyricum protective effects against GU. However, the metabolites of bacteria are highly dependent on survival environments. Unlike butyrate, which has a relatively stable turnover, hydrogen production is sensitive to the culture conditions. Although C. butyricum can survive and colonize in the stomach, the metabolites of C. butyricum may be different from those under optimized conditions. Therefore, further studies are required to identify whether butyrate and hydrogen are the crucial products of C. butyricum for the gastric mucosa protective effects. C. butyricum might be a good choice in the future for pretreatment of GUs, especially with H. pylori infection. From the findings of this study, we designed a theoretical working model for C. butyricum (Figure 7), which includes three possible benefits of C. butyricum in clinical practice. First, C. butyricum directly inhibits H. pylori growth through antagonistic interaction, eliminating the most important cause of the occurrence and reoccurrence of GU. Furthermore, C. butyricum is suitable for patients suffering from GU but not sensitive to the therapy of eradication H. pylori. Second, C. butyricum attenuates gastric mucosal lesions independently, which provides direct evidence for therapeutical administration. Third, C. butyricum colonization of the stomach provides a long-lasting protection that prevents the occurrence and recurrence of ulcers. The main metabolic products, including butyrate and hydrogen, play crucial roles in the protective effects of C. butyricum. In addition, the probiotic C. butyricum can be used as a nutrition annexing agent for those sensitive to gastric mucosal lesions or infected by Helicobacter pylori, which is a 8348 July 21, 2015 Volume 21 Issue 27

143 Wang FY et al. Effects of C. butyricum on gastric ulcers prominent advantage lacking in the current clinical practice of GU treatment. Nonetheless, future investigations are needed to test these speculations. In summary, pretreatment with C. butyricum reduced oxidative stress, inflammatory responses, and injury severity in mice with 3 different GU models in this study. These data may suggest a potential protective effect of C. butyricum on GU and support further effort to explore its possible clinical application. ACKNOWLEDGMENTS We thank Dr. W.Z. Martini from US Army Institute of Surgical Research at Sam Houston, TX, United States, for critical reading and editing of this manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. COMMENTS Background Gastric ulcer (GU), which has a high incidence, can cause perforation, loss of blood and cancerization; therefore it is very important to prevent GU. However, the drugs currently used for GU in clinic are poor at preventing GU occurrence and relapse. Meanwhile, the resistance of Helicobacter pylori (H. pylori) to antibiotics requires constant changes the therapeutic strategies. Thus, there is an urgent need to find new methods to prevent GU. The probiotic Clostridium butyricum (C. butyricum) can inhibit H. pylori in vivo, but a direct protective effect of C. butyricum on gastric mucosa has not been reported. Research frontiers C. butyricum is widely used in clinics to resist pathogenic bacteria, especially in infection related diseases of intestine. The current study aimed to test whether C. butyricum could prevent the gastric mucosa from developing lesions induced alcohol, stress and excessive gastric juice. Innovations and breakthroughs There are some problems in the current therapy of GU: (1) H. pylori resistance to antibiotics is difficult to resolve; (2) the recurrence rate of GU is high with current therapies. H. pylori infection and weakened defensive barrier are the most important contributors; and (3) there are no effective agents among the current drugs that promote gastric mucosa repair. C. butyricum, which was reported to inhibit H. pylori colonization in the stomach, can produce butyrate and hydrogen, which are anti-inflammatory and anti-oxidative substances. In particular, butyrate is clinically applied for colitis to repair intestinal mucosa. Thus, C. butyricum may be an ideal drug to resolve H. pylori resistance and repair gastric mucosa. Applications The study results suggest that C. butyricum is a potentially protective probiotic that could be used to prevent GU induced by different factors. Terminology GU is caused by excessive amounts of various factors, including excess secretion of gastric acids and pepsin, stress, alcohol, non-steroidal antiinflammatory drugs, H. pylori infection and smoking. Over-excessive inflammation and oxidative stress play critical roles in the pathogenesis of GU. C. butyricum with its acid fast character can colonize the stomach. Peer-review This is a well-written study in which the authors analyzed the preventive effect of C. butyricum on GU induced by different stimulations in mice. The results suggest that C. butyricum is a potential protective probiotic that could be used to prevent different causes of GU. REFERENCES 1 Wallace JL. Prostaglandins, NSAIDs, and gastric mucosal protection: why doesn t the stomach digest itself? Physiol Rev 2008; 88: [PMID: DOI: / physrev ] 2 Zapata-Colindres JC, Zepeda-Gómez S, Montaño-Loza A, Vázquez-Ballesteros E, de Jesús Villalobos J, Valdovinos- Andraca F. The association of Helicobacter pylori infection and nonsteroidal anti-inflammatory drugs in peptic ulcer disease. Can J Gastroenterol 2006; 20: [PMID: ] 3 den Hollander WJ, Kuipers EJ. Current pharmacotherapy options for gastritis. Expert Opin Pharmacother 2012; 13: [PMID: DOI: / ] 4 Armuzzi A, Cremonini F, Bartolozzi F, Canducci F, Candelli M, Ojetti V, Cammarota G, Anti M, De Lorenzo A, Pola P, Gasbarrini G, Gasbarrini A. The effect of oral administration of Lactobacillus GG on antibiotic-associated gastrointestinal side-effects during Helicobacter pylori eradication therapy. Aliment Pharmacol Ther 2001; 15: [PMID: DOI: /j x] 5 Cremonini F, Di Caro S, Covino M, Armuzzi A, Gabrielli M, Santarelli L, Nista EC, Cammarota G, Gasbarrini G, Gasbarrini A. Effect of different probiotic preparations on anti-helicobacter pylori therapy-related side effects: a parallel group, triple blind, placebo-controlled study. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 6 Ogoshi K. Gastric Ulcer Relapse. Digestive Endoscopy 1994; 6: [DOI: /j tb00369.x] 7 Befrits R, Sjöstedt S, Tour R, Leijonmarck CE, Hedenborg L, Backman M. Long-term effects of eradication of Helicobacter pylori on relapse and histology in gastric ulcer patients: a twoyear follow-up study. Scand J Gastroenterol 2004; 39: [PMID: DOI: / ] 8 Chubineh S, Birk J. Proton pump inhibitors: the good, the bad, and the unwanted. South Med J 2012; 105: [PMID: DOI: /SMJ.0b013e31826efbea] 9 Yu EW, Bauer SR, Bain PA, Bauer DC. Proton pump inhibitors and risk of fractures: a meta-analysis of 11 international studies. Am J Med 2011; 124: [PMID: DOI: / j.amjmed ] 10 Khalili H, Huang ES, Jacobson BC, Camargo CA, Feskanich D, Chan AT. Use of proton pump inhibitors and risk of hip fracture in relation to dietary and lifestyle factors: a prospective cohort study. BMJ 2012; 344: e372 [PMID: DOI: /bmj.e372] 11 Darabi K. Proton-pump-inhibitor-induced hepatitis. South Med J 2005; 98: [PMID: DOI: /01. smj c1] 12 El-Matary W, Dalzell M. Omeprazole-induced hepatitis. Pediatr Emerg Care 2005; 21: [PMID: DOI: /01. pec b] 13 Canani RB, Cirillo P, Roggero P, Romano C, Malamisura B, Terrin G, Passariello A, Manguso F, Morelli L, Guarino A. Therapy with gastric acidity inhibitors increases the risk of acute gastroenteritis and community-acquired pneumonia in children. Pediatrics 2006; 117: e817-e820 [PMID: DOI: /peds ] 14 Eom CS, Jeon CY, Lim JW, Cho EG, Park SM, Lee KS. Use of acid-suppressive drugs and risk of pneumonia: a systematic review and meta-analysis. CMAJ 2011; 183: [PMID: DOI: /cmaj ] 15 Sato R, Tanaka M. Intestinal distribution and intraluminal localization of orally administered Clostridium butyricum in rats. Microbiol Immunol 1997; 41: [PMID: DOI: /j tb01909.x] 16 Woo TD, Oka K, Takahashi M, Hojo F, Osaki T, Hanawa T, Kurata S, Yonezawa H, Kamiya S. Inhibition of the cytotoxic effect of Clostridium difficile in vitro by Clostridium butyricum MIYAIRI 588 strain. J Med Microbiol 2011; 60: [PMID: DOI: /jmm ] 17 Takahashi M, Taguchi H, Yamaguchi H, Osaki T, Kamiya S. Studies of the effect of Clostridium butyricum on Helicobacter pylori in several test models including gnotobiotic mice. J Med Microbiol 2000; 49: [PMID: ] 18 Swarnakar S, Mishra A, Ganguly K, Sharma AV. Matrix metallo July 21, 2015 Volume 21 Issue 27

144 Wang FY et al. Effects of C. butyricum on gastric ulcers proteinase-9 activity and expression is reduced by melatonin during prevention of ethanol-induced gastric ulcer in mice. J Pineal Res 2007; 43: [PMID: DOI: /j X x] 19 Sutanto W, de Kloet ER. The use of various animal models in the study of stress and stress-related phenomena. Lab Anim 1994; 28: [PMID: DOI: / ] 20 Diniz LR, Vieira CF, Santos EC, Lima GC, Aragão KK, Vasconcelos RP, Araújo PC, Vasconcelos Yde A, Oliveira AC, Oliveira HD, Portella VG, Coelho-de-Souza AN. Gastroprotective effects of the essential oil of Hyptis crenata Pohl ex Benth. on gastric ulcer models. J Ethnopharmacol 2013; 149: [PMID: DOI: /j.jep ] 21 Misra HP, Fridovich I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J Biol Chem 1972; 247: [PMID: ] 22 Aebi H. Catalase in vitro. Methods Enzymol 1984; 105: [PMID: DOI: /S (84) ] 23 Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979; 95: [PMID: DOI: / (79) ] 24 Graziani G, D Argenio G, Tuccillo C, Loguercio C, Ritieni A, Morisco F, Del Vecchio Blanco C, Fogliano V, Romano M. Apple polyphenol extracts prevent damage to human gastric epithelial cells in vitro and to rat gastric mucosa in vivo. Gut 2005; 54: [PMID: DOI: /gut ] 25 Zhang HQ, Ding TT, Zhao JS, Yang X, Zhang HX, Zhang JJ, Cui YL. Therapeutic effects of Clostridium butyricum on experimental colitis induced by oxazolone in rats. World J Gastroenterol 2009; 15: [PMID: DOI: /wjg ] 26 Imase K, Takahashi M, Tanaka A, Tokunaga K, Sugano H, Tanaka M, Ishida H, Kamiya S, Takahashi S. Efficacy of Clostridium butyricum preparation concomitantly with Helicobacter pylori eradication therapy in relation to changes in the intestinal microbiota. Microbiol Immunol 2008; 52: [PMID: DOI: / j x] 27 Al Batran R, Al-Bayaty F, Jamil Al-Obaidi MM, Abdualkader AM, Hadi HA, Ali HM, Abdulla MA. In vivo antioxidant and antiulcer activity of Parkia speciosa ethanolic leaf extract against ethanol-induced gastric ulcer in rats. PLoS One 2013; 8: e64751 [PMID: DOI: /journal.pone ] 28 Ahmad A, Husain A, Mujeeb M, Khan SA, Najmi AK, Siddique NA, Damanhouri ZA, Anwar F. A review on therapeutic potential of Nigella sativa: A miracle herb. Asian Pac J Trop Biomed 2013; 3: [PMID: DOI: / S (13) ] 29 Gyires K. Neuropeptides and gastric mucosal homeostasis. Curr Top Med Chem 2004; 4: [DOI: / ] 30 Tariq M, Ageel AM. Gastric antiulcer and cytoprotective effects of dipyridamole in rats. J Pharmacol Exp Ther 1990; 253: [PMID: ] 31 Konturek SJ, Piastucki I, Brzozowski T, Radecki T, Dembińska- Kieć A, Zmuda A, Gryglewski R. Role of prostaglandins in the formation of aspirin-induced gastric ulcers. Gastroenterology 1981; 80: 4-9 [PMID: ] 32 Kapui Z, Boér K, Rózsa I, Blaskó G, Hermecz I. Investigations of indomethacin-induced gastric ulcer in rats. Arzneimittelforschung 1993; 43: [PMID: ] 33 Abdel Salam OM, Mózsik G, Szolcsányi J. Studies on the effect of intragastric capsaicin on gastric ulcer and on the prostacyclininduced cytoprotection in rats. Pharmacol Res 1995; 32: [PMID: DOI: /S (05) ] 34 Materia A, Jaffe BM, Money SR, Rossi P, De Marco M, Basso N. Prostaglandins in commercial milk preparations. Their effect in the prevention of stress-induced gastric ulcer. Arch Surg 1984; 119: [PMID: ] 35 Schildknecht S, Bachschmid M, Baumann A, Ullrich V. COX-2 inhibitors selectively block prostacyclin synthesis in endotoxinexposed vascular smooth muscle cells. FASEB J 2004; 18: [PMID: DOI: /fj fje] 36 Poggi A, Niewiarowski S, Stewart GJ, Sobel E, Smith JB. Human platelet secreted proteins and prostacyclin production by bovine aortic endothelial cells. Proc Soc Exp Biol Med 1983; 172: [PMID: DOI: / ] 37 Qadis AQ, Goya S, Yatsu M, Kimura A, Ichijo T, Sato S. Immunestimulatory effects of a bacteria-based probiotic on peripheral leukocyte subpopulations and cytokine mrna expression levels in scouring holstein calves. J Vet Med Sci 2014; 76: [PMID: DOI: /jvms ] 38 Scheppach W, Weiler F. The butyrate story: old wine in new bottles? Curr Opin Clin Nutr Metab Care 2004; 7: [PMID: DOI: / ] 39 Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther 2008; 27: [PMID: DOI: /j x] 40 Hallert C, Björck I, Nyman M, Pousette A, Grännö C, Svensson H. Increasing fecal butyrate in ulcerative colitis patients by diet: controlled pilot study. Inflamm Bowel Dis 2003; 9: [PMID: DOI: / ] 41 Scheppach W, Sommer H, Kirchner T, Paganelli GM, Bartram P, Christl S, Richter F, Dusel G, Kasper H. Effect of butyrate enemas on the colonic mucosa in distal ulcerative colitis. Gastroenterology 1992; 103: [PMID: ] 42 Vernia P, Cittadini M, Caprilli R, Torsoli A. Topical treatment of refractory distal ulcerative colitis with 5-ASA and sodium butyrate. Dig Dis Sci 1995; 40: [PMID: DOI: / BF ] 43 Russo I, Luciani A, De Cicco P, Troncone E, Ciacci C. Butyrate attenuates lipopolysaccharide-induced inflammation in intestinal cells and Crohn s mucosa through modulation of antioxidant defense machinery. PLoS One 2012; 7: e32841 [PMID: DOI: /journal.pone ] 44 Kovarik JJ, Hölzl MA, Hofer J, Waidhofer-Söllner P, Sobanov Y, Koeffel R, Saemann MD, Mechtcheriakova D, Zlabinger GJ. Eicosanoid modulation by the short-chain fatty acid n-butyrate in human monocytes. Immunology 2013; 139: [PMID: DOI: /imm.12089] 45 Iida T, Kawato T, Tanaka H, Tanabe N, Nakai K, Zhao N, Suzuki N, Ochiai K, Maeno M. Sodium butyrate induces the production of cyclooxygenases and prostaglandin E2 in ROS 17/2.8 osteoblastic cells. Arch Oral Biol 2011; 56: [PMID: DOI: /j.archoralbio ] 46 Jahns F, Wilhelm A, Jablonowski N, Mothes H, Radeva M, Wölfert A, Greulich KO, Glei M. Butyrate suppresses mrna increase of osteopontin and cyclooxygenase-2 in human colon tumor tissue. Carcinogenesis 2011; 32: [PMID: DOI: /carcin/bgr061] 47 Ferreira AF, Ortigueira J, Alves L, Gouveia L, Moura P, Silva C. Biohydrogen production from microalgal biomass: energy requirement, CO2 emissions and scale-up scenarios. Bioresour Technol 2013; 144: [PMID: DOI: / j.biortech ] 48 Jo JH, Lee DS, Park D, Park JM. Biological hydrogen production by immobilized cells of Clostridium tyrobutyricum JM1 isolated from a food waste treatment process. Bioresour Technol 2008; 99: [PMID: DOI: / j.biortech ] 49 Sun YQ, Xiu ZL, Li XH, Zhang DJ. Stoichiometric analysis of biological hydrogen production by fermentative bacteria. Int J Hydrogen Energy 2006; 31: [DOI: / j.ijhydene ] 50 Cardinal JS, Zhan J, Wang Y, Sugimoto R, Tsung A, McCurry KR, Billiar TR, Nakao A. Oral hydrogen water prevents chronic allograft nephropathy in rats. Kidney Int 2010; 77: [PMID: DOI: /ki ] 51 Buchholz BM, Kaczorowski DJ, Sugimoto R, Yang R, Wang Y, Billiar TR, McCurry KR, Bauer AJ, Nakao A. Hydrogen 8350 July 21, 2015 Volume 21 Issue 27

145 Wang FY et al. Effects of C. butyricum on gastric ulcers inhalation ameliorates oxidative stress in transplantation induced intestinal graft injury. Am J Transplant 2008; 8: [PMID: DOI: /j x] 52 Liu X, Chen Z, Mao N, Xie Y. The protective of hydrogen on stress-induced gastric ulceration. Int Immunopharmacol 2012; 13: [PMID: DOI: /j.intimp ] P- Reviewer: Ozturk O, Rocha JBT, Rodrigo L S- Editor: Yu J L- Editor: Stewart G E- Editor: Liu XM 8351 July 21, 2015 Volume 21 Issue 27

146 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Basic Study Apoptosis of human pancreatic carcinoma cell-1 cells induced by Yin Chen Hao Decoction ORIGINAL ARTICLE Hai-Bo Zhou, Jing-Ming Chen, Li-Ming Shao, Zhi-Gang Chen Hai-Bo Zhou, Jing-Ming Chen, Li-Ming Shao, Zhi-Gang Chen, Department of Gastroenterology, the Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou , Zhejiang Province, China Author contributions: Zhou HB designed and coordinated the research and wrote the paper; Chen JM and Chen ZG performed the majority of experiments; and Shao LM analyzed the data. Supported by Traditional Chinese Medicine Administration of Zhejiang Province, China, No. 2014ZA068. Institutional review board statement: The study was reviewed and approved by Chinese Medicine Administration Bureau of Zhejiang. Conflict-of-interest statement: The authors declare no conflict of interests. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Hai-Bo Zhou, MD, Department of Gastroenterology, the Second Affiliated Hospital of Zhejiang University School of Medicine, No. 88, Jiefang Road, Hangzhou , Zhejiang Province, China. zhouhaibohz@163.com Telephone: Received: January 24, 2015 Peer-review started: January 25, 2015 First decision: February 10, 2015 Revised: March 9, 2015 Accepted: April 17, 2015 Article in press: April 17, 2015 Published online: July 21, 2015 Abstract AIM: To evaluate human pancreatic carcinoma cell line (PANC-1) cells apoptosis and Bcl-2 and Bax expression induced by Yin Chen Hao Decoction (YCHD). METHODS: The cell growth inhibitory rate was determined by MTT assay. Apoptosis of PANC-1 cells before and after treatment with YCHD was determined by TUNEL staining. Expression of the apoptosisassociated genes, Bcl-2 and Bax, was detected by immunohistochemical staining and reverse transcription -PCR. RESULTS: YCHD inhibited the growth of PANC-1 cells. Following treatment with YCHD for h, the apoptotic rate of PANC-1 cells increased with time. In addition, the positive rate of Bcl-2 protein expression decreased in a time-dependent manner, whereas the positive rate of Bax protein expression increased in a time-dependent manner. Following treatment of with YCHD for 24-96h, expression of BAX mrna increased gradually and BCL-2 mrna reduced gradually with time. CONCLUSION: YCHD induces apoptosis of PANC-1 cells mediated in part via up-regulation of BAX and down-regulation of BCL-2. Key words: Apoptosis; Pancreatic carcinoma; Yin Chen Hao Decoction The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Yin Chen Hao Decoction (YCHD) inhibits the growth of pancreatic carcinoma cells. Following treatment with YCHD for h, the apoptotic rates in these cells is increased by YCHD, which is accompanied by time-dependent increased expression of Bax and 8352 July 21, 2015 Volume 21 Issue 27

147 Zhou HB et al. Yin Chen Hao Decoction induces apoptosis decreased expression of Bcl-2. YCHD-induced apoptosis of these cells may be mediated by upregulation of BAX and downregulation of BCL-2. Zhou HB, Chen JM, Shao LM, Chen ZG. Apoptosis of human pancreatic carcinoma cell-1 cells induced by Yin Chen Hao Decoction. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8352.htm DOI: i INTRODUCTION Yin Chen Hao Decoction (YCHD) is a classic Chinese medicine formula consisting of three herbal drugs Rheum officinale Baill, Artemisia capillaries Thunb and Gardenia iasminoides Ellis, and has long been used to treat cholestasis, hepatitis C [1], primary biliary cirrhosis [2], and liver fibrosis [3]. Previous research reported that YCHD is effective for choleresis and has anti-inflammatory and anti-asthmatic activity to relax bronchial smooth muscle [4,5]. Moreover, YCHD is a potent inhibitor of carcinoma [6]. The anti-cancer activity of YCHD may induce apoptosis of carcinoma cells. The Bcl-2 family plays a key role in the apoptosis. The Bcl-2 family includes proapoptotic members, such as Bax and Bad, and antiapoptotic members such as Bcl-2 and Bcl-xL [7-10]. Overexpression of Bax can quicken cell death [11-20], whereas overexpression of Bcl-2 can delay cell death [20-29]. The critical determinant of cell apoptosis is the ratio of Bcl-2/Bax [30]. In this study, the cell growth inhibitory rate was determined by MTT assay. The apoptosis status in pancreatic carcinoma PANC-1 cells after YCHD treatment was determined by the TUNEL staining method. Gene and protein expression of Bcl-2 and Bax was detected by immunohistochemical staining and reverse transcription (RT)-PCR, respectively. MATERIALS AND METHODS Materials Rheum officinale Baill, Artemisia capillaries Thunb and Gardenia iasminoides Ellis were purchased from the Second Affiliated Hospital of Zhejiang University, China. MTT was obtained from Sigma-Aldrich (St. Louis, MO, Unite States). The in situ cell detection kit and anti-bcl-2 and anti-bax monoclonal antibodies were purchased from Beijing Zhongshan Biotechnology Co, Ltd., (Beijing, China). Human pancreatic carcinoma PANC-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Methods For the preparation of YCHD, Artemisia capillaries Thunb (200 g), Gardenia iasminoides Ellis (100 g) and Rheum officinale Baill (60 g) were placed in a roundbottomed flask and boiled for 1 h in distilled water was added and then boiled for 1 h. The decoction was then percolated to obtain the filtrate and the residue was reboiled twice. The collected filtrates were then added together and concentrated under reduced pressure. The concentrated liquid was then vacuum dried. The yield of YCHD extract was 28.6% and the concentration was 40 μg/ml. The extract was stored in a desiccator until use. Cell culture The PANC-1 cells were incubated in Dulbecco s modified Eagle s medium (HyClone of Thermo Fisher Scientific, Waltham, MA, United States) supplemented with 2 mmol/l glutamine, 0.05 g/l penicillin, 0.1 g/l streptomycin, and 10% fetal bovine serum (FBS) at 37 in a humidified atmosphere containing 5% CO2. The culture medium was replaced every two days. MTT assay Cells were seeded at cells/well in 96-well plate overnight and treated with various concentrations of YCHD (5 μg/ml, 10 μg/ml, 20 μg/ml and 40 μg/ml) for different times for 24 h, 48 h and 72 h. After treatment, an MTT assay was used to determine cell densities. All experiments were performed in triplicate three separate times. TUNEL assay A MEBSTAIN Apoptosis Kit Direct (MBL International, Woburn, MA, United States) was used to perform TUNNEL staining according to the manufacturer s protocol. Nucleosome-sized DNA fragments are detected by tailing their 3 -OH ends with digoxigenin nucleotides using terminal deoxynucleotidyl transferase (TdT). After treatment, the cells were combined with POD-horseradish peroxidase and incubated with the TdT buffer. The numbers of TUNNEL-positive cells was counted under a light microscope. Immunohistochemical staining Pancreatic carcinoma PANC-1 cells were exposed to YCHD (20 μg/ml) for various times(24 h, 48 h, 72 h and 96 h). After treatment, the cells were grown on six-well glass plates and were fixed with acetone. After washing in PBS, The cells were washed with PBS and incubated in 3 ml/l H2O2 solution at room temperature for 5 min. Then, anti-bcl-2 or anti- Bax monoclonal antibodies at a 1:300 dilution were added and incubated at 4 overnight. The cells were washed with PBS and incubated with the secondary antibody(biotinylated anti-rat IgG) at room temperature for 1 h. Then the cells were washed with PBS and incubated with ABC compound (Vector Laboratories Inc., Burlingame, CA, United States) at room temperature for 10 min. DAB was used as the chromagen. After 10 min, the brown color signifying 8353 July 21, 2015 Volume 21 Issue 27

148 Zhou HB et al. Yin Chen Hao Decoction induces apoptosis Table 1 Effects of various concentrations of Yin Chen Hao Decoction on apoptosis of pancreatic carcinoma cell line-1 cells Concentration (µg/ml) Treatment time (h) Control ± ± ± ± a ± b ± b ± b ± b ± b ± b ± b ± b ± b ± b ± b a P < 0.05; b P < 0.01 vs control group. ml) for 24 h, 48 h, and 72 h. Apoptosis of PANC-1 cells was increased with dose and time (Table 1). TUNEL assay A TUNEL assay detected apoptotic cells according to the manufacturer s instructions. Positive staining was located in the nucleus (Figure 1). The apoptotic index of PANC-1 cells was increased with time (Table 2). Figure 1 TUNEL assay of apoptotic pancreatic carcinoma cell line-1 cells induced by Yin Chen Hao Decoction. Magnification 200. the presence of antigen bound to antibodies was detected by light microscopy and photographed at magnification 200. RT-PCR PANC-1 cells were exposed to YCHD (20 μg/ml) for various times (24 h, 48 h, 72 h and 96 h) and total RNA was extracted. The primers for Bcl-2, Bax, and β-actin in were as follows: β-actin (500 bp): 5 -GTGGGGCGCCCCAGGCACCA-3 and 5 -CTCCTTAATGTCACGCACGATTTC-3 ; Bcl-2 (716 bp): 5 -GGAAATATGGCGCACGCT-3 and 5- TCACTTGTGGCCCAGAT-3 ; Bax (508 bp): 5 -CCAGCTCTGAGCAGATCAT-3 and 5- TATCAGCCCA TCTTCTTCC-3. PCR was performed using the following procedures: 94 for 7 min followed 35 (Bax) or 30 (Bcl-2 and β-actin) cycles of 94 for 1 min, 60 for 45 s, and 72 for 45 s, and completed with one cycle at 72 for 7 min. For visualization, 10 µl of PCR product was loaded onto a 15 g/l agarose gel. Statistical analysis Statistical differences of data were analyzed by the paired two-tailed Student s t-test. P < 0.05 was considered significant. RESULTS MTT assay PANC-1 cells were exposed to various concentrations of YCHD (5 µg/ml, 10 µg/ml, 20 µg/ml, and 40 µg/ Expression of Bcl-2 proteins Positive staining was located in the cytoplasm (Figure 2A). PANC-1 cells were exposed to YCHD (20 µg/ml) for various times (24 h, 48 h, 72 h, and 96 h). The positive rate of Bcl-2 expression in PANC-1 cells was reduced with time (P < 0.05) (Table 3). Expression of Bax proteins Positive staining was located in the cytoplasm (Figure 2B). PANC-1 cells were exposed to YCHD (20 µg/ml) for various times (24 h, 48 h, 72 h, and 96 h). The positive rate of Bax expression increased with time (P < 0.05) (Table 4). RT-PCR When PANC-1 cells were exposed to YCHD (20 µg/ml) for various times (24 h, 48 h, 72 h, and 96 h), the expression of Bcl-2 mrna decreased and Bax mrna increased with time. DISCUSSION Cancer involves dysregulation of the cell cycle and uncontrolled growth due to the combined effects of hereditary and environmental factors. The mechanism of cell cycle dysregulation is an important cause of cell proliferation, which leads to cancer. Normally, each period of cell division and proliferation are strictly regulated by a variety of specific proteins. The results of the present study show that apoptosis of PANC-1 cells is time- and dose-dependent. This suggests that YCHD inhibits the growth of pancreatic carcinoma cells. Following treatment with 20 µg/ml YCHD, the positive rate of Bax protein expression was significantly increased, whereas the rate of Bcl-2 protein expression was significantly reduced with time. Furthermore, the expression of Bcl-2 mrna decreased and the density of Bax mrna 8354 July 21, 2015 Volume 21 Issue 27

149 Zhou HB et al. Yin Chen Hao Decoction induces apoptosis Table 2 Apoptotic index of pancreatic carcinoma cell line-1 cells treated with Yin Chen Hao Decoction (%) Treatment time (h) Control Apoptotic index 1.26 ± ± ± ± ± 1.23 t P value 1 P < 0.05 P < 0.05 P < 0.05 P < vs control group. A B Figure 2 Immunohistochemical staining. A: Bcl-2; B: Bax; magnification 200. Table 3 Positive rate of Bcl-2 expression in pancreatic carcinoma cell line-1 cells treated with Yin Chen Hao Decoction (%) Treatment time (h) Control Positive rate ± ± ± ± ± 0.36 t P value 1 P < 0.01 P < 0.01 P < 0.01 P < vs control group. Table 4 Positive rate of Bax expression in pancreatic carcinoma cell line-1 cells treated with Yin Chen Hao Decoction (%) Treatment time (h) Control Positive rate ± ± ± ± ± 1.47 t P value 1 P < P < P < P < vs control group. increased with time. Thus, the ratio of Bcl-2/Bax decreased with YCHD treatment to result in apoptosis of these cells. In conclusion, this study demonstrates that YCHD induces apoptosis of pancreatic carcinoma cells. Decreased expression of the BCL2 and increased expression of BAX may induce apoptosis. YCHD may be a new drug for pancreatic cancer chemotherapy. COMMENTS Background Yin Chen Hao Decoction (YCHD) is a classic Chinese medicine formula consisting of three herbal drugs (Rheum officinale Baill, Artemisia capillaris Thunb, and Gardenia jasminoides Ellis), and has long been used to treat cholestasis, hepatitis C, primary biliary cirrhosis, and liver fibrosis. Previous research reported that YCHD is effective for choleresis and has antiinflammatory and antiasthmatic activity to relax bronchial smooth muscle. Moreover, reports show that YCHD is a potent inhibitor of carcinoma. The anticancer activity of YCHD may induce apoptosis of carcinoma cells. Research frontiers YCHD has antitumor effects. The research hotspot related to YCHD is how it affects the progression of human cancer. Innovations and breakthroughs The present study demonstrates that YCHD is able to induce apoptosis of pancreatic carcinoma cells. Decreased expression of BCL2 and increased expression of BAX may induce apoptosis. Applications In understanding the role and mechanism of YCHD against pancreatic carcinoma, this study is expected to suggest a way of improving clinical 8355 July 21, 2015 Volume 21 Issue 27

150 Zhou HB et al. Yin Chen Hao Decoction induces apoptosis treatment. Peer-review This study is a very enjoyable and valuable work. The results may represent a molecular mechanism of YCHD for treatment of pancreatic carcinoma. REFERENCES 1 Itoh T, Shibahara N, Mantani N, Tahara E, Shimada Y, Terasawa K. Effect of Kampo treatment on chronic viral hepatitis on the basis of traditional diagnosis. J Tradit Med 1997; 14: Onji M, Kikuchi T, Michitaka K, Yamashita K, OhtaY. Combined use of ursodeo ycholic acid and Inchinko-to in jaundice patients with primary bjliaryclrrhosis. J Med Pharmaceut 1990; 7: Arai M, Yokosuka O, Fukai K, Kanda T, Kojima H, Kawai S, Imazeki F, Hirasawa H, Saisho H. A case of severe acute hepatitis of unknown etiology treated with the Chinese herbal medicine Inchinko-to. Hepatol Res 2004; 28: [PMID: ] 4 Liu YJ, Li Z, Lin ZB. Scoparone s effects on the airway smooth muscle of asthmatic guinea pigs. Zhongguo Yike Daxue Xuebao 2001; 30 (Supp1): Yuan X, Li Z, Liu HR, Yu XH, Han LW. Inhibitory effect of scoparone on airway inflammation and enhanced ROS of asthmatic models of guinea pigs. Zhongguo Yike Daxue Xuebao 2002; 31: Chen SD, Zhou HH, Li XM, Lin JP, Fan Y, Xu WJ. Inhibitory effects of Yinchenhao Decoction Inhibitory on fatty deposition and TNF- α secretion in HepG2 cells inducedby free fatty acid. Zhonghua Zhongyiyao Zazhi 2010; 9: Konopleva M, Konoplev S, Hu W, Zaritskey AY, Afanasiev BV, Andreeff M. Stromal cells prevent apoptosis of AML cells by up-regulation of anti-apoptotic proteins. Leukemia 2002; 16: [PMID: DOI: /sj.leu ] 8 van der Woude CJ, Jansen PL, Tiebosch AT, Beuving A, Homan M, Kleibeuker JH, Moshage H. Expression of apoptosis-related proteins in Barrett s metaplasia-dysplasia-carcinoma sequence: a switch to a more resistant phenotype. Hum Pathol 2002; 33: [PMID: DOI: /hupa ] 9 Panaretakis T, Pokrovskaja K, Shoshan MC, Grandér D. Activation of Bak, Bax, and BH3-only proteins in the apoptotic response to doxorubicin. J Biol Chem 2002; 277: [PMID: DOI: /jbc.M ] 10 Bellosillo B, Villamor N, López-Guillermo A, Marcé S, Bosch F, Campo E, Montserrat E, Colomer D. Spontaneous and druginduced apoptosis is mediated by conformational changes of Bax and Bak in B-cell chronic lymphocytic leukemia. Blood 2002; 100: [PMID: DOI: /blood ] 11 Qian W, Salamoun J, Wang J, Roginskaya V, Van Houten B, Wipf P. The combination of thioxodihydroquinazolinones and platinum drugs reverses platinum resistance in tumor cells by inducing mitochondrial apoptosis independent of Bax and Bak. Bioorg Med Chem Lett 2015; 25: [PMID: DOI: / j.bmcl ] 12 Zhang Y, Yan H. [Effect of simvastatin on retinal Bcl-2/Bax expression and cell apoptosis in rats with ischemia-reperfusion injury]. Zhonghua Yanke Zazhi 2014; 50: [PMID: ] 13 Azova MM, Blagonravov ML, Frolov VA. Effect of phosphocreatine and ethylmethylhydroxypyridine succinate on the expression of Bax and Bcl-2 proteins in left-ventricular cardiomyocytes of spontaneously hypertensive rats. Bull Exp Biol Med 2015; 158: [PMID: ] 14 Fan W, Du F, Liu X. Effects of hepatitis C virus gene NS2 on the expressions of Bcl-2 and Bax in HepG2 cells. J Pak Med Assoc 2014; 64: [PMID: ] 15 Peng X, Chen K, Chen J, Fang J, Cui H, Zuo Z, Deng J, Chen Z, Geng Y, Lai W. Aflatoxin B1 affects apoptosis and expression of Bax, Bcl-2, and Caspase-3 in thymus and bursa of fabricius in broiler chickens. Environ Toxicol 2015; Epub ahead of print [PMID: DOI: /tox.22120] 16 Ghasemian M, Mahdavi M, Zare P, Ali Hosseinpour Feizi M. Spiroquinazolinone-induced cytotoxicity and apoptosis in K562 human leukemia cells: alteration in expression levels of Bcl-2 and Bax. J Toxicol Sci 2015; 40: [PMID: DOI: /jts ] 17 Fickova M, Macho L, Brtko J. A comparison of the effects of tributyltin chloride and triphenyltin chloride on cell proliferation, proapoptotic p53, Bax, and antiapoptotic Bcl-2 protein levels in human breast cancer MCF-7 cell line. Toxicol In Vitro 2015; 29: [PMID: DOI: /j.tiv ] 18 Abarikwu SO, Farombi EO. Atrazine induces apoptosis of SH- SY5Y human neuroblastoma cells via the regulation of Bax/ Bcl-2 ratio and caspase-3-dependent pathway. Pestic Biochem Physiol 2015; 118: [PMID: DOI: / j.pestbp ] 19 Wang Y, Yin RF, Teng JS. Wogonoside induces cell cycle arrest and mitochondrial mediated apoptosis by modulation of Bcl-2 and Bax in osteosarcoma cancer cells. Int J Clin Exp Pathol 2015; 8: [PMID: ] 20 Zhu L, Han MB, Gao Y, Wang H, Dai L, Wen Y, Na LX. Curcumin triggers apoptosis via upregulation of Bax/Bcl-2 ratio and caspase activation in SW872 human adipocytes. Mol Med Rep 2015; 12: [PMID: DOI: /mmr ] 21 Hao C, Gao L, Zhang Y, Wang W, Yu G, Guan H, Zhang L, Li C. Acetylated chitosan oligosaccharides act as antagonists against glutamate-induced PC12 cell death via Bcl-2/Bax signal pathway. Mar Drugs 2015; 13: [PMID: DOI: / md ] 22 Zhang G, Wan Y, Zhang Y, Lan S, Jia R, Wang Z, Fan Y, Wang F. Expression of Mitochondria-Associated Genes (PPARGC1A, NRF-1, BCL-2 and BAX) in Follicular Development and Atresia of Goat Ovaries. Reprod Domest Anim 2015; 50: [PMID: DOI: /rda.12514] 23 Qu Y, Zhang X, Wu R. Knockdown of NF-κB p65 subunit expression suppresses growth of nude mouse lung tumor cell xenografts by activation of Bax apoptotic pathway. Neoplasma 2015; 62: [PMID: DOI: /neo_2015_005] 24 Jung KJ, Min KJ, Bae JH, Kwon TK. Carnosic acid sensitized TRAIL-mediated apoptosis through down-regulation of c-flip and Bcl-2 expression at the post translational levels and CHOPdependent up-regulation of DR5, Bim, and PUMA expression in human carcinoma caki cells. Oncotarget 2015; 6: [PMID: ] 25 Choi JE, Woo SM, Min KJ, Kang SH, Lee SJ, Kwon TK. Combined treatment with ABT-737 and VX-680 induces apoptosis in Bcl-2- and c-flip-overexpressing breast carcinoma cells. Oncol Rep 2015; 33: [PMID: DOI: / or ] 26 Fu H, Wang QS, Luo Q, Tan S, Su H, Tang SL, Zhao ZL, Huang LP. Simvastatin inhibits apoptosis of endothelial cells induced by sepsis through upregulating the expression of Bcl-2 and downregulating Bax. World J Emerg Med 2014; 5: [PMID: DOI: /wjem.j.issn ] 27 Ye L, Yuan G, Xu F, Sun Y, Chen Z, Chen M, Li T, Sun P, Li S, Sun J. The small-molecule compound BM-1197 inhibits the antiapoptotic regulators Bcl-2/Bcl-xL and triggers apoptotic cell death in human colorectal cancer cells. Tumour Biol 2015; 36: [PMID: ] 28 EI-Emshaty HM, Saad EA, Toson EA, Abdel Malak CA, Gadelhak NA. Apoptosis and cell proliferation: correlation with BCL-2 and P53 oncoprotein expression in human hepatocellular carcinoma. Hepatogastroenterology 2014; 61: [PMID: ] 29 Song H, Han IY, Kim Y, Kim YH, Choi IW, Seo SK, Jung SY, Park S, Kang MS. The NADPH oxidase inhibitor DPI can abolish hypoxia-induced apoptosis of human kidney proximal tubular epithelial cells through Bcl2 up-regulation via ERK activation without ROS reduction. Life Sci 2015; 126: [PMID: 8356 July 21, 2015 Volume 21 Issue 27

151 Zhou HB et al. Yin Chen Hao Decoction induces apoptosis DOI: /j.lfs ] 30 Pettersson F, Dalgleish AG, Bissonnette RP, Colston KW. Retinoids cause apoptosis in pancreatic cancer cells via activation of RAR-gamma and altered expression of Bcl-2/Bax. Br J Cancer 2002; 87: [PMID: DOI: / sj.bjc ] P- Reviewer: Nakano H S- Editor: Ma YJ L- Editor: AmEditor E- Editor: Zhang DN 8357 July 21, 2015 Volume 21 Issue 27

152 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Case Control Study ORIGINAL ARTICLE Clinical features of second primary cancers arising in early gastric cancer patients after endoscopic resection Jung-Wook Kim, Jae-Young Jang, Young Woon Chang, Yong Ho Kim Jung-Wook Kim, Jae-Young Jang, Young Woon Chang, Department of Internal Medicine, College of Medicine, Kyung Hee University, Seoul , South Korea Yong Ho Kim, Department of Surgery, College of Medicine, Kyung Hee University, Seoul , South Korea Author contributions: Kim JW and Jang JY designed the study; Chang YW and Kim YH analyzed data; Kim JW wrote the manuscript; Chang YW revised the paper; and Jang JY approved the final version. Supported by Kyung Hee University for the young medical researcher in 2007 (KHU ). Institutional review board statement: The study was reviewed and approved by the Institutional Review Board of Kyung Hee University Hospital (KMC IRB ) Informed consent statement: Because this was a retrospective study with minimal risk to patients, it was exempted from obtaining informed consent by the IRB. Conflict-of-interest statement: All authors declare no conflicts of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Jae-Young Jang, MD, PhD, Department of Internal Medicine, College of Medicine, Kyung Hee University, 1 Hoegi-dong, Dongdaemoongu, Seoul , South Korea. jyjang@khu.ac.kr Telephone: Fax: Received: February 24, 2015 Peer-review started: February 26, 2015 First decision: March 26, 2015 Revised: April 7, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract AIM: To investigate the incidence and distribution of second primary cancers (SPCs) in early gastric cancer (EGC) patients who underwent endoscopic resection (ER), compared to advanced gastric cancer (AGC) patients who underwent surgery. METHODS: The medical records of 1021 gastric cancer (GC) patients were retrospectively reviewed from January 2006 to December The characteristics and incidence of SPCs were investigated in those with EGC that underwent curative ER (the EGC group) and those with AGC who underwent curative surgical resection (the AGC group). RESULTS: We ultimately enrolled 184 patients in the EGC group and 229 patients in the AGC group. A total of 38 of the 413 (9.2%) GC patients had SPCs; the rate was identical in both groups. Of these 38 patients, 18 had synchronous and 20 had metachronous cancers. The most common SPC was lung cancer (18.4%), followed by colorectal cancer (13.2%) and esophageal cancer (13.2%). No significant risk factors were identified for the development of SPCs. CONCLUSION: Endoscopists should provide close surveillance and establish follow-up programs to ensure SPC detection in GC patients undergoing curative 8358 July 21, 2015 Volume 21 Issue 27

153 Kim JW et al. Second primary cancers and early gastric cancer resection regardless of their clinical characteristics. Key words: Second primary cancers; Early gastric cancer; Endoscopic resection; Advanced gastric cancer The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In this study, we investigate the incidence and distribution of second primary cancers (SPCs) in early gastric cancer (EGC) patients who underwent endoscopic resection (ER) compared to advanced gastric cancer patients who underwent surgery. Although SPCs developed rather commonly in gastric cancer patients, no significant risk factors were identified for their development. Therefore, endoscopists should perform close surveillance and establish follow-up programs for SPC detection after use of ER to treat EGC. Kim JW, Jang JY, Chang YW, Kim YH. Clinical features of second primary cancers arising in early gastric cancer patients after endoscopic resection. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8358.htm DOI: org/ /wjg.v21.i INTRODUCTION Worldwide, gastric cancer (GC) is the fourth most common cancer and the second-leading cause of cancer-related death, and is especially prevalent in the Asia-Pacific region including Korea [1]. Recently, the outcomes of GC patients have significantly improved, attributable to the introduction of periodic cancer screening programs and advances in early-detection techniques, surgical procedures, and multimodal treatments [2-5]. In practice, annual mortality from GC is continuously decreasing in Korea [6]. Also, implementation of a population-based mass-screening program has increased the detection rate of early gastric cancers (EGCs) from 33% in 1999 to 60% in 2012 [7]. Along with this increase, endoscopic resection (ER), including both endoscopic mucosal resection (EMR) and endoscopic submucosal dissection (ESD), has become a widely accepted standard technique for treatment of EGC in Korea and Japan, associated with a nominal risk of lymph node metastasis. The technique is minimally invasive, safe, and convenient [8-10]. To date, several reports have described excellent short- and long-term outcomes in patients who have undergone curative ER of EGC; the 5-year survival rate is 96.8% [9,11,12]. Such improved outcomes are associated with increases in the risk of development of second primary cancers (SPCs) at different locations throughout the body [13]. The risk of developing an SPC in cancer patients is considerably higher than in the general population [14]. As SPCs may have adverse effects on the overall prognosis of GC, early detection and proper management of SPCs in patients who have undergone curative resection of GC is especially important [13]. To date, few studies have explored the incidence or clinical features of SPCs in GC patients; those that have, studied heterogeneous groups of GC patients [13,15-18]. Further, although ER is now widely performed in EGC patients, no study has yet analyzed the clinical features of SPCs in EGC patients who have undergone ER. Apart from showing that ER is appropriate for treatment of very early-stage EGC, it is important to emphasize that long-term and regular endoscopic surveillance must be conducted to detect local recurrence or the development of metachronous GC. In addition, surveillance of SPCs may be an important responsibility of endoscopists, especially in patients with endoscopically resectable EGCs. Therefore, in the present study, we excluded GC patients who underwent non-curative resection (in whom SPCs are of relatively low importance), to focus on GC patients with very early-stage EGC, who require particular attention from endoscopists. We compared the incidence of, clinical features of, and risk factors for, SPC between two groups: EGC patients who underwent curative ER, and AGC patients who underwent curative surgical resection. We also attempted to identify risk factors that may have contributed to the development of SPCs in EGC patients who underwent ER. MATERIALS AND METHODS Study population Between January 2006 and December 2010, 1021 patients with GC were diagnosed and managed at the Kyung Hee University Hospital, Seoul, Korea, and we retrospectively analyzed their data. All patients underwent surgical or endoscopic GC resection. EGC patients underwent EMR or ESD according to individual indications. AGC patients underwent either partial or total gastrectomy, with lymph node dissection, depending on tumor location. Patients who had a previous history of malignancy, died within 1 year after diagnosis of GC, or required further therapy including chemotherapy, radiation therapy, or additional surgery were excluded. EGC patients who did not undergo curative ER of EGC, or who exhibited an undifferentiated histology, were also excluded. Curative ER for EGC was defined as R0 resection followed by pathological confirmation that resected specimens were included in the conventional indication [10] of EMR or the expanded indication [19] of ESD for EGC. R0 resection was defined as lateral tumor-free margin 2 mm and vertical tumor-free margin 0.5 mm on histologic examination after ER. Surgery was recommended to any patient who did not fulfill the criteria of curative ER upon pathological assessment following ER July 21, 2015 Volume 21 Issue 27

154 Kim JW et al. Second primary cancers and early gastric cancer Clinical characteristics, including age, gender, history of smoking, alcohol consumption, the GC cell type, diagnosis of early or advanced GC, and Helicobacter pylori (H. pylori) infection were assessed. H. pylori infection was determined using either a rapid urease test, a 13 C-urea breath test, or histology. All patients with GC underwent preoperative esophagogastroduodenoscopy. The standard preoperative or preprocedural workup for GC included a complete physical examination, routine blood testing including measurement of tumor markers, chest X-ray, computed tomography (CT) of the chest and abdomen, and whole-body positron emission tomography (PET)-CT. On regular follow-up examinations after treatment, blood tests, a chest X-ray, abdominal CT, and endoscopy of the gastrointestinal (GI) tract were performed. The study was approved by the Institutional Review Board of Kyung Hee University Hospital (KMC IRB ). Endoscopic resection All ER procedures were performed by a single experienced endoscopist (Jang JY) who had performed more than 1500 procedures. ER involved performance of both ESD and EMR. All EGC patients who underwent ER met the conventional or expanded criteria for EMR or ESD [10,19]. EMR was performed to treat lesions < 10 mm in diameter. ESD was performed for lesions 10 mm and for lesions that exhibited a high probability of piecemeal resection. EMR-P (precutting) was used on the lesion to avoid any incomplete resection of the transverse cutting. Lesions were marked externally using argon plasma coagulation (ERBE, Tubingen, Germany). To lift the lesion, a mixture of glycerin, epinephrine, and indigo carmine was locally injected into the external side of the marking. Once the lesion was lifted, incisions were made into its external side using a needle knife (KD-V451M, Olympus Medical Systems Co., Ltd., Tokyo, Japan) or an insulated tipped (IT) knife 2 (KD-611L, Olympus Medical Systems Co., Ltd., Tokyo, Japan). VIO 300D (ERBE, Tubingen, Germany) was used as the electrosurgical unit. In cases of EMR-P, after performing circumferential mucosal incision, a snare (SD-210U-15, 25, Olympus Medical Systems Co., Ltd., Tokyo, Japan) was mounted along the incision groove to subsequently dissect the lesion. In patients treated via ESD, a standard ESD method was used to achieve tumor resection. A typical sequence featured marking, incision, and submucosal dissection with simultaneous hemostasis. After placing an IT knife 2 into the incision site, resection was completed via submucosal dissection performed parallel to the proper muscle layer. Second primary cancers The diagnostic criteria of Warren and Gates [20] were used to diagnose SPCs: (1) a tumor must be unequivocally malignant upon histological evaluation; (2) each cancer must be geographically separate and distinct; and (3) the possibility that the second cancer represents a metastasis must be excluded. If necessary, immunohistochemical stains were used to differentiate SPCs from the metastasis of primary gastric cancer. SPCs were categorized into two groups depending on time of detection: synchronous cancer and metachronous cancer. Synchronous cancer was defined as a cancer diagnosed at the same time as the first primary cancer or within the following year, and metachronous cancer was defined as a cancer developing more than 1 year later. All GCs and SPCs were confirmed pathologically and/or radiologically. Statistical analysis Between-group comparisons of clinical features were performed using the two-tailed χ 2 test and the independent samples t-test. Logistic regression analysis was used to define risk factors for SPC. Statistical analyses were performed using SPSS software (version 18.0; SPSS Inc., Chicago, IL, United States). A P value < 0.05 was considered to be statistically significant. RESULTS Clinical characteristics of the patients Of the 1021 GC patients reviewed, we enrolled 413 patients who underwent curative endoscopic or surgical resection. A total of 314 EGC subjects were excluded because of surgery (249), a previous history of malignancy (9), loss to follow-up (8), performance of non-curative ER (34), or undifferentiated histology (14). Also, 294 AGC subjects were excluded because they required additional therapy after surgery (267), died within 1 year after diagnosis of GC (15), or had a previous history of malignancy (12). Finally, we evaluated 184 EGC patients who underwent curative ER (the EGC group) and 229 AGC patients who underwent curative surgical resection (the AGC group) (Figure 1). Table 1 shows the clinical characteristics of both groups. No differences existed in the age and gender distribution between the groups (P = and P = 0.159, respectively). The incidence of cigarette smoking (59.8% vs 47.6%, P = 0.014) and alcohol consumption (52.7% vs 40.6%, P = 0.014) was higher in the EGC group than in the AGC group. The prevalence of H. pylori infection was higher in the AGC group (57.1% vs 66.8%, P = 0.042). All patients in the EGC group exhibited a differentiated histology. There were no significant differences between the two groups with regard to the mean follow-up period (36.9 ± 14.9 mo vs 37.4 ± 16.7 mo, P = 0.679). Characteristics of SPCs SPCs were identified in 9.2% of the patients in the EGC group and 9.2% of the patients in the AGC group. Notably, the overall incidence of SPC did not differ between the two groups (P = 0.981). Synchronous 8360 July 21, 2015 Volume 21 Issue 27

155 Kim JW et al. Second primary cancers and early gastric cancer Gastric cancer (1021) EGC (498) AGC (523) EGC with surgery (249) EGC with ER (249) Additional therapy (267) Previous malignancy (12) Death within 1 year (15) Previous malignancy (9) Follow up loss (8) Non-curative resection (34) Undifferentiated histology (14) EGC with curative ER (184) AGC with curative resection (229) Figure 1 Flow chart of patients included in the analysis. Table 1 Characteristics of the early gastric cancer and advanced gastric cancer groups n (%) Overall EGC group AGC group P value (n = 413) (n = 184) (n = 229) Mean age (mean ± SD, 61.3 ± ± ± yr) Gender Male 293 (70.9) 137 (74.5) 156 (68.1) Female 120 (29.1) 47 (25.5) 73 (31.9) Smoking 229 (55.4) 110 (59.8) 109 (47.6) Alcohol 190 (46.0) 97 (52.7) 93 (40.6) H. pylori infection 258 (62.5) 105 (57.1) 153 (66.8) Histology Differentiated 262 (63.4) 184 (100) 78 (34.1) < Undifferentiated 151 (36.6) (65.9) Follow-up duration (mean ± SD, months) 37.2 ± ± ± EGC: Early gastric cancer; AGC: Advanced gastric cancer; SD: Standard deviation; H. pylori: Helicobacter pylori. Table 2 Incidence of second primary cancers in gastric cancer patients n (%) Overall EGC group AGC group P value (n = 413) (n = 184) (n = 229) Second primary cancer 38 (9.2) 17 (9.2) 21 (9.2) Synchronous cancer 18 (4.4) 8 (4.3) 10 (4.4) Metachronous cancer 20 (4.8) 9 (4.9) 11 (4.8) EGC: Early gastric cancer; AGC: Advanced gastric cancer. cancers were diagnosed in 4.3% of the patients in the EGC group and 4.4% of the patients in the AGC group. Metachronous cancers were diagnosed in 4.9% of the patients in the EGC group and 4.8% of the patients in the AGC group. There were no differences in the overall incidence of synchronous and metachronous cancers between the two groups (P = and P = 0.967, respectively) (Table 2). The majority of SPCs in both groups were solid cancers (94.1% in the EGC group and 95.2% in the AGC group) (Figure 2). Table 3 shows the number of patients with various types of SPCs and GCs. The most common site of SPC occurrence in the EGC group was the lung (17.6%), followed by the colorectum (11.8%), esophagus (11.8%), and urogenital area (11.8%). The most frequent sites of SPC occurrence in the AGC group were the lung (19.0%), followed by the colorectum (14.3%) and esophagus (14.3%). Both groups exhibited one patient that developed hematologic malignancies: non-hodgkin lymphoma in the EGC group and multiple myeloma in the AGC group (Table 2 and Figure 2). Risk factors for SPCs in EGC patients who underwent curative ER Logistic regression analyses of risk factors showed that age, gender, smoking, alcohol consumption, and H. pylori infection were not significantly associated with incidence of synchronous cancer. In contrast, smoking, H. pylori infection, and being of male gender all tended to be associated with a higher incidence of metachronous cancer. Alcohol consumption, on the other hand, tended to be associated with a lower incidence of metachronous cancer. However, these data were not statistically significant (Table 4). DISCUSSION In Korea, the National Cancer Screening Program facilitates biennial gastroscopy or upper GI barium 8361 July 21, 2015 Volume 21 Issue 27

156 Kim JW et al. Second primary cancers and early gastric cancer EGC with curative ER AGC with curative resection Lung Colorectum Esophagus Urogenital Gynecology Pancreas Skin Hematology Other Figure 2 Site distribution of second primary cancers according to gastric cancer group. EGC: Early gastric cancer; AGC: Advanced gastric cancer. Table 3 Distribution of second primary cancers according to gastric cancer group n (%) Table 4 Logistic regression analysis of risk factors in the early gastric cancer group Location Overall EGC group AGC group Synchronous cancer Metachronous cancer (n = 38) (n = 17) (n = 21) Lung 7 (18.4) 3 (17.6) 4 (19.0) Colorectal 5 (13.2) 2 (11.8) 3 (14.3) Esophagus 5 (13.2) 2 (11.8) 3 (14.3) Urogenital 4 (10.5) 2 (11.8) 2 (9.5) Gynecologic 3 (7.9) 1 (5.9) 2 (9.5) Pancreas 3 (7.9) 1 (5.9) 2 (9.5) Skin 2 (5.3) 1 (5.9) 1 (4.8) Hematology 2 (5.3) 1 (5.9) 1 (4.8) Others 7 (18.3) 4 (23.4) 3 (14.3) OR (95%CI) P value OR (95%CI) P value Age (> 60 yr) ( ) ( ) Sex (male) ( ) ( ) Smoking ( ) ( ) Alcohol ( ) ( ) H. pylori infection ( ) ( ) EGC: Early gastric cancer; OR: Odds ratio; CI: Confidence interval; H. pylori: Helicobacter pylori. EGC: Early gastric cancer; AGC: Advanced gastric cancer. studies for anyone in the population over 40 years old. With such efforts, the overall proportion of earlystage GC occurrence has been progressively rising [3,4]. Kim et al [21] participated in the Korean National Cancer Screening Program conducted from 2007 to 2010, analyzed the results of gastroscopies, and found that 74.0% of diagnosed GCs were EGCs. Due to the fact that the skills and techniques of endoscopists have evolved and developed, ER is the preferred method for treating EGC when appropriately indicated. This treatment not only preserves the stomach, warranting a better quality of life [22], but is also associated with a good prognosis when considering a 5-year survival rate of 96.8% [9]. Consequently, GC patients who are cured through ER or surgery are more vulnerable to the development of SPCs during their lifetime than those who have not curative resection, which may potentially have adverse effects on their overall health. To improve the outcomes of GC patients, timely identification of SPCs is considered an important clinical issue. However, previous studies have focused on the occurrence of metachronous GC after ER of EGC, prevention of metachronous GC, or prediction of the risk thereof [23,24]. Therefore, our present study of SPCs in EGC patients who underwent ER is both timely and important. In the present study, the incidence of SPCs in patients who underwent ER for EGC and surgery for AGC was 9.2% in both groups. This incidence is somewhat higher than those of previous studies, in which the figure ranged from 2% to 8% [13,15-17]. One reason for the discrepancy may be that all patients enrolled in the present study underwent curative endoscopic or surgical resection. Because the survival rate of early-stage GC patients is good, SPCs are more frequently detected in such patients. Previous studies have also found as much [15,17,25]. Therefore, the high incidence of SPCs noted in the present study is attributable to the fact that the prognoses of our enrolled patients were expected to be excellent. We have confirmed that long-term survival may contribute to the development of SPCs. Thus, GC patients who have undergone curative resection require particularly careful monitoring for the development of SPCs. Another possible reason for the higher incidence of SPCs noted here is that the evaluation protocol of our center dictates that all GC patients undergo extensive pretreatment work-up including colonoscopy, a chest X-ray, chest and/or abdominal CT, or PET-CT. Patients were also closely monitored through a regular followup protocol, contributing to an increase in the detection rates of metachronous cancers. We compared two groups, EGC and AGC patients who underwent curative resection of primary GC. Some authors have sought to show that genetic 8362 July 21, 2015 Volume 21 Issue 27

157 Kim JW et al. Second primary cancers and early gastric cancer differences contribute to variation in the prognoses of EGC and AGC patients [26-28]. Several genetic changes in AGC patients may contribute to the development of SPCs. However, our results suggest the possibility that it makes no genetic difference contributing the development of SPC between EGC and AGC, because the SPC incidence after complete resection of the tumor was identical in the two groups. In the present study, lung cancer (18.4%) was the most common cancer noted in GC patients with SPCs, followed by colorectal cancer (13.2%) and esophageal cancer (13.2%); these figures are similar to those of previous reports [13,15,17]. Interestingly, more than 25% of SPCs occurred in the GI tract, including the esophagus and colorectum. Development of multiple primary cancers of the digestive tract has been associated with microsatellite instability [29,30]. It is well known that hereditary non-polyposis colorectal cancer patients tend to develop GC [31]. Taking the results of previous studies and those of the present study together, it is possible that multiple malignancies in the digestive tract share a common carcinogenic process. Therefore, the high incidence of other GI tract cancers developing in GC patients suggests the need for careful endoscopic evaluation of the whole digestive tract in GC patients. Next, it is possible that the high proportion of smokers (55.4%) in the present study affected the distribution and prevalence of SPCs. Cigarette smoking is a major risk factor for many cancers, especially those of the aerodigestive tract, such as lung and esophageal cancer [32]. An association between cigarette smoking and the development of GC and colorectal cancer has also been reported [33,34]. However, in the present study, such detection may have been in large part attributable to the performance of routine pre-operative colonoscopy, and postoperative endoscopic surveillance for GC; these tests detect colorectal and esophageal cancer, respectively. Although no mechanism underlying the association between GC and SPCs has yet been established, careful screening for lung and digestive tract cancers should follow a diagnosis of GC. We also analyzed risk factors for SPCs in EGC patients who underwent ER. Although previous studies have reported that age, smoking, differentiated histology, and being male are all risk factors of SPC development [13,16,25], no statistically meaningful risk factors were found in the present study. This may be attributable to our small sample size and shortterm follow-up. However, it is conceivable that the characteristics of very early-stage differentiated EGC patients with SPCs differ from those of later-stage or undifferentiated GC patients. This means that clinicians should pay particular attention to SPC development in all EGC patients undergoing ER, regardless of their characteristics. Our study had some limitations. First, the work was retrospective in nature and conducted in a single center. Second, our sample size may have been inadequate to allow evaluation of the precise prevalence and distribution of SPCs in EGC patients with ER. However, as we enrolled GC patients who underwent only curative endoscopic or surgical resection, we maintained group homogeneity in terms of analysis of SPC diagnosis. Third, the prevalence of H. pylori infection in our patients (62.5%) was low compared to that of previous studies [35]. This may be attributable to missed histories of H. pylori eradication and/or acid suppression therapy, as well as our small sample size. Lastly, because our follow-up period was relatively short, we have likely underestimated the prevalence of SPCs. However, previous studies found that many metachronous primary cancers developed within 3 or 5 years [15,36]. Therefore, our results are reliable, at least to some extent. Despite these limitations, it is very important that we investigated SPCs developing in very early-stage EGC patients who underwent ER. In conclusion, SPCs developed rather commonly in GC patients and early detection of SPCs is essential to improve the prognosis and longevity of such patients. Thus, clinicians should consider, at the time of diagnosis of or surveillance for GC, that multiple primary cancers may develop later. In particular, endoscopists should perform close surveillance and establish follow-up programs for SPC detection, as well as cancer recurrence and metachronous GC detection, after use of ER to treat EGC. COMMENTS Background Worldwide, gastric cancer (GC) is the fourth most common cancer and the second-leading cause of cancer-related death, and is especially prevalent in the Asia-Pacific region including Korea. In practice, annual mortality from GC is continuously decreasing in Korea. Research frontiers To date, several reports have described excellent short- and long-term outcomes in patients who have undergone curative endoscopic resection (ER) of early gastric cancer (EGC); the 5-year survival rate is 96.8%. Innovations and breakthroughs The authors also attempted to identify risk factors that may have contributed to the development of second primary cancers (SPCs) in EGC patients who underwent ER. Applications SPCs developed rather commonly in GC patients and early detection of SPCs is essential to improve the prognosis and longevity of such patients. Peer-review The manuscript submitted by Kim et al evaluates a set of gastric cancer patient data in regards to early and advanced stage gastric cancer and second primary cancer development incidence and location. REFERENCES 1 Kamangar F, Dores GM, Anderson WF. Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 2006; 24: [PMID: 8363 July 21, 2015 Volume 21 Issue 27

158 Kim JW et al. Second primary cancers and early gastric cancer DOI: /JCO ] 2 Otsuji E, Yamaguchi T, Sawai K, Hagiwara A, Taniguchi H, Takahashi T. Recent advances in surgical treatment have improved the survival of patients with gastric carcinoma. Cancer 1998; 82: [PMID: DOI: /(SICI) ( )82] 3 Yeoh KG. How do we improve outcomes for gastric cancer? J Gastroenterol Hepatol 2007; 22: [PMID: ] 4 Dan YY, So JB, Yeoh KG. Endoscopic screening for gastric cancer. Clin Gastroenterol Hepatol 2006; 4: [PMID: DOI: /j.cgh ] 5 Lordick F, Siewert JR. Recent advances in multimodal treatment for gastric cancer: a review. Gastric Cancer 2005; 8: [PMID: DOI: /s z] 6 Shin A, Kim J, Park S. Gastric cancer epidemiology in Korea. J Gastric Cancer 2011; 11: [PMID: DOI: /jgc ] 7 Yang HK. Sentinel node biopsy in early gastric cancer: constant exertion for clinical application. Ann Surg Oncol 2012; 19: [PMID: DOI: /s ] 8 Japanese Gastric Cancer Association. Japanese gastric cancer treatment guidelines 2010 (ver. 3). Gastric Cancer 2011; 14: [PMID: DOI: /s ] 9 Ahn JY, Jung HY, Choi KD, Choi JY, Kim MY, Lee JH, Choi KS, Kim do H, Song HJ, Lee GH, Kim JH, Park YS. Endoscopic and oncologic outcomes after endoscopic resection for early gastric cancer: 1370 cases of absolute and extended indications. Gastrointest Endosc 2011; 74: [PMID: DOI: /j.gie ] 10 Soetikno R, Kaltenbach T, Yeh R, Gotoda T. Endoscopic mucosal resection for early cancers of the upper gastrointestinal tract. J Clin Oncol 2005; 23: [PMID: DOI: / JCO ] 11 Isomoto H, Shikuwa S, Yamaguchi N, Fukuda E, Ikeda K, Nishiyama H, Ohnita K, Mizuta Y, Shiozawa J, Kohno S. Endoscopic submucosal dissection for early gastric cancer: a largescale feasibility study. Gut 2009; 58: [PMID: DOI: /gut ] 12 Goto O, Fujishiro M, Kodashima S, Ono S, Omata M. Outcomes of endoscopic submucosal dissection for early gastric cancer with special reference to validation for curability criteria. Endoscopy 2009; 41: [PMID: DOI: / s ] 13 Ikeda Y, Saku M, Kawanaka H, Nonaka M, Yoshida K. Features of second primary cancer in patients with gastric cancer. Oncology 2003; 65: [PMID: ] 14 Dong C, Hemminki K. Second primary neoplasms in 633,964 cancer patients in Sweden, Int J Cancer 2001; 93: [PMID: DOI: /ijc.1317] 15 Kim C, Chon H, Kang B, Kim K, Jeung HC, Chung H, Noh S, Rha S. Prediction of metachronous multiple primary cancers following the curative resection of gastric cancer. BMC Cancer 2013; 13: 394 [PMID: DOI: / ] 16 Buyukasik O, Hasdemir AO, Gulnerman Y, Col C, Ikiz O. Second primary cancers in patients with gastric cancer. Radiol Oncol 2010; 44: [PMID: DOI: /v ] 17 Eom BW, Lee HJ, Yoo MW, Cho JJ, Kim WH, Yang HK, Lee KU. Synchronous and metachronous cancers in patients with gastric cancer. J Surg Oncol 2008; 98: [PMID: DOI: /jso.21027] 18 Park YK, Kim DY, Joo JK, Kim JC, Koh YS, Ryu SY, Kim YJ, Kim SK. Clinicopathological features of gastric carcinoma patients with other primary carcinomas. Langenbecks Arch Surg 2005; 390: [PMID: DOI: /s ] 19 Gotoda T. Endoscopic resection of early gastric cancer. Gastric Cancer 2007; 10: 1-11 [PMID: DOI: /s ] 20 Warren S, Gates O. Multiple primary malignant tumours: A survey of the literature and a statistical study. Am J Cancer 1932; 16: Kim BJ, Heo C, Kim BK, Kim JY, Kim JG. Effectiveness of gastric cancer screening programs in South Korea: organized vs opportunistic models. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i5.736] 22 Nagano H, Ohyama S, Fukunaga T, Seto Y, Fujisaki J, Yamaguchi T, Yamamoto N, Kato Y, Yamaguchi A. Indications for gastrectomy after incomplete EMR for early gastric cancer. Gastric Cancer 2005; 8: [PMID: DOI: / s ] 23 Han JS, Jang JS, Choi SR, Kwon HC, Kim MC, Jeong JS, Kim SJ, Sohn YJ, Lee EJ. A study of metachronous cancer after endoscopic resection of early gastric cancer. Scand J Gastroenterol 2011; 46: [PMID: DOI: / ] 24 Maehata Y, Nakamura S, Fujisawa K, Esaki M, Moriyama T, Asano K, Fuyuno Y, Yamaguchi K, Egashira I, Kim H, Kanda M, Hirahashi M, Matsumoto T. Long-term effect of Helicobacter pylori eradication on the development of metachronous gastric cancer after endoscopic resection of early gastric cancer. Gastrointest Endosc 2012; 75: [PMID: DOI: /j.gie ] 25 Lee JH, Bae JS, Ryu KW, Lee JS, Park SR, Kim CG, Kook MC, Choi IJ, Kim YW, Park JG, Bae JM. Gastric cancer patients at high-risk of having synchronous cancer. World J Gastroenterol 2006; 12: [PMID: ] 26 Chung SJ, Kim YS, Yang SY, Song JH, Kim D, Park MJ, Kim SG, Song IS, Kim JS. Five-year risk for advanced colorectal neoplasia after initial colonoscopy according to the baseline risk stratification: a prospective study in 2452 asymptomatic Koreans. Gut 2011; 60: [PMID: DOI: /gut ] 27 Kim BS, Cho SW, Min SK, Lee BH. Differences in prognostic factors between early and advanced gastric cancer. Hepatogastroenterology 2011; 58: [PMID: ] 28 Vecchi M, Nuciforo P, Romagnoli S, Confalonieri S, Pellegrini C, Serio G, Quarto M, Capra M, Roviaro GC, Contessini Avesani E, Corsi C, Coggi G, Di Fiore PP, Bosari S. Gene expression analysis of early and advanced gastric cancers. Oncogene 2007; 26: [PMID: DOI: /sj.onc ] 29 Ohtani H, Yashiro M, Onoda N, Nishioka N, Kato Y, Yamamoto S, Fukushima S, Hirakawa-Ys Chung K. Synchronous multiple primary gastrointestinal cancer exhibits frequent microsatellite instability. Int J Cancer 2000; 86: [PMID: DOI: /(SICI) ( )86] 30 Horii A, Han HJ, Shimada M, Yanagisawa A, Kato Y, Ohta H, Yasui W, Tahara E, Nakamura Y. Frequent replication errors at microsatellite loci in tumors of patients with multiple primary cancers. Cancer Res 1994; 54: [PMID: ] 31 Lynch HT, Smyrk T. Hereditary nonpolyposis colorectal cancer (Lynch syndrome). An updated review. Cancer 1996; 78: [PMID: DOI: /(SICI) ( )78] 32 Vineis P, Alavanja M, Buffler P, Fontham E, Franceschi S, Gao YT, Gupta PC, Hackshaw A, Matos E, Samet J, Sitas F, Smith J, Stayner L, Straif K, Thun MJ, Wichmann HE, Wu AH, Zaridze D, Peto R, Doll R. Tobacco and cancer: recent epidemiological evidence. J Natl Cancer Inst 2004; 96: [PMID: ] 33 Chao A, Thun MJ, Henley SJ, Jacobs EJ, McCullough ML, Calle EE. Cigarette smoking, use of other tobacco products and stomach cancer mortality in US adults: The Cancer Prevention Study II. Int J Cancer 2002; 101: [PMID: DOI: / ijc.10614] 34 Liang PS, Chen TY, Giovannucci E. Cigarette smoking and colorectal cancer incidence and mortality: systematic review and meta-analysis. Int J Cancer 2009; 124: [PMID: DOI: /ijc.24191] 35 Wang C, Yuan Y, Hunt RH. The association between Helicobacter pylori infection and early gastric cancer: a meta-analysis. Am J Gastroenterol 2007; 102: [PMID: DOI: 8364 July 21, 2015 Volume 21 Issue 27

159 Kim JW et al. Second primary cancers and early gastric cancer /j x] 36 Wu CW, Lo SS, Chen JH, Hsieh MC, Li AF, Lui WY. Multiple primary cancers in patients with gastric cancer. Hepatogastroenterology 2006; 53: [PMID: ] P- Reviewer: Grundmann O, Kayadibi H S- Editor: Qi Y L- Editor: A E- Editor: Liu XM 8365 July 21, 2015 Volume 21 Issue 27

160 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Retrospective Cohort Study ORIGINAL ARTICLE Effect of oral mesalamine on inflammatory response in acute uncomplicated diverticulitis Luca Nespoli, Giulia Lo Bianco, Fabio Uggeri, Fabrizio Romano, Angelo Nespoli, Davide Paolo Bernasconi, Luca Gianotti Luca Nespoli, Giulia Lo Bianco, Fabio Uggeri, Fabrizio Romano, Angelo Nespoli, Luca Gianotti, Department of Surgery and Translational Medicine, University of Milan-Bicocca, San Gerardo Hospital, Monza, Italy Davide Paolo Bernasconi, Department of Health Sciences, Centre of Biostatistics for Clinical Epidemiology, University of Milan-Bicocca, Monza, Italy Author contributions: Gianotti L, Nespoli L, Lo Bianco G and Nespoli A contributed equally to the ideation and design of this study; Lo Bianco G, Romano F and Uggeri F were responsible for the acquisition of data; Bernasconi DP carried out statistical analysis; Nespoli L, Lo Bianco G and Gianotti L drafted the manuscript; Nespoli L, Lo Bianco G, Bernasconi DP and Gianotti L revised the draft; Gianotti L and Nespoli A where in charge of study supervision. Institutional review board statement: Because of the retrospective design, approval of the ethic commission was not required in our institution. Informed consent statement: Not required for retrospective study. Conflict-of-interest statement: The authors declare no existing conflict of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Luca Nespoli, MD, Department of Surgery and Translational Medicine, University of Milan-Bicocca, San Gerardo Hospital, via Pergolesi 33, Monza, Italy. luca.nespoli@unimib.it Telephone: Fax: Received: February 12, 2015 Peer-review started: February 12, 2015 First decision: March 10, 2015 Revised: March 24, 2015 Accepted: May 7, 2015 Article in press: May 7, 2015 Published online: July 21, 2015 Abstract AIM: To evaluate the impact of mesalamine administration on inflammatory response in acute uncomplicated diverticulitis. METHODS: We conducted a single centre retrospective cohort study on patients admitted to our surgical department between January 2012 and May 2014 with a computed tomography -confirmed diagnosis of acute uncomplicated diverticulitis. A total of 50 patients were included in the analysis, 20 (study group) had received 3.2 g/d of mesalamine starting from the day of admission in addition to the usual standard treatment, 30 (control group) had received standard therapy alone. Data was retrieved from a prospective database. Our primary study endpoints were: C reactive protein mean levels over time and their variation from baseline (ΔCRP) over the first three days of treatment. Secondary end points included: mean white blood cell and neutrophile count over time, time before regaining of regular bowel movements (passing of stools), time before reintroduction of food intake, intensity of lower abdominal pain over time, analgesic consumption and length of hospital stay. RESULTS: Patients characteristics and inflammatory 8366 July 21, 2015 Volume 21 Issue 27

161 Nespoli L et al. Mesalamine in acute diverticulitis parameters were similar at baseline in the two groups. The evaluation of CRP levels over time showed, in treated patients, a distinct trend towards a faster decrease compared to controls. This difference approached statistical significance on day 2 (mean CRP 6.0 +/- 4.2 mg/dl and /- 6.7 mg/dl respectively in study group vs controls, P = 0.055). ΔCRP evaluation evidenced a significantly greater increment of this inflammatory marker in the control group on day 1 (P = 0.03). A similar trend towards a faster resolution of inflammation was observed evaluating the total white blood cell count. Neutrophile levels were significantly lower in treated patients on day 2 and on day 3 (P < 0.05 for both comparisons). Mesalamine administration was also associated with an earlier reintroduction of food intake (median 1.5 d and 3 d, study group vs controls respectively, P < 0.001) and with a shorter hospital stay (median 5 d and 5.5 d, study group vs controls respectively, P = 0.03). CONCLUSION: Despite its limitations, this study suggests that mesalamine may allow for a faster recovery and for a reduction of inflammatory response in acute uncomplicated diverticulitis. Key words: Acute diverticulitis; Inflammatory bowel disease; 5-ASA; benign colonic disease The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Acute uncomplicated diverticulitis is the most common presentation of symptomatic diverticular disease. Taking the lead from evidence suggesting that acute uncomplicated diverticulitis may represent a form of inflammatory bowel disease, our study investigated, to our knowledge for the first time, the impact of oral mesalamine administration on early inflammatory parameters. When compared to standard therapy alone, mesalamine addition seemed to allow for a faster decrease of inflammation and for a faster recovery of the patients. Despite the limitations inherent in the study design, the results may, in our opinion, constitute the basis for future randomized, placebocontrolled, studies. Nespoli L, Lo Bianco G, Uggeri F, Romano F, Nespoli A, Bernasconi DP, Gianotti L. Effect of oral mesalamine on inflammatory response in acute uncomplicated diverticulitis. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: INTRODUCTION Acute uncomplicated diverticulitis is the most common presentation of symptomatic diverticular disease and represents an important economical burden for the health-care systems of western countries [1-6]. Notions about the pathogenesis of this disease are still controversial and so is the choice of the best treatment strategy [7,8]. Most guidelines [9-11] indicate bowel rest, intravenous fluids and broadspectrum antibiotics as standard treatment, however, evidence supporting this kind of recommendation is scarce and of low quality [12,13]. Some authors have suggested that this condition may arise from an inflammatory process rather than from an infective one, thus supporting a rationale for the use of antiinflammatory drugs [14]. A number of studies have explored the role of 5-ASA preparations, and especially of mesalamine in treating chronic symptoms and reducing the rate of recurrence after a first episode of acute uncomplicated diverticulitis, with promising but inconsistent results [15-20]. Evidence regarding the effectiveness of this drug during the acute phase of the disease, however, is still scarce. The aim of this study is to evaluate the impact of high dosage mesalamine administration in modulating the inflammatory response in acute uncomplicated leftsided diverticulitis. MATERIALS AND METHODS We conducted a retrospective cohort study on patients diagnosed with acute uncomplicated diverticulitis and admitted to our surgical department between January 2012 and May Data was retrieved from an institutional prospective database and covered the period of hospitalization. The patients considered for evaluation were aged over 18 years, had a computed tomography (CT) scanconfirmed diagnosis of acute uncomplicated diverticulitis (staged Hinchey 1A or 1B) and had received 3.2 g/d of mesalamine for the duration of their in-hospital stay in addition to the usual standard therapy. They were compared to a group of controls admitted to our department at the same period of time with a CTconfirmed diagnosis of acute uncomplicated diverticulitis and treated without mesalamine. Exclusion criteria were: a known history of peptic ulcer, recent surgery on the gastrointestinal tract, inflammatory bowel disease, short bowel syndrome or other condition causing malabsorption or altered bowel mobility, endometriosis/ dysmenorrhea, major medical or psychiatric diseases, immunodepression, recent consumption (during the preceding 4 wk) of antibiotics, steroids or products containing mesalamine. In accordance with with current guidelines, all patients were prescribed broadspectrum intravenous antibiotics and fluid support by the attending surgeon, who was also in charge of deciding the timing for the resumption of oral food intake and discharge. In the period of interest, our internal protocol for antibiotic therapy included a combination of quinolones and metronidazole given intravenously to all patients that were not allergic or intolerant. Recovery was assessed on the basis of a clinical decision July 21, 2015 Volume 21 Issue 27

162 Nespoli L et al. Mesalamine in acute diverticulitis Table 1 Baseline Study patients Control patients P value (n = 20) (n = 30) Age (yr) ± ± Sex (F) 2 12 (60.0) 19 (63.3) 0.81 BMI (kg/m²) ± ± Arterial hypertension 2 11 (55) 13 (43.3) 0.42 Type 2 diabetes mellitus 2 1 (5) 5 (16.7) 0.21 Recurrent episode 2 5 (25) 1 (3.4) 0.02 Hinchey IB 2 5 (25) 2 (6.7) 0.07 Time to admission (d) ± ± CRP (mg/dl) 3 6 ± ± WBC (10 9 /L) ± ± Neutrophiles (10 9 /L) ± ± Pain (NRS score) ± ± Data as mean ± SD, t-test; 2 Data as n (%), χ 2 test; 3 Data as mean ± SD, mann Whitney test. The decision to add mesalamine to the standard therapy was taken independently by the attending physician, on the basis of evidence that relates mesalamine administration in such a setting to a possible improvement of long-term symptoms [15-17]. Treated patients received 3.2 g of mesalamine/d by way of two 800 mg tablets (Asamax, Astellas Pharma Inc, Chuo-ku, TKY, Japan) subministered twice daily. The dosing schedule was chosen in accordance with the existing data regarding the use of mesalamine in acute ulcerative colitis (UC) that indicates a daily dosage of between 2.4 g/die and 4.8 g/die to be a safe and effective induction therapy for patients with mild to moderately active UC [21] and in conformity with the most recent trials on the use of mesalamine in diverticular disease [20,22]. A daily administration regimen was preferred on the basis of evidence that it is more effective in inducing and maintaining remission than cyclical administration [23]. The length of treatment prosecution following hospital discharge was defined for each patient by the attending physician. Laboratory assessments of serum white blood cells (WBC), neutrophiles and C reactive protein (CRP) levels where performed and evaluated with reference to the normal ranges applied locally. The administration of analgesic medication was taken into account and registered for each day. A 0-10 Numeric Rating Scale (NRS) score for lower abdominal pain was assigned daily following usual ward practice. Time before recovery of normal bowel function (passing of stools) and time before resumption of oral food intake were also recorded. All clinical and biochemical data were reported on a case-report form and entered into the database. The primary endpoints of the study included mean daily levels of serum CRP and their variation during the first three days of in-patient treatment. Variation was defined as the difference between CRP mean values for each day of treatment and baseline. Baseline levels were defined using the results of laboratory assessments done in the emergency room during the initial patient evaluation. Secondary endpoints were: daily WBC and neutrophile count, intensity of lower abdominal pain over time, analgesic consumption, time before recovery of normal bowel function (passing of stools), time before resumption of oral food intake and length of in-hospital stay. Descriptive statistics for continuous data were expressed as mean ± SD as well as median (range). Discrete data were summarized as numbers and percentages. For continuous variables, the t-test or the Mann-Whitney test were used, depending on normality distribution assumption. For categorical variables the χ 2 test was used. For all statistical analyses, a two-sided p value < 0.05 was considered statistically significant. Statistical analyses was carried out using the Epi Info software package for Windows and the SPSS Statistics 22.0 standard software package. RESULTS During the period of interest, 50 eligible patients were admitted to our surgical department with a CT-confirmed diagnosis of acute uncomplicated diverticulitis. 20 were treated with mesalamine in addition to the usual standard theraphy while 30 patients received standard therapy alone. Baseline characteristics of the study population are summarized in Table 1. A compared analysis shows that the two groups are balanced in terms of age, sex and co-morbidities. Mean age was 59.9 ± 15.7 years in the study group and 66.5 ± 15.4 years in the control group; 60% (12/20) of study patients and 63.3% (19/30) of control patients were women. The most frequent co-morbid conditions were type 2 diabetes mellitus and arterial hypertension. Other conditions included: chronic obstructive pulmonary disease (COPD), kidney failure, asthma, coronary artery disease and glaucoma. The average Body Mass Index (BMI) appeared to be higher in the control group (mean 24.8 ± 3.8 kg/m 2 for the study group and 28.9 ± 5.8 kg/m 2 for the control group, p = 0.01). A known history of prior episodes of diverticulitis was more frequent in the study group than among controls (positive history in 5/20 patients, 25.0% in the study group and 1/30 patients, 3.4% in the control group), along with a higher incidence of Hinchey IB diverticulitis, which was recorded in 5/20 patients (25%) in the study group and in 2/30 patients (6.7%) in the control group (p = 0.07). Time from the outbreak of the first symptoms to admission was comparable in the two groups. Baseline levels for inflammatory parameters and scores for lower abdominal pain were found to be similar in the two groups. Namely, mean CRP at the time of admission was 6.0 ± 4.6 mg/dl and 6.0 ± 6.3 mg/dl in the study group and in controls, respectively, (p = 0.41) July 21, 2015 Volume 21 Issue 27

163 Nespoli L et al. Mesalamine in acute diverticulitis P = 0.05 Study group Control group Study group Control group CRP, mean (mg/dl) WBC count, mean (10 9 /L) Baseline Baseline t /d t /d Figure 1 C reactive protein levels. Mean C reactive protein (CRP) levels, over time, in the two groups. Figure 3 white blood cells count. Mean white blood cells (WBC) count, over time, in the two groups. ΔCRP P = 0.03 Study group Control group Baseline t /d Neutrophile count, mean (10 9 /L) P = 0.04 P = Baseline t /d Study group Control group Figure 4 Neutrophile count. Mean neutrophile count, over time, in the two groups. Figure 2 C reactive protein mean levels over time and their variation from baseline. C reactive protein (CRP) variation from baseline, over time, in the two groups. Δ CRP = mean CRP - mean CRP at baseline. Figure 1 represents CRP plasma levels over time. A distinct trend towards a faster decrease of this parameter can be evidenced in study patients if compared to controls. This difference approached statistical significance on day 2 (mean CRP 6.0 ± 4.2 mg/dl and 10.0 ± 6.7 mg/dl, in study group and controls, respectively, p = 0.05). We evaluated the variation of CRP levels over the first three days (ΔCRP). This parameter represents the differential between CRP measurements obtained daily and expressed as a mean value for each group and CRP at baseline. As shown in Figure 2, a significantly greater increment of Δ CRP was observed in control patients on day 1 (ΔCRP 1.4 ± 2.7 mg/dl and 4.7 ± 6.0 mg/dl in study group and controls, respectively, p = 0.03). A similar trend towards a faster resolution of inflammation was observed evaluating the total WBC and neutrophile count, as described in Figures 3 and 4. Mean neutrophile levels were significantly lower in treated patients on day 2 (p = 0.04) and on day 3 (p = 0.01). The evaluated clinical outcomes are summarized in Table 2. A shorter time to resumption of oral food intake (median 1 d, range 1-4 d and median 3 d, range 1-5 d for the study group and controls, respectively, p < 0.001) and a reduced length of in-hospital stay (median 5 d, range 3-6 and median 5.5 d, range 4-12 d for the study group and controls, respectively, p = 0.03) were observed in treated patients when compared to controls. Pain levels for both groups decreased rapidly from baseline during in-hospital treatment; a difference in favor of control patients was found on day 3 (mean NRS score 1.1 ± 1.4 and 0.4 ± 1.1, study group and controls, respectively, p = 0.05) while a trend towards a more consistent analgesic consumption, though not statistically significant, was observed in controls (Table 3). DISCUSSION The traditional pathogenic model for diverticular disease has recently been challenged. Evidence exists showing, in patients suffering from diverticular disease, the presence of chronic microscopic and macroscopic inflammatory alterations of the mucosa, similar to 8369 July 21, 2015 Volume 21 Issue 27

164 Nespoli L et al. Mesalamine in acute diverticulitis Table 2 Clinical outcomes Study group Control group P value 1 (n = 20) (n = 30) mean ± SD Median (range) mean ± SD Median (range) Time before recovery of bowel function (d) 1.9 ± (1-4) 2.4 ± (0-7) 0.29 Time before resumption of food intake (d) 1.7 ± (1-4) 3.1 ± (1-5) < Length of in-hospital stay (d) 4.7 ± (3-6) 6 ± (4-12) Mann-Whitney test. Table 3 Pain and analgesics consumption n (%) Study patients Control patients P value (n = 20) (n = 30) Median (range) mean ± SD Median (range) mean ± SD Pain (NRS score) Day 1 2 (0-7) 2.4 ± (0-8) 1.9 ± Day (0-8) 1.9 ± (0-4) 0.9 ± Day 3 0 (0-3) 1.1 ± (0-5) 0.4 ± Analgesy Day 1 11 (55) 22 (73.3) Day 2 13 (65) 19 (63.3) Day 3 7 (35) 14 (46.7) Mann-Whitney test; 2 Date is χ 2 test. Analgesy represents the proportion of patients assuming pain medications. those found in inflammatory bowel disease which may contribute to the genesis of this condition [24,25]. Moreover, a recent trial in acute uncomplicated diverticulitis has shown a lack of effect of intravenous antibiotics, suggesting a possible role of inflammation in determining the genesis and the course of this condition [13]. For these reasons, a new interest has risen for the potential use of anti-inflammatory medication in such a setting. A number of studies have shown that mesalamine (alone or in combination with antibiotics) could represent a promising therapeutic option for treating chronic symptoms and preventing recurrence in diverticular disease. Two four-armed open label trials [15,16] have shown mesalamine to be more effective than rifaximin in achieving symptomatic relief over a 3 mo period. A randomized open label study by Tursi et al [17] demonstrated an 85% reduction in recurrent attacks of diverticulitis in patients treated with a combination of mesalamine and rifaximine as compared to rifaximine alone, a result which was consistent with a previous open label study on the effects of Mesalamine supplementation after a first attack of acute diverticulitis [18]. More recently, an intermittent prophylaxis with Mesalamine was shown to be more effective than placebo in controlling chronic symptoms and to allow for a reduction in the consumption of additional gastrointestinal drugs [19]. One large, randomized, placebo-controlled trial [20] employing a high dosage of mesalamine (3 g/d) administered from the day of admission to patients suffering from acute uncomplicated diverticulitis showed, on a long term evaluation, a higher rate of complete relief from chronic symptoms in patients that had received mesalamine. Similar findings were evidenced by a study of similar design that evaluated the effects of a 2.4 g/die mesalamine administration during a symptomatic flare of uncomplicated divericular disease [22]. The potential role of this drug in modulating acute inflammatory response, however, has not been further determined. This retrospective cohort study is the first, to our knowledge, to evaluate the impact of mesalamine on early inflammatory response in uncomplicated diverticulitis. As an acute-phase reactant, CRP is strictly related to the inflammatory stimulus, its values increase and decrease promptly due to its short halflife [26]. This parameter has been shown to be the best marker in assessing response to therapy in acute diverticulitis as well as a useful tool for diagnosis [27]. It also correlates with the severity of the disease and with the presence of complications [28,29]. In our population we observed baseline CRP levels comparable to those described by other authors as well as a more rapid decrease of the same levels, over time, in the study group. The relative advantage for patients treated with Mesalamine over patients that had received antibiotics alone may be attributable to the anti-inflammatory properties of Mesalamine and be conductible to a preponderant pathogenic role of inflammation in acute uncomplicated diverticulitis.the similar trend observed over time for the WBC and neutrophile count seems to offer further confirmation of this interpretation. Data on the length of in-hospital stay and time to resumption of oral food intake are not easly comparable to other studies since they are strongly influenced by local policies. Gastrointestinal transit is known to be altered in a variety of mucosal inflammatory conditions 8370 July 21, 2015 Volume 21 Issue 27

165 Nespoli L et al. Mesalamine in acute diverticulitis of the gut. In vivo and in vitro studies suggest that mediators such as interleukin 1β and interleukin 6, modulation of the lymphocyte function via the major histocompatibility complex Ⅱ and neural modulation of intestinal inflammation through pro-inflammatory molecules could all play a role in this phenomenon [30]. In light of these studies, the observed trend towards an earlier recovery of bowel function and earlier resumption of oral food intake in treated patients may be attributable to a faster reduction of local inflammation. This may possibly have ultimately led to the earlier discharge of the patients. Several limitations inherent in the study design, however, should be taken into account when evaluating clinical outcomes. The absence of randomization and blinding and the lack of strict criteria for discharge may have led to an overestimation of these results. Our study did not show any advantage for study patients over controls with reference to abdominal pain scores. This was in contrast with two previous studies [19,22] that showed that mesalamine may relieve symptoms during symptomatic uncomplicated diverticular disease (SUDD).This discrepancy might be related to the different mechanisms that may underlie pain generation in acute and in chronic settings.in fact, it has been suggested that the pathogenesis of pain in SUDD patients, could be related, at least in part, to changes in neuromuscular function [31] secondary to chronic low-grade inflammation rather than to an acute inflammatory process. Moreover, the absence of regulation of the concomitant use of analgesics has already been cited as a potential confounding factor [22]. Their higher consumption in the control group may have influenced the proportion of patients reporting symptomatic improvement. A stricter definition of the rules for the clinical management of patients, with special reference to timing for discharge and re-feeding and to criteria for pain assessment and antibiotic prescription, would be useful when evaluating clinical parameters. Potential limitations inherent to the study design were a possible selection bias and the limited sample size. Nevertheless, these preliminary results suggest that mesalamine may possibly be effective in treating acute uncomplicated diverticulitis, allowing for a faster recovery and for a more rapid decrease of certain objective inflammatory markers. This could possibly lead to an earlier discharge with benefit to the patient and a reduction in health-care costs. Further, randomized, placebo-controlled, double-blind trials are needed to obtain confirmation. ACKNOWLEDGMENTS We thank Mrs. Mabel Evaetta Morton for her support in the language revision of the manuscript. COMMENTS Background Acute uncomplicated diverticulitis is the most common presentation of symptomatic diverticular disease. At present, treatment consists in bowel rest, broad-spectrum antibiotics and intravenous fluids, often in an in-hospital setting. The clinical course is characterized by the progressive decrease of inflammatory parameters and of local pain. Usually, the reintroduction of solid food intake and the discharge of patients are decided on clinical basis. Research frontiers Recently, evidence has been provided showing similarities between acute uncomplicated diverticulitis and inflammatory bowel diseases, supporting the idea that local inflammation plays a key role in the pathogenesis of both conditions. This suggests a potential role for anti-inflammatory compounds, such as mesalamine, in this disease. Innovations and breakthroughs Despite the positive results observed in long-term mesalamine administration in patients suffering from diverticular disease, the effects on inflammatory parameters during the acute flare have not been thoroughly investigated so far. In this retrospective analysis, the authors observed a beneficial effect of mesalamine on inflammation, consisting in lower serum crp levels and in their faster decrease in treated patients, if compared to controls. The earlier resumption of solid food intake and the shorter hospital stay the authors observed in treated patients, also seemed consistent with a faster resolution of local inflammation. Applications This retrospective cohort study, despite the limitations intrinsic to the study design and despite the limited sample size, has shown a potential role for mesalamine administration in speeding the resolution of acute inflammation in patients suffering from acute uncomplicated diverticulitis. This would allow for shorter hospitalization with benefit to the patients and a reduction in health care costs. Terminology Acute uncomplicated diverticulitis: Self-limited and confined inflammation of diverticula in the absence of abscess, macroperforation, fistula or peritonitis. Symptomatic uncomplicated diverticular disease: Symptomatic diverticulosis characterized by abdominal symptoms (abdominal pain, particularly in the lower left abdominal quadrant and alteration of bowel habits) without macroscopic signs of inflammation (no mucosal inflammation on colonoscopy, no increase in erythrocyte sedimentation rate or CRP, no fever). Peer-review The authors described the first experience in using high doses of mesalamine in speeding resolution of acute uncomplicated diverticulitis on a retrospective analysis. Authors found that mesalamine supplementation, when compared to standard therapy alone, seemed to allow for a faster decrease of acute inflammatory parameters and for a faster recovery of the patients. These results are described for the first time and, despite the retrospective design of the study, are of interest for clinical practice REFERENCES 1 Sandler RS, Everhart JE, Donowitz M, Adams E, Cronin K, Goodman C, Gemmen E, Shah S, Avdic A, Rubin R. The burden of selected digestive diseases in the United States. Gastroenterology 2002; 122: [PMID: DOI: /gast ] 2 Martel J, Raskin JB. History, incidence, and epidemiology of diverticulosis. J Clin Gastroenterol 2008; 42: [PMID: DOI: /MCG.0b013e f18] 3 Painter NS, Burkitt DP. Diverticular disease of the colon: a deficiency disease of Western civilization. Br Med J 1971; 2: [PMID: DOI: /bmj ] 4 Jun S, Stollman N. Epidemiology of diverticular disease. Best Pract Res Clin Gastroenterol 2002; 16: [PMID: DOI: /bega ] 5 Delvaux M. Diverticular disease of the colon in Europe: 8371 July 21, 2015 Volume 21 Issue 27

166 Nespoli L et al. Mesalamine in acute diverticulitis epidemiology, impact on citizen health and prevention. Aliment Pharmacol Ther 2003; 18 Suppl 3: [PMID: DOI: /j ] 6 Papagrigoriadis S, Debrah S, Koreli A, Husain A. Impact of diverticular disease on hospital costs and activity. Colorectal Dis 2004; 6: [PMID: DOI: / j x] 7 Humes DJ, Spiller RC. Review article: The pathogenesis and management of acute colonic diverticulitis. Aliment Pharmacol Ther 2014; 39: [PMID: DOI: /apt.12596] 8 Tursi A. New physiopathological and therapeutic approaches to diverticular disease: an update. Expert Opin Pharmacother 2014; 15: [PMID: DOI: / ] 9 Stollman NH, Raskin JB. Diagnosis and management of diverticular disease of the colon in adults. Ad Hoc Practice Parameters Committee of the American College of Gastroenterology. Am J Gastroenterol 1999; 94: [PMID: DOI: / j x] 10 Rafferty J, Shellito P, Hyman NH, Buie WD. Practice parameters for sigmoid diverticulitis. Dis Colon Rectum 2006; 49: [PMID: DOI: /s ] 11 Andeweg CS, Mulder IM, Felt-Bersma RJ, Verbon A, van der Wilt GJ, van Goor H, Lange JF, Stoker J, Boermeester MA, Bleichrodt RP. Guidelines of diagnostics and treatment of acute left-sided colonic diverticulitis. Dig Surg 2013; 30: [PMID: DOI: / ] 12 de Korte N, Unlü C, Boermeester MA, Cuesta MA, Vrouenreats BC, Stockmann HB. Use of antibiotics in uncomplicated diverticulitis. Br J Surg 2011; 98: [PMID: DOI: /bjs.7376] 13 Chabok A, Påhlman L, Hjern F, Haapaniemi S, Smedh K. Randomized clinical trial of antibiotics in acute uncomplicated diverticulitis. Br J Surg 2012; 99: [PMID: DOI: /bjs.8688] 14 Tursi A, Papagrigoriadis S. Review article: the current and evolving treatment of colonic diverticular disease. Aliment Pharmacol Ther 2009; 30: [PMID: DOI: / j x] 15 Di Mario F, Aragona G, Leandro G, Comparato G, Fanigliulo L, Cavallaro LG, Cavestro GM, Iori V, Maino M, Moussa AM, Gnocchi A, Mazzocchi G, Franzé A. Efficacy of mesalazine in the treatment of symptomatic diverticular disease. Dig Dis Sci 2005; 50: [PMID: DOI: /s z] 16 Comparato G, Fanigliulo L, Cavallaro LG, Aragona G, Cavestro GM, Iori V, Maino M, Mazzocchi G, Muzzetto P, Colla G, Sianesi M, Franzé A, Mario FD. Prevention of complications and symptomatic recurrences in diverticular disease with mesalazine: a 12-month follow-up. Dig Dis Sci 2007; 52: [PMID: DOI: /s ] 17 Tursi A, Brandimarte G, Daffinà R. Long-term treatment with mesalazine and rifaximin versus rifaximin alone for patients with recurrent attacks of acute diverticulitis of colon. Dig Liver Dis 2002; 34: [PMID: DOI: / S (02) ] 18 Trepsi E, Colla C, Panizza P, Polino MG, Venturini A, Bottani G, De Vecchi P, Matti C. [Therapeutic and prophylactic role of mesalazine (5-ASA) in symptomatic diverticular disease of the large intestine. 4 year follow-up results]. Minerva Gastroenterol Dietol 1999; 45: [PMID: ] 19 Parente F, Bargiggia S, Prada A, Bortoli A, Giacosa A, Germanà B, Ferrari A, Casella G, De Pretis G, Miori G. Intermittent treatment with mesalazine in the prevention of diverticulitis recurrence: a randomised multicentre pilot double-blind placebo-controlled study of 24-month duration. Int J Colorectal Dis 2013; 28: [PMID: DOI: /s ] 20 Stollman N, Magowan S, Shanahan F, Quigley EM. A randomized controlled study of mesalamine after acute diverticulitis: results of the DIVA trial. J Clin Gastroenterol 2013; 47: [PMID: DOI: /MCG.0b013e f6] 21 Feagan BG, Macdonald JK. Oral 5-aminosalicylic acid for induction of remission in ulcerative colitis. Cochrane Database Syst Rev 2012; 10: CD [PMID: DOI: / CD pub3] 22 Kruis W, Meier E, Schumacher M, Mickisch O, Greinwald R, Mueller R. Randomised clinical trial: mesalazine (Salofalk granules) for uncomplicated diverticular disease of the colon- -a placebo-controlled study. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12248] 23 Tursi A, Brandimarte G, Giorgetti GM, Elisei W. Continuous versus cyclic mesalazine therapy for patients affected by recurrent symptomatic uncomplicated diverticular disease of the colon. Dig Dis Sci 2007; 52: [PMID: DOI: / s ] 24 Ghorai S, Ulbright TM, Rex DK. Endoscopic findings of diverticular inflammation in colonoscopy patients without clinical acute diverticulitis: prevalence and endoscopic spectrum. Am J Gastroenterol 2003; 98: [PMID: DOI: / j x] 25 Tursi A, Brandimarte G, Elisei W, Giorgetti GM, Inchingolo CD, Danese S, Aiello F. Assessment and grading of mucosal inflammation in colonic diverticular disease. J Clin Gastroenterol 2008; 42: [PMID: DOI: /MCG.0b013e ca2] 26 Tursi A. Biomarkers in diverticular diseases of the colon. Dig Dis 2012; 30: [PMID: DOI: / ] 27 Ridgway PF, Latif A, Shabbir J, Ofriokuma F, Hurley MJ, Evoy D, O Mahony JB, Mealy K. Randomized controlled trial of oral vs intravenous therapy for the clinically diagnosed acute uncomplicated diverticulitis. Colorectal Dis 2009; 11: [PMID: DOI: /j x] 28 Andeweg CS, Knobben L, Hendriks JC, Bleichrodt RP, van Goor H. How to diagnose acute left-sided colonic diverticulitis: proposal for a clinical scoring system. Ann Surg 2011; 253: [PMID: DOI: /SLA.0b013e ] 29 Tursi A, Elisei W, Brandimarte G, Giorgetti GM, Aiello F. Predictive value of serologic markers of degree of histologic damage in acute uncomplicated colonic diverticulitis. J Clin Gastroenterol 2010; 44: [PMID: DOI: / MCG.0b013e3181dad979] 30 Collins SM. The immunomodulation of enteric neuromuscular function: implications for motility and inflammatory disorders. Gastroenterology 1996; 111: [PMID: DOI: /S (96) ] 31 Simpson J, Scholefield JH, Spiller RC. Origin of symptoms in diverticular disease. Br J Surg 2003; 90: [PMID: DOI: /bjs.4277] P- Reviewer: Cologne KG, Tursi A S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8372 July 21, 2015 Volume 21 Issue 27

167 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Retrospective Cohort Study ORIGINAL ARTICLE Score model for predicting acute-on-chronic liver failure risk in chronic hepatitis B Fang-Yuan Gao, Yao Liu, Xiao-Shu Li, Xie-Qiong Ye, Le Sun, Ming-Fan Geng, Rui Wang, Hui-Min Liu, Xiao-Bing Zhou, Li-Li Gu, Yan-Min Liu, Gang Wan, Xian-Bo Wang Fang-Yuan Gao, Yao Liu, Xiao-Shu Li, Xie-Qiong Ye, Le Sun, Ming-Fan Geng, Rui Wang, Hui-Min Liu, Xiao-Bing Zhou, Li-Li Gu, Yan-Min Liu, Xian-Bo Wang, Center of Integrative Medicine, Beijing Ditan Hospital, Capital Medical University, Beijing , China Gang Wan, Statistics Section, Beijing Ditan Hospital, Capital Medical University, Beijing , China Author contributions: Wang XB and Gao FY conceived of and designed the study; Gao FY, Liu Y, Li XS, Ye XQ, Sun L, Geng MF, Wang R, Liu HM, Zhou XB, Gu LL, Liu YM and Wan G contributed to the acquisition and analysis of data; Gao FY and Liu Y drafted the manuscript; all authors participated in interpretation of the findings; Wang XB revised the manuscript; all authors have read and approved the final version of the manuscript. Supported by Grants from National Natural Science Foundation of China, No , No ; and 215 Program, No Conflict-of-interest statement: The authors declare that they have no conflicts interest in this study. Data sharing statement: Technical appendix, statistical code, and dataset available from the corresponding author at wangxianbo638@163.com. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Xian-Bo Wang, Professor, Center of Integrative Medicine, Beijing Ditan Hospital, Capital Medical University, Beijing , China. wangxianbo638@163.com Telephone: Fax: Received: February 5, 2015 Peer-review started: February 6, 2015 First decision: March 10, 2015 Revised: March 25, 2015 Accepted: May 4, 2015 Article in press: May 4, 2015 Published online: July 21, 2015 Abstract AIM: To establish a clinical scoring model to predict risk of acute-on-chronic liver failure (ACLF) in chronic hepatitis B (CHB) patients. METHODS: This was a retrospective study of 1457 patients hospitalized for CHB between October 2008 and October 2013 at the Beijing Ditan Hospital, Capital Medical University, China. The patients were divided into two groups: severe acute exacerbation (SAE) group (n = 382) and non-sae group (n = 1075). The SAE group was classified as the high-risk group based on the higher incidence of ACLF in this group than in the non-sae group (13.6% vs 0.4%). Two-thirds of SAE patients were randomly assigned to risk-model derivation and the other one-third to model validation. Univariate risk factors associated with the outcome were entered into a multivariate logistic regression model for screening independent risk factors. Each variable was assigned an integer value based on the regression coefficients, and the final score was the sum of these values in the derivation set. Model discrimination and calibration were assessed using area under the receiver operating characteristic curve and the Hosmer-Lemeshow test. RESULTS: The risk prediction scoring model included 8373 July 21, 2015 Volume 21 Issue 27

168 Gao FY et al. Predicting model for ACLF in CHB the following four factors: age 40 years, total bilirubin 171 µmol/l, prothrombin activity 40%-60%, and hepatitis B virus DNA > 10 7 copies/ml. The sum risk score ranged from 0 to 7; 0-3 identified patients with lower risk of ACLF, whereas 4-7 identified patients with higher risk. The Kaplan-Meier analysis showed the cumulative risk for ACLF and ACLF-related death in the two risk groups (0-3 and 4-7 scores) of the primary cohort over 56 d, and log-rank test revealed a significant difference (2.0% vs 33.8% and 0.8% vs 9.4%, respectively; both P < ). In the derivation and validation data sets, the model had good discrimination (C index = 0.857, 95% confidence interval: and C index = 0.889, 95% confidence interval: , respectively) and calibration demonstrated by the Hosmer-Lemeshow test (χ 2 = 4.516, P = and χ 2 = 1.959, P = 0.923, respectively). CONCLUSION: Using the scoring model, clinicians can easily identify patients (total score 4) at high risk of ACLF and ACLF-related death early during SAE. Key words: Acute-on-chronic liver failure; Chronic hepatitis B; Prediction model; Risk score; Severe acute exacerbation The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Acute-on-chronic liver failure (ACLF) is a severe life-threatening clinical syndrome characterized by liver failure and associated with an extremely high mortality if liver transplantation or artificial liver support is not available. Early diagnosis might allow for effective patient risk stratification and more appropriate medical care. However, previous studies on severe acute exacerbation of ACLF have focused on the clinical outcomes, and global uniform standards and correlation studies for predicting ACLF occurrence are lacking. We developed a clinical scoring model to predict the risk of ACLF early in patients with chronic hepatitis B. Gao FY, Liu Y, Li XS, Ye XQ, Sun L, Geng MF, Wang R, Liu HM, Zhou XB, Gu LL, Liu YM, Wan G, Wang XB. Score model for predicting acute-on-chronic liver failure risk in chronic hepatitis B. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8373.htm DOI: i INTRODUCTION Chronic hepatitis B (CHB) is a significant global health threat with more than 350 million people infected [1]. In the natural history of chronic hepatitis B virus (HBV) infection, severe acute exacerbation (SAE) is not uncommon. It is characterized by high serum alanine aminotransferase (ALT) levels, jaundice, and coagulopathy, and has a cumulative incidence of 10%-30% annually [2-5]. The exacerbations can be mild, but some patients may progress to acute-on-chronic liver failure (ACLF) and even death [6,7]. ACLF is a severe, life-threatening clinical syndrome characterized by liver failure and is associated with multiple end-organ failure [8]. Liver transplantation is the only definitive therapy available to salvage this group of patients, however, this is not readily available or feasible in many parts of the world where HBV is highly endemic. Therefore, for early diagnosis and treatment, it is necessary to determine the risk factors and assess the risk of ACLF. However, global uniform standards and correlation studies for predicting ACLF occurrence are lacking. In the present study, we analyzed the clinical data of patients hospitalized for CHB at the Beijing Ditan Hospital, Capital Medical University, China over a fiveyear period (from October 2008 to October 2013). The aims of this study were to identify the independent risk factors for ACLF, to develop a risk prediction model to identify patients at an increased risk of ACLF, and to facilitate implementation of preventive strategies. MATERIALS AND METHODS Study population Patients with CHB hospitalized at the Beijing Ditan Hospital, Capital Medical University, China, between October 2008 and October 2013, were retrospectively studied. The preliminary screening identified 1693 patients with ALT levels elevated to > 5 times the upper limit of normal (ULN; 40 IU/L) with complete clinical, laboratory, imaging, and follow-up data. Patients who did not meet the research standards were excluded (n = 236). A total of 1457 patients were enrolled in the study and were subsequently divided into either the SAE or non-sae group (Figure 1). Patients enrolled in the study had no coinfection with hepatitis A, C, D, or E viruses or other viruses including HIV, cytomegalovirus, and Epstein-Barr virus, hepatocellular carcinoma (HCC), liver decompensated cirrhosis, alcoholic liver disease, drug-induced hepatitis, autoimmune hepatitis, Wilson disease, jaundice caused by biliary obstruction, prolonged prothrombin time (PT) induced by blood system disease, or serious diseases involving other organ systems, and were not pregnant. Diagnostic criteria of SAE and ACLF The inclusion criteria for the present study were based on those proposed by Fujiwara et al [9] and Wang et al [10] and the consensus recommendations of the Asian Pacific Association for the Study of the Liver (APASL 2008; India) [11], with minor modifications. The criteria for SAE of CHB were as follows: (1) presence of hepatitis B surface antigen for > 6 mo before hospitalization; (2) ALT > 5 ULN ( July 21, 2015 Volume 21 Issue 27

169 Gao FY et al. Predicting model for ACLF in CHB 2008/ / hospitalized patients with chronic hepatitis B 1457 patient enrolled Excluded: 153 decompensated cirrhosis 54 liver failure at admission 11 hepatocellular carcinoma 4 biliary obstruction 9 pregnancy 5 other (HAV, HCV) 1075 Non-SAE TBil < 5 ULN and PTA > 60% 382 SAE TBil 5ULN or PTA 40%-60% 4 ACLF 1071 Non-ACLF 52 ACLF 330 Non-ACLF 1 death 3 survival 15 death 37 survival Figure 1 Outline of the screening and case selection protocol. ACLF: Acute-on-chronic liver failure; CHB: Chronic hepatitis B; HAV: Hepatitis A virus; HCV: Hepatitis C virus; PTA: Prothrombin activity; SAE: Severe acute exacerbation; ULN: Upper limit of normal. IU/L); and (3) total bilirubin (TBil) 5 ULN (85 µmol/l) or prothrombin activity (PTA) 40%-60%. ACLF was defined as the recent development of jaundice (TBil 5 ULN) and coagulopathy [PTA < 40% or international normalized ratio (INR) of PT 1.5], complicated within 4 wk by ascites and/or encephalopathy in a patient with previously diagnosed or undiagnosed chronic liver disease. Treatment schedule All patients received standard medical treatment except for liver transplantation, including bed rest, liver-protective treatment, energy supplements and vitamins, intravenous infusion of plasma and albumin, maintaining water-electrolyte and acid-base equilibrium, and preventing and treating complications. Antiviral therapy, including lamivudine, adefovir dipivoxil, entecavir, or telbivudine, was administered according to HBV replication levels, financial condition, and the willingness of the patient. Candidate predictor variables Retrospectively collected data included patient demographics; clinical and laboratory variables including PT, PTA, INR, white blood cell count, neutrophil count, lymphocyte count, serum potassium, sodium, creatinine, alpha-fetoprotein, aspartate transaminase, ALT, TBil, albumin, cholinesterase, hepatitis B e antigen, and HBV DNA levels; and imaging findings. Baseline data were the data obtained at the first diagnosis from computerized and paper medical records. In addition, the severity of liver disease was assessed using the Model for End-Stage Liver Disease (MELD) score and the Child-Turcotte-Pugh (CTP) score. The MELD score was calculated according to the following formula: MELD score = 3.78 ln[tbil (mg/ dl)] ln[inr] ln[cr (mg/dl)] (constant for liver disease etiology = 0 if cholestatic or alcoholic, otherwise = 1) [12]. The modified CTP score included five parameters: TBil level, albumin level, PT, and the presence and severity of ascites and encephalopathy [13]. Statistical analysis Statistical analysis to identify risk factors was performed using SPSS version 19.0 (IBM Corp., Armonk, NY, United States). Patient characteristics were compared between patients with and without ACLF and between the derivation and validation samples using the χ 2 or Fisher s exact tests for categorical variables and the t test or Mann-Whitney U test for variables with an abnormal distribution. Percentages were reported to describe categorical variables, mean ± SD were reported to describe the normally distributed continuous variables, and medians with interquartile ranges were reported for continuous variables with skewed distributions. Logistic regression analysis was used for multivariate analysis. In the development of risk prediction models for ACLF, the regression coefficients of the predictors were converted to integer 8375 July 21, 2015 Volume 21 Issue 27

170 Gao FY et al. Predicting model for ACLF in CHB risk scores by rounding the quotient from dividing the regression coefficients, and the final score was the sum of these values. Model discrimination and calibration were assessed using the area under the receiver operating characteristic (ROC) curve (C statistic) and the Hosmer-Lemeshow test. The cutoff sensitivity and specificity of the risk score were calculated, and the patients were divided into high-risk and lowrisk groups. The Kaplan-Meier method was used to compare the cumulative risk for ACLF and death in the two groups, and the significance of difference was tested with the log-rank test. P < 0.05 was considered statistically significant. The statistical methods of this study were reviewed by Gang Wan from the Statistics Section of Beijing Ditan Hospital, Capital Medical University. RESULTS Patient characteristics Of the 1693 patients who were seropositive for hepatitis B surface antigen at the time of study entry, the following were excluded by imaging (abdominal ultrasound, CT, and magnetic resonance imaging): 153 with liver decompensated cirrhosis, 54 with liver failure at admission, 11 with HCC, four with biliary obstruction, and nine who were pregnant. Patients coinfected with hepatitis A virus (n = 2), and hepatitis C virus (n = 3) were excluded using serologic assays. A total of 1457 patients were enrolled in the study. Patients were divided into SAE (n = 382) and non- SAE (n = 1075) groups. In the non-sae group, 4/1075 (0.37%) patients progressed to ACLF after admission to the hospital. However, in the SAE group, 52/382 (13.61%) patients developed ACLF (Figure 1). Additionally, the mean number of days between hospital admission and development of ACLF was 9 d (range, 2-34 d), and the rate of ACLF-related death (n = 15) was 28.8% in the SAE group. The ACLF incidence was significantly higher in the SAE group than in the non-sae group (P < 0.001) (Figure 1). Given the low incidence of ACLF in the non-sae group, we mainly focused on the SAE group. Using univariate analysis, we compared patients with ACLF to those without ACLF in the SAE group and found that they were older, had worse underlying diseases, had lower PTA and albumin and sodium levels, and higher TBil and HBV DNA levels (Table 1). With multivariate analysis of the primary cohort, only age 40 years, TBil 171 µmol/l (10 ULN), PTA 40%-60%, and HBV DNA > 10 7 copies/ml remained independent risk factors for ACLF (Table 2). Derivation of risk prediction model All patients with SAE were randomly allocated into the model derivation and validation sets at a 2:1 ratio. ACLF risk predictors at study entry were comparable between the model derivation and validation sets (P > 0.05). All the risk predictors included in the risk prediction model were significantly associated with outcome on forward logistic regression analyses (P < 0.05). The regression coefficients of the predictors in the risk prediction model were converted into integer risk scores (Table 3). We arbitrarily assigned the regression coefficient of associated with age 40 years as equivalent to one risk point, and divided each regression coefficient associated with the different risk factor levels by to determine the number of risk points (rounded to one digit). The risk score was the sum of the risk points from each of the four risk factors in the range of 0 to 7. At the cutoff point of 4 determined by ROC analysis, sensitivity and specificity for ACLF occurrence were 88.6% and 72.2%, respectively, at the maximum Youden index. The sum risk scores of 0-3 identified patients at lower risk of ACLF (0%-4.7%), whereas the sum risk scores of 4-7 identified patients at higher risk (26.0%-68.8%). The score distributions in the derivation, validation, and all patient populations were examined. Scores 6 and 7 were collapsed into a single category because of the small number of patients in the score category of 7 (Figure 2A). The Kaplan-Meier analysis showed the cumulative risk for ACLF in the two risk groups (0-3 and 4-7) of the primary cohort over 56 d, and log-rank test revealed a significant difference (2.0% vs 33.8%, P < ) (Figure 2B). The relationship of the score model and ACLFrelated death was also evaluated. We observed that the mortality rate gradually increased with increasing score, from 0% in scores 0-2, 3.1% in score 3, 8.1% in score 4, and 10.5% in score 5, to 11.1% in scores 6 and 7, in the primary cohort (Figure 3A). The cumulative risk of ACLF-related death was also significantly higher in the high-risk group (4-7) than that in the low-risk group (0-3) (P < ) (Figure 3B). Validation of risk prediction model The prediction model discriminated patients who developed ACLF from those who did not using the C index of in the derivation cohort [95% confidence interval (CI): ] and in the validation cohort (95%CI: ). Model calibration was also good in both groups, as demonstrated by the Hosmer-Lemeshow test (χ 2 = 4.516, P = 0.808, and χ 2 = 1.959, P = 0.923, respectively). Moreover, we used the area under the ROC curve to compare the predictive value of this score model with MELD and CTP scores. As shown in Figure 4A, the C index was for our score model in the derivation cohort, for MELD, and for CTP. In the validation cohort, the C index was for our score model, for MELD, and for CTP (Figure 4B). This indicates that this score model was superior to MELD or CTP score in estimating the risk of ACLF July 21, 2015 Volume 21 Issue 27

171 Gao FY et al. Predicting model for ACLF in CHB Table 1 Baseline characteristics of the study cohort Variables Total Non-ACLF ACLF P value (n = 382) (n = 330) (n = 52) Demographics Sex Female 60 (15.7) 49 (14.8) 11 (21.2) Male 322 (84.3) 281 (85.2) 41 (78.8) Age (yr) < (59.2) 207 (62.7) 19 (36.5) < (40.8) 123 (37.3) 33 (63.5) Underlying disease HBV carriers 98 (25.7) 93 (28.2) 5 (9.6) CHB 255 (58.9) 217 (65.8) 38 (73.1) Compensatory cirrhosis 29 (7.6) 20 (6.0) 9 (17.3) Biochemical indicators ALT (U/L) (338.1, ) (361.6, ) (324.9, ) AST (U/L) (217.7, 836.1) (216.1, 806.9) (273.8, 960.9) TBil (μmol/l) < (61.3) 210 (63.6) 24 (46.2) (38.7) 120 (36.4) 28 (53.8) PTA (%) > (48.1) 181 (54.8) 3 (5.8) < (32.5) 100 (30.3) 24 (46.1) (19.4) 49 (14.9) 25 (48.1) ALB 4 (g/l) 37.2 ± ± ± CHE (U/L) ± ± ± K (mmol/l) 3.91 ± ± ± Na (mmol/l) ± ± ± Cr 5 (µmol/l) 67.6 ± ± ± Virology indicators HBeAg 6 (IU/mL) Negative 88 (23.0) 73 (22.1) 15 (28.8) Positive 280 (73.3) 243 (73.6) 37 (71.2) HBV DNA (copies/ml) < (40.1) 144 (43.6) 9 (17.3) < (27.2) 93 (28.2) 11 (21.2) > (32.7) 93 (28.2) 32 (61.5) Data are presented as mean ± SD, n (%), or median (interquartile range). 1 t test; 2 χ 2 test or Fisher s exact test; 3 Mann-Whitney U test; 4 One missing data; 5 Eight missing data; 6 Fourteen missing data. ACLF: Acute-on-chronic liver failure; CHB: Chronic hepatitis B; ALB: Albumin; ALT: Alanine transaminase; AST: Aspartate transaminase; HBV: Hepatitis V virus; HBeAg: Hepatitis B e antigen; TBil: Total bilirubin; PTA: Prothrombin activity; ALB: Albumin; CHE: Cholinesterase; K: Potassium; Na: Sodium; Cr: Creatinine. Table 2 Forward multivariate logistic regression analysis of significant variables Variables Odds ratio 95%CI P value Lower Upper Age (yr) < 40 Reference TBil (µmol/l) < 171 Reference PTA (%) > 60 Reference < < HBV DNA (copies/ml) < 10 6 Reference > < HBV: Hepatitis V virus; CI: Confidence interval; PTA: Prothrombin activity; TBil: Total bilirubin. DISCUSSION There is increasing interest in predicting the probability of adverse events for various medical purposes. Accurately predicting the probability of adverse events allows for effective patient risk stratification, thus permitting more appropriate medical care. It is well established that SAE of CHB may lead to liver failure with potential severe and even lethal consequences [6,7]. An estimated 40%-50% of hepatitis B e-antigenpositive patients can undergo the immune clearance phase and partly develop SAE [14]. A three-month mortality has been reported in > 50% of cases of HBV- ACLF without liver transplantation [15,16]. The majority of the research on SAE or ACLF focuses on the clinical outcomes; epidemiologic data regarding the progression of SAE to ACLF, for use in predicting the ACLF risk, are poorly documented. This study is believed to be the first to focus on the occurrence and prediction of ACLF. Our data showed 8377 July 21, 2015 Volume 21 Issue 27

172 Gao FY et al. Predicting model for ACLF in CHB Table 3 Regression coefficients and integer risk scores of acute-on-chronic liver failure predictors estimated from the derivation set A % 11.1% ACLF predictors Regression coefficient P value Risk score Age 40 (yr) TBil 171 (µmol/l) PTA (%) < HBV DNA > 10 7 (copies/ml) < Overall risk level ACLF rate Total score Low risk 0%-4.7% 0-3 High risk 26.0%-68.8% 4-7 The regression coefficient is considered as one risk point. ACLF: Acute-on-chronic liver failure; HBV: Hepatitis V virus; PTA: Prothrombin activity; TBil: Total bilirubin. A ACLF (%) Derivation Validation All patients Risk score /7 All patients 0/57 0/62 0/60 2/65 6/74 4/38 3/27 B ACLF-related death (%) Cumulative risk of ACLF-related death (%) Low-risk (0-3 scores) 3.1% High-risk (4-7 scores) 8.1% Log rank P < t /d 0 Risk score /7 Derivation 0/37 0/46 1/37 2/43 13/50 8/26 11/16 Validation 0/20 0/16 0/23 2/22 4/24 4/12 7/11 All patients 0/57 0/62 1/60 4/65 17/74 12/38 18/27 B Cumulative risk for ACLF (%) Low-risk (0-3 scores) High-risk (4-7 scores) Log rank P < t /d Figure 2 Risk for acute-on-chronic liver failure in patients with severe acute exacerbation with different scores. A: The bars show the proportion of acute-on-chronic liver failure (ACLF) for each score category in the derivation, validation, and all-patient populations; B: Kaplan-Meier method compared the cumulative risk for ACLF between the low-risk (0-3 scores) and high-risk (4-7 scores) groups in the all-patient cohort. Figure 3 Risk for acute-on-chronic liver failure-related death of patients with severe acute exacerbation with different scores. A: The bars show the proportion of acute-on-chronic liver failure (ACLF)-related death for each score category in the all-patient cohort; B: Kaplan-Meier method compared the cumulative risk of ACLF-related death between the low-risk (0-3 scores) and high-risk (4-7 scores) groups in the all-patient cohort. that 13.6% (52/382) of SAE patients progressed to ACLF and that 28.8% (15/52) of those died of ACLFrelated causes within 56 d. In patients hospitalized for SAE receiving early intervention, the ACLF mortality rate in the present study decreased by > 14.5% compared to the ACLF mortality rate (43.3%) in our previous study [17]. Univariate and multivariate analyses identified the following four early warning and monitoring indicators: age 40 years, TBil 171 µmol/l (10 ULN), PTA 40%-60%, and HBV DNA > 10 7 copies/ml. We developed a risk score prediction model after ascribing different weights to each factor. Using these routinely available clinical data, the model facilitated identification of patients (total score 4) at high risk for ACLF and ACLF-related death early in the course of SAE. Several prognostic models of liver failure outcome include age as an important epidemiologic risk factor [18]. The most widely used prognostic model, the King s College Hospital criteria, includes age 40 years as an indicator of adverse outcome in patients with a non-acetaminophen etiology [19]. To date, how the liver is affected by increasing age has not been fully elucidated [20] ; however, some studies have 8378 July 21, 2015 Volume 21 Issue 27

173 Gao FY et al. Predicting model for ACLF in CHB A 1.0 ROC curve B 1.0 ROC curve Sensitivity Sensitivity Present score (0.857) MELD score (0.601) CTP score (0.593) Reference line specificity Present Score (0.889) MELD Score (0.632) CTP Score (0.646) Reference line specificity Figure 4 Area under the receiver operating characteristic curves of different score models for patients with severe acute exacerbation in the derivation and validation sets. A: C indices for the score model in the derivation cohort; B: C indices for the score model in the validation cohort. CTP: Child-Turcotte-Pugh; MELD: Model for End-Stage Liver Disease. confirmed that liver volume and hepatic blood flow decrease [21] and hepatic metabolism and hepatocyte morphology change [22,23] with aging. In our study, we observed that patients 40 years of age were more likely to progress to ACLF. The main mechanisms of hepatocellular jaundice are the decreased ability of cytosolic unconjugated bilirubin-binding proteins (e.g., ligandin) and UDPglucuronic acid transferase to take up and bind cytosolic unconjugated bilirubin. In addition, other processes such as hepatocellular and hepatic lobule damage that cause exudative and edema-like lesions, could reduce the excretion of conjugated bilirubin [24]. As such, serum bilirubin level is an important indicator of the extent of hepatocellular damage and necrosis. The results of this study demonstrate that patients with higher TBil levels ( 171 µmol/l; 10 ULN) had a higher relative risk of ACLF onset. PTA is recognized as a reliable marker of the protein synthetic function of the liver and, thus, a marker of the hepatic functional reserve. It is included in many authorized criteria for the diagnosis of liver failure and is used as an indication for liver transplantation worldwide. However, it is rarely applied to predict ACLF risk [12,25,26]. In classifying the PTA of SAE patients, we found that a PTA of 40%-60% was an important independent risk factor for ACLF. In particular, the risk score of 40%-50% PTA was triple that of other independent risk factors, including age and TBil level. Pretreatment HBV DNA level was closely related to cirrhosis and HCC [27-30], and could also be attributed to the enhanced immune response in SAE, which led to massive hepatocellular necrosis and clearance of the majority of HBV. The results of aggravated liver injury and decreased liver reservation could increase the chance of mortality. Jeng et al [31] found that serum HBV DNA level was the only significant risk factor for predicting hepatic decompensation in patients with acute exacerbation of CHB. Hsu et al [32] observed that pretreatment HBV DNA level stratified the risk of death in patients with SAE of CHB before the manifestation of overt liver failure. Consistent with these previous studies, our analysis identified that patients in the ACLF group tended to have a higher viral load; the risk score of HBV DNA 10 7 copies/ml was double that of other independent risk factors including age and TBil level, highlighting the significance of pretreatment HBV DNA level in predicting ACLF risk. A potential limitation of this study was that it was a retrospective, single-center study. Stratification of continuous variables as well as conversion of the regression coefficients to score point values, although necessary for clinical practicality, could be assumed to have resulted in a loss of information and decreased model accuracy. Therefore, larger, prospective, randomized studies are required to confirm the results. In conclusion, a risk score model using routinely collected clinical data to predict the risk of ACLF and ACLF-related death in patients hospitalized with SAE of CHB has excellent prediction accuracy and discriminatory ability. This model might be useful as a tool in identifying those patients at the highest risk of ACLF and in guiding monitoring and treatment decisions. COMMENTS Background Acute-on-chronic liver failure (ACLF) is a severe life-threatening clinical syndrome characterized by liver failure and is associated with high mortality if liver transplantation or artificial liver support is not available. Therefore, for early diagnosis and treatment, it is necessary to determine the risk factors and assess the risk of ACLF. Research frontiers The previous research on the severe acute exacerbation (SAE) or ACLF focuses on the clinical outcomes; epidemiologic data regarding the progression of SAE to ACLF, for use in predicting the ACLF risk, are poorly documented. Innovations and breakthroughs This study developed a risk score model using routinely collected clinical data 8379 July 21, 2015 Volume 21 Issue 27

174 Gao FY et al. Predicting model for ACLF in CHB to predict the risk of ACLF and ACLF-related death in patients hospitalized with SAE of chronic hepatitis B that was superior to the Model for End-stage Liver Disease and Child-Turcotte-Pugh scores. Applications The risk score model might be useful as a tool in identifying those patients (total score 4) at the highest risk of ACLF and in guiding monitoring and treatment decisions early in the course of SAE. Terminology According to the diagnostic criteria of ACLF recommended by the Asian Pacific Association for the Study of the Liver: acute hepatic insult manifesting as jaundice (serum bilirubin > 85 µmol/l) and coagulopathy (prothrombin activity < 40% or international normalized ratio of prothrombin time 1.5), complicated within 4 wk by ascites and/or encephalopathy in patients with previously diagnosed or undiagnosed chronic liver diseases. Peer-review This study gives a clinical score model that can easily be applied to predict the risk of ACLF in patients with chronic hepatitis B. It is important for predicting the risk of ACLF and ACLF-related death early in the course of SAE. The sample size is adequate and statistical methods are accurate. The quality of the manuscript s presentation and readability are good. REFERENCES 1 Liaw YF, Chu CM. Hepatitis B virus infection. Lancet 2009; 373: [PMID: DOI: /S (09) ] 2 Seeff LB, Koff RS. Evolving concepts of the clinical and serologic consequences of hepatitis B virus infection. Semin Liver Dis 1986; 6: [PMID: DOI: /s ] 3 Lok AS, Lai CL. Acute exacerbations in Chinese patients with chronic hepatitis B virus (HBV) infection. Incidence, predisposing factors and etiology. J Hepatol 1990; 10: [PMID: ] 4 Liaw YF. Acute exacerbation and superinfection in patients with chronic viral hepatitis. J Formos Med Assoc 1995; 94: [PMID: ] 5 Perrillo RP. Acute flares in chronic hepatitis B: the natural and unnatural history of an immunologically mediated liver disease. Gastroenterology 2001; 120: [PMID: ] 6 Wong VW, Chan HL. Severe acute exacerbation of chronic hepatitis B: a unique presentation of a common disease. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 7 Liaw YF, Leung N, Kao JH, Piratvisuth T, Gane E, Han KH, Guan R, Lau GK, Locarnini S. Asian-Pacific consensus statement on the management of chronic hepatitis B: a 2008 update. Hepatol Int 2008; 2: [PMID: DOI: / s ] 8 Garg H, Sarin SK, Kumar M, Garg V, Sharma BC, Kumar A. Tenofovir improves the outcome in patients with spontaneous reactivation of hepatitis B presenting as acute-on-chronic liver failure. Hepatology 2011; 53: [PMID: DOI: /hep.24109] 9 Fujiwara K, Yasui S, Yonemitsu Y, Fukai K, Arai M, Imazeki F, Suzuki A, Suzuki H, Sadahiro T, Oda S, Yokosuka O. Efficacy of combination therapy of antiviral and immunosuppressive drugs for the treatment of severe acute exacerbation of chronic hepatitis B. J Gastroenterol 2008; 43: [PMID: DOI: / s ] 10 Wang K, Wu ZB, Ye YN, Liu J, Zhang GL, Su YJ, He HL, Zheng YB, Gao ZL. Plasma Interleukin-10: A Likely Predictive Marker for Hepatitis B Virus-Related Acute-on-Chronic Liver Failure. Hepat Mon 2014; 14: e19370 [PMID: DOI: / hepatmon.19370] 11 Sarin SK, Kumar A, Almeida JA, Chawla YK, Fan ST, Garg H, de Silva HJ, Hamid SS, Jalan R, Komolmit P, Lau GK, Liu Q, Madan K, Mohamed R, Ning Q, Rahman S, Rastogi A, Riordan SM, Sakhuja P, Samuel D, Shah S, Sharma BC, Sharma P, Takikawa Y, Thapa BR, Wai CT, Yuen MF. Acute-on-chronic liver failure: consensus recommendations of the Asian Pacific Association for the study of the liver (APASL). Hepatol Int 2009; 3: [PMID: DOI: /s x] 12 Kamath PS, Wiesner RH, Malinchoc M, Kremers W, Therneau TM, Kosberg CL, D Amico G, Dickson ER, Kim WR. A model to predict survival in patients with end-stage liver disease. Hepatology 2001; 33: [PMID: DOI: / jhep ] 13 Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams R. Transection of the oesophagus for bleeding oesophageal varices. Br J Surg 1973; 60: [PMID: ] 14 Sheen IS, Liaw YF, Tai DI, Chu CM. Hepatic decompensation associated with hepatitis B e antigen clearance in chronic type B hepatitis. Gastroenterology 1985; 89: [PMID: ] 15 Sun QF, Ding JG, Xu DZ, Chen YP, Hong L, Ye ZY, Zheng MH, Fu RQ, Wu JG, Du QW, Chen W, Wang XF, Sheng JF. Prediction of the prognosis of patients with acute-on-chronic hepatitis B liver failure using the model for end-stage liver disease scoring system and a novel logistic regression model. J Viral Hepat 2009; 16: [PMID: DOI: / j x] 16 Cui YL, Yan F, Wang YB, Song XQ, Liu L, Lei XZ, Zheng MH, Tang H, Feng P. Nucleoside analogue can improve the long-term prognosis of patients with hepatitis B virus infection-associated acute on chronic liver failure. Dig Dis Sci 2010; 55: [PMID: DOI: /s ] 17 Liu H, Zhang H, Wan G, Sang Y, Chang Y, Wang X, Zeng H. Neutrophil-lymphocyte ratio: a novel predictor for short-term prognosis in acute-on-chronic hepatitis B liver failure. J Viral Hepat 2014; 21: [PMID: DOI: /jvh.12160] 18 Schiødt FV, Chung RT, Schilsky ML, Hay JE, Christensen E, Lee WM. Outcome of acute liver failure in the elderly. Liver Transpl 2009; 15: [PMID: DOI: /lt.21865] 19 O Grady JG, Alexander GJ, Hayllar KM, Williams R. Early indicators of prognosis in fulminant hepatic failure. Gastroenterology 1989; 97: [PMID: ] 20 Zeeh J, Platt D. The aging liver: structural and functional changes and their consequences for drug treatment in old age. Gerontology 2002; 48: [PMID: ] 21 Wynne HA, Cope LH, Mutch E, Rawlins MD, Woodhouse KW, James OF. The effect of age upon liver volume and apparent liver blood flow in healthy man. Hepatology 1989; 9: [PMID: ] 22 Cotreau MM, von Moltke LL, Greenblatt DJ. The influence of age and sex on the clearance of cytochrome P450 3A substrates. Clin Pharmacokinet 2005; 44: [PMID: DOI: / ] 23 Schmucker DL. Hepatocyte fine structure during maturation and senescence. J Electron Microsc Tech 1990; 14: [PMID: DOI: /jemt ] 24 Tiribelli C, Ostrow JD. New concepts in bilirubin and jaundice: report of the Third International Bilirubin Workshop, April 6-8, 1995, Trieste, Italy. Hepatology 1996; 24: [PMID: DOI: /hep ] 25 Bernuau J, Rueff B, Benhamou JP. Fulminant and subfulminant liver failure: definitions and causes. Semin Liver Dis 1986; 6: [PMID: DOI: /s ] 26 Bernuau J, Benhamou JP. Classifying acute liver failure. Lancet 1993; 342: [PMID: ] 27 Iloeje UH, Yang HI, Su J, Jen CL, You SL, Chen CJ. Predicting cirrhosis risk based on the level of circulating hepatitis B viral load. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 28 Chen CJ, Yang HI, Su J, Jen CL, You SL, Lu SN, Huang GT, Iloeje UH. Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 2006; 295: [PMID: DOI: /jama ] 29 Yuen MF, Tanaka Y, Fong DY, Fung J, Wong DK, Yuen JC, But DY, Chan AO, Wong BC, Mizokami M, Lai CL. Independent risk factors and predictive score for the development of hepatocellular carcinoma in chronic hepatitis B. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 8380 July 21, 2015 Volume 21 Issue 27

175 Gao FY et al. Predicting model for ACLF in CHB 30 Lee MH, Yang HI, Liu J, Batrla-Utermann R, Jen CL, Iloeje UH, Lu SN, You SL, Wang LY, Chen CJ. Prediction models of long-term cirrhosis and hepatocellular carcinoma risk in chronic hepatitis B patients: risk scores integrating host and virus profiles. Hepatology 2013; 58: [PMID: DOI: /hep.26385] 31 Jeng WJ, Sheen IS, Liaw YF. Hepatitis B virus DNA level predicts hepatic decompensation in patients with acute exacerbation of chronic hepatitis B. Clin Gastroenterol Hepatol 2010; 8: [PMID: DOI: /j.cgh ] 32 Hsu YC, Wu CY, Chang CY, Tai CM, Tseng CH, Perng DS, Mo LR, Lin JT. Pretreatment viral DNA stratifies mortality risk in patients receiving antiviral therapy for severe acute exacerbation of chronic hepatitis B. Antivir Ther 2013; 18: [PMID: DOI: /IMP2435] P- Reviewer: Wu HC, Wang L S- Editor: Yu J L- Editor: AmEditor E- Editor: Zhang DN 8381 July 21, 2015 Volume 21 Issue 27

176 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Retrospective Study ORIGINAL ARTICLE Demethylation of tumor necrosis factor-α converting enzyme promoter associated with high hepatitis B e antigen level in chronic hepatitis B Zhen-Li Wang, Shuai Gao, Xin-You Li, Feng-Kai Sun, Feng Li, Yu-Chen Fan, Kai Wang Zhen-Li Wang, Shuai Gao, Xin-You Li, Feng-Kai Sun, Feng Li, Yu-Chen Fan, Kai Wang, Department of Hepatology, Qilu Hospital of Shandong University, Jinan , Shandong Province, China Yu-Chen Fan, Kai Wang, Institute of Hepatology, Shandong University, Jinan , Shandong Province, China Author contributions: Wang ZL and Gao S performed the majority of the experiments and wrote the manuscript; Li XY and Li F collected all the human material and revised the manuscript; Sun FK and Fan YC acquired the data and performed statistical analysis; Wang K designed and supervised the study and revised the manuscript. Supported by Key Project of Chinese Ministry of Science and Technology, No. 2012ZX and No. 2013ZX ; National Natural Science Foundation of China, No , No and No ; Science and Technology Development Plan of Shandong Province, China, No. 2014GSF Institutional review board statement: The study was reviewed and approved by the Research and Ethics Committee at Qilu Hospital of Shandong University, China. Informed consent statement: All study participants provided informed written consent prior to study enrollment. Conflict-of-interest statement: The authors declare no conflicts of interest related to this work. Data sharing statement: Technical appendix, statistical code, and data set available from the corresponding author at wangdoc876@126.com. Participants gave informed consent for data sharing. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Kai Wang, MD, PhD, Department of Hepatology, Qilu Hospital of Shandong University, No. 107, Wenhuaxi Road, Jinan , Shandong Province, China. wangdoc876@126.com Telephone: Fax: Received: January 26, 2015 Peer-review started: January 27, 2015 First decision: March 10, 2015 Revised: March 19, 2015 Accepted: May 4, 2015 Article in press: May 4, 2015 Published online: July 21, 2015 Abstract AIM: To evaluate tumor necrosis factor-α converting enzyme (TACE) methylation status in patients with chronic hepatitis B (CHB). METHODS: Eighty patients with hepatitis B e antigen (HBeAg)-positive CHB, 80 with HBeAg-negative CHB, and 40 healthy controls (HCs) were randomly enrolled in this study. Genomic DNA was extracted from peripheral blood mononuclear cells and methylation status of TACE promoter was determined by methylation-specific polymerase chain reaction. The clinical and laboratory parameters were collected. RESULTS: One hundred and thirty of 160 patients with CHB (81.25%) and 38 of 40 HCs (95%) displayed TACE promoter methylation. The difference was significant 8382 July 21, 2015 Volume 21 Issue 27

177 Wang ZL et al. HBeAg level in CHB (χ 2 = 4.501, P < 0.05). TACE promoter methylation frequency in HBeAg-positive CHB (58/80, 72.5%) was significantly lower than that in HBeAg-negative CHB (72/80, 90%; χ 2 = 8.041, P < 0.01) and HCs (χ 2 = 8.438, P < 0.01). However, no significant difference was observed in the methylation frequency between HBeAgnegative CHB and HCs (χ 2 = 0.873, P > 0.05). In the HBeAg-positive group, TACE methylation frequency was significantly negatively correlated with HBeAg (r = , P < 0.01), alanine aminotransferase (r = , P < 0.01) and aspartate aminotransferase (r = , P < 0.01). CONCLUSION: Patients with HBeAg-positive CHB have aberrant demethylation of the TACE promoter, which may potentially serve as a biomarker for HBeAg seroconversion. Key words: Tumor necrosis factor-α converting enzyme; Methylation; Chronic hepatitis B; Methylation-specific polymerase chain reaction; Biomarker The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: We retrospectively recruited 80 patients with hepatitis B e antigen (HBeAg)-positive chronic hepatitis B (CHB), 80 with HBeAg-negative CHB, and 40 healthy controls. We evaluated tumor necrosis factor-α converting enzyme (TACE) promoter methylation status in peripheral blood mononuclear cells and analyzed the association between TACE methylation status and clinical features. Aberrant demethylation of the TACE promoter in HBeAg-positive CHB was associated with high HBeAg, alanine aminotransferase and aspartate aminotransferase levels. These findings imply that demethylation of the TACE promoter may potentially serve as a biomarker for HBeAg seroconversion. Wang ZL, Gao S, Li XY, Sun FK, Li F, Fan YC, Wang K. Demethylation of tumor necrosis factor-α converting enzyme promoter associated with high hepatitis B e antigen level in chronic hepatitis B. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8382.htm DOI: org/ /wjg.v21.i INTRODUCTION Hepatitis B virus (HBV) has chronically infected > 350 million people throughout the world and results in to deaths annually [1,2]. China has an estimated 120 million people chronically infected with HBV [3]. Nearly 15%-40% of HBV carriers will progress to life-threatening complications including liver cirrhosis [4], decompensated liver disease [5], or hepatocellular carcinoma (HCC) [6,7]. Hepatitis B e antigen (HBeAg) seroconversion is a crucial step during the progression of HBV infection. However, there has been no sensitive and effective model for predicting the occurrence of HBeAg seroconversion until now. DNA methylation is one of the most important epigenetic mechanisms, which denotes the addition of a methyl group to DNA. It is widespread in the human genome and mainly occurs at cytosine adjacent to guanine (CpG dinucleotides) [8]. DNA methylation in gene promoter regions often results in long-term silencing of gene expression [9]. Meanwhile, aberrant promoter demethylation is usually associated with overexpression of genes that might participate in pathogenesis of many diseases [10]. Previous studies demonstrated that aberrant demethylation in the promoter region of genes occurs in many diseases and may be used as a biomarker [11,12]. Tumor necrosis factor (TNF)-α-converting enzyme (TACE) is a modular transmembrane protein with a zinc-dependent catalytic domain [13]. The main function of TACE is to mediate cleavage of substrates such as TNF-α, TNF receptor type Ⅰ and type Ⅱ [13-15]. It is well documented that the overexpression of TACE is associated with several human diseases, including liver cancer. The human TACE promoter has not been definitely characterized to date. In the present study, we recognized the region within 2000 bp upstream of the transcriptional initiation site as a presumptive promoter region for the TACE gene, as reported previously [16-18]. GenBank indicates that there are four CpG islands located on the TACE promoter sequence (Figure 1). Therefore, aberrant demethylation of the TACE gene promoter may occur in patients with chronic hepatitis B (CHB) and may be associated with disease progression. In this study, we determined the methylation status of the TACE promoter in patients with HBeAg-positive CHB, HBeAg-negative CHB and healthy controls (HCs), and evaluated the relationship between TACE promoter methylation status and clinical features. MATERIALS AND METHODS Patients and controls Eighty patients with HBeAg-positive CHB, 80 with HBeAg-negative CHB and 40 HCs were randomly enrolled from July 2012 to June 2014 at the Department of Hepatology, Qilu Hospital of Shandong University, China. Chronic HBV infection was defined as the presence of hepatitis B surface antigen (HBsAg) for > 6 mo prior to the beginning of this study [2]. The HCs were recruited from among eligible blood donors, who had no history of liver diseases. Patients were excluded if they met any of the following criteria: (1) coinfection with hepatitis C virus or HIV; (2) other liver diseases such as autoimmune hepatitis and alcoholic hepatitis; (3) receiving antioxidant agent or interferon therapy; (4) pregnancy; (5) decompensated liver disease or HCC. Prior to sample collection, informed consent was obtained from each participant and the 8383 July 21, 2015 Volume 21 Issue 27

178 Wang ZL et al. HBeAg level in CHB TACE gene CpG site MSP Gene promoter -476 to -372 CpG island 3 +1 CpG island to CpG island to -509 CpG island to +436 Figure 1 Gene structure and methylation-specific polymerase primer set for TACE gene. TACE: Tumor necrosis factor-α converting enzyme. Table 1 Primers for methylation-specific polymerase chain reaction of the tumor necrosis factor-α converting enzyme gene Primer name Primer sequence (5-3 ) Product size (bp) Annealing temperature ( ) M F: GGAGTTTGAGATTAGTTTGGTTAAC R: TAAACACCTCCTAAATTTAAACGAT U F: AGGAGTTTGAGATTAGTTTGGTTAATG R: TAAACACCTCCTAAATTTAAACAAT M: Methylated sequence; U: Unmethylated sequence; F: Forward; R: Reverse. study was approved by the local Ethics Committee of Qilu Hospital of Shandong University. Peripheral blood mononuclear cells isolation and DNA extraction Peripheral blood mononuclear cells (PBMCs) were isolated using gradient centrifugation via Ficoll-Paque (Pharmacia Diagnostics, Uppsala, Sweden) and stored at -20 until use. Genomic DNA was extracted from PBMCs using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA, United States) and stored at -20. Sodium bisulfite modification and methylation-specific polymerase chain reaction Extracted DNA was treated with sodium bisulfite using an EZ DNA methylation kit (Zymo Research, Orange, CA, United States) and then used to perform methylation-specific polymerase chain reaction (MSP). Methylated and unmethylated primers specific for TACE promoters were designed using MethPrimer (Table 1) [19]. There were four CpG islands in the promoter region of the TACE gene. The reasons for choosing this area included: (1) the primers contained at least one CpG site at the 3 -end; (2) the primers in the M pair and U pair contained the same CpG sites within their sequence; and (3) two sets of primers had similar product Tm values, which were 68.1 for the M pair and 67.3 for the U pair [18]. The selected primer sets were used to amplify the bisulfite-modified DNA in our study. The M pair primers amplified the to site of the 5 -UTR of the TACE gene (+1 for the transcriptional start site). Meanwhile, the U pair primers amplified the to site of the 5 -UTR of the TACE gene (Figure 1). MSP was performed in a total volume of 25 μl containing 1 μl bisulfite-treated DNA, 0.5 μl of each primer (10 μmol/l), 10.5 μl nuclease-free water, and 12.5 μl Premix Taq (Zymo Research, Irvine, CA, United States), which consisted of Taq DNA polymerase, reaction buffer, and dntp mixture. The PCR protocol was composed of an initial denaturation at 95 for 10 min, followed by 45 cycles of denaturation at 95 for 30 s, annealing at 56 for 40 s, and primer extension at 72 for 40 s; followed by final extension at 72 for 10 min. Water blank without DNA was used in each round of PCR. PCR products were electrophoresed on a 2% agarose gel, stained with ethidium bromide, and visualized under UV illumination. Clinicopathological data collection Fasting venous blood was collected from each subject. HBeAg was detected by an automatic analyzer (Cobas 6000; Roche Diagnostics, Basel, Switzerland). The HBV DNA level was measured by a real-time PCR system (ABI 7300; Applied Biosystems, Foster City, CA, United States). The serum biochemical markers (Cobas Integra 800; Roche Diagnostics, Mannheim, Germany) included alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), albumin, and creatinine. Hemostasis markers (ACL TOP 700, Instrument Laboratory, Lexington, MA, United States) included prothrombin time-international normalized ratio (PT-INR), and prothrombin time activity (PTA). These markers were measured using standard methodologies in the Department of Laboratory Medicine, Qilu Hospital, Shandong University, China. Statistical analysis Quantitative variables are expressed as the mean (24 th -75 th percentiles). Categorical variables are expressed as number (percentage). Statistical analyses were performed with SPSS version 16.0 (SPSS Inc., Chicago, IL, United States). Categorical variables were compared by χ 2 test. Quantitative variables were compared by Student s t test or Mann-Whitney U test. Spearman correlation coefficients were calculated to evaluate correlations between TACE methylation status and clinicopathological parameters. All statistical analyses were two-sided and P < 0.05 was considered statistically significant. The statistical methods of 8384 July 21, 2015 Volume 21 Issue 27

179 Wang ZL et al. HBeAg level in CHB 269 participants screened 259 participants assessed 200 participants enrolled 6 HBeAg + CHB and 4 HBeAg - CHB patients were excluded for not consent to this study 26 HBeAg + CHB patients were excluded for: Other liver diseases (20) Incomplete clinical data (6) 33 HBeAg - CHB patients were excluded for: Other liver diseases (25) Incomplete clinical data (8) RESULTS Basic characteristics From June 2012 to July 2014, 269 participants (112 HBeAg-positive CHB patients, 117 HBeAg-negative CHB patients, and 40 HCs) were screened at the Department of Hepatology, Qilu Hospital. Six HBeAgpositive CHB patients and four HBeAg-negative patients were excluded for not giving consent to the study. Twenty-six HBeAg-positive CHB patients were excluded because of other liver diseases (n = 20) or incomplete clinical data (n = 6). Thirty-three HBeAgnegative CHB patients were excluded because of other liver diseases (n = 25) or incomplete clinical data (n = 8), leaving 200 participants. In the enrolled participants, there were 80 patients in the HBeAgpositive group, 80 in the HBeAg-negative group, and 40 in the HC group (Figure 2). The basic characteristics of the enrolled subjects are summarized in Table 2. HBeAg + CHB n = 80 HBeAg - CHB n = 80 HCs n = 40 Figure 2 Flow diagram of the participant selection process. HBeAg: Hepatitis B e antigen; CHB: Chronic hepatitis B; HC: Healthy control. Table 2 Baseline characteristics of the enrolled participants Variable HBeAg + CHB group HBeAg - CHB group HC group Number Age (yr) ( ) ( ) ( ) Male sex, n 57 (71.25) 53 (66.25) 28 (70.00) (%) HBeAg ( ) NA NA Log10 (HBV DNA) 5.23 ( ) 3.08 ( ) NA ALT (U/L) ( ) ( ) NA AST (U/L) ( ) ( ) NA TBIL ( ) ( ) NA (μmol/l) ALB (g/l) ( ) ( ) NA Cr (μmol/l) 63.0 ( ) ( ) NA PT-INR 1.02 ( ) 1.01 ( ) NA PTA (%) ( ) 87.0 ( ) NA Methylation, n (%) 58 (72.5) 72 (90) 38 (95) Quantitative variables are expressed as the median (25 th -75 th percentiles). Categorical variables are expressed as number (percentage). ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; TBIL: Total bilirubin; ALB: Albumin; Cr: Creatinine; PT-INR: Prothrombin time-international normalized ratio; PTA: Prothrombin activity; NA: Not available. this study were reviewed by Dr. Shu-Mei Wang from Department of Epidemiology and Biostatistics, School of Public Health, Shandong University. Methylation status of TACE promoter in CHB and HCs The methylation status of the TACE promoter was determined in PBMCs of all participants (Figure 3). One hundred and thirty of the 160 patients with CHB (81.25%) and 38 of the 40 HCs (95%) displayed aberrant TACE promoter methylation and the difference was significant (χ 2 = 4.501, P < 0.05). TACE promoter methylation frequency in the HBeAg-positive CHB group (58/80, 72.5%) was significantly lower than that in the HBeAg-negative CHB (72/80, 90%; χ 2 = 8.041, P < 0.01) and HC (χ 2 = 8.438, P < 0.01) groups. However, no significant difference could be observed in the methylation frequency between the HBeAg-negative CHB and HC groups (χ 2 = 0.873, P > 0.05) groups. Correlation between TACE promoter methylation and clinicopathological features In the HBeAg-positive CHB group, there was a negative correlation between TACE promoter methylation and HBeAg (r = , P < 0.01), ALT (r = , P < 0.01) and AST (r = , P < 0.01) (Figure 4). There was no significant correlation between TACE promoter methylation and sex (r = 0.011, P = 0.922), age (r = 0.119, P = 0.294), log10 HBV DNA (r = 0.203, P = 0.07), albumin (r = , P = 0.689), TBIL (r = , P = 0.258), PT-INR (r = 0.027, P = 0.810), PTA (r = , P = 0.223) and creatinine (r = 0.079, P = 0.484). In the HBeAg-negative CHB group, there was no significant correlation between TACE promoter methylation and sex (r = , P = 0.934), age (r = 0.023, P = 0.842), HBeAg (r = 0.076, P = 0.500), log10 HBV DNA (r = 0.060, P = 0.596), ALT (r = , P = 0.327), AST (r = , P = 0.519), albumin (r = 0.016, P = 0.886), TBIL (r = , P = 0.201), PT-INR (r = 8385 July 21, 2015 Volume 21 Issue 27

180 Wang ZL et al. HBeAg level in CHB Marker HBeAg + CHB M U HBeAg - CHB M U M HC U M WB U 150 bp 100 bp 50 bp Figure 3 Typical methylation-specific polymerase analysis results of the TACE gene promoter. WB: Water blank. A 2000 b B 2000 b HBeAg 1000 ALT (U/L) Methylated Unmethylated 0 Methylated Unmethylated C 1000 b 800 AST (U/L) Methylated Unmethylated Figure 4 Comparison of HBeAg, ALT, and AST between HBeAg-positive chronic hepatitis B patients with methylated and unmethylated TACE promoters. Significant difference ( b P < 0.05, methylated vs unmethylated) , P = 0.084), PTA (r = 0.156, P = 0.167) and creatinine (r = , P = 0.836). DISCUSSION We investigated the methylation status of the TACE gene in PBMCs of 80 patients with HBeAg-positive CHB, 80 patients with HBeAg-negative CHB, and 40 HCs. TACE promoter methylation frequency in HBeAgpositive CHB patients (58/80, 72.5%) was significantly lower than that in HBeAg-negative CHB patients (72/80, 90%; χ 2 = 8.041, P < 0.01) and HCs (χ 2 = 8.438, P < 0.01). However, no significant difference could be observed in the methylation frequency between the HBeAg-negative CHB patients and HCs (χ 2 = 0.873, P > 0.05). In the HBeAg-positive group, the TACE methylation frequency was significantly negatively correlated with HBeAg (r = , P < 0.01), ALT (r = , P < 0.01) and AST (r = , P < 0.01). The prevalence of hepatitis B is a major concern worldwide. Approximately one-third of the global population has serological evidence of past or present infection with HBV, and million people are chronic HBsAg carriers. Once chronically infected, the covalently closed circular DNA of HBV is hard to eradicate from the nucleus of hepatocytes [20,21]. People with hepatitis B are at an increased risk of developing hepatic decompensation, cirrhosis, and HCC [1]. HBeAg seroconversion is a crucial step during the progression of HBV infection. Until now, no sensitive and effective 8386 July 21, 2015 Volume 21 Issue 27

181 Wang ZL et al. HBeAg level in CHB model for predicting the occurrence of HBeAg seroconversion has been proposed. DNA methylation and demethylation are important epigenetic mechanisms. Demethylation of a promoter region is often associated with long-term gene overexpression and is linked to many diseases [22-24]. DNA methylation status is usually stable and suitable for use as a biomarker for disease detection and prognosis prediction [25]. The present study revealed that the TACE methylation frequency was significantly lower in HBeAg-positive CHB than in HBeAg-negative CHB and HCs. Also, the TACE methylation frequency was negatively correlated with serum ALT and AST. Aberrant TACE methylation status may have a role in the progression of HBV infection and induce liver damage. Most importantly, this study revealed that TACE demethylation was significantly associated with the HBeAg level in HBeAg-positive CHB, which indicated that it might possess a potential value for predicting HBeAg seroconversion. Further studies are needed to prove its usefulness. The prediction of HBeAg seroconversion is essential for the management of HBV infection. This finding might help clinicians initiate the correct treatment strategy at an early stage and prevent many patients from developing fatal complications such as hepatic decompensation, cirrhosis, or HCC. There were several limitations in this study. The sample size was relatively small and we could not confirm our results in a second cohort. Therefore, our findings need further validation with large studies prior to clinical application, and the follow-up of the HBeAg-positive CHB patients should also be performed in a further study. Prospective studies with longterm follow-up would be useful for determining the predictive values for HBeAg seroconversion. This is an exploratory study and further studies are needed to reveal the mechanisms involved. In conclusion, this study demonstrated demethylation of the TACE promoter in HBeAg-positive CHB, which was associated with HBeAg level. TACE promoter demethylation may potentially serve as a marker for HBeAg seroconversion. COMMENTS Background Hepatitis B e antigen (HBeAg) seroconversion is a crucial step during the progression of hepatitis B virus (HBV) infection. Nevertheless, there have been no sensitive and effective markers for predicting the occurrence of HBeAg seroconversion until now. Tumor necrosis factor (TNF)-α converting enzyme (TACE) have been demonstrated to be involved in liver inflammation. GenBank indicates that there are four CpG islands located on the TACE promoter sequence. However, the methylation status of the TACE promoter in chronic hepatitis B (CHB) and its significance for HBeAg seroconversion have not been demonstrated. Research frontiers HBeAg seroconversion is a crucial step during the progression of HBV infection. The current research hotspot is to find effective biomarkers for predicting the occurrence of HBeAg seroconversion. DNA methylation is one of the most important epigenetic mechanisms. Aberrant methylation or demethylation of several genes has been associated with a number of diseases and many methylation biomarkers have been proposed. Innovations and breakthroughs This study demonstrated aberrant demethylation of the TACE promoter in HBeAg-positive CHB, which was associated with high HBeAg level, and indicated that TACE demethylation may potentially serve as a biomarker for HBeAg seroconversion. Applications Aberrant demethylation of TACE promoter may be used as a biomarker for predicting the occurrence of HBeAg seroconversion. Terminology TACE is a modular transmembrane protein with a zinc-dependent catalytic domain. Its main function is to mediate cleavage of substrates such as TNF-α, TNF receptor Ⅰ and TNF receptor Ⅱ. DNA methylation is one of the most important epigenetic mechanisms, which donates a methyl group to DNA. A biomarker is a substance used as an indicator of a biological state. Peer-review This manuscript presented some useful data showing that aberrant demethylation of TACE promoter existed in HBeAg-positive CHB, which was associated with high HBeAg level. This might potentially serve as a biomarker for HBeAg seroconversion. The research design, and the data analysis and statistics are reasonable. REFERENCES 1 Liaw YF, Chu CM. Hepatitis B virus infection. Lancet 2009; 373: [PMID: DOI: /S (09) ] 2 Lok AS, McMahon BJ. Chronic hepatitis B. Hepatology 2007; 45: [PMID: DOI: /hep.21513] 3 Cui Y, Jia J. Update on epidemiology of hepatitis B and C in China. J Gastroenterol Hepatol 2013; 28 Suppl 1: 7-10 [PMID: DOI: /jgh.12220] 4 Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 2006; 45: [PMID: DOI: /j.jhep ] 5 Sato S, Suzuki K, Akahane Y, Akamatsu K, Akiyama K, Yunomura K, Tsuda F, Tanaka T, Okamoto H, Miyakawa Y, Mayumi M. Hepatitis B virus strains with mutations in the core promoter in patients with fulminant hepatitis. Ann Intern Med 1995; 122: [PMID: ] 6 Lok AS. Chronic hepatitis B. N Engl J Med 2002; 346: [PMID: DOI: /NEJM ] 7 Bosch FX, Ribes J, Cléries R, Díaz M. Epidemiology of hepatocellular carcinoma. Clin Liver Dis 2005; 9: , v [PMID: DOI: /j.cld ] 8 Cokus SJ, Feng S, Zhang X, Chen Z, Merriman B, Haudenschild CD, Pradhan S, Nelson SF, Pellegrini M, Jacobsen SE. Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 2008; 452: [PMID: DOI: /nature06745] 9 Jones PA. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat Rev Genet 2012; 13: [PMID: DOI: /nrg3230] 10 Qian J, Chen Q, Yao DM, Yang L, Yang J, Wen XM, Zhang YY, Chai HY, Ma JC, Deng ZQ, Lin J. MOK overexpression is associated with promoter hypomethylation in patients with acute myeloid leukemia. Int J Clin Exp Pathol 2015; 8: [PMID: ] 11 Zhang W, Jiao H, Zhang X, Zhao R, Wang F, He W, Zong H, Fan Q, Wang L. Correlation between the expression of DNMT1, and GSTP1 and APC, and the methylation status of GSTP1 and APC in association with their clinical significance in prostate cancer. Mol Med Rep 2015; 12: [PMID: DOI: / mmr ] 12 Søes S, Daugaard IL, Sørensen BS, Carus A, Mattheisen M, 8387 July 21, 2015 Volume 21 Issue 27

182 Wang ZL et al. HBeAg level in CHB Alsner J, Overgaard J, Hager H, Hansen LL, Kristensen LS. Hypomethylation and increased expression of the putative oncogene ELMO3 are associated with lung cancer development and metastases formation. Oncoscience 2014; 1: [PMID: ] 13 Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP. A metalloproteinase disintegrin that releases tumour-necrosis factoralpha from cells. Nature 1997; 385: [PMID: DOI: /385729a0] 14 Reddy P, Slack JL, Davis R, Cerretti DP, Kozlosky CJ, Blanton RA, Shows D, Peschon JJ, Black RA. Functional analysis of the domain structure of tumor necrosis factor-alpha converting enzyme. J Biol Chem 2000; 275: [PMID: ] 15 Condon TP, Flournoy S, Sawyer GJ, Baker BF, Kishimoto TK, Bennett CF. ADAM17 but not ADAM10 mediates tumor necrosis factor-alpha and L-selectin shedding from leukocyte membranes. Antisense Nucleic Acid Drug Dev 2001; 11: [PMID: DOI: / ] 16 Akizu N, Estarás C, Guerrero L, Martí E, Martínez-Balbás MA. H3K27me3 regulates BMP activity in developing spinal cord. Development 2010; 137: [PMID: DOI: / dev ] 17 Li C, Chu N, Wang B, Wang J, Luan J, Han L, Meng D, Wang Y, Suo P, Cheng L, Ma X, Miao Z, Liu S. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population. PLoS One 2012; 7: e24561 [PMID: DOI: /journal.pone ] 18 Han LY, Fan YC, Mu NN, Gao S, Li F, Ji XF, Dou CY, Wang K. Aberrant DNA methylation of G-protein-coupled bile acid receptor Gpbar1 (TGR5) is a potential biomarker for hepatitis B Virus associated hepatocellular carcinoma. Int J Med Sci 2014; 11: [PMID: DOI: /ijms.6745] 19 Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002; 18: [PMID: ] 20 Raimondo G, Allain JP, Brunetto MR, Buendia MA, Chen DS, Colombo M, Craxì A, Donato F, Ferrari C, Gaeta GB, Gerlich WH, Levrero M, Locarnini S, Michalak T, Mondelli MU, Pawlotsky JM, Pollicino T, Prati D, Puoti M, Samuel D, Shouval D, Smedile A, Squadrito G, Trépo C, Villa E, Will H, Zanetti AR, Zoulim F. Statements from the Taormina expert meeting on occult hepatitis B virus infection. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 21 Pollicino T, Saitta C, Raimondo G. Hepatocellular carcinoma: the point of view of the hepatitis B virus. Carcinogenesis 2011; 32: [PMID: DOI: /carcin/bgr108] 22 Rochtus A, Izzi B, Vangeel E, Louwette S, Wittevrongel C, Lambrechts D, Moreau Y, Winand R, Verpoorten C, Jansen K, Van Geet C, Freson K. DNA methylation analysis of Homeobox genes implicates HOXB7 hypomethylation as risk factor for neural tube defects. Epigenetics 2015; 10: [PMID: DOI: / ] 23 Yuan R, Zhi Q, Zhao H, Han Y, Gao L, Wang B, Kou Z, Guo Z, He S, Xue X, Hu H. Upregulated expression of mir-106a by DNA hypomethylation plays an oncogenic role in hepatocellular carcinoma. Tumour Biol 2015; 36: [PMID: DOI: /s ] 24 Augello C, Gianelli U, Falcone R, Tabano S, Savi F, Bonaparte E, Ciboddo M, Paganini L, Parafioriti A, Ricca D, Lonati S, Cattaneo D, Fracchiolla NS, Iurlo A, Cortelezzi A, Bosari S, Miozzo M, Sirchia SM. PDGFB hypomethylation is a favourable prognostic biomarker in primary myelofibrosis. Leuk Res 2015; 39: [PMID: DOI: /j.leukres ] 25 Chan TA, Baylin SB. Epigenetic biomarkers. Curr Top Microbiol Immunol 2012; 355: [PMID: DOI: /82_2011_165] P- Reviewer: Celikbilek M, He ST, Kemik O S- Editor: Qi Y L- Editor: Cant MR E- Editor: Liu XM 8388 July 21, 2015 Volume 21 Issue 27

183 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Retrospective Study ORIGINAL ARTICLE Anatomy and influence of the splenic artery in laparoscopic spleen-preserving splenic lymphadenectomy Chao-Hui Zheng, Mu Xu, Chang-Ming Huang, Ping Li, Jian-Wei Xie, Jia-Bin Wang, Jian-Xian Lin, Jun Lu, Qi-Yue Chen, Long-Long Cao, Mi Lin Chao-Hui Zheng, Mu Xu, Chang-Ming Huang, Ping Li, Jian- Wei Xie, Jia-Bin Wang, Jian-Xian Lin, Jun Lu, Qi-Yue Chen, Long-Long Cao, Mi Lin, Department of Gastric Surgery, Fujian Medical University Union Hospital, Fuzhou , Fujian Province, China Author contributions: Zheng CH, Xu M and Huang CM designed the research; Li P, Xie JW and Wang JB performed the research; Lin JX, Lu J and Chen QY contributed to the diagnostic imaging work; Cao LL and Lin M analyzed the data; Zheng CH, Xu M and Huang CM wrote the paper. Supported by National Key Clinical Specialty Discipline Construction Program of China, No. [2012]649; and Key Project of Science and Technology Plan of Fujian Province, China, No. 2014Y0025. Institutional review board statement: Ethics committee of Fujian Union Hospital approved this retrospective study. Written consent was given by the patients for their information to be stored in the hospital database and used for research. Informed consent statement: All study participants, or their legal guardian, provided informed written consent prior to study enrollment. Conflict-of-interest statement: The authors declare that they have no competing interests. Data sharing statement: Technical appendix, statistical code, and dataset are available from the corresponding author at hcmlr2002@163.com. Participants gave informed consent for data sharing. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Chang-Ming Huang, Professor, Department of Gastric Surgery, Fujian Medical University Union Hospital, No. 29 Xinquan Road, Fuzhou Fujian Province, China. hcmlr2002@163.com Telephone: Fax: Received: February 11, 2015 Peer-review started: February 11, 2015 First decision: March 10, 2015 Revised: March 31, 2015 Accepted: April 17, 2015 Article in press: April 17, 2015 Published online: July 21, 2015 Abstract AIM: To investigate the splenic hilar vascular anatomy and the influence of splenic artery (SpA) type in laparoscopic total gastrectomy with spleen-preserving splenic lymphadenectomy (LTGSPL). METHODS: The clinical anatomy data of 317 patients with upper- or middle-third gastric cancer who underwent LTGSPL in our hospital from January 2011 to December 2013 were collected. The patients were divided into two groups (concentrated group vs distributed group) according to the distance between the splenic artery s furcation and the splenic hilar region. Then, the anatomical layout, clinicopathologic characteristics, intraoperative variables, and postoperative variables were compared between the two groups. RESULTS: There were 205 patients with a concentrated type (64.7%) and 112 patients with a distributed type (35.3%) SpA. There were 22 patients (6.9%) with a single branch of the splenic lobar vessels, 250 (78.9%) with 2 branches, 43 (13.6%) with 3 branches, and 2 patients (0.6%) with multiple branches. Eighty seven 8389 July 21, 2015 Volume 21 Issue 27

184 Zheng CH et al. Vascular anatomy in splenic hilum patients (27.4%) had type Ⅰ splenic artery trunk, 211 (66.6%) had type Ⅱ, 13 (4.1%) had type Ⅲ, and 6 (1.9%) had type Ⅳ. The mean splenic hilar lymphadenectomy time (23.15 ± 8.02 vs ± 8.84 min; P = 0.002), mean blood loss resulting from splenic hilar lymphadenectomy (14.78 ± vs ± ml; P = 0.044), and number of vascular clamps used at the splenic hilum (9.64 ± 2.88 vs ± 3.57; P = 0.040) were significantly lower in the concentrated group than in the distributed group. However, the mean total surgical time, mean total blood loss, and the mean number of harvested splenic hilar lymph nodes were similar in both groups (P > 0.05 for each comparison). There were also no significant differences in clinicopathological and postoperative characteristics between the groups (P > 0.05). CONCLUSION: It is of value for surgeons to know the splenic hilar vascular anatomy when performing LTGSPL. Patients with concentrated type SpA may be optimal patients for training new surgeons. Key words: Stomach neoplasms; Spleen-preservation; Laparoscopy; Lymphadenectomy; Vascular anatomy The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Japanese Gastric Cancer Association guidelines recommend splenic hilar lymphadenectomy in patients with upper- and middle-third gastric cancer. However, the vessels in the splenic hilum are intricate and variable. The areas adjacent to the splenic hilum are located in a deep, narrow operating space, which makes it difficult to identify the proper vessels and successfully complete splenic regional lymphadenectomy. Therefore, familiarity with the vascular anatomy is useful for surgeons performing laparoscopic total gastrectomy with spleen-preserving splenic hilar lymphadenectomy (LTGSPL) and may reduce the complications. This is the first study to investigate the splenic vascular anatomy in vivo and its influence on LTGSPL. Zheng CH, Xu M, Huang CM, Li P, Xie JW, Wang JB, Lin JX, Lu J, Chen QY, Cao LL, Lin M. Anatomy and influence of the splenic artery in laparoscopic spleen-preserving splenic lymphadenectomy. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8389.htm DOI: org/ /wjg.v21.i INTRODUCTION The splenic hilar lymph nodes (No. 10 LNs) are easily invaded in advanced upper- or middle-third gastric cancer. The metastatic frequency in No. 10 LNs is 9.8%-20.9% [1]. According to the Japanese Gastric Cancer Association (JGCA), No. 10 LNs must be dissected in upper- or middle-third gastric cancer patients treated with radical total gastrectomy [2]. The feasibility and safety of laparoscopic-assisted total gastrectomy with D2 LN dissection in upper- or middlethird gastric cancer patients have been accepted [3,4]. Laparoscopic total gastrectomy with spleen-preserving splenic hilar lymphadenectomy (LTGSPL) has been gradually offered to these patients as a result of new interest in surgical treatments and progress in gastric cancer surgical and anatomical techniques [5-7]. The feasibility of LTGSPL in these patients has also been confirmed [5-9]. The vessels in the splenic hilum are intricate and variable. The areas adjacent to the splenic hilum are complex and located in a deep, narrow operating space, which makes it difficult to identify the correct vessels accurately, and successfully complete splenic regional lymphadenectomy. Furthermore, it is difficult to control bleeding once vessels are injured. Therefore, highly skilled surgeons are required for this procedure [7,9]. Both experience and knowledge of minimally invasive surgical anatomy are helpful for laparoscopic surgery [10]. Additionally, familiarity with the splenic hilar vascular anatomy is useful for surgeons performing LTGSPL, and may reduce the complications. However, studies on the splenic hilar vascular anatomy in vivo and the impact of splenic artery (SpA) type on LTGSPL have not been reported. Therefore, we conducted this study to investigate SpA vascular anatomy and evaluate the influence of different vessel types on the surgical outcomes in patients undergoing LTGSPL. MATERIALS AND METHODS Patients Between January 2011 and December 2013, 317 patients with upper- or middle-third gastric cancer underwent LTGSPL in the Department of Gastric Surgery, Fujian Medical University Union Hospital. All subjects were preoperatively confirmed as having upper- or middle-third gastric cancer by analyses of endoscopic biopsy specimens. Preoperative imaging was routinely performed following endoscopic examination, including computer tomography (CT) scanning, ultrasonography (US) of the abdomen, and endoscopic US. Patients with T4b gastric cancer were preoperatively excluded from this study. Patients with enlargement and integration of No.10 LNs were not considered candidates for surgery. The surgical procedure, including its advantages and risks, was explained to all candidates for surgery. The ethics committee of Fujian Union Hospital approved this retrospective study. Written consent was given by the patients for their information to be stored in the hospital database and used for research July 21, 2015 Volume 21 Issue 27

185 Zheng CH et al. Vascular anatomy in splenic hilum Data collection All patients underwent abdominal helical CT (Discovery CT750 HD, GE Healthcare, Waukesha, WI, United States). The scans ranged from the top of the diaphragm to the lower edge of the liver. On average, 100 ml of nonionic contrast agent was infused at a rate of 2 ml/s. CT data acquisition was triggered using the bolus tracking technique. The region of interest was the abdominal aorta just below the diaphragmatic dome. The trigger threshold level was set at a CT value of 100 Hounsfield units. Abdominal CT scans were performed at a slice thickness of 5 mm. Scanning was performed during each phase in a single breath-hold. The 3D images by CT (3DCT) of the splenic vessels were individually reconstructed using the original scanning images. The CT data were downloaded to an offline workstation for image postprocessing and analysis. The distance from the SpA s furcation to the splenic hilar region was measured using the reconstructed images. The distance was then re-measured during surgery by the opening degree of the dissecting forceps, which was 2 cm when opened completely. The results were then compared with the 3DCT. We selected 2 cm as the cutoff point for classification. When the SpA divided into its terminal branches < 2 cm from the splenic hilum, the case was considered to be concentrated type. If the distance was 2 cm, the case was considered to be the distributed type [11,12]. Patients were then assigned to the concentrated group or the distributed group. TNM stage was defined based on the 7 th Edition of the UICC TNM system [13]. The operation time at the splenic hilum was defined as the time for splenic hilar lymphadenectomy. Blood loss at the splenic hilum was defined as the volume of blood lost during dissection of the splenic hilar LNs. Surgical procedures Splenic hilar lymphadenectomy was performed according to the guidelines of the Japanese Classification of Gastric Carcinoma [14]. In our institution, LTGSPL has become highly standardized, with all operations performed by a senior surgeon (Chang- Ming Huang) who had performed > 500 laparoscopic assisted gastrectomies before starting to perform this operation [15,16]. We have summarized an effective procedure called Huang s 3-step maneuver for performing LTGSPL in clinical practice [17]. The steps are described as follows: Patient positioning: The patient is placed in a reverse Trendelenburg position with the head elevated about degrees and tilted left side up about degrees. The surgeon stands between the patient s legs, and the assistant and camera operator are both on the patient s right side. Splenic hilar LNs dissection: The first step is dissection of the LNs in the inferior pole region of the spleen. The surgeon uses an ultrasonic scalpel to separate the greater omentum toward the left up to the splenic flexure of the colon along the superior border of the transverse colon. Next, the anterior pancreatic fascia (APF) is peeled against the anterior inherent pancreatic fascia along the direction of the pancreas to the superior border of the pancreatic tail. Then, the surgeon uses the ultrasonic scalpel to open the APF along the fascia s continuation, and the retropancreatic space (RPS) is entered at the superior border of the pancreas. Next, the mutually linked potential space in the gastrosplenic ligament (GSL) and the splenorenal ligament can be entered by following the RPS, and the end of the splenic vessel s trunk can be exposed at the initial segment of the GSL. The dissection is continued along the end of the splenic vessels to expose the lower lobar vessels of the spleen (LLVSs) or the lower pole vessels of the spleen. The assistant uses the right hand to pull up the fatty lymphatic tissue on the surface of the vessels, and the surgeon uses the non-functional face of the ultrasonic scalpel to dissect the lymphatic tissue along the vessels distally up to the splenic hilar. During the dissection, the roots of the left gastroepiploic vein (LGEV) can be revealed at the splenic lobar artery (SLA) or splenic lower pole artery (SLPA) near the lower pole of the spleen. The assistant pulls up the fatty lymphatic tissue at the roots of the LGEVs, and the surgeon uses the ultrasonic scalpel to vascularize the vessels by dissecting the tissue along the anatomical space at the surface of the vessels. Next, the LGEVs are transected at their roots with vascular clamps. The resection of the No. 4sb LNs is then accomplished. At this time, the assistant pulls up the fatty lymphatic tissue on the surface of the LLVSs, while the surgeon uses the ultrasonic scalpel to meticulously dissect this tissue along the anatomical space on the surface of the LLVSs toward the splenic hilar, alternatively using blunt and sharp methods of separation. As the LLVSs are gradually revealed, 1-2 branches of the short gastric vessels (SGVs) issuing from the inferior lobar artery of the spleen may be encountered. If so, the assistant gently pulls up the SGVs, and the surgeon uses the ultrasonic scalpel to meticulously dissect the fatty lymphatic tissue around the vessels to vascularize the vessels, which are divided at their roots with vascular clamps. The second step is dissection of the LNs in the region of the SpA trunk. The assistant uses the right hand to pull up the isolated fatty lymphatic tissue on the surface of the trunk of SpA. The surgeon uses the ultrasonic scalpel to denude the trunk of the SpA along the latent anatomic space on its surface toward the splenic hilar up to the fork of the splenic lobar arteries. The fatty lymphatic tissue around the end of the SpA is then excised. One or two branches of the posterior gastric artery (PGA), which are derived from the SpA, will always be encountered in this region. At this time, the assistant should clamp the vessels and pull 8391 July 21, 2015 Volume 21 Issue 27

186 Zheng CH et al. Vascular anatomy in splenic hilum them upward, while the surgeon uses the ultrasonic scalpel to dissect the fatty lymphatic tissue around the PGAs and close to the trunk of the SpA. The PGAs are divided at their roots using vascular clamps. The excision of the No. 11d LNs is then accomplished. The third step is dissection of the LNs in the superior pole region of the spleen. The assistant gently pulls up the fatty lymphatic tissue on the surface of the splenic vessels branches in the GSL, and the surgeon applies the non-functional face of the ultrasonic scalpel along the anatomical space on the surface of the SLA and vein to completely vascularize the vessels in the splenic superior lobar area, using meticulous sharp or blunt pushing, peeling and dissection. At this time, 1-3 branches of the SGVs arising from the SLA and passing through the GSL are usually encountered. The assistant should clamp and pull the SGVs upward, while the surgeon meticulously resects the surrounding fatty lymphatic tissue, proceeding toward the roots of the vessels. Next, the SGVs are divided at their roots with clamps. The last branch of SGVs in the superior pole region of the spleen is often very short, which causes the fundus to lie close against the splenic hilar. The last branch can be easily damaged, causing bleeding, if there is lack of proper traction. At this time, the assistant should pull the fundus toward the lower right side enough to completely expose the vessel, while the surgeon transects the vessel at its root with vascular clamps after carefully separating the surrounding fatty lymphatic tissue. Finally, the splenic hilar lymph nodes are dissected completely. Statistical analysis Statistical analyses were performed using the SPSS 18.0 statistical software package (IBM Corp., Armonk, NY, United States). Means were compared using t-tests. Categorical data were compared with a χ 2 test or Fisher s exact test. P values < 0.05 were considered statistically significant. RESULTS vascular anatomy in the splenic hilum Classification of the terminal branches of the SpA: The SpA branches from the celiac artery. It continues toward the left along the upper border of the pancreas and gives off branches to the pancreas along the way. The SpA then divides into the terminal branches in the spleen. The type of terminal branches was classified according to the distance between the artery s furcation and the splenic hilar region as either a concentrated type or distributed type SpA. The concentrated type SpA divides into its terminal branches < 2 cm from the splenic hilum. The SpA trunk is long, but the branches are short and wide in diameter and reach the spleen as a compact bundle in this type. Conversely, the distributed type SpA generally divides into its terminal branches 2 cm from the splenic hilum. The SpA trunk is short, but the branches are longer and have a smaller diameter and enter the spleen in a distributed fashion (Figure 1). In the study, the types of the terminal branches of the SpA observed preoperatively by 3DCT were consistent with their intraoperative conditions. The anatomical data showed that 64.7% of the patients had the concentrated type (205 cases) and 35.3% had the distributed type (112 cases). SLA: The SLAs are the terminal branches of the SpA at the splenic hilum, and there can be one or a number of branches. If the SpA passes tortuously through the splenic hilar without dividing into terminal branches, it is classified as a single-branch type. This type is rare and was observed in 22 cases (6.9%) in our study. When the SpA divides into the superior and inferior lobar arteries, it is classified as a 2-branched type. This type is common and was observed in 250 cases (78.9%). It is called a 3-branched type when the SpA divides into the superior, middle, and inferior lobar arteries of the spleen. This type was present in 43 cases (13.6%) in the study. The SpA rarely branches into 4-7 branches that enter the splenic hilum, and these cases are classified as multiple-branched type. There were only two such cases (0.6%) in our study (Figure 2). Relationship between the course of the SpA trunk and the pancreas: The course of the SpA trunk is intimately associated with the pancreas, and it is divided into four variations. In Type Ⅰ, the SpA trunk follows the suprapancreatic course to the splenic hilum after arising from the celiac artery. This type was present in 87 cases (27.4%). In Type Ⅱ, the middle half of the SPA trunk has either a retro- or intra-pancreatic course. There were 211 Type Ⅱ cases (66.6%) in our study. In Type Ⅲ, the distal half of the SPA follows either a retro- or intra-pancreatic course. There were 13 Type Ⅲ cases (4.1%). In Type Ⅳ, the distal three-quarters of the SpA is entirely embedded in the substance of the pancreas or follows a retropancreatic course. We observed six Type Ⅳ cases (1.9%) in this study (Figure 3). There is also an existing splenic pole artery (SPoA) that directly enters the upper and/or lower pole of the spleen without passing through the splenic hilum. There is a splenic upper pole artery (SUPA) and a splenic lower pole artery (SLPA). The SPoA may arise from the SpA trunk, SLA or left gastroepiploic artery. The data show that 68 patients had SPoA. The incidence of SUPA was 16.40% (52 cases). The incidence of SLPA was 5.05% (16 cases). The splenic artery also branched into arteries to supply other organs. The short gastric artery (SGA) and left gastroepiploic artery are important vessels related to the splenic hilar lymphadenectomy. The SGA mainly arises from the SLA, the SpA trunk and the left gastroepiploic artery. The mean number of branches of the SGA was 3.62 ± 1.09 (range, 0 to 7) in our study July 21, 2015 Volume 21 Issue 27

187 Zheng CH et al. Vascular anatomy in splenic hilum A 1 2 < 2.0 cm < 2.0 cm B cm 2.0 cm Figure 1 terminal branches of the splenic artery. A: The concentrated type SpA (1: Preoperative assessment using 3DCT images; 2: Operative view after the completion of the splenic LN dissection); B: The distributed type SpA (1: Preoperative assessment using 3DCT images; 2: Operative view after the completion of the splenic LN dissection). SpA: Splenic artery; 3DCT: 3-dimensional computer tomography; LNs: lymph nodes. A B C D Figure 2 Splenic lobar artery. A: Single-branch type; B: Two-branched type; C: Three-branched type; D: Multiple-branched July 21, 2015 Volume 21 Issue 27

188 Zheng CH et al. Vascular anatomy in splenic hilum A B C D Figure 3 Relation between the course of the splenic artery trunk and the pancreas. A: Type Ⅰ; B: Type Ⅱ; C: Type Ⅲ; D: Type Ⅳ. The detailed data are presented in Table 1. Patient clinicopathologic characteristics The clinicopathologic characteristics of the 317 patients are presented in Table 2. The series included 244 men and 73 women with a mean age of 60.8 years (range, years). Age, sex, body mass index, tumor size, histologic type, tumor depth, N stage and TNM stage did not differ between the groups (all P > 0.05). Patient intraoperative characteristics For all 317 patients, the mean surgical time was ± min (range, min). The mean total blood loss was ± ml (range, ml). The mean number of harvested No. 10 LNs was 2.69 ± 2.16 (range, 0-9). The mean splenic hilar lymphadenectomy time (23.15 ± 8.02 vs ± 8.84 min; P = 0.002), mean blood loss resulting from splenic hilar lymphadenectomy (14.78 ± vs ± ml; P = 0.044), number of vascular clamps used at the splenic hilum (9.64 ± 2.88 vs ± 3.57; P = 0.040), and mean total number of retrieved LNs (40.36 ± vs ± 14.80; P = 0.015) were significantly lower in the concentrated group than in the distributed group. The mean total surgical time, mean total blood loss, mean number of retrieved and positive No.10 LNs, and mean number of positive LNs were similar in both groups (all P > 0.05) (Table 3). Patient postoperative characteristics There was no significant difference in the length of hospital stay, time to first flatus, time to a fluid diet, time to a soft diet, or morbidity between the two groups (all P > 0.05) (Table 4). DISCUSSION The vessels in the splenic hilum are intricate and variable, and are covered with fatty lymphoid tissue. Therefore, careful lymph node dissection in the area is important because uncontrollable bleeding can occur after vessel or spleen injury [18]. Thus, understanding the vessel anatomy in the splenic hilum is important. Most studies of the splenic hilar vessels are performed by dissecting cadavers or postmortem specimens. These studies examine the origin, length and course of the SpA. They also examine the type of terminal branches of the SpA using a sequential injection method involving both radiology and corrosion casting. These types of studies provided the theoretical basis for spleen-preserving treatment in traumatic spleen injuries [11,19,20]. There are also studies that have used multidetector-row CT or digital subtraction angiography to identify the type of SpA, branches of the SpA, and segmental arteries in the spleen. These analyses provided the anatomical imaging data for spleen artery embolotherapy [21-23]. Several scholars have suggested that studies based on cadavers or postmortem specimens do not accurately reflect the splenic hilar vascular anatomy because of tissue degeneration that occurs after the specimens are fixed in formalin. In addition, only the general vessel course in the splenic hilum can 8394 July 21, 2015 Volume 21 Issue 27

189 Zheng CH et al. Vascular anatomy in splenic hilum Table 1 Vascular anatomy of the splenic hilum in the 2 groups Table 3 Comparison of intraoperative characteristics between the 2 groups Terminal branches of the SpA Concentrated type Distributed type P value Intraoperative characteristics Terminal branches of the SpA Concentrated type Distributed type P value Type of SpA Single branch SpA branched SpA branched SpA Multiple-branched SpA 0 2 SpA along the pancrease Type Ⅰ Type Ⅱ Type Ⅲ 7 6 Type Ⅳ 4 2 SUPA SLPA No. of SGAs 3.60 ± ± Operation time (min) ± ± Operation time at splenic ± ± hilum (min) Blood loss (ml) ± ± Blood loss at splenic hilum ± ± (ml) No. of positive LNs 7.36 ± ± No. of retrieved LNs ± ± No. of positive No. 10 LNs 0.23 ± ± No. of retrieved No ± ± LNs No. of vascular clamps at splenic hilum 9.64 ± ± SUPA: Splenic upper pole artery; SLPA: Splenic lower pole artery; SGA: Short gastric artery. LNs: Lymph nodes. Table 2 Comparison of clinicopathological characteristics between the 2 groups Patient characteristics Terminal branches of the SpA P value Concentrated type Distributed type No. of patients Sex Male Female Age (yr) ± ± BMI (kg/m 2 ) ± ± Tumor size (cm) 5.40 ± ± Histological Differentiated Undifferentiated Depth of invasion pt pt pt pt4a Lymph node metastasis pn pn pn pn TNM stage Ⅰ Ⅱ Ⅲ be observed by imaging. The distribution of the fatty tissue or the adjacent organs around the vessels cannot be evaluated. Thus, there are limitations in clinical guidance. Recently, laparoscopic splenectomy has been used clinically and is now a standard procedure in hemopathy [24,25]. These studies only investigated surgical feasibility, safety, surgical approach, and surgical complications rather than the vascular anatomy in vivo. Conversely, our study dissected the splenic hilar vessels in vivo using a laparoscope. Therefore, our study was more intuitive and realistic because the normal physiological function Table 4 Comparison of postoperative characteristics between the 2 groups Postoperative characteristics Terminal branches of the SpA Concentrated type Distributed type P value Postoperative hospital ± ± stay (d) Day of first flatus (d) 4.17 ± ± Day of first fluid diet (d) Day of first semifluid diet (d) Postoperative complications 4.81 ± ± ± ± Pulmonary infection Abdominal infection Wound problem Anastomotic leakage Chylous fistula Anastomotic bleeding Septicemia existed during the investigation. As a result, our study provides a more reliable and valuable reference for surgeons performing LTGSPL. The SpA usually passes the upper border of the pancreas in a variety of forms [12]. Identifying the relationship between the SpA and the pancreas helped reduce intraoperative injury. Type Ⅰ allowed the SpA to be sufficiently exposed and vascularized. Thus, it was easy to dissect the lymphatic fatty tissues around the entire artery. However, in other types, a portion of the SpA ran within the parenchyma of the pancreas. The resection of the lymphatic tissues should be performed more carefully because the pancreatic tissues might be incorrectly regarded to be LNs, which could lead to postoperative complications such as pancreatic fistula. The SLA branches from the SpA at the splenic hilum and is variable [12]. The SLA is tortuous, dissociative and usually identified as the SGV or posterior gastric vessel. Thus, it might be incorrectly severed, leading to splenic ischemia. Therefore, vessels with an unclear 8395 July 21, 2015 Volume 21 Issue 27

190 Zheng CH et al. Vascular anatomy in splenic hilum course should be separated toward their distal terminal until their orientation can be distinguished. Such manipulation enables a safe division and prevents unnecessary injury caused by a blind dissection. The SGAs were some of the most important structures that required severing during lymphadenectomy. The SGAs were easily injured and resulted in bleeding, which influenced the operation outcome. They originated from the SLA and could be naturally revealed during the process of denuding the SLA. Then, the vessel was severed at its root. There were no branches from the SGAs encountered in this plane and none of the branches had been twisted, which reduced the risk of vascular injury. The concentrated type SpA was common in this study. The intraoperative characteristics were further compared between the groups, and the results revealed that the mean splenic hilar LN dissection time, mean blood loss due to splenic hilar LN dissection, and number of vascular clamps used at the splenic hilum were significantly lower in the concentrated group because the branches of the distributed type SpA were longer. The length of the branches was ± 8.44 mm in the distributed type and ± mm in the concentrated type in a previous specimen study [26]. Thus, more lymph node tissue must be dissected in the distributed group. The caliber of branches in the distributed type [11,12] was smaller, and these vessels were easily injured, which increased the operative difficulty and risk. As a result, the dissection time and blood loss in the splenic hilum were increased. Moreover, the number of SGA branches was higher in the distributed group, although there was no significant difference between groups. There were more SGAs that needed to be dissected and severed, increasing the surgical difficulty. Thus, the operative risk of LTGSPL was lower in the concentrated type SpA because of the shorter time required and less blood loss. However, the branches of the concentrated type SpA were more centralized and the interval between branches was narrow. The surgeon should also be very attentive when excising the LNs in this area to avoid injuring the vessels. The types of terminal branches of the SpA detected preoperatively using 3DCT were consistent with the intraoperative conditions. Thus, it could be roughly classified according to 3DCT preoperatively. Furthermore, 3DCT also enabled surgeons to know the distribution and variation of the splenic vessels preoperatively [27]. LTGSPL cannot be applied in every center routinely. Thus, it is beneficial for surgeons to master the technique by selecting patients with the concentrated type SpA identified using 3DCT preoperatively. However, some shortcomings of this study need to be noted. First, it is very difficult to perform LTGSPL and cannot be widely applied in other centers. Second, the results were based on a retrospective analysis of the clinical data at a single institution, and needs to be further confirmed in future large-scale, prospective clinical trials. In conclusion, the vascular anatomy of the splenic hilum is complex and variable, and knowing the anatomical characteristics helps surgeons to perform LTGSPL safely and effectively. New surgeons could choose patients with the concentrated type of splenic artery because it is less difficult to comple the operation in these patients. ACKNOWLEDGMENTS We are indebted to all the members of our lab for helpful comments and discussions. COMMENTS Background Because the vessels in the splenic hilum are intricate and variable, and the areas adjacent to the splenic hilum are complex and located in a deep narrow operating space, it is difficult to identify the correct vessels accurately, and successfully complete splenic regional lymphadenectomy. Therefore, familiarity with the splenic hilar vascular anatomy is helpful for surgeons to perform laparoscopic total gastrectomy with spleen-preserving splenic hilar lymphadenectomy (LTGSPL) successfully, and may reduce the complications. Research frontiers In spite of a few case reports and small series, studies on the splenic hilar vascular anatomy in vivo and the impact of splenic artery type on LTGSPL are lacking. Innovations and breakthroughs The clinical anatomy data of 317 patients with upper- or middle-third gastric cancer who underwent LTGSPL were collected in vivo. The results of the current study demonstrate that there exists a concentrated type and a distributed type of splenic artery (SpA). The types of splenic lobar artery include 1-branched type, 2-branched type, 3-branched type and multiple-branched type. The types of SpA trunk include Type Ⅰ, Type Ⅱ, Type Ⅲ, and Type Ⅳ. Further analysis showed that the mean splenic hilar lymphadenectomy time, mean blood loss resulting from splenic hilar lymphadenectomy, and numbers of vascular clamps used at the splenic hilum were significantly lower in the concentrated group than in the distributed group. Applications The study dissected the splenic hilar vessels in vivo using laparoscopy. This study was more intuitive and realistic than prior reports because normal physiological function existed during the investigation. Therefore, this research provides a more reliable and valuable reference for surgeons performing LTGSPL. Terminology From our experience in a previous study, the authors selected 2 cm as the cutoff point for SpA classification. When the SpA divided into its terminal branches < 2 cm from the splenic hilum, the case was considered to be concentrated type. If the distance was 2 cm, the case was considered to be the distributed type. Peer-review This is an interesting study in which authors evaluate the anatomy of splenic hilar vessels in vivo and its influence on LTGSPL for patients with upper- or middle-third gastric cancer. This finding has important clinical implications for gastrointestinal surgeons in spleen-preserving splenic hilar lymphadenectomy, especially for the beginners. REFERENCES 1 Mönig SP, Collet PH, Baldus SE, Schmackpfeffer K, Schröder W, Thiele J, Dienes HP, Hölscher AH. Splenectomy in proximal gastric cancer: frequency of lymph node metastasis to the splenic hilus. J Surg Oncol 2001; 76: [PMID: ] 2 Japanese Gastric Cancer Association. Japanese gastric cancer treatment guidelines 2010 (ver. 3). Gastric Cancer 2011; 14: [PMID: DOI: /s ] 8396 July 21, 2015 Volume 21 Issue 27

191 Zheng CH et al. Vascular anatomy in splenic hilum 3 Edwards P, Blackshaw GR, Lewis WG, Barry JD, Allison MC, Jones DR. Prospective comparison of D1 vs modified D2 gastrectomy for carcinoma. Br J Cancer 2004; 90: [PMID: ] 4 Bösing NM, Goretzki PE, Röher HD. Gastric cancer: which patients benefit from systematic lymphadenectomy? Eur J Surg Oncol 2000; 26: [PMID: DOI: / ejso.1999] 5 Uyama I, Sugioka A, Fujita J, Komori Y, Matsui H, Hasumi A. Laparoscopic total gastrectomy with distal pancreatosplenectomy and D2 lymphadenectomy for advanced gastric cancer. Gastric Cancer 1999; 2: [PMID: DOI: / s ] 6 Huscher C, Mingoli A, Sgarzini G, Sansonetti A, Piro F, Ponzano C, Brachini G. Value of extended lymphadenectomy in laparoscopic subtotal gastrectomy for advanced gastric cancer. J Am Coll Surg 2005; 200: 314 [PMID: DOI: / j.jamcollsurg ] 7 Hyung WJ, Lim JS, Song J, Choi SH, Noh SH. Laparoscopic spleen-preserving splenic hilar lymph node dissection during total gastrectomy for gastric cancer. J Am Coll Surg 2008; 207: e6-e11 [PMID: DOI: /j.jamcollsurg ] 8 Hur H, Jeon HM, Kim W. Laparoscopic pancreas- and spleenpreserving D2 lymph node dissection in advanced (ct2) upperthird gastric cancer. J Surg Oncol 2008; 97: [PMID: DOI: /jso.20927] 9 Okabe H, Obama K, Kan T, Tanaka E, Itami A, Sakai Y. Medial approach for laparoscopic total gastrectomy with splenic lymph node dissection. J Am Coll Surg 2010; 211: e1-e6 [PMID: DOI: /j.jamcollsurg ] 10 Kim MC, Choi HJ, Jung GJ, Kim HH. Techniques and complications of laparoscopy-assisted distal gastrectomy (LADG) for gastric cancer. Eur J Surg Oncol 2007; 33: [PMID: DOI: /j.ejso ] 11 Ssoson-Jaroschewitsch A. Zur chirurgischen Anatomie des Milzhilus. Zeitsch Ges Anat Abt Bd 1927; 84: S Zheng CH, Huang CM, Li P, Xie JW, Wang JB, Lin JX, Lu J. Laparoscopic spleen-preserving hilar lymph nodes dissection based on splenic hilar vascular anatomy. Zhonghua Xiaohua Waike Zazhi 2012; (11): [DOI: /cma.j.issn ] 13 Sobin LH, Gospodarowicz MK, Wittekind C. TNM Classification of Malignant Tumours. Hoboken: Wiley, Washington K. 7th edition of the AJCC cancer staging manual: stomach. Ann Surg Oncol 2010; 17: [PMID: DOI: /s z] 15 Jia-Bin W, Chang-Ming H, Chao-Hui Z, Ping L, Jian-Wei X, Jian-Xian L. Laparoscopic spleen-preserving No. 10 lymph node dissection for advanced proximal gastric cancer in left approach: a new operation procedure. World J Surg Oncol 2012; 10: 241 [PMID: DOI: / ] 16 Lu J, Huang CM, Zheng CH, Li P, Xie JW, Wang JB, Lin JX. Learning curve of laparoscopy spleen-preserving splenic hilar lymph node dissection for advanced upper gastric cancer. Hepatogastroenterology 2013; 60: [PMID: DOI: /hge12641] 17 Huang CM, Chen QY, Lin JX, Zheng CH, Li P, Xie JW. Huang s three-step maneuver for laparoscopic spleen-preserving No. 10 lymph node dissection for advanced proximal gastric cancer. Chin J Cancer Res 2014; 26: [PMID: DOI: / j.issn ] 18 Yüney E, Höbek A, Keskin M, Yilmaz O, Kamali S, Oktay C, Bender O. Laparoscopic splenectomy and LigaSure. Surg Laparosc Endosc Percutan Tech 2005; 15: [PMID: ] 19 Farag A, Shoukry A, Nasr SE. A new option for splenic preservation in normal sized spleen based on preserved histology and phagocytic function of the upper pole using upper short gastric vessels. Am J Surg 1994; 168: [PMID: ] 20 Treutner KH, Klosterhalfen B, Winkeltau G, Moench S, Schumpelick V. Vascular Anatomy of the Spleen. Clin Anat 1993; (6): Requarth JA, Miller PR. The splenic artery stump pressure is affected by arterial anatomy after proximal embolotherapy in blunt splenic injury. J Trauma Acute Care Surg 2012; 73: [PMID: DOI: /TA.0b013e e62] 22 Dasgupta N, Matsumoto AH, Arslan B, Turba UC, Sabri S, Angle JF. Embolization therapy for traumatic splenic lacerations. Cardiovasc Intervent Radiol 2012; 35: [PMID: DOI: /s y] 23 Pandey SK, Bhattacharya S, Mishra RN, Shukla VK. Anatomical variations of the splenic artery and its clinical implications. Clin Anat 2004; 17: [PMID: DOI: /ca.10220] 24 Mayberry JC, Sheppard BC, Mullins RJ. Laparoscopic management of an enlarging subcapsular splenic hematoma: case report. J Trauma 1998; 44: [PMID: ] 25 Hamamci EO, Besim H, Bostanoglu S, Sonişik M, Korkmaz A. Use of laparoscopic splenectomy in developing countries: analysis of cost and strategies for reducing cost. J Laparoendosc Adv Surg Tech A 2002; 12: [PMID: DOI: / ] 26 Li W, Cui ZX, Dong XT, Kang JS, Liu YL, Zhang XJ. Role of CT angiography in the examinations of splenic artery and its branches. Zhongguo Quanke Yixue 2010; 10: Wang JB, Huang CM, Zheng CH, Li P, Xie JW, Lin JX, Lu J. Role of 3DCT in laparoscopic total gastrectomy with spleen-preserving splenic lymph node dissection. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] P- Reviewer: Namikawa T S- Editor: Ma YJ L- Editor: Cant MR E- Editor: Zhang DN 8397 July 21, 2015 Volume 21 Issue 27

192 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Clinical Trials Study ORIGINAL ARTICLE SLITRK3 expression correlation to gastrointestinal stromal tumor risk rating and prognosis Chao-Jie Wang, Zi-Zhen Zhang, Jia Xu, Ming Wang, Wen-Yi Zhao, Lin Tu, Chun Zhuang, Qiang Liu, Yan-Yin Shen, Hui Cao, Zhi-Gang Zhang Chao-Jie Wang, Zi-Zhen Zhang, Jia Xu, Ming Wang, Wen- Yi Zhao, Lin Tu, Chun Zhuang, Hui Cao, Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai , China Qiang Liu, Yan-Yin Shen, Department of Pathology, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai , China Chao-Jie Wang, Zhi-Gang Zhang, State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai , China Author contributions: Wang CJ and Zhang ZZ contributed equally to this study and were co-first authors; Wang CJ and Zhang ZZ participated in data collection, data analysis, and wrote the manuscript; Xu J, Wang M, Zhao WY, Tu L, Zhuang C, Liu Q, and Shen YY participated in data collection and helped perform the statistical analysis; Cao H and Zhang ZG conceived the study, participated in its design, and provided critical revisions; all authors read and approved the final manuscript. Supported by National Natural Science Foundation of China General Program, No ; Shanghai City Committee of Science and Technology Key Project, No ; and Key Discipline Project of Renji Hospital, Shanghai Jiaotong University School of Medicine, No. RJ Institutional review board statement: Clinical materials and samples were obtained with approval from the Ethical Committees of Renji Hospital and Shanghai Jiaotong University School of Medicine. Clinical trial registration statement: The clinical investigation was carried out in accordance with the principles expressed in the Declaration of Helsinki. Informed consent statement: Written informed consent was obtained from all participants. Conflict-of-interest statement: No potential conflicts of interest relevant to this article were reported. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Hui Cao, MD, Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, No Dong fang Road, Shanghai , China. caohuishcn@hotmail.com Telephone: Fax: Received: November 25, 2014 Peer-review started: November 26, 2014 First decision: January 8, 2015 Revised: February 13, 2015 Accepted: April 28, 2015 Article in press: April 28, 2015 Published online: July 21, 2015 Abstract AIM: To assess the influence of SLIT and NTRKlike family member 3 (SLITRK3) on the prognosis of gastrointestinal stromal tumor (GIST) and determine whether SLITRK3 can help improve current risk stratification systems. METHODS: We hypothesized that SLITRK3 could be used as a prognostic molecular biomarker for GIST. 35 fresh tumor samples and 417 paraffin-embedded specimens from GIST patients were utilized. SLITRK July 21, 2015 Volume 21 Issue 27

193 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis mrna expression in GIST tumor tissue was detected by real-time polymerase chain reaction, and SLITRK3 protein levels were estimated by immunohistochemistry. The correlation of SLITRK3 expression with various tumor clinicopathological characteristics and follow-up data were analyzed. RESULTS: GIST tumors had high expression of SLITRK3 compared with adjacent normal tissues and the expression level gradually increased with risk grade. SLITRK3 protein expression was closely associated with gastrointestinal bleeding, tumor site, tumor size, mitotic index, and National Institutes of Health (NIH) classification. Survival analysis showed that SLITRK3 expression was closely correlated with overall survival and disease-free survival of GIST patients. Multivariate analysis also identified SLITRK3 expression, mitotic index, and NIH stage as significant risk factors of GIST recurrence. CONCLUSION: SLITRK3 expression is a highly significant predictor of GIST recurrence and metastasis. Combinations of SLITRK3 and NIH stage have strong predictive and prognostic value, and are feasible markers for clinical practice in gastrointestinal stromal tumor. Key words: SLITRK3; Gastrointestinal stromal tumor; Biomarkers; Non-epithelial tumors; Risk stratification The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Prognostic biomarkers are required to refine risk stratification treatment strategies for gastrointestinal stromal tumor (GIST). In this study, we hypothesized that SLIT and NTRK-like family member 3 (SLITRK3) could be used as a prognostic molecular biomarker for GIST. The results indicated that SLITRK3 expression is a highly significant predictor of GIST recurrence and metastasis. Combinations of SLITRK3 and NIH stage have strong predictive and prognostic value, and are feasible markers for clinical practice in gastrointestinal stromal tumor. Wang CJ, Zhang ZZ, Xu J, Wang M, Zhao WY, Tu L, Zhuang C, Liu Q, Shen YY, Cao H, Zhang ZG. SLITRK3 expression correlation to gastrointestinal stromal tumor risk rating and prognosis. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8398.htm DOI: i INTRODUCTION Gastrointestinal stromal tumors (GISTs) are the most common non-epithelial tumors [1] and the most common type of gastrointestinal cancer following gastric and colorectal cancer [1-4]. Surgery is the primary treatment option, but patients suffer from high-rates of tumor recurrence or metastasis, resulting in death. The majority of GISTs result from activating mutations in c-kit and alpha-type platelet-derived growth factor receptor (PDGFRA) [5]. Recent studies have shown that adjuvant therapy with imatinib, a small molecule tyrosine kinase inhibitor, can prolong both survival and time to metastasis following surgery [6]. However, most micro-gists (less than 1 cm in diameter) have little malignancy potential despite the presence of KIT or PDGFRA mutations [7]. Furthermore, a 2002 risk assessment for aggressive GISTs showed that tumor growth rates can be affected by numerous factors [8]. Together, this demonstrates the need for additional prognostic molecular biomarkers to better characterize tumor prognosis and guide treatment strategy. Secretion of transmitters and hormones is regarded as a hallmark of neuroendocrine cells and tumors. Synaptic-like microvesicle proteins, such as amphiphysin, synaptic vesicle protein, SV2, and synapsin 1, are found in a majority of GISTs [9]. Expression of these proteins enables GISTs to secrete neurotransmitters or hormones, suggesting that GISTs adopt a neuroendocrine phenotype. SLITRK3 is one of the six isoforms of SLIT and neurotropic tyrosine receptor kinase (NTRK)- like family member (Slitrk1-6), which are neuronal transmembrane proteins that control neurite growth [10]. Recently, SLITRK3 has been identified as a post-synaptic adhesion molecule that selectively regulates inhibitory synapse development and is important for normal functional GABAergic synapse development [11]. GABA is a key inhibitory neurotransmitter and mediates synaptic transmission, neural network development [12], and is involved in digestive diseases such as esophageal reflux and gastric cancer [13-15]. GISTs may originate from the interstitial cells of Cajal (ICCs), with pacemaker potentials suggesting that mutations in genes involved in synapse or neural development may underlie GIST behavior [9]. In agreement with this, we have previously found that the expression of SLITRK3 was increased in a high-risk group compared to a low-risk group (unpublished data), and Milde et al [16] showed higher SLITRK3 expression levels in lymphoma. The aim of this study was to assess the influence of SLITRK3 on the prognosis of GIST and determine whether SLITRK3 can help improve current risk stratification systems. We hypothesized that upregulation of SLITRK3 is strongly-associated with high recurrence risk and poor prognosis in GIST patients. We tested this by using qrt-pcr and immunohistochemistry on GIST samples and examining the relationship to patient outcome. MATERIALS AND METHODS Patients and samples Formalin-fixed paraffin-embedded (FFPE) tissue 8399 July 21, 2015 Volume 21 Issue 27

194 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis Table 1 Risk level access of gastrointestinal stromal tumor Risk level Tumor size (cm) Mitotic count (50/HPF) Primary tumor location Very low Any Low Any Medium > 5 Stomach < Any Stomach High Any Any Tumor rupture > 10.0 Any Any Any > 10 Any > 5.0 > 5 Any > 5 Non stomach Non stomach sections were collected from GIST patients who underwent surgery at Renji Hospital, Shanghai Jiaotong University School of Medicine, China from 2004 to The inclusion criteria for this study were as follows: (1) primary GIST cases with definite pathologic diagnosis, as previously described [17] ; (2) all cases received surgical resection; and (3) no reoccurrence or metastasis was detected. The exclusion criteria were: (1) chemotherapy, radiotherapy, or other antitumor therapy before surgery; and (2) incomplete clinicopathologic data. A total of 417 tumor tissue samples, with tumor adjacent normal tissue available for 139, were collected. All cases were divided into four groups according to the risk table published by the National Institutes of Health (NIH) (Table 1) [8]. Tissue microarray and immunohistochemical staining were performed to access the expression levels of SLITRK3 in these samples. The follow-up data, including survival, reoccurrence, and metastasis as re-examination results, were obtained from outpatient medical records or from patients and their relatives by telephone interview using a follow-up questionnaire. Additionally, 35 fresh frozen GIST specimens were obtained between 2010 and 2012 from GIST patients who received surgical resection at Renji Hospital, Shanghai Jiaotong University School of Medicine, China. The samples were used for qrt-pcr detection of SLITRK3 expression. Tissue microarray construction Tissue microarrays were constructed by Suzhou Xinxin Biotechnology Co., Ltd (Xinxin Biotechnology Co, Suzhou, China). First, 139 GIST tissues with paired tumor adjacent normal tissues were used to construct 3 microarrays, while the other 278 GIST tissues were used to construct another 4 microarrays. Tissue paraffin blocks of GIST samples were stained with hematoxylin-eosin to confirm the diagnoses, and were marked at fixed points with most typical histological characteristics under a microscope. Two 1.6 mm cores per donor block were transferred into a recipient block tissue microarray, with each dot array containing fewer than 160 dots. Three-micron-thick sections were cut from the recipient block and transferred to glass slides with an adhesive tape transfer system for ultraviolet cross linkage. Immunohistochemistry The slides were baked at 56 for 1 h, de-paraffinized in xylene for 20 min, and rehydrated through a graded series of ethanol concentrations (5 min in 100% ethanol followed by 5 min in 70% ethanol). Antigen retrieval was performed in a pressure cooker for 10 min with 0.01 mol/l sodium citrate buffer (ph 6.0). Endogenous peroxidase activity was quenched with 0.3% hydrogen peroxide in methanol at 37 for 30 min. Next, an SLITRK3 antibody (NBP , Novus Biologicals, Colorado, United States; concentration: 1:100) was applied to cover the specimens overnight at 4, which was followed by incubation with a labeled polymer-hrp anti-rabbit secondary antibody (Dako, CA, United States) for 30 min at room temperature. Staining was detected with diaminobenzidine (Thermo, MA, United States) as chromogen and counterstained with hematoxylin prior to coverslipping. The staining intensity and percentage of positive cells were recorded by two pathologists of Renji Hospital (Liu Q and Shen YY) and a consensus score was obtained for each slide. Immunohistochemical scoring was categorized as follows: (1) staining intensity was scored from 0 to 3: 0 for no staining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining; (2) staining area was graded into 0-3 levels: 0 for no staining area, 1 for extent to less than 1/3, 3 for more than 2/3, and 2 for in-between; and (3) immunohistochemical classification was based on the sum of intensity and extent score: 0 as negative (-), 1-2 as weakly positive (+), 3-4 as positive (++), and 5-6 as strongly positive (+++). We further ranked the protein level into two classes as (-) or (+) for SLITRK3 low expression while (++) or (+++) was for SLITRK3 high expression. RNA extraction and RT-PCR conditions Total RNA was extracted from fresh frozen GIST specimens and GIST cells using RNAiso Plus (Takara, Dalian, China) according to the manufacturer s instructions. RNA quantity and quality were measured by NanoDrop 2000 (NanoDrop, DE, United States). RNA integrity was assessed by standard denaturing agarose gel electrophoresis. Reverse-transcription reactions were performed with Prime Script RT Master Mix (Takara, Dalian, China) according to the manufacturer s instructions. First-strand cdna was synthesized from 2 μg of total RNA. Quantitative real-time PCR All qrt-pcr primer sequences were obtained from the Primer Bank database ( primerbank/) (Table 2). Relative quantification of cdna samples were measured by the SYBR-Green method in 8400 July 21, 2015 Volume 21 Issue 27

195 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis Table 2 Quantitative real-time PCR primer for candidate genes and endogenous reference gene Gene name Primer Sequence (5'-3') Tm ( ) Amplicon size (bp) SLITRK3 Forward TTCCATAGCTGAGATGCTTCACA Reverse GGAATCGGGGTAGTCCATCC S Forward GTAACCCGTTGAACCCCATT Reverse CCATCCAATCGGTAGTAGCG 61.7 Table 3 Patient and tumor characteristics Clinicopathological factors n (%) Gender Male 226 (54.2) Female 191 (45.8) Age (yr) (53.5) > (46.5) Median 60 Gastrointestinal bleeding No 315 (75.5) Yes 102 (24.5) Primary tumor site Stomach 229 (54.9) Small bowel 123 (29.5) Colon 21 (5.0) Others 44 (10.6) Predominant cell type Spindle 271 (65.0) Epithelioid 54 (12.9) Mixed 92 (22.1) Primary tumor size (cm) (48.4) (33.1) > (18.5) Median 5.5 Mitotic index (per 50 HPFs) (74.1) (14.4) > (11.5) NIH stage Very low risk 33 (7.9) Low risk 154 (36.5) Intermediate risk 67 (16.1) High risk 163 (39.1) Recurrence No 331 (79.4) Yes 71 (17.0) Insufficient data 15 (3.6) Death from illness No 376 (90.2) Yes 26 (6.2) Insufficient data 15 (3.6) a final volume of 20 μl with Power SYBR Green PCR Master Mix (Applied Biosystems, NY, USA) according to the manufacturer s instructions. All reactions were performed on ABI ViiA 7 Real-Time PCR System (Applied Biosystems, NY, United States) in triplicate and the results were analyzed by ViiA 7 software. The 2 - Ct method was used to quantify the relative gene expression levels and 18S was used for normalization. Statistical analysis For comparisons, one-way analyses of variance, Wilcoxon signed rank test, and chi-squared tests were performed where appropriate. Kaplan-Meier curves were used to visualize biomarker expression, and NIH risk stage with respect to overall survival (OS) and disease-free survival (DFS) data. Univariate and multivariate analyses were based on the Cox proportional hazards regression model. Only those factors statistically significant (P < 0.05) in univariate Table 4 Expression levels of SLITRK3 in gastrointestinal stromal tumor and adjacent non-tumor tissues n (%) Tissue analysis had access to the next multivariate analyses. Statistical analyses were all performed using SPSS 19.0 software (Chicago, IL, United States). All statistical tests were 2-sided, and P-value differences < 0.05 were considered statistically significant. All statistical analysis was reviewed and confirmed by Zhi- Gang Zhang. RESULTS SLITRK3 level Tumor 14 (11) 37 (28) 49 (37) 31 (24) Non-tumor tissue 91 (69) 33 (25) 5 (4) 2 (2) Patient and tumor characteristics Detailed clinicopathological data is shown in Table 3. Of the 417 paraffin-embedded GIST tissue samples, the predominant cell types were spindle cell (n = 271; 65.0%), epithelioid cell (n = 54; 12.9%), and mixed (n = 92; 22.1%). The maximum tumor diameter detected in GIST patients ranged from 0.5 to 30 cm (median: 5.5 cm). Risk stratification was performed according to the NIH risk classification, and suggested that there were 33 (7.9%) very low-risk cases, 154 (36.9%) low-risk cases, 67 (16.1%) intermediate-risk cases, and 163 (39.1%) high-risk cases. GIST tumors have high expression of SLITRK3 protein compared with adjacent normal tissues We performed immunohistochemistry in 139 GIST tissue samples which had both tumor (T) and adjacent non-tumor (N) tissue to determine if expression levels of SLITRK3 differed between tumor and non-tumor tissue. The results showed that SLITRK3 protein was expressed at different levels in different tissue samples and was divided into four classes, as described in materials and methods (Figure 1A). Most of the adjacent non-tumor tissues were (-) or (+), while most tumor samples ranged from (+) to (+++) (Figure 1B and Table 4), indicating higher SLITRK3 protein levels in tumor samples. The difference between tumor and paired adjacent normal tissues (T-N), ranging from -1 to 3 [(-) for 0 and (+++) for 3], revealed that SLITRK3 expression was increased in 76.3% (100/131) of GIST tumors where T-N > 0 (Figure 1C). Wilcoxon 8401 July 21, 2015 Volume 21 Issue 27

196 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis A (-) (+) (++) (+++) Adjacent tissue (-) B Adjacent normal tissues Tumor tissues 69% C % 28% Number of samples % 25% 28% 24% 11% 4% 2% (-) (+) (++) (+++) Number of samples % 17% 3% SLITRK3 staining class SLITRK3 score (tumor-nontumor) Figure 1 Immunohistochemistry of SLITRK3 in gastrointestinal stromal tumor and adjacent non-tumor tissues. A: Representative images of SLITRK3 expression levels detected in tumor and adjacent tissue; B: Frequency distribution of SLITRK3 staining scores in tumor and adjacent non-tumor tissues; C: Frequency distribution of different SLITRK3 expression levels calculated by normalizing the SLITRK3 expression score in tumor against that in adjacent non-tumor tissues. signed rank test further confirmed that GIST tumors have a significantly higher expression of SLITRK3 protein than adjacent normal tissue tumor samples (P < 0.001). SLITRK3 protein expression level is closely correlated with clinicopathological factors in GIST In order to better understand the significance of SLITRK3 expression in GIST tumor tissues, we expanded the tissue microarray sample size to 417 cases (4 cases were off-chip and not included in the statistics). Among the 413 GIST tumor tissues, SLITRK3 staining was strongly positive (+++) in 85 cases (20.6%), positive (++) in 142 cases (34.4%), weakly positive (+) in 112 cases (27.1%), and negative (-) in 74 cases (17.9%). We then ranked the protein level into two classes: (-) or (+) for low expression and (++) or (+++) for high expression, in order to further investigate the relationship between SLITRK3 and clinicopathological factors in GIST. Chisquare test revealed that the SLITRK3 protein level was not associated with gender, age, or predominant cell type, but was closely related with gastrointestinal bleeding, primary tumor site, primary tumor size, mitotic index, and NIH classification (Table 5). SLITRK3 mrna expression is up-regulated in fresh tumor tissues with higher NIH risk To further confirm SLITRK3 expression in GIST, the relative expression levels of SLITRK3 mrnas were analyzed by qrt-pcr in 35 fresh GISTs samples. The relative expression level of SLITRK3 mrna in the low risk group (n = 13), intermediate risk group (n = 10), and high risk group (n = 12) were ± 0.002, ± 0.009, and ± 0.009, respectively, indicating a gradually increasing trend. SLITRK3 expression in GIST tumor tissues of the intermediate and high risk groups were significantly higher than those of the lowrisk group (P = and P = 0.044) (Figure 2). SLITRK3 is a predictor for poor prognosis in GIST patients The relationship between SLITRK3 expression and overall survival (OS) or disease-free survival (DFS) in GIST patients was investigated. All 398 cases with complete follow-up data were classified into four classes according to SLITRK3 expression levels and calculated according to the Kaplan-Meier method. The 5-year OS rates decreased successively from 100% in (-), 99.0% in (+), 86.7% in (++), and 57.4% in (+++) (Log-Rank-test, P < 0.001) (Figure 3A). Meanwhile, the 5-year DFS rates also decreased successively form 91.7% in (-), 78.6% in (+), 71.6% in (++), and 41.8% in (+++) (Log-Rank-test, P < 0.001) (Figure 3B). To further investigate whether SLITRK3 can be used as an independent predictor associated with poor prognosis in GIST, univariate and multivariate analysis were performed. Univariate analysis revealed that primary tumor size, mitotic index, NIH stage, 8402 July 21, 2015 Volume 21 Issue 27

197 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis Table 5 Correlations between SLITRK3 expression and clinicopathological factors in 417 gastrointestinal stromal tumor patients Clinicopathological factors 1 SLITRK3 expression Number of patients χ 2 P value 2 Low High Gender Male Female Age (yr) > Gastrointestinal bleeding No Yes Primary tumor site Stomach < Small bowel Colon Others Predominant cell type Spindle Epithelioid Mixed Primary tumor size 5 cm < > 5 cm Mitotic index 5/50 HPF < > 5/50 HPF NIH stage Very low risk < Low risk Intermediate risk High risk Cases with missing data were not included for analysis; 2 P-value by χ 2 test; 3 Statistically significant (P < 0.01). SLITRK3 relative expression (normalized by 18s) a vs 2 P = vs 3 P = vs 3 P = Figure 2 SLITRK3 mrna expression in 35 gastrointestinal stromal tumor tissues with different risk grades ( a P < 0.05, group 1 vs group 2; b P < 0.01, group 1 vs group 3). The SLITRK3 mrna levels in GIST tumor tissues of the high risk group (group 3) and intermediate risk group (group 2) were significantly higher than those of the low-risk group (group 1) (P = and P = 0.044). and SLITRK3 expression were significantly associated with OS (Table 6). Univariate analysis revealed that primary tumor site, primary tumor size, mitotic index, NIH stage, and SLITRK3 expression were significantly associated with DFS (Table 7). Only those factors with statistically significant relationships with DFS in the univariate analysis were entered in the Cox s proportional-hazard model for multivariate analysis (Table 8). The NIH stage is based on primary tumor site, tumor size, and mitotic index, and correlated with each of them strongly, so we developed 3 models for multivariate analysis. Analysis included NIH stage without SLITRK3 expression in b model A, SLITRK3 expression instead of NIH stage in model B, and both in model C. In model A, primary tumor site, mitotic index, and NIH stage were statistically significant indicators of poor DFS, and model B showed that SLITRK3 expression is also a significant indicator of poor DFS. Importantly, in model C, SLITRK3 expression (but not NIH stage) was an independent risk factor for GIST recurrence. SLITRK3 index is helpful to improve the accuracy of NIH risk stratification system In order to find out whether SLITRK3 can help improve the NIH stage, we further investigated a subgroup of 152 high risk cases. The Kaplan-Meier analysis revealed that the 5-year DFS rate in the SLITRK3 (+++) group was significantly lower than the others (20.3% vs 52.7%, Log-Rank-test, P = 0.018) (Figure 4). Furthermore, we found that 71 patients suffered from disease recurrence, mostly with an original high NIH risk rating. Kaplan-Meier curve analysis based on SLITRK3 expression of these patients showed that 1-year and 3-year OS rates in the SLITRK3 (-), (+), (++) group was 83.3% and 61.7%, respectively; the SLITRK3 (+++) group was 58.5% and 9.7%, respectively (Log-Rank-test, P =0.003) (Figure 5). DISCUSSION In the current study, we examined the correlation between SLITRK3 and GLIST behavior and survival. We found that SLITKR3 was expressed more highly in tumor tissue, correlated well with clinicopathological features, and predicted poor survival in patients. Most 8403 July 21, 2015 Volume 21 Issue 27

198 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis A Ⅰ. SLITRK3 (-) (n = 69) Ⅱ. SLITRK3 (+) (n = 108) Ⅲ. SLITRK3 (++) (n = 138) Ⅳ. SLITRK3 (+++) (n = 83) B Ⅰ. SLITRK3 (-) (n = 69) Ⅱ. SLITRK3 (+) (n = 108) Ⅲ. SLITRK3 (++) (n = 138) Ⅳ. SLITRK3 (+++) (n = 83) Overall survival (%) Log-Rank-test, P < Disease free survival (%) Log-Rank-test, P < t /mo t /mo Figure 3 Overall survival (A) and disease-free survival (B) of 398 gastrointestinal stromal tumors according to SLITRK3 expression. Table 6 Univariate analysis of factors influencing overall survival in 402 patients with gastrointestinal stromal tumor Factor 5-yr OS rate (%) OS HR (95%CI) P value Gender Male: Female 81.3: ( ) Age (yr) 60: > : ( ) Gastrointestinal bleeding No: Yes 86.8: ( ) Primary tumor site Gastric: Non-gastric 83.0: ( ) Predominant cell type Spindle: Epithelioid: Mixed 87.7: 82.4: ( ) Primary tumor size (cm) 5: > : ( ) Mitotic index (HPFs) 5/50: 6-10/50: > 10/ : 83.0: ( ) < NIH stage Very low: Low: Mid: High 100.0: 100.0: 88.6: ( ) SLITRK3 expression (-): (+): (++): (+++) 100.0: 99.0: 86.7: ( ) < Statistically significant (P < 0.01). Mid: Intermediate. Table 7 Univariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor Factor 5-yr DFS rate (%) DFS HR (95%CI) P value Gender Male: Female 69.0: ( ) Age (yr) 60: > : ( ) Gastrointestinal bleeding No: Yes 71.6: ( ) Primary tumor site Gastric: Non-gastric 81.5: ( ) Predominant cell type Spindle: Epithelioid: Mixed 72.0: 67.1: ( ) Primary tumor size (cm) 5: > : ( ) < Mitotic index (HPFs) 5/50: 6-10/50: > 10/ : 50.7: ( ) < NIH stage Very low: Low: Mid: High 100.0: 93.3: 87.1: ( ) < SLITRK3 expression (-): (+): (++): (+++) 91.7: 78.6: 71.6: ( ) < Statistically significant (P < 0.01). Mid: Intermediate; DFS: Disease-free survival. importantly, increasing SLITKR3 expression correlated with decreased overall survival and disease-free survival. Currently, risk stratification schemes for operable GIST, such as the NIH consensus criteria, modified consensus criteria, and AFIP-Miettinen criteria, all depend on tumor site, tumor size, and mitosis index [8,18-20]. Mitosis count is one of the most valuable prognostic factors in GIST, but has limitations and controversial reliability [21]. Observation of mitosis can be subjective, time consuming, and affected by the high power field (HPF) area of the microscope and tissue fixation time. A previous study using 16 different pathologists and different microscopes resulted in a wide counting range from the same sample [22]. Moreover, according to current risk stratification, abrupt changes can occur in estimating risk of recurrence when the tumor size or mitosis index is close to a cutoff value. This is especially important due to the existence of small and mitotically inactive malignant GISTs [1,23,24]. Together, these factors suggest that the current risk criteria can be improved significantly July 21, 2015 Volume 21 Issue 27

199 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis Table 8 Multivariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor Factor Model A Model B Model C DFS HR (95%CI) P value DFS HR (95%CI) P value DFS HR (95%CI) P value Primary tumor site Gastric: Non-gastric ( ) ( ) ( ) Primary tumor size (cm) 5: > ( ) ( ) ( ) Mitotic index (HPFs) 5/50: 6-10/50: > 10/ ( ) < ( ) < ( ) < NIH stage Very low: Low: Mid: High ( ) ( ) SLITRK3 expression (-): (+): (++): (+++) ( ) ( ) Statistically significant (P < 0.05); 2 Statistically significant (P < 0.01). Model A includes analysis of NIH stage without SLITRK3; model B includes SLITRK3 without NIH stage; model C includes both of them. Mid = intermediate. Disease free survival (%) Figure 4 Disease-free survival analysis in a subgroup of 152 high risk cases. OS after recurrence (%) t /mo Ⅰ. SLITRK3 (-)(+)(++) (n = 97) Ⅱ. SLITRK3 (+++) (n = 55) Log-Rank-test, P = t /mo Ⅰ. SLITRK3 (-)(+)(++) (n = 39) Ⅱ. SLITRK3 (+++) (n = 32) Log-Rank-test, P = Figure 5 Overall survival analysis in 71 patients after recurrence. We found that the clinical measurements in our study, including age, sex, tumor size, and mitoses index, were all similar to previously reported studies [21,25-27]. Patients who suffered from disease recurrence or death were mainly from the high-risk group. The 5-year OS and DFS rate of our database were 85.0% and 69.4%, respectively, compared with 72.3% and 70.5%, respectively, from a large multicenter, retrospective analysis of clinical data published in Lancet Oncology 2012 [21]. The better 5-year OS rate of our study might reflect differences in standardized treatment and the use of IM adjuvant therapy. SLITRK3 is expressed predominantly in neural tissues and has neurite-modulating activity [28]. However, the function of SLITRK3 in solid tumors is poorly studied. In our previous study (unpublished data), the expression of SLITRK3 monotonically increased from the low-risk group to the high-risk group. We found that SLITRK3 was also up-regulated in tumor compared to non-tumor tissue by using immunohistochemistry and qrt-pcr. This finding is in agreement with Milde et al [16], who demonstrated that SLITRK3 was up-regulated in lymphoma. SLITRK3 expression was also associated with a higher incidence of GI bleeding, a common symptom of GIST and a good indicator for highrisk patients [29,30]. Furthermore, SLITRK3 expression correlated with NIH risk classification, and the reduced overall survival and disease-free progression suggests that elevated expression of SLITRK3 is a good tumor biomarker candidate, particularly for aggressive GISTs. The function and mechanism of SLITRK3 protein in the malignant processes of GIST it still unclear, necessitating the need for experiments both in vitro and in vivo. However, it is very likely that there are other potential GIST risk-related genes, as suggested by our previous gene microarray (unpublished data). In agreement with this, the potassium channel tetramerization domain containing protein 10 (KCTD10) has been shown to correlate with GIST prognosis [31]. Future studies and identification of novel prognostic biomarkers will help further stratify risk groups and direct treatment strategies for GIST. Our detailed analysis showed that SLITRK3 mrna expression level increased according to NIH risk classification. We found that SLIRTK3 protein level was closely associated with tumor site, tumor size, and mitotic index. As current risk stratification schemes are mainly based on these three features, it is not surprising that up-regulation of SLIRTK3 is strongly associated with a high-risk NIH grade. However, we found that NIH stage was a significant unfavorable factor for OS in univariate analysis, but not multivariate analysis. This suggests that the current NIH criteria is very likely not an optimal prognostic tool. We found that under all circumstances that SLITRK3 expression was a significant predictor of poor 8405 July 21, 2015 Volume 21 Issue 27

200 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis prognosis. Therefore, we believe that the combination of SLITRK3 expression and NIH criteria will better stratify post-operative GIST patients. Many patients with operable GIST can be cured by surgery alone and may not benefit from IM adjuvant therapy. Given the expense of IM adjuvant therapy and its associated side effects [32], an improved selection of patients for adjuvant therapy will be of clinical benefit. Due to the poor prognosis and reduced OS, we strongly suggest that patients with high SLITRK3 expression, especially those who also are in the NIH high-risk groups, receive IM adjuvant therapy and close follow-up management after surgery. In conclusion, we have identified SLITRK3 as a novel prognostic molecular biomarker that may help guide treatment of GIST. COMMENTS Background Recent studies have shown that adjuvant therapy with imatinib, a small molecule tyrosine kinase inhibitor, can prolong both survival and time to metastasis following surgery. However, most micro-gastro intestinal stromal tumors (GIST) (less than 1 cm in diameter) have little malignancy potential, despite the presence of a KIT or PDGFRA mutation. Furthermore, a 2002 risk assessment for aggressive GISTs showed that tumor growth rates can be affected by numerous factors. Research frontiers In agreement with this, the authors have previously found that the expression of SLIT and NTRK-like family member 3 (SLITRK3) was increased in a high-risk group when compared to a low-risk group (unpublished data), and Milde et al showed higher SLITRK3 expression levels in lymphoma. Innovations and breakthroughs The authors hypothesized that up-regulation of SLITRK3 is strongly associated with high recurrence risk and poor prognosis in GIST patients. We tested this by using qrt-pcr and immunohistochemistry on GIST samples and examining the relationship to patient outcome. Applications The authors have identified SLITRK3 as a novel prognostic molecular biomarker that may help guide treatment of GIST. Peer-review In this study, the authors aimed to assess the influence of SLITRK3 on the prognosis of GIST, determine whether different degrees of SLITRK3 expression were significantly associated with overall survival, and assess whether this can help improve current risk stratification systems according to tables published by the National Institutes of Health for GIST. REFERENCES 1 Nilsson B, Bümming P, Meis-Kindblom JM, Odén A, Dortok A, Gustavsson B, Sablinska K, Kindblom LG. Gastrointestinal stromal tumors: the incidence, prevalence, clinical course, and prognostication in the preimatinib mesylate era--a populationbased study in western Sweden. Cancer 2005; 103: [PMID: DOI: /cncr.20862] 2 Tryggvason G, Gíslason HG, Magnússon MK, Jónasson JG. Gastrointestinal stromal tumors in Iceland, : the icelandic GIST study, a population-based incidence and pathologic risk stratification study. Int J Cancer 2005; 117: [PMID: DOI: /ijc.21167] 3 Goettsch WG, Bos SD, Breekveldt-Postma N, Casparie M, Herings RM, Hogendoorn PC. Incidence of gastrointestinal stromal tumours is underestimated: results of a nation-wide study. Eur J Cancer 2005; 41: [PMID: DOI: / j.ejca ] 4 Rubió J, Marcos-Gragera R, Ortiz MR, Miró J, Vilardell L, Gironès J, Hernandez-Yagüe X, Codina-Cazador A, Bernadó L, Izquierdo A, Colomer R. Population-based incidence and survival of gastrointestinal stromal tumours (GIST) in Girona, Spain. Eur J Cancer 2007; 43: [PMID: DOI: / j.ejca ] 5 Hirota S. Gastrointestinal stromal tumors: their origin and cause. Int J Clin Oncol 2001; 6: 1-5 [PMID: ] 6 Corless CL, Ballman KV, Antonescu CR, Kolesnikova V, Maki RG, Pisters PW, Blackstein ME, Blanke CD, Demetri GD, Heinrich MC, von Mehren M, Patel S, McCarter MD, Owzar K, DeMatteo RP. Pathologic and molecular features correlate with long-term outcome after adjuvant therapy of resected primary GI stromal tumor: the ACOSOG Z9001 trial. J Clin Oncol 2014; 32: [PMID: DOI: /JCO ] 7 Demetri GD, Benjamin RS, Blanke CD, Blay JY, Casali P, Choi H, Corless CL, Debiec-Rychter M, DeMatteo RP, Ettinger DS, Fisher GA, Fletcher CD, Gronchi A, Hohenberger P, Hughes M, Joensuu H, Judson I, Le Cesne A, Maki RG, Morse M, Pappo AS, Pisters PW, Raut CP, Reichardt P, Tyler DS, Van den Abbeele AD, von Mehren M, Wayne JD, Zalcberg J. NCCN Task Force report: management of patients with gastrointestinal stromal tumor (GIST)--update of the NCCN clinical practice guidelines. J Natl Compr Canc Netw 2007; 5 Suppl 2: S1-S29; quiz S30 [PMID: ] 8 Fletcher CD, Berman JJ, Corless C, Gorstein F, Lasota J, Longley BJ, Miettinen M, O Leary TJ, Remotti H, Rubin BP, Shmookler B, Sobin LH, Weiss SW. Diagnosis of gastrointestinal stromal tumors: A consensus approach. Hum Pathol 2002; 33: [PMID: ] 9 Bümming P, Nilsson O, Ahlman H, Welbencer A, Andersson MK, Sjölund K, Nilsson B. Gastrointestinal stromal tumors regularly express synaptic vesicle proteins: evidence of a neuroendocrine phenotype. Endocr Relat Cancer 2007; 14: [PMID: DOI: /ERC ] 10 Aruga J, Mikoshiba K. Identification and characterization of Slitrk, a novel neuronal transmembrane protein family controlling neurite outgrowth. Mol Cell Neurosci 2003; 24: [PMID: ] 11 Takahashi H, Katayama K, Sohya K, Miyamoto H, Prasad T, Matsumoto Y, Ota M, Yasuda H, Tsumoto T, Aruga J, Craig AM. Selective control of inhibitory synapse development by Slitrk3- PTPδ trans-synaptic interaction. Nat Neurosci 2012; 15: , S1-S2 [PMID: DOI: /nn.3040] 12 Akerman CJ, Cline HT. Refining the roles of GABAergic signaling during neural circuit formation. Trends Neurosci 2007; 30: [PMID: DOI: /j.tins ] 13 Herman MA, Alayan A, Sahibzada N, Bayer B, Verbalis J, Dretchen KL, Gillis RA. micro-opioid receptor stimulation in the medial subnucleus of the tractus solitarius inhibits gastric tone and motility by reducing local GABA activity. Am J Physiol Gastrointest Liver Physiol 2010; 299: G494-G506 [PMID: DOI: /ajpgi ] 14 Ren LH, Chen WX, Qian LJ, Li S, Gu M, Shi RH. Addition of prokinetics to PPI therapy in gastroesophageal reflux disease: a meta-analysis. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i9.2412] 15 Matuszek M, Jesipowicz M, Kleinrok Z. GABA content and GAD activity in gastric cancer. Med Sci Monit 2001; 7: [PMID: ] 16 Milde T, Shmelkov SV, Jensen KK, Zlotchenko G, Petit I, Rafii S. A novel family of slitrk genes is expressed on hematopoietic stem cells and leukemias. Leukemia 2007; 21: [PMID: DOI: /sj.leu ] 17 Poveda A, del Muro XG, López-Guerrero JA, Martínez V, Romero I, Valverde C, Cubedo R, Martín-Broto J. GEIS 2013 guidelines for gastrointestinal sarcomas (GIST). Cancer Chemother Pharmacol 2014; 74: [PMID: DOI: / s ] 18 Miettinen M, Lasota J. Gastrointestinal stromal tumors: pathology and prognosis at different sites. Semin Diagn Pathol 2006; 23: [PMID: ] 8406 July 21, 2015 Volume 21 Issue 27

201 Wang CJ et al. SLITRK3 in GIST risk rating and prognosis 19 Joensuu H. Risk stratification of patients diagnosed with gastrointestinal stromal tumor. Hum Pathol 2008; 39: [PMID: DOI: /j.humpath ] 20 Gold JS, Gönen M, Gutiérrez A, Broto JM, García-del-Muro X, Smyrk TC, Maki RG, Singer S, Brennan MF, Antonescu CR, Donohue JH, DeMatteo RP. Development and validation of a prognostic nomogram for recurrence-free survival after complete surgical resection of localised primary gastrointestinal stromal tumour: a retrospective analysis. Lancet Oncol 2009; 10: [PMID: DOI: /S (09) ] 21 Joensuu H, Vehtari A, Riihimäki J, Nishida T, Steigen SE, Brabec P, Plank L, Nilsson B, Cirilli C, Braconi C, Bordoni A, Magnusson MK, Linke Z, Sufliarsky J, Federico M, Jonasson JG, Dei Tos AP, Rutkowski P. Risk of recurrence of gastrointestinal stromal tumour after surgery: an analysis of pooled population-based cohorts. Lancet Oncol 2012; 13: [PMID: DOI: / S (11) ] 22 Gal R, Rath-Wolfson L, Rosenblatt Y, Halpern M, Schwartz A, Koren R. An improved technique for mitosis counting. Int J Surg Pathol 2005; 13: [PMID: ] 23 Tanaka J, Oshima T, Hori K, Tomita T, Kim Y, Watari J, Oh K, Hirota S, Matsumoto T, Miwa H. Small gastrointestinal stromal tumor of the stomach showing rapid growth and early metastasis to the liver. Dig Endosc 2010; 22: [PMID: DOI: /j x] 24 Miettinen M, El-Rifai W, H L Sobin L, Lasota J. Evaluation of malignancy and prognosis of gastrointestinal stromal tumors: a review. Hum Pathol 2002; 33: [PMID: ] 25 Rosa F, Alfieri S, Tortorelli AP, Di Miceli D, Papa V, Ricci R, Doglietto GB. Gastrointestinal stromal tumors: prognostic factors and therapeutic implications. Tumori 2012; 98: [PMID: DOI: / ] 26 Linhares E, Gonçalves R, Valadão M, Vilhena B, Herchenhorn D, Romano S, Ferreira MA, Ferreira CG, Ramos Cde A, de Jesus JP. Gastrointestinal stromal tumor: analysis of 146 cases of the center of reference of the National Cancer Institute--INCA. Rev Col Bras Cir 2011; 38: [PMID: ] 27 Maor Y, Avidan B, Melzer E, Bar-Meir S. Long-term clinical outcome of patients with gastric gastrointestinal stromal tumors. Dig Dis Sci 2010; 55: [PMID: DOI: / s ] 28 Aruga J, Yokota N, Mikoshiba K. Human SLITRK family genes: genomic organization and expression profiling in normal brain and brain tumor tissue. Gene 2003; 315: [PMID: ] 29 Miettinen M, Sobin LH, Lasota J. Gastrointestinal stromal tumors of the stomach: a clinicopathologic, immunohistochemical, and molecular genetic study of 1765 cases with long-term follow-up. Am J Surg Pathol 2005; 29: [PMID: ] 30 Lv A, Li Z, Tian X, Guan X, Zhao M, Dong B, Hao C. SKP2 high expression, KIT exon 11 deletions, and gastrointestinal bleeding as predictors of poor prognosis in primary gastrointestinal stromal tumors. PLoS One 2013; 8: e62951 [PMID: DOI: /journal.pone ] 31 Kubota D, Yoshida A, Tsuda H, Suehara Y, Okubo T, Saito T, Orita H, Sato K, Taguchi T, Yao T, Kaneko K, Katai H, Kawai A, Kondo T. Gene expression network analysis of ETV1 reveals KCTD10 as a novel prognostic biomarker in gastrointestinal stromal tumor. PLoS One 2013; 8: e73896 [PMID: DOI: /journal. pone ] 32 Wu L, Zhang Z, Yao H, Liu K, Wen Y, Xiong L. Clinical efficacy of second-generation tyrosine kinase inhibitors in imatinib-resistant gastrointestinal stromal tumors: a meta-analysis of recent clinical trials. Drug Des Devel Ther 2014; 8: [PMID: DOI: /DDDT.S63840] P- Reviewer: Aseni P, Lu XF, Tang HH, Yang CH S- Editor: Qi Y L- Editor: Rutherford A E- Editor: Liu XM 8407 July 21, 2015 Volume 21 Issue 27

202 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Observational Study ORIGINAL ARTICLE Gastric mucosa in Mongolian and Japanese patients with gastric cancer and Helicobacter pylori infection Takeshi Matsuhisa, Yoshio Yamaoka, Tomohisa Uchida, Davaadorj Duger, Battulga Adiyasuren, Oyuntsetseg Khasag, Tserentogtokh Tegshee, Byambajav Tsogt-Ochir Takeshi Matsuhisa, Department of Gastroenterology, Tama- Nagayama University Hospital, Nippon Medical School, Tokyo , Japan Yoshio Yamaoka, Department of Environmental and Preventive Medicine, Oita University of Medicine, Oita , Japan Tomohisa Uchida, Department of Molecular Pathology, Oita University of Medicine, Oita , Japan Davaadorj Duger, Vice President of Mongolian National University of Medical Sciences and President of Mongolian Society of Gastroenterology, Ulaanbaatar 14210, Mongolia Battulga Adiyasuren, Department of Endoscopy, Ulaanbaatar Songdo Hospital, Ulaanbaatar 14210, Mongolia Oyuntsetseg Khasag, Byambajav Tsogt-Ochir, Department of Gastroenterology, Mongolian National University of Medical Sciences, Ulaanbaatar 14210, Mongolia Tserentogtokh Tegshee, Department of Gastroenterology, Third Central State Hospital, Ulaanbaatar 16081, Mongolia Author contributions: Matsuhisa T and Yamaoka Y contributed to study conception and design, data interpretation, and writing, editing, review, and approval of the article; Matsuhisa T, Yamaoka Y, Uchida T, Duger D, Adiyasuren B, Khasag O, Tegshee T and Tsogt-Ochir B contributed to data acquisition. Supported by (in part) National Institutes of Health, No. DK62813; and Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, No , No , No , and No Institutional review board statement: This study was reviewed and approved by the ethics committees of Nippon Medical School, Tokyo, Japan; Oita University, Oita, Japan; Mongolian National University of Medical Sciences, Ulaanbaatar, Mongolia; Ulaanbaatar Songdo Hospital, Ulaanbaatar, Mongolia; and Third Central State Hospital, Ulaanbaatar, Mongolia. Informed consent statement: All study participants, or their legal guardian, provided informed written consent prior to study enrollment. Conflict-of-interest statement: Matsuhisa T has received research funding from Eisai Co., Ltd as a part of this study. Data sharing statement: The technical appendix, statistical code, and dataset are available from the corresponding author at matuhisa@nms.ac.jp. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Takeshi Matsuhisa, MD, Professor, Department of Gastroenterology, Tama-Nagayama University Hospital, Nippon Medical School, Tama, Tokyo , Japan. matuhisa@nms.ac.jp Telephone: Fax: Received: January 24, 2015 Peer-review started: January 25, 2015 First decision: March 10, 2015 Revised: March 30, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract AIM: To investigate the characteristics of gastric cancer and gastric mucosa in a Mongolian population 8408 July 21, 2015 Volume 21 Issue 27

203 Matsuhisa T et al. Mongolian and Japanese gastric mucosa by comparison with a Japanese population. METHODS: A total of 484 Mongolian patients with gastric cancer were enrolled to study gastric cancer characteristics in Mongolians. In addition, a total of 208 Mongolian and 3205 Japanese consecutive outpatients who underwent endoscopy, had abdominal complaints, no history of gastric operation or Helicobacter pylori eradication treatment, and no use of gastric secretion inhibitors such as histamine H2-receptor antagonists or proton pump inhibitors were enrolled. This study was conducted with the approval of the ethics committees of all hospitals. The triple-site biopsy method was used for the histologic diagnosis of gastritis and H. pylori infection in all Mongolian and Japanese cases. The infection rate of H. pylori and the status of gastric mucosa in H. pylori -infected patients were compared between Mongolian and Japanese subjects. Age (± 5 years), sex, and endoscopic diagnosis were matched between the two countries. RESULTS: Approximately 70% of Mongolian patients with gastric cancer were years of age, and approximately half of the cancers were located in the upper part of the stomach. Histologically, 65.7% of early cancers exhibited differentiated adenocarcinoma, whereas 73.9% of advanced cancers displayed undifferentiated adenocarcinoma. The infection rate of H. pylori was higher in Mongolian than Japanese patients (75.9% vs 48.3%, P < ). When stratified by age, the prevalence was highest among young patients, and tended to decrease in patients aged 50 years or older. The anti-east-asian CagAspecific antibody was negative in 99.4% of H. pylori - positive Mongolian patients. Chronic inflammation, neutrophil activity, glandular atrophy, and intestinal metaplasia scores were significantly lower in Mongolian compared to Japanese H. pylori -positive patients (P < ), with the exception of the intestinal metaplasia score of specimen from the greater curvature of the upper body. The type of gastritis changed from antrumpredominant gastritis to corpus-predominant gastritis with age in both populations. CONCLUSION: Gastric cancer was located in the upper part of the stomach in half of the Mongolian patients; Mongolian patients were infected with non-east-asiantype H. pylori. Key words: Chronic inflammation; Gastric cancer; Glandular atrophy; Helicobacter pylori; Intestinal metaplasia; Japanese; Mongolian; Neutrophil activity; Non-East- Asian-type strain The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Characteristics of gastric cancer and gastric mucosa in Mongolian patients were observed; approximately half of the cancers were located in the upper part of the stomach. The infection rate of Helicobacter pylori was higher in Mongolian compared to Japanese patients (75.9% vs 48.3%, P < ). Mongolian patients were infected with non-east-asian-type H. pylori strains. Atrophic and intestinal metaplasia scores were lower in H. pylori -infected Mongolian patients compared to Japanese patients (P < ). The type of gastritis changed from antrum-predominant gastritis to corpus-predominant gastritis with age in both populations. Matsuhisa T, Yamaoka Y, Uchida T, Duger D, Adiyasuren B, Khasag O, Tegshee T, Tsogt-Ochir B. Gastric mucosa in Mongolian and Japanese patients with gastric cancer and Helicobacter pylori infection. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8408.htm DOI: org/ /wjg.v21.i INTRODUCTION Helicobacter pylori (H. pylori) infections cause not only peptic ulcer disease, but also gastric cancer [1,2]. Among H. pylori strains, there is a Western-type and an East- Asian-type; the East-Asian-type strain greatly influences the development of atrophic gastritis and gastric cancer. Mongolia, South Korea, and Japan are located in Eastern Asia and have the highest incidence of gastric cancer in the world [age-standardized incidence rates (ASR): 47.4 cases per males, 62.3 cases per males, and 45.8 cases per males, respectively] [3]. In spite of the high prevalence of H. pylori infection in Bangladeshi [4,5], Thai [6], and Indian populations, the incidence of gastric cancer in these countries is extremely low. These trends have been denoted as Asian enigmas [7] or the Asian Paradox [8]. In this report, the characteristics of gastric cancer, H. pylori infection, and gastric mucosa in Mongolian and Japanese patients were observed and compared. MATERIALS AND METHODS Patients Between January 2011 and December 2013, 484 consecutive gastric cancer patients (mean age: 60.5 years, range, years; male-to-female ratio of 1:0.51) in the Department of Endoscopy of Ulaanbaatar Songdo Hospital (Ulaanbaatar, Mongolia) were enrolled to study the characteristics of gastric cancer in Mongolian patients. In addition, we performed endoscopy on 208 consecutive outpatients (mean age: 41.6 years, range, years; male-to-female ratio of 1:1.89) at the Department of Gastroenterology, Health Sciences University of Mongolia, the Department of Endoscopy, Ulaanbaatar Songdo Hospital, and the Department of Gastroenterology, Third Central State Hospital in 8409 July 21, 2015 Volume 21 Issue 27

204 Matsuhisa T et al. Mongolian and Japanese gastric mucosa #3: lesser curvature of the lower body [Angulus] #1: greater curvature of the lower antrum [Antrum] #2: greater curvature of the upper body [Corpus] #4: from ulcers or cancer lesions Figure 1 Triple-site biopsy. Triple-site biopsy specimens were used for the histologic diagnosis of chronic inflammation, neutrophil activity, glandular atrophy, intestinal metaplasia and Helicobacter pylori in the gastric mucosa. Ulaanbaatar, Mongolia in November The data were compared with our independent endoscopy survey of 3205 consecutive outpatients (mean age: 55.1 years, range, years male-to-female ratio of 1:0.73) at Nippon Medical School between January 2008 and March 2014 in Tokyo, Japan. All patients in both countries had abdominal complaints, no history of gastric operation or H. pylori-eradication treatment, and no use of gastric secretion inhibitors such as histamine H2-receptor antagonists or proton pump inhibitors. This study was conducted with the approval of the ethics committees of all hospitals. Written informed consent to participate in the study was obtained from all patients except minors, whose consent was obtained from the guardian. All endoscopy procedures in Mongolian patients were performed by T Matsuhisa and Y Yamaoka using the same criteria used for the Japanese patients. All endoscopy procedures in Japanese patients were performed by T Matsuhisa. Classification of gastric cancer The 3rd English edition of the Japanese Classification of Gastric Carcinoma was used for histologic classification and to describe the location of the gastric cancer: upper (U), middle (M), and lower (L) [9]. Cancer lesions involved in more than two regions were excluded. Among gastric cardia cancers, cancers in the stomach < 2 cm distal to the esophagogastric junction were included in the cases of the U region. Nishi s criterion (in Japanese) was used for the definition of gastric cardia cancer (esophagogastric cancer). According to this criterion, the tumor center must be located in the stomach or esophagus within 2 cm of the esophagogastric junction, irrespective of histology. This criterion is also included in the 3 rd English edition of Japanese Classification of Gastric Carcinoma [9]. The locations of gastric cancers were diagnosed by Mongolian doctors (T Tegshee and B Adiyasuren). Cancer limited to mucosa or submucosa was defined as early gastric cancer, regardless of the presence or absence of lymph node metastases [9]. Advanced gastric cancer was defined as cancer that had infiltrated a deeper layer than the muscularis propria [9]. Papillary adenocarcinoma, well-differentiated type, and moderately-differentiated type were considered differentiated adenocarcinoma, and poorly differentiated adenocarcinoma, signet-ring cell carcinoma, and mucinous adenocarcinoma were considered undifferentiated adenocarcinoma [9]. Gastric cancer in Mongolian patients included endoscopically operated patients (endoscopic submucosal dissection or endoscopic mucosal resection), surgically operated patients, patients not operated on, and inoperable patients. Biopsy specimens were used for the histologic diagnosis of gastric cancer. Cancers were diagnosed by a single Mongolian pathologist (T Baldandorj). Diagnosis of gastritis and H. pylori infection The triple-site biopsy method (Figure 1) [5,6,10,11] was used for the histologic diagnosis of gastritis and H. pylori infection in all Mongolian and Japanese cases. Chronic inflammation, neutrophil activity, glandular atrophy, intestinal metaplasia, and H. pylori were scored using a 4-point scale ranging from 0 to 3 (0: none, 1: mild, 2: moderate, and 3: severe) based on the Updated Sydney system [12]. Specimen #1 was taken from the greater curvature of the lower antrum (antrum), specimen #2 was taken from the greater curvature of the upper corpus (corpus), and specimen #3 was taken from the lesser curvature of the lower corpus (angulus). Specimen #4 and others were taken from ulcers or cancer lesions. In Mongolian endoscopy cases, all biopsy specimens were subjected to hematoxylin-eosin, Giemsa, and anti- East-Asian CagA-specific antibody (α-eas Ab) staining in Japan [13]. α-eas Ab is specifically immunoreactive with East-Asian CagA but not Western CagA. All Japanese cases were subjected to hematoxylin-eosin and Giemsa staining. One pathologist (N Yamada) diagnosed all sections to minimize any bias in the histologic diagnoses. In total, 203 pairs from 208 Mongolian and 3205 Japanese patients matched by age (± 5 years), sex, and endoscopic diagnosis were used to compare the prevalence of H. pylori infection between the two countries. From 158 H. pylori-positive Mongolian and 1736 H. pylori-positive Japanese patients matched by age (± 5 years), sex, and endoscopic diagnosis, 137 pairs of H. pylori-positive patients were used to compare the characteristics of gastric mucosa. Corpus/antrum activity score (C/A) ratio The C/A ratio was used to diagnose the type of gastritis in H. pylori-positive patients [10,11]. The C/A ratio in every age group was calculated using the mean score of C divided by the mean score of A. Patients with a C/A ratio < 1 were assessed as having antrumpredominant gastritis and those with a C/A ratio > 1 were assessed as having corpus-predominant gastritis July 21, 2015 Volume 21 Issue 27

205 Matsuhisa T et al. Mongolian and Japanese gastric mucosa Early gastric cancer n = 143 Advanced gastric cancer n = year year year year year year year Total n = % 20% 20% 60% 80% 100% Figure 2 Analysis of gastric cancer in Mongolian patients. Early gastric cancer n = Upper (U) Middle (M) Lower (L) Advanced gastric cancer n = Total n = % 20% 20% 60% 80% 100% Figure 3 Distribution of gastric cancer in Mongolian patients. Statistical analysis McNemar s test was used to compare the prevalence of H. pylori infection, and the Mann-Whitney U test was used to compare the gastric mucosa. P < 0.05 was considered significant. RESULTS Characteristics of gastric cancer in Mongolian patients In 484 consecutive cases of gastric cancer in Mongolian patients, early gastric cancer accounted for 29.5% (143/484). When stratified by age group, total gastric cancer, early gastric cancer, and advanced gastric cancer were most frequent in patients in their 60s, followed by those in their 50s and then 70s, accounting for 71.9%, 72.0%, and 71.8% of these cancers, respectively (Figure 2). Moreover, 6.5%-9.8% of gastric cancer presented in young adults aged 39 years and younger. The male-to-female ratio was 1:0.51. The percentages of the sites most affected by total gastric cancer were 46.5% in the U region, followed by 28.1% in the L region, and 25.4% in the M region (Figure 3). Lesions occurring in two or three regions (UM region: 91 cases, ML region: 16 cases, UML region: 7 cases; all were advanced gastric cancer) were excluded. The affected area of early gastric cancer and advanced gastric cancer was also largest in the U region (47.5% and 45.8%, respectively). Among gastric cancer in Mongolian patients, gastric cardia cancer accounted for 3.9% (19/484) of total gastric cancer. A greater percentage of total gastric cancer cases were undifferentiated adenocarcinoma (61.8%) than differentiated adenocarcinoma (37.2%). Similarly, in advanced gastric cancer, cases of undifferentiated adenocarcinoma (73.9%) were greater than those of differentiated adenocarcinoma (25.2%) (Figure 4). By contrast, in early gastric cancer, differentiated adenocarcinoma (65.7%) was more prevalent than undifferentiated adenocarcinoma (32.9%). Infection rate of H. pylori The infection rate of H. pylori was 76.0% (158/208 patients) in Mongolian patients. When stratified by age, H. pylori infection was highest among young people (< 19 years: 88.9%; years: 76.9%; years: 89.7%), and tended to decrease in people 50 years of age and older (50-59 years: 68.4%; years: 61.5%; 70 years or older: 71.4%) (Figure 5) July 21, 2015 Volume 21 Issue 27

206 Matsuhisa T et al. Mongolian and Japanese gastric mucosa pap tub1 Early gastric cancer n = tub2 por sig adenosquamous Advanced gastric cancer n = squamous Total n = % 20% 20% 60% 80% 100% Figure 4 Histologic distribution of gastric cancer in Mongolian patients. Analysis of the percentages of differentiated adenocarcinoma (papillary adenocarcinoma [pap], well-differentiated type [tub1], and moderately differentiated type [tub2]) and undifferentiated adenocarcinoma (poorly differentiated adenocarcinoma [por] and signet-ring cell carcinoma [sig]). Mongolian 100% 80% 60% 40% C/A ratio Japanese Antrum-predominant gastritis Corpus-predominant gastritis P < % 0.5 0% (n = 9) (n = 52) (n = 39) (n = 37) Age (yr) (n = 38) (n = 26) (n = 7) (n = 30) (n = 33) (n = 28) Age (yr) (n = 25) (n = 21) Mann-Whitney U -test Figure 5 prevalence of Helicobacter pylori infection in Mongolian patients according to age. The infection rate of H. pylori was higher in Mongolian than in Japanese patients (75.9% vs 48.3%, P < ). α-eas Ab positivity α-eas Ab was negative in 99.4% (157/158 patients) of H. pylori-positive Mongolian patients. Gastric mucosa The mean scores for gastritis and H. pylori in the H. pylori-positive cases were all significantly lower in Mongolian patients than in Japanese patients (all P < ); the only exception was the intestinal metaplasia scores of specimen #2, which did not differ significantly between Mongolian and Japanese patients (Table 1). C/A ratio The C/A ratio in 137 matched pairs of H. pylori-infected Mongolian and Japanese patients revealed antrumpredominant gastritis in < 49 years and 39 years, respectively, and corpus-predominant gastritis in Figure 6 Corpus/antrum activity score ratio in Helicobacter pylori-positive Mongolian and Japanese patients matched by age, sex, and endoscopic diagnostics. Corpus/antrum (C/A) ratio < 1 indicates antrum-predominant gastritis, whereas ratio > 1 corpus-predominant gastritis. patients > 50 years and 40 years, respectively (Figure 6). The mean C/A ratio of the Japanese patients > 60 years of age was higher than that of the Mongolian patients (1.43 vs 1.01; P < 0.01). DISCUSSION The incidence and mortality of gastric cancer are high in Eastern Asia and Central and Eastern Europe. According to the age-adjusted cancer incidence in Mongolian males, the liver is the most common cancer site (ASR: 97.8 cases per males), followed by the stomach (47.4 cases per males), lungs (27.7 cases per males), esophagus (21.2 cases per males), and colorectum (5.7 cases per males) (Globocan 2012) [3]. By contrast, in Japanese males, the stomach is the most common cancer site (45.8 cases per males), followed by the colorectum (42.1 cases per males), lungs (38.8 cases per males), prostate (30.4 cases per males) and liver 8412 July 21, 2015 Volume 21 Issue 27

207 Matsuhisa T et al. Mongolian and Japanese gastric mucosa Table 1 Gastritis scores of Helicobacter pylori -positive Mongolian and Japanese patients matched by age, sex, and endoscopic diagnosis, n = 137 Nationality Specimen Chronic inflammation Neutrophil activity Glandular atrophy Intestinal metaplasia Helicobacter pylori Mongolian # ± 0.59 P < ± 0.54 P < ± 0.36 P < ± 0.40 P < ± 0.79 P < Japanese (antrum) 2.30 ± ± ± ± ± 1.01 Mongolian # ± 0.50 P < ± 0.47 P < ± 0.19 P < ± ± 0.84 P < Japanese (corpus) 2.03 ± ± ± ± ± 0.79 Mongolian # ± 0.62 P < ± 0.61 P < ± 0.41 P < ± 0.60 P < ± 0.87 P < Japanese (angulus) 2.21 ± ± ± ± ± 0.95 P values according to the Mann-Whitney U-test. A B Figure 7 Gastric cancer cases in the upper region. A: Sixty-seven-year-old-woman with cancer located near the cardia, type 2; b: Eighty-eight-year-old-man with cancer located around the cardia, type 3. (14.6 cases per males) [3]. In South Korean males, the stomach is also the most common cancer site (62.3 cases per males) [3]. South Korea, Mongolia, and Japan have the highest incidences of gastric cancer in the world. We previously examined gastric mucosa in relation to H. pylori infection in South Koreans [14], Chinese [6,11], Vietnamese [6,11], Thai [6,11], Burmese (Lecture, Nay Pyi Daw, Myanmar, 2008), Bangladeshi [4,5], and Nepalese [11] patients, and reported that atrophic and intestinal metaplasia scores were very high in Japanese and South Koreans. In this study, we investigated the characteristics of gastric cancer and the gastric mucosa in the context of H. pylori infection in Mongolian patients, who belong to the East Asian population, and compared them with those of Japanese patients. Characteristics of gastric cancer in Mongolian patients Other than incidence and mortality, very few data relating to Mongolian patients with gastric cancer are available via PubMed. Therefore, we determined the ratio of early gastric cancer to total gastric cancer, age group frequency, region, and histologic type in Mongolian patients. Globally, gastric cancer is more common in men than women [3], and this is also true for Mongolian patients (male-to-female ratio 1:0.51). The percentage of early gastric cancer among total gastric cancer is 29.5% in Mongolian patients, which is lower than in Japanese cases (80%) [15] ; the delayed spread of gastric examination screening, endoscopy devices, and early gastric cancer diagnostics in Mongolia may be determining factors. In addition, because H. pylori testing is not widespread in Mongolia, it is not clear if the cases included in this study were infected with H. pylori. In countries and regions with a high incidence, gastric cancer occurs more frequently in the distal portion of the stomach; in countries and regions with a low incidence, gastric cancer occurs more frequently in the proximal portion [16]. Approximately half of the Japanese cases of gastric cancer occurred in the M region, (M > L > U) [15], while approximately half of the Mongolian gastric cancer cases occurred in the U region, indicating a considerable difference in the location frequency. Mongolians reportedly have high meat and salt intake (15 g/d). Other common practices include consuming large amounts of hot tea, regular alcohol intake, hurried eating, and low intake of fruit and vegetables [17,18]. Although H. pylori infection is not a risk factor for gastric cardia cancer [19], obesity is an onset risk factor of gastric cardia cancer [20,21]. Furthermore, obesity may influence the development of early gastric cancer and differentiated adenocarcinoma in males regardless of H. pylori infection [22]. No data regarding the degree of obesity in gastric cancer patients have been reported; however, the percentage of obese Mongolian adults (16.4%) is high compared with Japanese adults (4.5%) according to age-standardized data [23]. In this context, patients with a body mass index 30 kg/m 2 are defined as obese. Gastric cardia cancer 8413 July 21, 2015 Volume 21 Issue 27

208 Matsuhisa T et al. Mongolian and Japanese gastric mucosa accounted for 3.9% of total gastric cancer in Mongolian patients, and 3.2% of Japanese gastric cancer patients who underwent either endoscopic surgery or an open surgery in the previous decade [24]. Many cancers were located in the U region, including the cardia, in Mongolian patients (Figure 7), but the frequency of gastric cardia cancer does not differ compared to the Japanese patients. Because of the large number of advanced cancer cases among Mongolian patients, we must consider the possibility that gastric cardia cancers enlarged in size were classified as U region cancers. The factors (other than obesity) that contribute to the high incidence of gastric cancer in the U region remain to be determined. A detailed investigation of environmental factors and host factors is also necessary. In Mongolian patients, the most prevalent histologic types of total, early, and advanced gastric cancers are undifferentiated adenocarcinoma, differentiated adenocarcinoma, and undifferentiated adenocarcinoma, respectively. In Japanese patients, undifferentiated adenocarcinoma was prevalent before the 1970s and differentiated adenocarcinoma has been dominant since the 1980s due to the aging of H. pylori-infected patients [15]. According to a report by Yamada et al [15], who examined patients who underwent surgical treatment in the 2000s, differentiated adenocarcinoma accounted for 68% and undifferentiated adenocarcinoma accounted for only 32% of cases. The trend of prevalent differentiated adenocarcinoma is weaker in advanced gastric cancer, but significantly stronger in early gastric cancer [16]. In Mongolian patients, differentiated adenocarcinoma is common in early gastric cancer, as in Japanese; however, a different trend was observed for advanced gastric cancer and total gastric cancer. The prevalence of undifferentiated adenocarcinoma in total gastric cancer in Mongolia may be due to differences in the criteria used by pathologist in Mongolia and the lower mean age of gastric cancer in Mongolian patients (60.5 years) compared to the Japanese patients (64 years) [15]. Based on the results of our field study in Asian countries, the gastric ulcer (GU)/duodenal ulcer (DU) ratiois different. There are big differences among Asian countries. Japanese [14] and South Korean [14] patients present as GU-predominant cases (1.69 and 1.75, respectively), whereas Bangladeshi [5] and Nepalese [11] present as DU-predominant cases (0.31 and 0.25, respectively). According to a personal communication with one Mongolian doctor who previously investigated this topic (O Khasag, Mongolian National University of Medical Sciences), Mongolia is a country of GU predominance (1.9 in 2003 based on unpublished data). Regarding the relationship between peptic ulcer disease and gastric cancer, a higher GU/DU ratio in a country or region has been associated with a greater incidence of gastric cancer [25]. Furthermore, the development of gastric cancer is positively correlated with GU, but negatively correlated with DU [26]. Based on these reports, gastric cancer is likely to be common among Japanese, South Korean, and Mongolian patients. Infection rate of H. pylori Approximately half of the world s population is infected with H. pylori, and the infection rate is higher in developing countries than in developed countries [27]. The infection rate of H. pylori is reported to be 5% or less in people younger than 20 years of age, and 40% in people in their 50s in developed countries [27]. In Japan, the infection rate is decreasing gradually, and the prevalence is 6.4% in children (0-12 years-old) [28] and 5.2% in high school students (16 or 17 yearsold) [29]. In developing countries, the infection rate of H. pylori can be as high as 50% in teenagers and more than 90% in people in their 30s [30]. Our results indicate that H. pylori infection rates are high (76.0%) in Mongolian patient and very high in those years of age (88.9%), revealing a developing country-type prevalence. Positive rate of α-eas Ab The Japanese are infected with East-Asian-type H. pylori, but the type of H. pylori that infects Mongolian patients has not been determined. Therefore, the Mongolian biopsies were stained with α-eas Ab, which specifically reacts to East-Asian-type H. pylori. In H. pylori-positive Mongolian cases, the rate of α-eas Ab positivity was 0.6% (1/158 H. pylori-positive cases), indicating that despite the location of Mongolia in East Asia, Mongolians are not infected with East-Asian-type H. pylori (i.e. Western-type CagA or CagA-negative strains). The H. pylori strains are currently being characterized by one of the authors (Y Yamaoka). Gastric mucosa The scores for gastritis and H. pylori were significantly lower in H. pylori-infected Mongolian patients compared to Japanese patients at all gastric sites, with the exception of the intestinal metaplasia score in specimen #2. East-Asian-type H. pylori strains induce stronger chronic inflammation and neutrophil activity than Western-type H. pylori strains [31] and are involved in gastric mucosal atrophy and gastric cancer [32]. According to a report by Uemura et al [1], atrophic changes and intestinal metaplasia are strongly related to the risk of gastric cancer, and severe atrophic change, and intestinal metaplasia in particular, leads to a high risk of both intestinal-type and diffuse-type gastric cancer [9]. Because the South- Asian population is infected with Western-type H. pylori [33,34], glandular atrophy and intestinal metaplasia scores were significantly lower in Bangladeshi [5] and Nepalese [12] patients in our previously reported results. Therefore, the incidence of gastric cancer is very low in Bangladesh and Nepal (ASR: 7.2 cases per males and 7.4 cases per males, 8414 July 21, 2015 Volume 21 Issue 27

209 Matsuhisa T et al. Mongolian and Japanese gastric mucosa respectively) [3]. Although glandular atrophy and intestinal metaplasia scores are low in Mongolian patients, the incidence of gastric cancer is high; however, it is important to note that these scores were not obtained from patients with gastric cancer. To address this paradox, the gastric mucosa of Mongolian patients with gastric cancer should be examined. We are planning a gastric mucosal survey of patients with gastric cancer in Uvs, a western province with the highest prevalence of gastric cancer in Mongolia (ASR: cases per males). C/A ratio The prevalence of antrum-predominant gastritis tends to decrease with age in favor of corpus-predominant gastritis in Mongolian and Japanese patients. The C/A ratio in patients older than 60 years was higher in Japanese patients than in Mongolian patients. All age groups of Bangladeshi and Nepalese subjects had antrum-predominant gastritis [5,12]. The risk of gastric cancer is 23.3 times higher for corpus-predominant gastritis than for antrum-predominant gastritis [1]. This report is consistent with the low incidence of gastric cancer in South-Asian countries (Bangladesh and Nepal) and the high incidence in East-Asian countries (Japan, South Korea, and Mongolia). Therefore, a high C/A ratio, indicating corpus-predominant gastritis, is one of the causative factors of gastric cancer. In conclusion, a comparative analysis of gastric mucosa in Mongolia and Japan, two countries with a high incidence of gastric cancer, was conducted. Gastric cancer occurred most frequently in the U region in Mongolian patients, and peaked among those in their 60s. The most prevalent histologic types of early and advanced gastric cancers are differentiated adenocarcinoma and undifferentiated adenocarcinoma, respectively. The infection rate of H. pylori was high in Mongolian patients, particularly those 1719 years-old. The scores for gastric mucosa may have been lower in the Mongolian patients compared to the Japanese patients because the majority were infected with non- East-Asian-type H. pylori strains. H. pylori-positive young Mongolian patients had antrum-predominant gastritis and developed more corpus-predominant gastritis with advanced age similar to the Japanese population. Further studies should clarify the reason for the high gastric cancer prevalence in Mongolian patients infected with non-east-asian-type H. pylori. ACKNOWLEDGMENTS We sincerely thank all medical staff at the Department of Gastroenterology, Health Sciences University of Mongolia, Department of Endoscopy, Ulaanbaatar Songdo Hospital, and Department of Gastroenterology, Third Central State Hospital, Ulaanbaatar, Mongolia, for all their work related to endoscopy. We also thank Hidenobu Watanabe, Emeritus Professor at the School of Medicine, Niigata University, Niigata, Japan for the histologic criterion of gastric cardia cancer, Nobutaka Yamada, former Assistant Professor in the Department of Pathology, Nippon Medical School, Tokyo, Japan, for the pathologic diagnoses of all Japanese biopsy specimens, and Nurse Yumi Sakamoto at Nippon Medical School Hospital, Nurse Kiyomi Suzuki at Daini Kokudou Hospital, and Nurse Sonomi Nawata at JR Kyusyu Hospital for their cooperation. COMMENTS Background Helicobacter pylori (H. pylori) infections cause not only peptic ulcer disease, but also gastric cancer. Mongolia, South Korea, and Japan, which are located in Eastern Asia, have the highest incidence of gastric cancer in the world. Other than incidence and mortality, very few data relating to Mongolian patients with gastric cancer are available in PubMed. The characteristics of gastric cancer, H. pylori infection, and gastric mucosa were observed and compared between Mongolian and Japanese patients. Research frontiers There are Western-type and East-Asian-type strains of H. pylori: the East- Asian-type strain influences the development of atrophic gastritis and gastric cancer greatly. There are no data regarding the type of H. pylori strain that tends to infect Mongolian patients or the gastric mucosa and type of gastritis in this population. Innovations and breakthroughs Gastric cancer occurred most frequently in the upper gastric region of Mongolian patients and peaked in those in their 60s. The most prevalent histologic types of early and advanced gastric cancers were differentiated adenocarcinoma and undifferentiated adenocarcinoma, respectively. The infection rate of H. pylori was high in Mongolian patients, particularly those years-old. The majority of Mongolians were infected with non-east-asian-type H. pylori strains (99.4%), which may explain the lower gastric mucosa scores when compared to Japanese patients. H. pylori-positive young Mongolian patient had antrumpredominant gastritis and developed more corpus-predominant gastritis with advanced age, similar to the Japanese patients. Applications There are many differences between Mongolian and Japanese patients in the location of gastric cancer, H. pylori strain type, and gastric mucosa. Future studies should clarify the reason for the high gastric cancer prevalence in Mongolian patients infected with non-east-asian-type H. pylori. Terminology The anti--asian CagA-specific antibodies specifically immunoreactive with East- Asian CagA, but not Western CagA. Patients with a corpus/antrum activity ratio < 1 were assessed as having antrum-predominant gastritis, and those with a ratio > 1 were assessed as having corpus-predominant gastritis. Peer-review In this study, the authors investigated the characteristics of gastric cancer and gastric mucosa in Mongolian patients by comparing the gastric mucosa of Mongolian and Japanese patients. Approximately 70% of older Mongolians had gastric cancer, and approximately half of the Mongolian cancers were located in the upper part of the stomach. Three-fourths of advanced cancer displayed undifferentiated adenocarcinoma. Many differences in stomach characteristics were observed in Mongolian patients compared with Japanese patients. The prevalence of H. pylori infection was higher in Mongolian than in Japanese patients (75.9% vs 48.3%, P < ). The most surprising result was that 99.4% of H. pylori-positive cases were infected with non-east-asian-type H. pylori. In general, this study is novel, interesting, and scientific, and, importantly, has clinical significance. REFERENCES 1 Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter 8415 July 21, 2015 Volume 21 Issue 27

210 Matsuhisa T et al. Mongolian and Japanese gastric mucosa pylori infection and the development of gastric cancer. N Engl J Med 2001; 345: [PMID: DOI: / NEJMoa001999] 2 Fukase K, Kato M, Kikuchi S, Inoue K, Uemura N, Okamoto S, Terao S, Amagai K, Hayashi S, Asaka M. Effect of eradication of Helicobacter pylori on incidence of metachronous gastric carcinoma after endoscopic resection of early gastric cancer: an open-label, randomised controlled trial. Lancet 2008; 372: [PMID: DOI: /S (08) ] 3 International Agency for Research on Cancer, World Health Organization. Available from: URL: aspx 4 Matsuhisa T, Aftab H. Observation of upper gastrointestinal diseases and gastric mucosa in Bangladeshi population-comparison with Japanese. Bangladesh Med J 2012; 23: Matsuhisa T, Aftab H. Observation of gastric mucosa in Bangladesh, the country with the lowest incidence of gastric cancer, and Japan, the country with the highest incidence. Helicobacter 2012; 17: [PMID: DOI: / j x] 6 Matsuhisa TM, Yamada NY, Kato SK, Matsukura NM. Helicobacter pylori infection, mucosal atrophy and intestinal metaplasia in Asian populations: a comparative study in age-, gender- and endoscopic diagnosis-matched subjects. Helicobacter 2003; 8: [PMID: DOI: / j x] 7 Miwa H, Go MF, Sato N. H. pylori and gastric cancer: the Asian enigma. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 8 Matsukura N, Yamada S, Kato S, Tomtitchong P, Tajiri T, Miki M, Matsuhisa T, Yamada N. Genetic differences in interleukin-1 betapolymorphisms among four Asian populations: an analysis of the Asian paradox between H. pylori infection and gastric cancer incidence. J Exp Clin Cancer Res 2003; 22: [PMID: ] 9 Japanese Gastric Cancer Association. Japanese classification of gastric carcinoma: 3rd English edition. Gastric Cancer 2011; 14: [PMID: DOI: /s ] 10 Matsuhisa T, Matsukura N, Yamada N. Topography of chronic active gastritis in Helicobacter pylori-positive Asian populations: age-, gender-, and endoscopic diagnosis-matched study. J Gastroenterol 2004; 39: [PMID: DOI: / s y] 11 Matsuhisa T, Miki M, Yamada N, Sharma SK, Shrestha BM. Helicobacter pylori infection, glandular atrophy, intestinal metaplasia and topography of chronic active gastritis in the Nepalese and Japanese population: the age, gender and endoscopic diagnosis matched study. Kathmandu Univ Med J (KUMJ) 2007; 5: [PMID: ] 12 Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston Am J Surg Pathol 1996; 20: [PMID: DOI: / ] 13 Uchida T, Kanada R, Tsukamoto Y, Hijiya N, Matsuura K, Yano S, Yokoyama S, Kishida T, Kodama M, Murakami K, Fujioka T, Moriyama M. Immunohistochemical diagnosis of the caga-gene genotype of Helicobacter pylori with anti-east Asian CagA-specific antibody. Cancer Sci 2007; 98: [PMID: ] 14 Matsuhisa T. Helicobacter pylori infection and gastroduodenal diseases in East, Southeast, and South Asian countries. In: Kim BW, Lee JH, editors. Asian Perspective in Helicobacter Research. The 10th Japan-Korea Joint Symposium on Helicobacter pylori Infection May 31-June 1; Seoul, South-Korea, 2013: Yamada M, Oda I, Taniguchi H, Kushima R. [Chronological trend in clinicopathological characteristics of gastric cancer]. Nihon Rinsho 2012; 70: [PMID: ] 16 Sin HR, Curado MP, Ferlay J, Heanue M, Edwards B, Strom M. Processing of data. In: Curado MP, Edwards B, Shin HR, Storm H, Ferlay J, Heanue M, Boyle P. Cancer incidence in five continents, Vol. IX. Lyon: IARC Scientific Publications, 2007: Moore MA, Aitmurzaeva G, Arsykulov ZA, Bozgunchiev M, Dikanbayeva SA, Igisinov G, Igisinov N, Igisinov S, Karzhaubayeva S, Oyunchimeg D, Oyunsuren T, Soipova M, Tumubaatar T. Chronic disease prevention research in Central Asia, the Urals, Siberia and Mongolia - past, present and future. Asian Pac J Cancer Prev 2009; 10: [PMID: ] 18 Sandagdorj T, Sanjaajamts E, Tudev U, Oyunchimeg D, Ochir C, Roder D. Cancer incidence and mortality in Mongolia - National Registry Data. Asian Pac J Cancer Prev 2010; 11: [PMID: ] 19 Huang JQ, Sridhar S, Chen Y, Hunt RH. Meta-analysis of the relationship between Helicobacter pylori seropositivity and gastric cancer. Gastroenterology 1998; 114: [PMID: DOI: /S (98) ] 20 Kubo A, Corley DA. Body mass index and adenocarcinomas of the esophagus or gastric cardia: a systematic review and metaanalysis. Cancer Epidemiol Biomarkers Prev 2006; 15: [PMID: DOI: / EPI ] 21 Zhang J, Su XQ, Wu XJ, Liu YH, Wang H, Zong XN, Wang Y, Ji JF. Effect of body mass index on adenocarcinoma of gastric cardia. World J Gastroenterol 2003; 9: [PMID: ] 22 Kim HJ, Kim N, Kim HY, Lee HS, Yoon H, Shin CM, Park YS, Park DJ, Kim HH, Lee KH, Kim YH, Kim HM, Lee DH. Relationship between body mass index and the risk of early gastric cancer and dysplasia regardless of Helicobacter pylori infection. Gastric Cancer 2014; Epub ahead of print [PMID: DOI: /s ] 23 Mean body mass index trends (age-standardized estimate) Data by country. Available from: URL: main.a Yamada M, Kushima R, Oda I, Taniguchi H, Sekine S, Odagaki T, Abe S, Sou E, Yachida T, Sakamoto T, Nonaka S, Suzuki H, Yoshinaga S, Nakajima T, Matsuda T, Saito Y, Shimoda T. Yearly trends of adenocarcinoma of the esophago-gastric junction and Barrett s adenocarcinoma, and association with Helicobacter pylori infection. Stomach and Intestine 2011; 46: Chiba T. Helicobacter pylori infection in Asia. Helicobacter Res 2000; 4: Van Zanten SJ, Dixon MF, Lee A. The gastric transitional zones: neglected links between gastroduodenal pathology and helicobacter ecology. Gastroenterology 1999; 116: [PMID: DOI: /S (99) ] 27 Megraud F. Epidemiology of Helicobacter pylori infection. In: Rathbone BK, Heatley RV. Helicobacter pylori and gastroduodenal disease. London: Blackwell Scientific Publications, 1993: Okuda M, Miyashiro E, Koike M, Okuda S, Minami K, Yoshikawa N. Breast-feeding prevents Helicobacter pylori infection in early childhood. Pediatr Int 2001; 43: [PMID: DOI: /j X x] 29 Akamatsu T, Ichikawa S, Okudaira S, Yokosawa S, Iwaya Y, Suga T, Ota H, Tanaka E. Introduction of an examination and treatment for Helicobacter pylori infection in high school health screening. J Gastroenterol 2011; 46: [PMID: DOI: /s ] 30 Graham DY. Helicobacter pylori: its epidemiology and its role in duodenal ulcer disease. J Gastroenterol Hepatol 1991; 6: [PMID: DOI: /j tb01448.x] 31 Azuma T. Helicobacter pylori CagA protein variation associated with gastric cancer in Asia. J Gastroenterol 2004; 39: [PMID: DOI: /s ] 32 Azuma T, Yamazaki S, Yamakawa A, Ohtani M, Muramatsu A, Suto H, Ito Y, Dojo M, Yamazaki Y, Kuriyama M, Keida Y, Higashi H, Hatakeyama M. Association between diversity in the Src homology 2 domain--containing tyrosine phosphatase binding site of Helicobacter pylori CagA protein and gastric atrophy and cancer. J Infect Dis 2004; 189: [PMID: DOI: /381782] 33 Yamaoka Y, Orito E, Mizokami M, Gutierrez O, Saitou N, Kodama T, Osato MS, Kim JG, Ramirez FC, Mahachai V, Graham 8416 July 21, 2015 Volume 21 Issue 27

211 Matsuhisa T et al. Mongolian and Japanese gastric mucosa DY. Helicobacter pylori in North and South America before Columbus. FEBS Lett 2002; 517: [PMID: DOI: /S (02) ] 34 Yamaoka Y. Helicobacter pylori typing as a tool for tracking human migration. Clin Microbiol Infect 2009; 15: [PMID: DOI: /j x] P- Reviewer: Shimada H, Zhang ZY S- Editor: Ma YJ L- Editor: AmEditor E- Editor: Liu XM 8417 July 21, 2015 Volume 21 Issue 27

212 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Observational Study ORIGINAL ARTICLE Downregulation of KIF1B mrna in hepatocellular carcinoma tissues correlates with poor prognosis Song-Zhu Yang, Jian-Tao Wang, Wei-Wei Yu, Qing Liu, Yan-Fang Wu, Shu-Guang Chen Song-Zhu Yang, Jian-Tao Wang, Wei-Wei Yu, Qing Liu, Yan- Fang Wu, Department of Hepatobiliary Surgery, Yantaishan Hospital, Yantai , Shandong Province, China Shu-Guang Chen, Department of Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing , China Author contributions: Yang SZ, Wang JT, and Chen SG designed the research; Yang SZ, Wang JT, Yu WW, Liu Q, and Wu YF performed the research; Yu WW and Liu Q contributed new reagents/analytic tools; Yang SZ, Wang JT, Wu YF, and Chen SG analyzed the data; and Yang SZ, Wang JT, and Chen SG wrote the paper. Institutional review board statement: The study protocol was approved by the Ethics Committee of the Yantaishan Hospital. Informed consent statement: Informed consent was obtained from each patient. Conflict-of-interest statement: No potential conflicts of interest relevant to this article were reported. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Shu-Guang Chen, MD, Professor, Department of Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, 1 Shuaifuyuan, Wangfujing, Dongcheng District, Beijing , China. pumchcsg@163.com Telephone: Fax: Received: March 16, 2015 Peer-review started: March 17, 2015 First decision: March 26, 2015 Revised: April 11, 2015 Accepted: May 7, 2015 Article in press: May 7, 2015 Published online: July 21, 2015 Abstract AIM: To compare kinesin family member 1B (KIF1B) expression with clinicopathologic parameters and prognosis in hepatocellular carcinoma (HCC) patients. METHODS: KIF1B protein and mrna expression was assessed in HCC and paracarcinomatous (PC) tissues from 68 patients with HCC using Western blot and quantitative real-time reverse transcription-pcr, respectively. Student s t -tests were used to analyze relationships between clinicopathologic parameters and KIF1B expression, the Kaplan-Meier method was used to analyze survival outcomes, and the log-rank test was used to compare survival differences between groups. RESULTS: Mean protein and mrna levels of KIF1B were similar between HCC and PC tissues. However, HCC tissues with vein invasions had significantly lower KIF1B protein levels compared to those without vein invasions (2.30 ± 0.82 relative units vs 2.77 ± 0.84 relative units, P < 0.05). KIF1B protein levels in HCC tissues from patients with recurrence during the followup period were significantly lower than those without recurrence (2.31 ± 0.92 relative units vs 2.80 ± 0.80 relative units, P < 0.05). However, KIF1B protein and mrna expression in HCC patients was not associated with other clinicopathologic parameters. Ratios of KIF1B mrna expression in HCC tissues to those in PC tissues were correlated with overall survival (13.5 mo vs 20.0 mo, P < 0.05) and disease-free survival (11.5 mo vs 19.5 mo, P < 0.05) July 21, 2015 Volume 21 Issue 27

213 Yang SZ et al. KIF1B expression in HCC patients CONCLUSION: Downregulation of KIF1B in HCC tissues is associated with poor prognosis; additional clinical studies are needed to confirm whether KIF1B can serve as a prognostic marker. Key words: Clinicopathologic correlation; Kinesin family member 1B; Liver cancer; Survival; Tumor progression The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Expression of kinesin family member 1B (KIF1B) protein and mrna did not significantly differ between hepatocellular carcinoma (HCC) tissues and paracarcinomatous tissues. KIF1B protein levels in HCC tissues were inversely correlated with recurrence and tumor vein invasion. Furthermore, ratios of KIF1B mrna in HCC tissues to paracarcinomatous tissues correlated with overall survival and disease-free survival for patients with HCC. Downregulation of KIF1B mrna in HCC tissues was associated with poor prognosis. Yang SZ, Wang JT, Yu WW, Liu Q, Wu YF, Chen SG. Downregulation of KIF1B mrna in hepatocellular carcinoma tissues correlates with poor prognosis. World J Gastroenterol 2015; 21(27): Available from: URL: wjgnet.com/ /full/v21/i27/8418.htm DOI: org/ /wjg.v21.i INTRODUCTION Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third most common cause of cancer-related deaths worldwide [1,2]. An estimated new liver cancer cases and deaths occurred worldwide during 2012, with China alone accounting for approximately 50% of the total number of cases and deaths [3]. It imposes high social and medical burdens, especially in societies with high incidences of viral hepatitis infection [4]. Most HCC patients are diagnosed beyond the stage at which surgical options are suitable, and thus have poor prognoses. However, patients at the same stage may have different prognoses [5] because many factors affect outcomes, such as clinicopathologic parameters [6-13] and emerging biomarkers [10,14-19]. This study explores how kinesin family member 1B (KIF1B) affects the long-term survival outcomes in patients with HCC who undergo surgical treatment. Recently, a single nucleotide polymorphism, rs , located at intron 24 of KIF1B, was associated with susceptibility to hepatitis B virus (HBV)-related HCC in a genome-wide association study [20]. Several studies confirmed that KIF1B affects the progression from HBV infection to HCC [20,21]. However, expression of KIF1B protein and mrna in tumors and paracarcinomatous (PC) tissues of HCC patients was not described in existing studies. This study retrospectively investigated the relationship between KIF1B expression and clinicopathologic parameters, and its predictive value for HCC prognosis. MATERIALS AND METHODS Patients and samples Resected tumor and matched PC specimens were collected from 68 HCC patients, and were immediately frozen in liquid nitrogen and stored at -80 until further testing. PC tissue was defined as liver tissue collected 2-5 cm away from the tumor border. All patients were treated with surgery in the Department of Hepatobiliary Surgery, Yantaishan Hospital, between January 2012 and June The diagnosis of HCC was made based on guidelines from the Chinese Society of Hepatology, the Chinese Society of Infectious Diseases, and the Chinese Medical Association [22]. Patients who received other treatment (transarterial chemoembolization, radiofrequency ablation, or others) before surgery or had other tumor diseases were excluded from this study. The study protocol was approved by the Ethics Committee of the Yantaishan Hospital. Informed consent was obtained from each patient. Viral infection, tumor size, number of tumor nodules, histopathologic classification, vein invasion, recurrence status, and patient survival time were evaluated. Vein invasion found during pathologic examination indicated tumor infiltration in the portal venous and/or hepatic veins. Recurrence was monitored with ultrasound, CT scans, and magnetic resonance imaging. Western blot analysis HCC and PC tissues were homogenized and treated with RIPA lysis buffer (Dingguo, Beijing, China); the extracted proteins were resolved by 4%-12% acrylamide gradient gel. After electrophoresis, samples were transferred to a polyvinylidene fluoride membrane using iblot fast transfer electric transfer (Invitrogen of Thermo Fisher Scientific, Waltham, MA, United States). Membranes were blocked at room temperature for 1 h with 5% milk, and incubated with a primary antibody against KIF1B or GAPDH (1:1000; Abcam, Cambridge, United Kingdom) at 4 overnight, followed by washing with buffer three times, a secondary antibody (1:8000, Abcam) incubation at room temperature for 2 h, washing three times, and visualized with an ECL kit (Pierce of Thermo Fisher Scientific). KIF1B-specific signals were quantified from exposed X-ray films using a scanner with BandScan 4.30 densitometry software, and are expressed as integrated intensity units relative to the GAPDH signals. The results were analyzed by physicians in a blinded manner. Quantitative real-time reverse transcription-pcr Total RNA was extracted from HCC and PC tissues with the Trizol method. The retroviral reverse transcriptase kit (Takara, Tokyo, Japan) was used to 8419 July 21, 2015 Volume 21 Issue 27

214 Yang SZ et al. KIF1B expression in HCC patients Patient No HCC PC HCC PC HCC PC HCC PC HCC PC KIF1B GAPDH Figure 1 Kinesin family member 1B (KIF1B) protein expression. Representative Western blot for KIF1B expression in hepatocellular carcinoma (HCC) and paracarcinomatous (PC) tissues. GAPDH was used as the internal loading control. synthesize cdna with the reaction conditions of 37 for 60 min and 95 for 3 min. Primers were sense: 5 -TTTCCAGCACTTAATGAAAACACATAG-3 ; antisense: 5 -CAAAGTTAAATTTCCCTGCTTTGAA-3 for KIF1B, and sense: 5 -GAAGGTGAAGGTCGGAGTC-3 ; antisense: 5 -GAAGATGGTGATGGGATTTC-3 for GAPDH. Realtime PCR was performed with the 7500 real-time quantitative PCR instrument (Applied Biosystems of Thermo Fisher Scientific) with the following conditions: 95 for 20 s, 60 for 30 s, and 72 for 30 s for 40 cycles. Data were normalized using the GAPDH housekeeping gene and are expressed as 2 Ct. Patient follow-ups Patient follow-up data was obtained after discharge for all 68 HCC patients by direct communication with the patients or their relatives, or by reviewing hospital records. Disease-free survival (DFS) was measured from the date of hepatectomy until tumor recurrence. Overall survival (OS) was measured from the date of hepatectomy until death or the last follow-up point. The last follow-up evaluation was censored on December 31, 2014, or up to the time of death. Statistical analysis Values are presented as mean ± SD or median (range). The Student s t-test was used to evaluate differences in KIF1B protein and mrna expression between HCC and PC tissues. Spearman correlation coefficients were used to analyze relationships between expression levels of KIF1B protein and mrna in HCC. The Student s t-test was used to analyze relationships between KIF1B expression level and clinicopathologic parameters. Bivariate correlations were used to analyze the association between survival time and KIF1B protein and mrna. OS and DFS was calculated by the Kaplan-Meier method and analyzed by the log-rank test. All tests were two-tailed; P < 0.05 was considered significant. The SPSS package 13.0 (SPSS Inc., Chicago, IL, United States) was used for all analyses. RESULTS Patient characteristics The mean age of the HCC patients was 58.4 ± 10.9 years; 83.8% (57/68) were male, and 80.9% (55/68) had HBV infections. Nineteen HCC patients had at least one tumor nodule larger than 5 cm. Tumors were well differentiated in 25 patients, and moderately or poorly differentiated in 32 and 11 patients, respectively. The median follow-up time was 16.5 mo (range, 1-36 mo). HCC recurred in 34 patients over a median recurrence time of 13.5 mo. During the follow-up, 31 patients died, with a mean survival time of 16.8 ± 9.4 mo. KIF1B protein and mrna expression in HCC and PC tissues The mean KIF1B protein level in HCC tissues was 2.55 ± 0.87 relative units (RU), which was higher, but not significantly so, than in PC tissues (2.38 ± 0.92 RU). The mean KIF1B mrna level in HCC tissues (1.47 ± 0.29 RU) was also similar to that in PC tissues (1.48 ± 0.29 RU). KIF1B protein and mrna expression did not significantly differ between HCC and PC tissues (Figure 1). Correlation between KIF1B expression and clinicopathologic features KIF1B protein expression in HCC tissues with vein invasion was significantly lower than in those without vein invasion (2.30 ± 0.82 RU vs 2.77 ± 0.84 RU, P = 0.033). KIF1B mrna expression in HCC tissues with vein invasion (1.41 ± 0.25 RU) was also lower than in those without vein invasion (1.50 ± 0.30 RU), but not significantly so. However, ratios of KIF1B mrna expression in HCC/adjacent PC tissues with vein invasions were significantly lower than those without vein invasions (0.89 ± 0.29 RU vs 1.11 ± 0.33 RU, P = 0.009). KIF1B protein levels in HCC tissues from patients who experienced recurrence during the follow-up were significantly lower than in those without recurrence (2.31 ± 0.92 RU vs 2.80 ± 0.80 RU, P = 0.022). KIF1B mrna levels were slightly lower, but not significantly so, in the recurrence group. Ratios of HCC/PC KIF1B mrna expression in patients with recurrence during the follow-up were significantly lower than those without recurrence (0.96 ± 0.31 vs 1.11 ± 0.29, P = 0.043). There was no association between KIF1B protein or mrna expression and other clinicopathologic parameters, including patient age, sex, hepatitis B virus, liver function, tumor differentiation, tumor size, and number of tumor nodules (Table 1). Bivariate correlations were used to analyze the 8420 July 21, 2015 Volume 21 Issue 27

215 Yang SZ et al. KIF1B expression in HCC patients Table 1 Kinesin family member 1B expression in cancer and paracarcinomatous tissues according to clinicopathologic features in 68 patients with hepatocellular carcinoma Clinicopathologic feature n KIF1B protein, relative units KIF1B mrna, relative units HCC tissue PC tissue HCC/PC HCC tissue PC tissue HCC/PC Age (yr) ± ± ± ± ± ± 0.05 < ± ± ± ± ± ± 0.35 Sex Male ± ± ± ± ± ± 0.31 Female ± ± ± ± ± ± 0.37 Child classification A ± ± ± ± ± ± 0.32 B ± ± ± ± ± ± 0.27 Hepatitis B virus Positive ± ± ± ± ± ± 0.30 Negative ± ± ± ± ± ± 0.37 Differentiation Well ± ± ± ± ± ± 0.33 Moderately ± ± ± ± ± ± 0.30 Poorly ± ± ± ± ± ± 0.30 Tumor size (cm) > ± ± ± ± ± ± ± ± ± ± ± ± 0.31 Tumor nodule Solitary ± ± ± ± ± ± 0.31 Multiple ± ± ± ± ± ± 0.32 Vein invasion Positive ± ± ± ± ± ± 0.29 Negative ± 0.84 a 2.40 ± ± ± ± ± 0.33 b Recurrence status Yes ± ± ± ± ± ± 0.31 No ± 0.80 c 2.17 ± ± ± ± ± 0.29 c a P < 0.05, b P < 0.01 vs positive vein invasion; c P < 0.05 vs recurrence. KIF1B: Kinesin family member 1B; PC: Paracarcinomatous; HCC: Hepatocellular carcinoma. association between survival time and KIF1B protein and mrna. Ratios of KIF1B mrna expression in HCC/ adjacent PC tissues were correlated with OS and DFS, with respective Pearson correlations of and (P < for both). Kaplan-Meier survival curves and log-rank tests showed that downregulation of KIF1B mrna in HCC tissues was associated with poor prognosis. Median OS for the downregulated group was 13.5 mo, significantly shorter than for the upregulated group at 20 mo (P < 0.05; Figure 2A). Median DFS for down- and upregulated groups were 11.5 mo and 19.5 mo, respectively (P < 0.05; Figure 2B). DISCUSSION KIF1B is located on chromosome 1p36, and belongs to the kinesin superfamily of intermediate filaments that is responsible for intracellular vesicular transport [23]. KIF1B encodes two alternatively spliced isoforms, KIF1Ba and KIF1Bb, and both isoforms form homodimers and transport mitochondria and synaptic vesicle precursors, respectively [24]. KIF1B has been shown to act as a tumor suppressor in multiple cancers, including aggressive neuroblastoma, pheochromocytoma, colon, liver, brain, breast, and other cancers, by acting on various inhibitors of cell proliferation and activators of apoptosis [25,26]. KIF1B knockdown in rat sympathetic neurons prevents apoptosis following nerve growth factor withdrawal, indicating that KIF1B plays a crucial role in neuronal apoptosis upon nerve growth factor limitation [27]. KIF1B is reportedly associated with gastric cancer invasion [28], which suggests that KIF1B has a function in cancer progression. Zhang et al [20] showed KIF1B contributed distinctly to the progression from chronic HBV infection to HCC. However, the exact function of KIF1B in HCC is unclear; conditional knockout models may be necessary to further investigate its role in hepatocarcinogenesis. KIF1B expression in HCC tissues and its relationship with tumor progression and prognosis are not widely reported. The present study found that KIF1B protein is expressed in cancer tissues and PC tissues of patients with HCC, with no significant differences in expression levels. There is no correlation between the expression level of KIF1B protein and mrna in HCC samples. Genetic polymorphisms and epigenetic factors may have contributed to the difference. An important result of the current study is that KIF1B protein expression is associated with vein invasion and tumor recurrence status. These factors are highly correlated with invasion and metastasis 8421 July 21, 2015 Volume 21 Issue 27

216 Yang SZ et al. KIF1B expression in HCC patients A 1.0 B 1.0 Overall survival Up-regulated expression of KIF1B mrna Down-regulated expression of KIF1B mrna Disease-free survival Up-regulated expression of KIF1B mrna Down-regulated expression of KIF1B mrna Time after surgery (mo) Time after surgery (mo) Figure 2 Survival of patients with hepatocellular carcinoma after surgical resection according to kinesin family member 1B (KIF1B) mrna expression. A: Overall survival; B: Disease-free survival (P < 0.05; log-rank test). of HCC [29-31]. The results indicate that more invasive tumors have lower KIF1B protein expression, and by extension, that KIF1B has a suppressive function in HCC. The results also show that there is no pattern for KIF1B protein expression when the subjects and their specimens are stratified by sex, age, liver function, HBV, number of tumor nodules, tumor size, and tumor differentiation. These factors might not affect KIF1B expression, or might do so only subtly. Unlike the protein results, KIF1B mrna expression had no correlation to any tested clinicopathologic features. Interestingly, ratios of KIF1B mrna expression in HCC/PC pairs are negatively correlated with OS and DFS. HCC patients were divided into two groups: patients with downregulated expression (higher KIF1B mrna expression in PC tissues than in HCC tissues) and those with upregulated expression (higher KIF1B mrna expression in HCC tissues than in PC tissues). The downregulated KIF1B mrna group had longer DFS than the upregulated KIF1B mrna group. In addition, patients with downregulated KIF1B mrna had increased risk of recurrence and significantly reduced OS. The results of the present study show that KIF1B is a liver cancer suppressor gene. KIF1B mrna levels may be prognostic biomarkers. In conclusion, this is the first investigation of KIF1B expression at both the protein and mrna levels in association with clinicopathologic features of HCC. Expression of KIF1B protein and mrna do not differ between HCC tissues and PC tissues. KIF1B protein levels in HCC tissues from patients with recurrence during the follow-up are significantly lower than in those without recurrence. HCC tissues with vein invasions have significantly lower KIF1B protein levels than those without vein invasions. Ratios of KIF1B mrna relative expression in HCC tissues to PC tissues correlate with OS and DFS. Based on the downregulation of KIF1B mrna in HCC, we propose that the manipulation of KIF1B expression in HCC patients might have therapeutic implications. However, related reports, especially on KIF1B functions and mechanisms of regulation in normal and HCC tissues, are limited and warrant further study. Further largescale clinical studies are needed to confirm whether KIF1B could serve as a liver cancer prognostic marker. COMMENTS Background An estimated new liver cancer cases and deaths occurred worldwide during 2012, with China alone accounting for approximately 50% of the total number of cases and deaths. Most hepatocellular carcinoma (HCC) patients are diagnosed beyond the stage at which surgical options are suitable, and thus have poor prognoses. However, patients at the same stage may have different prognoses because many factors affect outcomes, such as clinicopathologic parameters and emerging biomarkers. In this study, we explore how kinesin family member 1B (KIF1B) affects the long-term survival outcomes in patients with HCC who undergo surgical treatment. Research frontiers A single nucleotide polymorphism of KIF1B, rs , located at intron 24, is associated with susceptibility to hepatitis B virus-related HCC in a genomewide association stud, and several studies confirm that KIF1B affects the progression from infection to HCC. However, expression of KIF1B protein and mrna in tumors and paracarcinomatous tissues of HCC patients was not described in existing studies. The authors therefore retrospectively investigated the relationship between KIF1B expression and clinicopathologic parameters, and its predictive value for HCC prognosis. Innovations and breakthroughs KIF1B expression in HCC tissues and its relationship with tumor progression and prognosis are not widely reported. The present study found that KIF1B protein is expressed in cancer and paracarcinomatous tissues of patients with HCC, with no significant differences in expression levels. The authors observed no significant correlation between the expression level of KIF1B protein and mrna in HCC samples. Genetic polymorphisms and epigenetic factors may have contributed to the difference. An important result of the current study is that KIF1B protein expression is associated with vein invasion and tumor recurrence status. These factors are strongly correlated with invasion and metastasis of HCC. The results indicate that more invasive tumors have lower KIF1B protein expression, and by extension, that KIF1B has a suppressive function in HCC. Unlike the protein results, KIF1B mrna expression is not correlated to any tested clinicopathologic feature. Interestingly, correlation analysis showed that ratios of KIF1B mrna expression in HCC/paracarcinomatous pairs are negatively correlated with overall and disease-free survival. The downregulated KIF1B mrna group had longer disease-free survival than the upregulated KIF1B mrna group. In addition, patients with downregulated KIF1B mrna had increased risk of recurrence and significantly reduced overall survival July 21, 2015 Volume 21 Issue 27

217 Yang SZ et al. KIF1B expression in HCC patients Applications This study suggests that KIF1B is a liver cancer suppressor gene. KIF1B mrna levels may be prognostic biomarkers for HCC. Peer-review This is a good retrospective study in which the authors investigated the relationship between KIF1B expression and clinicopathologic parameters, and its predictive value for HCC prognosis. The results are interesting and suggest that KIF1B mrna levels may be prognostic biomarkers for HCC. REFERENCES 1 World Health Organization. Mortality Database. Updated Available from URL: mortality_data/en/ 2 Blum HE. Hepatocellular carcinoma: therapy and prevention. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 3 Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, CA Cancer J Clin 2015; 65: [PMID: DOI: /caac.21262] 4 Shariff MI, Cox IJ, Gomaa AI, Khan SA, Gedroyc W, Taylor- Robinson SD. Hepatocellular carcinoma: current trends in worldwide epidemiology, risk factors, diagnosis and therapeutics. Expert Rev Gastroenterol Hepatol 2009; 3: [PMID: DOI: /egh.09.35] 5 Miao R, Luo H, Zhou H, Li G, Bu D, Yang X, Zhao X, Zhang H, Liu S, Zhong Y, Zou Z, Zhao Y, Yu K, He L, Sang X, Zhong S, Huang J, Wu Y, Miksad RA, Robson SC, Jiang C, Zhao Y, Zhao H. Identification of prognostic biomarkers in hepatitis B virus-related hepatocellular carcinoma and stratification by integrative multiomics analysis. J Hepatol 2014; 61: [PMID: DOI: /j.jhep] 6 Liu L, Miao R, Yang H, Lu X, Zhao Y, Mao Y, Zhong S, Huang J, Sang X, Zhao H. Prognostic factors after liver resection for hepatocellular carcinoma: a single-center experience from China. Am J Surg 2012; 203: [PMID: DOI: / j.amjsurg] 7 Wan S, Civan J, Rossi S, Yang H. Profiling HBV integrations in hepatocellular carcinoma. Hepatobiliary Surg Nutr 2013; 2: [PMID: ] 8 Zhan P, Ji YN. Prognostic significance of TP53 expression for patients with hepatocellular carcinoma: a meta-analysis. Hepatobiliary Surg Nutr 2014; 3: [PMID: DOI: /j.issn ] 9 Zhan P, Ji YN, Yu LK. TP53 mutation is associated with a poor outcome for patients with hepatocellular carcinoma: evidence from a meta-analysis. Hepatobiliary Surg Nutr 2013; 2: [PMID: DOI: /j.issn ] 10 Ha SY, Song DH, Hwang SH, Cho SY, Park CK. Expression of prothymosin alpha predicts early recurrence and poor prognosis of hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int 2015; 14: [PMID: ] 11 Li JJ, Pan K, Gu MF, Chen MS, Zhao JJ, Wang H, Liang XT, Sun JC, Xia JC. Prognostic value of soluble MICA levels in the serum of patients with advanced hepatocellular carcinoma. Chin J Cancer 2013; 32: [PMID: DOI: /cjc ] 12 Xu C, Zeng XH, Wang L, Tao SQ, Wu QX, Zhu P, Deng GH, Wang YM. sfrp-4, a potential novel serum marker for chronic hepatitis B-related hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int 2015; 14: [PMID: ] 13 Yang L, Rong W, Xiao T, Zhang Y, Xu B, Liu Y, Wang L, Wu F, Qi J, Zhao X, Wang H, Han N, Guo S, Wu J, Gao Y, Cheng S. Secretory/releasing proteome-based identification of plasma biomarkers in HBV-associated hepatocellular carcinoma. Sci China Life Sci 2013; 56: [PMID: DOI: / s x] 14 Geng M, Cao YC, Chen YJ, Jiang H, Bi LQ, Liu XH. Loss of Wnt5a and Ror2 protein in hepatocellular carcinoma associated with poor prognosis. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 15 Sun Y, Yang H, Mao Y, Xu H, Zhang J, Li G, Lu X, Sang X, Zhao H, Zhong S, Huang J, Zhang H. Increased Golgi protein 73 expression in hepatocellular carcinoma tissue correlates with tumor aggression but not survival. J Gastroenterol Hepatol 2011; 26: [PMID: ] 16 Aida T, Bodell WJ. [Mechanism of cellular resistance to ACNU in rat brain tumor cell line]. Neurol Med Chir (Tokyo) 1986; 26: [PMID: DOI: /j.issn ] 17 Lo RC, Ng IO. Hepatocellular tumors: immunohistochemical analyses for classification and prognostication. Chin J Cancer Res 2011; 23: [PMID: DOI: /s ] 18 Zheng L, Liang P, Li J, Huang XB, Wang WW, Wang L, Feng H. Expression of BC protein in hepatocellular carcinoma and its relationship to prognosis. Chin J Cancer 2010; 29: [PMID: ] 19 Wang YL, Zhu ZJ, Teng DH, Yao Z, Gao W, Shen ZY. Glypican-3 expression and its relationship with recurrence of HCC after liver transplantation. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 20 Zhang H, Zhai Y, Hu Z, Wu C, Qian J, Jia W, Ma F, Huang W, Yu L, Yue W, Wang Z, Li P, Zhang Y, Liang R, Wei Z, Cui Y, Xie W, Cai M, Yu X, Yuan Y, Xia X, Zhang X, Yang H, Qiu W, Yang J, Gong F, Chen M, Shen H, Lin D, Zeng YX, He F, Zhou G. Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers. Nat Genet 2010; 42: [PMID: DOI: / ng.638] 21 Wang ZC, Gao Q, Shi JY, Yang LX, Zhou J, Wang XY, Shi YH, Ke AW, Shi GM, Ding ZB, Dai Z, Qiu SJ, Fan J. Genetic polymorphism of the kinesin-like protein KIF1B gene and the risk of hepatocellular carcinoma. PLoS One 2013; 8: e62571 [PMID: ] 22 Chinese Society of Hepatology, Chinese Medical Association; Chinese Society of Infectious Diseases, Chinese Medical Association. [The guidelines of prevention and treatment for chronic hepatitis B]. Zhonghua Ganzangbing Zazhi 2005; 13: [PMID: ] 23 Nangaku M, Sato-Yoshitake R, Okada Y, Noda Y, Takemura R, Yamazaki H, Hirokawa N. KIF1B, a novel microtubule plus enddirected monomeric motor protein for transport of mitochondria. Cell 1994; 79: [PMID: ] 24 MacAskill AF, Kittler JT. Control of mitochondrial transport and localization in neurons. Trends Cell Biol 2010; 20: [PMID: ] 25 Munirajan AK, Ando K, Mukai A, Takahashi M, Suenaga Y, Ohira M, Koda T, Hirota T, Ozaki T, Nakagawara A. KIF1Bbeta functions as a haploinsufficient tumor suppressor gene mapped to chromosome 1p36.2 by inducing apoptotic cell death. J Biol Chem 2008; 283: [PMID: DOI: /jbc. M ] 26 Strunze S, Engelke MF, Wang IH, Puntener D, Boucke K, Schleich S, Way M, Schoenenberger P, Burckhardt CJ, Greber UF. Kinesin- 1-mediated capsid disassembly and disruption of the nuclear pore complex promote virus infection. Cell Host Microbe 2011; 10: [PMID: DOI: /j.chom ] 27 Schlisio S, Kenchappa RS, Vredeveld LC, George RE, Stewart R, Greulich H, Shahriari K, Nguyen NV, Pigny P, Dahia PL, Pomeroy SL, Maris JM, Look AT, Meyerson M, Peeper DS, Carter BD, Kaelin WG. The kinesin KIF1Bbeta acts downstream from EglN3 to induce apoptosis and is a potential 1p36 tumor suppressor. Genes Dev 2008; 22: [PMID: DOI: / gad ] 28 Dong Z, Xu X, Du L, Yang Y, Cheng H, Zhang X, Li Z, Wang L, Li J, Liu H, Qu X, Wang C. Leptin-mediated regulation of MT1- MMP localization is KIF1B dependent and enhances gastric cancer cell invasion. Carcinogenesis 2013; 34: [PMID: July 21, 2015 Volume 21 Issue 27

218 Yang SZ et al. KIF1B expression in HCC patients DOI: /carcin/bgt028] 29 Tung-Ping Poon R, Fan ST, Wong J. Risk factors, prevention, and management of postoperative recurrence after resection of hepatocellular carcinoma. Ann Surg 2000; 232: [PMID: ] 30 Huang J. Current progress in epigenetic research for hepatocarcinomagenesis. Sci China C Life Sci 2009; 52: [PMID: DOI: /s ] 31 Shimada K, Sano T, Sakamoto Y, Kosuge T. A long-term followup and management study of hepatocellular carcinoma patients surviving for 10 years or longer after curative hepatectomy. Cancer 2005; 104: [PMID: DOI: /cncr.21461] P- Reviewer: El-Emshaty HM, Pinero F, Xu Y S- Editor: Qi Y L- Editor: AmEditor E- Editor: Zhang DN 8424 July 21, 2015 Volume 21 Issue 27

219 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Prospective Study ORIGINAL ARTICLE Parameters affecting different acoustic radiation force impulse applications in the diagnosis of fibrotic liver changes Sabrina Galgenmueller, Heike Jaeger, Wolfgang Kratzer, Stefan A Schmidt, Suemeyra Oeztuerk, Mark M Haenle, Richard A Mason, Tilmann Graeter Sabrina Galgenmueller, Wolfgang Kratzer, Suemeyra Oeztuerk, Mark M Haenle, Department of Internal Medicine I, University Hospital Ulm, Ulm, Germany Heike Jaeger, FASCIA Research, Division of Neurophysiology, Ulm, Germany Stefan A Schmidt, Tilmann Graeter, Department of Diagnostic and Interventional Radiology, University Hospital Ulm, Ulm, Germany Richard A Mason, Louis Stokes Cleveland Department of Veterans Affairs Medical Center, Cleveland, OH 44106, United States Author contributions: Galgenmueller S and Jaeger H contributed equally to this work; Kratzer W, Graeter T, Haenle MM, and Oeztuerk S designed the study; Galgenmueller S, Kratzer W, Graeter T, Haenle MM, Jaeger H, and Schmidt SA performed the research; Oeztuerk S analyzed the data; Galgenmueller S, Kratzer W, Mason RA, and Graeter T wrote the manuscript. Institutional review board statement: The study was reviewed and approved by the local ethics committee of the University of Ulm. Informed consent statement: Because of the retrospective and anonymous character of this study, the need for informed consent was waived by the institutional review board. Conflict-of-interest statement: The authors declare that are no conflicts of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Wolfgang Kratzer, Professor, Department of Internal Medicine I, University Hospital Ulm, Albert-Einstein- Allee 23, Ulm, Germany. wolfgang.kratzer@uniklinik-ulm.de Telephone: Fax: Received: January 29, 2015 Peer-review started: February 10, 2015 First decision: March 10, 2015 Revised: March 17, 2015 Accepted: April 17, 2015 Article in press: April 17, 2015 Published online: July 21, 2015 Abstract AIM: To analyze the virtual touch tissue quantification (VTTQ) and virtual touch imaging quantification (VTIQ) techniques, and identify possible factors that may influence VTTQ and VTIQ measurements. METHODS: One hundred and eighty-six (104 women/82 men) of 323 subjects met the inclusion criteria (age > 18 years, no history of chronic or gastrointestinal disease, body-mass index (BMI) < 30 kg/m², a fasting period of at least three hours, no history of hepatotoxic pharmaceuticals, alcohol consumption < 24 g/d in men and < 12 g/d in women, and normal findings upon ultrasound examination of the abdomen). Measurements were taken at depths of 50 mm with VTTQ, 15 mm and 25 mm with VTIQ in the right hepatic lobe, and at 15 mm with only VTIQ in the left hepatic lobe. The examiner acquired six measurements per position, thereby giving 24 measurements in total. RESULTS: The 95% confidence intervals of mean were 8425 July 21, 2015 Volume 21 Issue 27

220 Galgenmueller S et al. Elastography of liver tissue m/s for VTTQ and m/s, m/s, and m/s for VTIQ in a depth of 15 mm and 25 mm in the right hepatic lobe and 15 mm in the left hepatic lobe. Only superficial measurements in the right hepatic lobe with the VTIQ method exhibited an effect of age on shear wave velocity. Measurements acquired using the 6C1 probe with the VTTQ method showed no dependence on BMI. By comparison, BMI influenced measurements taken with the VTIQ method using the 9L4 probe in the superficial and deep areas of the right hepatic lobe, as well as in the left hepatic lobe (P = , P = , P = , respectively). Gender influenced measurements at depths of 50 mm with VTTQ and 25 mm with VTIQ in the right hepatic lobe (P = , P = ). Significant differences were found between measurements with the 6C1 (VTTQ) and 9L4 probes (VTIQ) (P = ), between superficial and deep measurements (P < ), and between the right and left lobes of the liver (P < ). CONCLUSION: Measurements in the right lobe and deep regions are preferable. Gender differences must be considered. BMI must be considered when assessing VTIQ technology. Key words: Acoustic radiation force impulse; Elasticity imaging techniques; Liver; Reference standards; Virtual touch imaging and quantification; Virtual touch tissue quantification; Ultrasonography The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Virtual touch tissue quantification (VTTQ) and virtual touch imaging and quantification (VTIQ) are two new elastographic techniques for estimating tissue stiffness. Both methods (VTTQ and VTIQ) allow a quantitative and non-invasive assessment of shear wave velocity. Shear wave speed quantification may be a diagnostic tool in the diagnosis of fibrotic liver changes. Therefore, standard values in healthy liver tissue must be generated. The objective of the present study is to analyze the VTTQ and VTIQ techniques. Possible factors that may influence VTTQ and VTIQ measurements were also studied. Galgenmueller S, Jaeger H, Kratzer W, Schmidt SA, Oeztuerk S, Haenle MM, Mason RA, Graeter T. Parameters affecting different acoustic radiation force impulse applications in the diagnosis of fibrotic liver changes. World J Gastroenterol 2015; 21(27): Available from: URL: com/ /full/v21/i27/8425.htm DOI: org/ /wjg.v21.i developed to facilitate the non-invasive assessment of tissue properties. These techniques fall into the categories of strain imaging, shear wave speed measurement, and shear wave speed imaging [1]. The advantage of the latter two categories lies in the quantitative assessment of shear wave velocity (SWV). A few studies have investigated the application of acoustic radiation force impulse (ARFI) shear wave speed quantification in the diagnosis of fibrotic liver changes and, in some cases, compared its findings with those of other diagnostic techniques, such as biopsy, serum liver function tests (LFTs), and transient elastography [2-4]. A meta-analysis of studies using liver biopsy as the reference quantified this ARFI method s diagnostic as 0.87 Area under Receiver Operating Characteristic Curve (AUROC) for the evaluation of significant liver fibrosis and 0.93 (AUROC) for the diagnosis of cirrhosis [5]. In addition, these studies have documented a good degree of reproducibility for these techniques [6,7]. Certain studies have established normal reference values for the Virtual Touch Tissue Quantification (VTTQ) technique using the Acuson S2000 in healthy children [8-10] and adults [7,11-20]. To date, use of the new ARFI technique of Virtual Touch Imaging Quantification (VTIQ) has only been described for normal mammary tissue [21]. Earlier elastographic techniques, such as quasistatic elastography, depend on a manual compression of the tissue to arrive at estimates of tissue stiffness [22]. New methods based on acoustic radiation force (ARF) permit such evaluation without the reliance on examiner-dependent pressure on the tissue. A shear wave perpendicular to the direction of propagation is produced by means of a brief high-intensity acoustic impulse. This wave is localized using tracking beams and a quantitative value in m/s is calculated [1,23]. The VTTQ technique permits the selection of an area of liver tissue, as defined in a region of interest (ROI), allowing measurements to a depth of up to 8.0 cm. The VTIQ method uses a moveable Q box quantification tool to select a defined region. A pulse sequence of 256 acquisition beam lines covers a width of 38 mm. Point shear wave elastography using the VTTQ method is performed in each of these regions [1]. Stiffer regions appear red, while softer regions appear blue in the resulting qualitative color elastogram. Using an ROI, a quantitative SWV in m/s can be measured at selected points (Figure 1). The objective of the present study is to analyze the VTTQ and VTIQ techniques, and assess the potential effects of factors such as age, gender, body-mass index (BMI), fasting time, use of oral contraceptive steroids, depth and position of measurement, and choice of probe. INTRODUCTION A variety of elastographic techniques have been MATERIALS AND METHODS Collective and study design Taking part in the study were 323 subjects, 186 of 8426 July 21, 2015 Volume 21 Issue 27

221 Galgenmueller S et al. Elastography of liver tissue Table 1 Standard-value collective with 186 subjects mean ± STD (Range) P value Women Men All (n = 104; 55.9%) (n = 82; 44.1%) (n = 186) Age (yr) ± ± ± ( ) ( ) ( ) BMI (kg/m 2 ) ± ± ± 2.14 < ( ) ( ) ( ) Liver size (mm) ± ± ± ( ) ( ) ( ) Figure 1 Virtual touch imaging quantification measurement in the right liver lobe at a depth of 15 mm and 25 mm from the liver capsule. whom met the inclusion criteria. Inclusion criteria included age > 18 years, no history of chronic or gastrointestinal disease, BMI < 30 kg/m 2, a fasting period of at least three hours, no history of hepatotoxic pharmaceuticals, alcohol consumption < 24 g/d in men and < 12 g/d in women, and normal findings upon ultrasound examination of the abdomen. The study was approved by the institutional ethics commission (Nr. 397/13) and subjects provided their written informed consent. Nine examiners performed ultrasound examinations using the convex (6C1 HD, MHz) and linear probes (9L4, MHz) of the Acuson S3000 (Siemens Medical Solutions, Mountain View, CA, United States). Measurements of the right hepatic lobe were performed using the VTTQ (6C1-probe) and VTIQ (9L4-probe) method. Subjects were placed in a supine position with an elevated right arm and suppressed respiration at breathing baseline. The probe was placed over the sixth or seventh intercostal space. Examiners initiated VTIQ measurement at a depth adjustment of 4.5 cm with minimum and maximum shear wave velocities of 0.5 m/s and 4.0 m/s, respectively. VTTQ measurements were performed at a depth of 5.0 cm beneath the skin surface, while VTIQ measurements were performed at 15 and 25 mm from the level of the liver capsule. In addition, a measurement at 15 mm was obtained in the left hepatic lobe with VTIQ. The 9L4 probe was therefore located beneath the xiphoid process in the cross section. A total of six measurements were acquired per position. Data analysis and statistical treatment Statistical analysis was performed using the SAS statistical software package (version 9.2, Cary, North Carolina). Results were presented as mean ± SD, median, and range for continuous variables. Normal distribution was tested using the Shapiro-Wilk test. Differences between two groups were identified using the t-test or Mann-Whitney U test. A one-way analysis of variance or Kruskal-Wallis test was performed to compare more than two groups. The relationship BMI: Body-mass index. Table 2 Association of the measurements with age, bodymass index, sex, and use of oral contraceptives between SWV and continuous variables were investigated using Spearman s correlation coefficient (r). All tests were two-sided. RESULTS 6C1-50 mmr 9L4-15 mmr P value 9L4-25 mmr 9L4-15 mml Age groups BMI groups Oral contraceptives Gender L4-15 mmr L4-25 mmr < L4-15 mml < < < R: Right liver lobe; L: Left liver lobe; 50 mm/25 mm/15 mm: Depth of measurement in millimeters; 6C1: Convex probe; 9L4: Linear probe; BMI: Body-mass index. Description of the collective A total of 186 subjects were enrolled in the study (104 women and 82 men). The mean age was ± years. A statistically significant difference was identified between women and men for BMI (P < ; Table 1). One subject underwent postmenopausal hormone replacement therapy and used a copper-based intrauterine device. Three subjects took an iron preparation. Three further volunteers had in the past taken L-thyroxine. SWV and age A significant correlation was not identified between age and SWV with the 6C1 or 9L4 probes at all depths (P > 0.05). After classification of age into four classes (n = 69, n = 57, n = 39, n = 21), only in the case of measurements at a depth of 15 mm in the right hepatic lobe was there a significant difference between the age groups (P = ; Table 2). The mean and standard deviation in this case stood at 1.29 ± July 21, 2015 Volume 21 Issue 27

222 Galgenmueller S et al. Elastography of liver tissue Table 3 Shear wave velocities of different age, body-mass index, and fasting groups and of women with and without oral contraceptives mean ± STD or median (range) (m/s) 6C1-50 mmr 9L4-15 mmr 9L4-25 mmr 9L4-15 mml Age group (yr) (n = 69) 1.28 ± ± ± ± ( ) 1.27 ( ) 1.18 ( ) 1.50 ( ) (n = 57) 1.28 ± ± ± ± ( ) 1.22 ( ) 1.23 ( ) 1.52 ( ) (n = 39) 1.25 ± ± ± ± ( ) 1.29 ( ) 1.18 ( ) 1.46 ( ) > 50 (n = 21) 1.19 ± ± ± ± ( ) 1.55 ( ) 1.17 ( ) 1.65 ( ) BMI group (kg/m 2 ) < (n = 30) 1.35 ± ± ± ± ( ) 1.39 ( ) 1.29 ( ) 1.59 ( ) (n = 30) 1.20 ± ± ± ± ( ) 1.34 ( ) 1.20 ( ) 1.51 ( ) (n = 36) 1.21 ± ± ± ± ( ) 1.19 ( ) 1.15 ( ) 1.47 ( ) (n = 28) 1.29 ± ± ± ± ( ) 1.25 ( ) 1.20 ( ) 1.59 ( ) (n = 24) 1.25 ± ± ± ± ( ) 1.16 ( ) 1.18 ( ) 1.36 ( ) (n = 20) 1.29 ± ± ± ± ( ) 1.31 ( ) 1.09 ( ) 1.52 ( ) > (n = 18) 1.26 ± ± ± ± ( ) 1.56 ( ) 1.16 ( ) 1.61 ( ) Fasting time (h) 3.0 (n = 54) 1.28 ± ± ± ± ( ) 1.22 ( ) 1.17 ( ) 1.54 ( ) (n = 66) 1.22 ± ± ± ± ( ) 1.34 ( ) 1.18 ( ) 1.51 ( ) 8.0 (n = 66) 1.28 ± ± ± ± ( ) 1.27 ( ) 1.21 ( ) 1.50 ( ) Oral contraceptives No (n = 63) 1.24 ± ± ± ± ( ) 1.40 ( ) 1.20 ( ) 1.54 ( ) Yes (n = 41) 1.20 ± ± ± ± ( ) 1.26 ( ) 1.22 ( ) 1.47 ( ) 6C1: Convex probe; 9L4: Linear Probe; STD: Standard deviation; R: Right liver lobe; L: Left liver lobe; 50 mm/25 mm/15 mm: Depth of measurement in millimeters; BMI: Body-mass index. m/s, 1.25 ± 0.25 m/s, 1.38 ± 0.32 m/s, and 1.57 ± 0.44 m/s for the individual age classes, respectively. The SWVs for the 6C1 probe and other depths with the 9L4 probe are given in Table 3. SWV and BMI A negative correlation was found between BMI and the measurements at 25 mm depth in the right hepatic lobe (r = , P ). No significant correlation could be detected at 5 cm, 15 mm in the right hepatic lobe and 15 mm in the left hepatic lobe (P = , P = , P = ). The subjects were divided into seven BMI classes containing 30, 30, 36, 28, 24, 20, and 18 volunteers, respectively. No statistically significant difference between the groups could be detected for the 6C1 probe (P = ). By contrast, the linear probe showed significant differences for all measurement positions (P = , P = , P = ; Table 3). SWV and fasting time Three hours fasting was reported by 54 subjects, while 66 subjects each reported fasting for or 8.0 h. No statistically significant differences between the groups could be identified for either probe at any of the measurement depths (P = , P = , P = , P = ; Table 3). SWV and oral contraceptives Forty-one of the 104 women participating in the study (39.4%) used oral contraceptive steroids. For measurements in the right hepatic lobe, there were no statistically significant differences between those who did and did not use oral contraceptives (P = , P = , P = ). By contrast, a statistically significant difference between the groups was identified for examination of the left hepatic lobe (P = ): here, women using oral contraceptives showed lower SWVs (1.45 ± 0.25 m/s vs 1.57 ± 0.32 m/s; Table 3). SWV and gender A significant difference between men and women was identified for the convex probe (P = ), with men 8428 July 21, 2015 Volume 21 Issue 27

223 Galgenmueller S et al. Elastography of liver tissue Table 4 Shear wave velocities in both men and women Women (n = 104) Men (n = 82) mean ± STD median (range) mean ± STD median (range) 6C1-50 mmr 1.22 (0.20) 1.18 ( ) 1.31 (0.20) 1.27 ( ) 9L4-15 mmr 1.34 (0.30) 1.30 ( ) 1.32 (0.31) 1.24 ( ) 9L4-25 mmr 1.23 (0.21) 1.21 ( ) 1.17 (0.21) 1.15 ( ) 9L4-15 mml 1.53 (0.30) 1.50 ( ) 1.52 (0.29) 1.52 ( ) 6C1: Convex probe; 9L4: Linear probe, STD: Standard deviation; R: Right liver lobe; L: Left liver lobe; 50 mm/25 mm/15 mm: Depth of measurement. SWV in m/s Table 5 Shear wave velocities of all subjects in the right and left liver lobe mean 95%CI mean STD median 95%CI median min-max (m/s) (m/s) (m/s) (m/s) (m/s) (m/s) 6C1-50 mmr L4-15 mmr L4-25 mmr L4-15 mml C1: Convex probe; 9L4: Linear probe; STD: Standard deviation; min: Minimum; max: Maximum; R: Right liver lobe, L: Left lifer lobe; 50 mm/25 mm/15 mm: Depth of measurement. exhibiting higher values. There was also a statistically significant difference with the 9L4 probe using the VTIQ technique at 25 mm (P = ), with higher values being observed in women. Neither the surface measurement at 15 mm depth of the right hepatic lobe nor the tissue measurements at 15 mm depth in the left hepatic lobe showed any statistically significant differences (P = , P = ; Table 4). SWV, probe, and measurement depth A highly significant correlation was detected for the VTTQ technique with the 6C1 probe in a depth of 5.0 cm under the skin and the VTIQ technique with the 9L4 probe at a depth of 25 mm under the liver capsule (r = ; P < ), as well as for measurements in the right and left hepatic lobes at 15 mm (r = ; P = ) with the VTIQ technique. The comparison of measurements at 15 mm using the linear probes and at 5.0 cm using the convex probe also showed a significant correlation (r = , P = ) in the right liver lobe. There was also a correlation for measurements at both 15 mm and 25 mm in the right hepatic lobe using the VTIQ technique of the linear probe (r = ; P = ). An overview of all median values, means, standard deviations, range, and minimum and maximum measurements with the VTTQ technique of the convex probe (6C1) and the VTIQ technique of the linear probe (9L4) are given in Table 5. Figure 2 shows the box-plot diagram of measurements with the two probes C1-50 mmr 9L4-15 mmr 9L4-25 mmr 9L4-15 mmr Figure 2 Box-plot diagram of the shear wave velocity for the two probes (6C1, 9L4) and the various depths in the right (R) and left (L) hepatic lobes. DISCUSSION A total of 186 healthy volunteers were examined with the VTTQ and VTIQ techniques using the Acuson S3000 scanner. Subjects with pathological changes or tumors of the liver were excluded from the study. According to EFSUMB guidelines, the probe was positioned intercostally for measurements in the right hepatic lobe [24]. For anatomical reasons, however, examination of the left hepatic lobe required an abdominal approach. With respect to positioning the patient for examination, no consensus has been reached. While some authors preferred to examine the liver with subjects lying on their left side [6,19], others performed the examination with subjects in a supine position [15,18]. Six measurements were acquired at each of the four positions. A defined number of measurements for reliable SWV determination has yet to be established [6-8,10-16,18-20,25]. A statistically significant difference in SWV was observed between women and men in measurements with the convex probe at a depth of 5.0 cm and with the linear probe at a depth of 25 mm. Studies of transient elastography also observed an effect of gender in SWV [26]. By contrast, studies with the VTTQ technique failed to demonstrate any dependence on gender [13,14,16,18-20]. However, with the exception of two studies [16,20], measurements were taken at a depth of cm under the capsule. The findings of the present study similarly failed to demonstrate any statistically significant difference at a depth of 15 mm. However, it must be noted that women and men included in the study collective differed significantly in terms of BMI (P < ), which can represent a source of error in calculations. A definitive statement on the dependence of SWV on gender is therefore not possible based on data from the present study. Investigations of the influence of BMI on measurements using the VTTQ technique have reported contradictory findings [12,14,15,20]. Data from the present 8429 July 21, 2015 Volume 21 Issue 27

224 Galgenmueller S et al. Elastography of liver tissue study concerning measurements using the 6C1 probe failed to demonstrate either a significant correlation between SWV and BMI (P = ) or statistically significant differences in SWV between the individual BMI classes (P = ). Study criteria, however, excluded subjects with a BMI > 30 kg/m² from the collective of subjects with normal values, and only 9.8% of the 186 participants exhibited a BMI > 25 kg/m². By contrast, when the 9L4 probe was used, an influence of BMI was detected at all measurement positions, and there was a tendency toward lower SWV values with higher BMI. In fact, at a depth of 25 mm, SWV s correlation with BMI was highly significant (P < ). Compared with the 6C1 probe, the 9L4 probe exhibited a more limited penetration into liver tissue. It is unclear whether the VTIQ, with its greater flow line, is more prone to artifacts, which may result in an underestimation of SWV at the margins of the measurement. Further research is required to elucidate these questions. Significantly lower SWV values were measured in the left hepatic lobe of women taking oral contraceptive steroids than in women not using hormonal contraception (P = ). Animal experiments have demonstrated a protective effect of female sex hormones on the formation of the extracellular matrix in the liver [27]. The relevance of these findings in humans remains unclear. Previous studies have failed to detect any influence of oral contraceptives on SWV [14]. Because of the increased scatter of values in the left hepatic lobe, measurements in the parenchyma of the right hepatic lobe are recommended [24,25]. In addition, the statistical significance of this finding was marginal; thus, its immediate clinical significance is questionable. Investigations of the effects of fasting time on measurements using VTTQ found an increase in SWV, especially in the first hour following food intake [13,28]. Following a time interval of three hours, however, no significant difference could be detected [28]. Similarly, data of the present study failed to detect any significant difference between the individual groups following a fasting period of at least three hours. Intra-individual variation in SWV of up to 0.3 m/s secondary to alimentary intake has been reported [13]. Measurements should therefore be acquired following a fasting period of at least three hours. At a depth of 25 mm, the median SWV values were higher for measurements acquired using the 6C1 probe compared with those obtained using the 9L4 probe (P = ). The standard deviations for the two probes, however, were quite similar. Comparable findings were reported in another study [11]. In that study, however, the scatter of the linear and convex probes differed. Similarly, at a depth of 3.0 cm, lower values were measured with the linear probe than with the convex probe. A comparison of the 6C1 probe with the 9L4 probe at a depth of 15 mm yielded higher values for the linear probe (P = ). This may be explained by the proximity of the liver capsule. The scatter of the values was also greater (0.30 vs 0.20). Thus, the 6C1 is to be preferred for measurements in deeper liver regions. Significantly higher SWV values were returned for measurements of the superficial hepatic parenchyma using the 9L4 probe than for measurements of deeper regions (P < ). In addition, significantly higher values were measured in the left hepatic lobe than on the right (P < ). Important factors include the liver capsule and the different physical characteristics of the ultrasound probes. In superficial regions there is also an increased risk of exerting pressure on the tissue with the probe tip. The anatomical position of the left hepatic lobe hinders visualization of the tissue and the measurement is affected by the pulsation of adjacent organs. An IQR < 30% is considered essential for the validity of the data [18,19]. For measurements at a depth of 15 mm in the right and left hepatic lobe, this yields values of 0.34 and These values were higher than comparable values in deeper regions (0.22; 0.27). A minimum distance from the capsule of > 15 mm is recommended for measurements using the VTIQ technique. In healthy volunteers, the 95%CI for the mean and median of the 6C1 and 9L4 probes stood at m/s; m/s and m/s; 1.17 m/ s-1.23 m/s, respectively. These data were below the established cut-off value of 1.34 m/s for diagnosis of high-grade liver fibrosis (F 2) [5]. In other studies, both higher and lower values were reported for mean ± SD, median, minimum, and maximum SWVs. It is therefore questionable whether SWV findings can be directly compared with other populations [7,20]. A limitation of the present study is the lack of laboratory data. Thus, subjects with unrecognized elevation of liver function tests could have been included in the study population. In addition, the validity of data was not secured using an SR of > 60% and an IQR of < 30%. However, unlike transient elastography, there are no corresponding guidelines from the manufacturer, to date. The reproducibility of the measurement method was also not investigated. The value of the VTTQ technique has already been shown in studies [6,7]. Corresponding investigations must now be performed for the VTIQ method. Due to lower dispersion, measurements in the right hepatic lobe and deep regions are preferable. Gender differences must be considered. The BMI must be considered when assessing VTIQ. The choice of probe affects the SWV in deep measurements. Further studies must be performed to confirm the results. COMMENTS Background Liver ultrasound elastography is one of the most recent acquisitions in the field of medical imaging. There are many approaches in liver elastography, based on different physical principles, but the goal remains the same: evaluation of liver elasticity, and thus assessment of liver fibrosis stage. Three main techniques 8430 July 21, 2015 Volume 21 Issue 27

225 Galgenmueller S et al. Elastography of liver tissue are now subjects for numerous studies: transient elastography, shear-wave elastography, and acoustic radiation force impulse imaging. Factors that may affect shear wave measurements are currently important topics of scientific research. Research frontiers Various factors affect the shear wave results and must be considered in applying the method. Innovations and breakthroughs Virtual touch tissue quantification (VTTQ) and virtual touch imaging quantification (VTIQ) are new elastographic techniques for estimating tissue stiffness. Both methods allow quantitative and non-invasive assessment of shear wave velocity. Shear wave speed quantification may be a diagnostic tool in the diagnosis of fibrotic liver changes. Therefore, standard values in healthy liver tissue must be generated. Applications Differences were found between measurements with convex and linear probes. Gender, BMI, and penetration influence the measurements. Terminology VTIQ utilizes acoustic push pulses and tracking beams that are sequenced across a user-defined region of interest in order to generate an elastogram depicting the relative stiffness of tissue. VTTQ utilizes an acoustic push pulse to generate shear waves through a user-placed region of interest. When detection pulses interact with a passing shear wave, they reveal the wave s location at a specific time, allowing calculation of the shear wave speed. This value is related to the stiffness of the tissue within the region of interest. Peer-review Many elastographic techniques have been developed to facilitate the noninvasive assessment of tissue properties. Just as the authors said: To date, use of the new ARFI technique of VTIQ has only been described for normal mammary tissue. This paper analyzed the VTTQ and VTIQ techniques and assessed the potential effects of various factors. The manuscript is well-written and guides the reader consequently throughout a profound framework of research data. The manuscript has a good revealed concept on the presented contexts. REFERENCES 1 Bamber J, Cosgrove D, Dietrich CF, Fromageau J, Bojunga J, Calliada F, Cantisani V, Correas JM, D Onofrio M, Drakonaki EE, Fink M, Friedrich-Rust M, Gilja OH, Havre RF, Jenssen C, Klauser AS, Ohlinger R, Saftoiu A, Schaefer F, Sporea I, Piscaglia F. EFSUMB guidelines and recommendations on the clinical use of ultrasound elastography. Part 1: Basic principles and technology. Ultraschall Med 2013; 34: [PMID: DOI: /s ] 2 Colombo S, Buonocore M, Del Poggio A, Jamoletti C, Elia S, Mattiello M, Zabbialini D, Del Poggio P. Head-to-head comparison of transient elastography (TE), real-time tissue elastography (RTE), and acoustic radiation force impulse (ARFI) imaging in the diagnosis of liver fibrosis. J Gastroenterol 2012; 47: [PMID: DOI: /s ] 3 Friedrich-Rust M, Wunder K, Kriener S, Sotoudeh F, Richter S, Bojunga J, Herrmann E, Poynard T, Dietrich CF, Vermehren J, Zeuzem S, Sarrazin C. Liver fibrosis in viral hepatitis: noninvasive assessment with acoustic radiation force impulse imaging versus transient elastography. Radiology 2009; 252: [PMID: DOI: /radiol ] 4 Takaki S, Kawakami Y, Miyaki D, Nakahara T, Naeshiro N, Murakami E, Tanaka M, Honda Y, Yokoyama S, Nagaoki Y, Kawaoka T, Hiramatsu A, Tsuge M, Hiraga N, Imamura M, Hyogo H, Aikata H, Takahashi S, Arihiro K, Chayama K. Non-invasive liver fibrosis score calculated by combination of virtual touch tissue quantification and serum liver functional tests in chronic hepatitis C patients. Hepatol Res 2014; 44: [PMID: DOI: /hepr.12129] 5 Friedrich-Rust M, Nierhoff J, Lupsor M, Sporea I, Fierbinteanu- Braticevici C, Strobel D, Takahashi H, Yoneda M, Suda T, Zeuzem S, Herrmann E. Performance of Acoustic Radiation Force Impulse imaging for the staging of liver fibrosis: a pooled meta-analysis. J Viral Hepat 2012; 19: e212-e219 [PMID: DOI: / j x] 6 Bota S, Sporea I, Sirli R, Popescu A, Danila M, Costachescu D. Intra- and interoperator reproducibility of acoustic radiation force impulse (ARFI) elastography--preliminary results. Ultrasound Med Biol 2012; 38: [PMID: DOI: / j.ultrasmedbio ] 7 D'Onofrio M, Gallotti A, Mucelli RP. Tissue quantification with acoustic radiation force impulse imaging: Measurement repeatability and normal values in the healthy liver. AJR Am J Roentgenol 2010; 195: [PMID: DOI: / AJR ] 8 Eiler J, Kleinholdermann U, Albers D, Dahms J, Hermann F, Behrens C, Luedemann M, Klingmueller V, Alzen GF. Standard value of ultrasound elastography using acoustic radiation force impulse imaging (ARFI) in healthy liver tissue of children and adolescents. Ultraschall Med 2012; 33: [PMID: DOI: /s ] 9 Hanquinet S, Courvoisier D, Kanavaki A, Dhouib A, Anooshiravani M. Acoustic radiation force impulse imaging-normal values of liver stiffness in healthy children. Pediatr Radiol 2013; 43: [PMID: DOI: /s ] 10 Lee MJ, Kim MJ, Han KH, Yoon CS. Age-related changes in liver, kidney, and spleen stiffness in healthy children measured with acoustic radiation force impulse imaging. Eur J Radiol 2013; 82: e290-e294 [PMID: DOI: /j.ejrad ] 11 Chang S, Kim MJ, Kim J, Lee MJ. Variability of shear wave velocity using different frequencies in acoustic radiation force impulse (ARFI) elastography: a phantom and normal liver study. Ultraschall Med 2013; 34: [PMID: ] 12 Goertz RS, Amann K, Heide R, Bernatik T, Neurath MF, Strobel D. An abdominal and thyroid status with Acoustic Radiation Force Impulse Elastometry--a feasibility study: Acoustic Radiation Force Impulse Elastometry of human organs. Eur J Radiol 2011; 80: e226-e230 [PMID: DOI: /j.ejrad ] 13 Goertz RS, Egger C, Neurath MF, Strobel D. Impact of food intake, ultrasound transducer, breathing maneuvers and body position on acoustic radiation force impulse (ARFI) elastometry of the liver. Ultraschall Med 2012; 33: [PMID: DOI: /s ] 14 Horster S, Mandel P, Zachoval R, Clevert DA. Comparing acoustic radiation force impulse imaging to transient elastography to assess liver stiffness in healthy volunteers with and without valsalva manoeuvre. Clin Hemorheol Microcirc 2010; 46: [PMID: ] 15 Jaffer OS, Lung PF, Bosanac D, Patel VM, Ryan SM, Heneghan MA, Quaglia A, Sidhu PS. Acoustic radiation force impulse quantification: repeatability of measurements in selected liver segments and influence of age, body mass index and liver capsuleto-box distance. Br J Radiol 2012; 85: e858-e863 [PMID: DOI: /bjr/ ] 16 Kaminuma C, Tsushima Y, Matsumoto N, Kurabayashi T, Taketomi-Takahashi A, Endo K. Reliable measurement procedure of virtual touch tissue quantification with acoustic radiation force impulse imaging. J Ultrasound Med 2011; 30: [PMID: ] 17 Gallotti A, D Onofrio M, Pozzi Mucelli R. Acoustic Radiation Force Impulse (ARFI) technique in ultrasound with Virtual Touch tissue quantification of the upper abdomen. Radiol Med 2010; 115: [PMID: DOI: /s ] 18 Madhok R, Tapasvi C, Prasad U, Gupta AK, Aggarwal A. Acoustic radiation force impulse imaging of the liver: measurement of the normal mean values of the shearing wave velocity in a healthy liver. J Clin Diagn Res 2013; 7: [PMID: DOI: /JCDR/2012/ ] 19 Popescu A, Sporea I, Sirli R, Bota S, Focşa M, Dănilă M, Nicoliţă D, Martie A, Sendroiu M, Juchiş A. The mean values of liver stiffness assessed by Acoustic Radiation Force Impulse elastography in normal subjects. Med Ultrason 2011; 13: [PMID: ] 8431 July 21, 2015 Volume 21 Issue 27

226 Galgenmueller S et al. Elastography of liver tissue 20 Son CY, Kim SU, Han WK, Choi GH, Park H, Yang SC, Choi JS, Park JY, Kim do Y, Ahn SH, Chon CY, Han KH. Normal liver elasticity values using acoustic radiation force impulse imaging: a prospective study in healthy living liver and kidney donors. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: /j x] 21 Golatta M, Schweitzer-Martin M, Harcos A, Schott S, Junkermann H, Rauch G, Sohn C, Heil J. Normal breast tissue stiffness measured by a new ultrasound technique: virtual touch tissue imaging quantification (VTIQ). Eur J Radiol 2013; 82: e676-e679 [PMID: DOI: /j.ejrad ] 22 Treece G, Lindop J, Chen L, Housden J, Prager R, Gee A. Realtime quasi-static ultrasound elastography. Interface Focus 2011; 1: [PMID: ] 23 Nightingale K. Acoustic Radiation Force Impulse (ARFI) Imaging: a Review. Curr Med Imaging Rev 2011; 7: [PMID: DOI: / ] 24 Cosgrove D, Piscaglia F, Bamber J, Bojunga J, Correas JM, Gilja OH, Klauser AS, Sporea I, Calliada F, Cantisani V, D Onofrio M, Drakonaki EE, Fink M, Friedrich-Rust M, Fromageau J, Havre RF, Jenssen C, Ohlinger R, Săftoiu A, Schaefer F, Dietrich CF. EFSUMB guidelines and recommendations on the clinical use of ultrasound elastography. Part 2: Clinical applications. Ultraschall Med 2013; 34: [PMID: DOI: /s ] 25 Toshima T, Shirabe K, Takeishi K, Motomura T, Mano Y, Uchiyama H, Yoshizumi T, Soejima Y, Taketomi A, Maehara Y. New method for assessing liver fibrosis based on acoustic radiation force impulse: a special reference to the difference between right and left liver. J Gastroenterol 2011; 46: [PMID: DOI: /s ] 26 Roulot D, Czernichow S, Le Clésiau H, Costes JL, Vergnaud AC, Beaugrand M. Liver stiffness values in apparently healthy subjects: influence of gender and metabolic syndrome. J Hepatol 2008; 48: [PMID: DOI: /j.jhep ] 27 Yasuda M, Shimizu I, Shiba M, Ito S. Suppressive effects of estradiol on dimethylnitrosamine-induced fibrosis of the liver in rats. Hepatology 1999; 29: [PMID: DOI: /hep ] 28 Popescu A, Bota S, Sporea I, Sirli R, Danila M, Racean S, Suseanu D, Gradinaru O, Ivascu Siegfried C. The influence of food intake on liver stiffness values assessed by acoustic radiation force impulse elastography-preliminary results. Ultrasound Med Biol 2013; 39: [PMID: DOI: /j.ultrasmedbio ] P- Reviewer: Chen SJ S- Editor: Qi Y L- Editor: Rutherford A E- Editor: Ma S 8432 July 21, 2015 Volume 21 Issue 27

227 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Systematic review: Eosinophilic esophagitis in Asian countries SYSTEMATIC REVIEWS Yoshikazu Kinoshita, Norihisa Ishimura, Naoki Oshima, Shunji Ishihara Yoshikazu Kinoshita, Norihisa Ishimura, Naoki Oshima, Shunji Ishihara, Department of Gastroenterology and Hepatology, Shimane University School of Medicine, Izumo , Japan Author contributions: Kinoshita Y designed the study; Kinoshita Y, Ishimura N and Ishihara S performed the systematic literature search; Ishimura N and Oshima N performed the statistical calculations; Kinoshita Y and Ishihara S wrote the manuscript. Conflict-of-interest statement: The authors have no conflicts of interest to declare concerning this manuscript. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Yoshikazu Kinoshita, MD, PhD, Professor, Chairman, Department of Gastroenterology and Hepatology, Shimane University School of Medicine, 89-1, Enya, Izumo , Shimane, Japan. kinosita@med.shimane-u.ac.jp Telephone: Fax: Received: March 20, 2015 Peer-review started: March 21, 2015 First decision: April 23, 2015 Revised: May 12, 2015 Accepted: June 10, 2015 Article in press: June 10, 2015 Published online: July 21, 2015 Abstract AIM: to investigate the prevalence and the clinical characteristics of Asian patients with eosinophilic esophagitis. METHODS: We conducted a systematic search of the PubMed and Web of Science databases for original studies, case series, and individual case reports of eosinophilic esophagitis in Asian countries published from January 1980 to January We found 66 and 80 articles in the PubMed and Web of Science databases, respectively; 24 duplicate articles were removed. After excluding animal studies, articles not written in English, and meeting abstracts, 25 articles containing 217 patients were selected for analysis. RESULTS: Sample size-weighted mean values were determined for all pooled prevalence data and clinical characteristics. The mean age of the adult patients with eosinophilic esophagitis was approximately 50 years, and 73% of these patients were male. They frequently presented with allergic diseases including bronchial asthma, allergic rhinitis, food allergy, and atopic dermatitis. Bronchial asthma was the most frequent comorbid allergic disease, occurring in 24% of patients with eosinophilic esophagitis. Dysphagia was the primary symptom reported; 44% of the patients complained of dysphagia. Although laboratory blood tests are not adequately sensitive for an accurate diagnosis of eosinophilic esophagitis, endoscopic examinations revealed abnormal findings typical of this disease, including longitudinal furrows and concentric rings, in 82% of the cases. One-third of the cases responded to proton pump inhibitor administration. CONCLUSION: The characteristics of eosinophilic 8433 July 21, 2015 Volume 21 Issue 27

228 Kinoshita Y et al. Eosinophilic esophagitis in Asia esophagitis in Asian patients were similar to those reported in Western patients, indicating that this disease displays a similar pathogenesis between Western and Asian patients. Key words: Eosinophilic esophagitis; Allergy; Prevalence; Symptom; Endoscopy; Asia; Treatment The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: We conducted a systematic literature search of eosinophilic esophagitis in Asian countries. More than 200 patients with eosinophilic esophagitis were found, and their clinical characteristics were summarized. All clinical characteristics of the Asian patients, except for the prevalence of food impaction, were similar to those of Western patients. Eosinophilic esophagitis may share the same pathogenetic mechanisms between Asian and Western patients. Kinoshita Y, Ishimura N, Oshima N, Ishihara S. Systematic review: Eosinophilic esophagitis in Asian countries. World J Gastroenterol 2015; 21(27): Available from: URL: DOI: INTRODUCTION Eosinophilic esophagitis (EoE) is a chronic inflammatory esophageal disease that induces dense intra-epithelial infiltration of eosinophils in the esophageal mucosa [1,2]. Affected patients develop esophageal fibrostenotic complications after chronic inflammation and often suffer from dysphagia, swallowing discomfort, and heartburn. More than half of patients with EoE have concomitant atopic diseases, which may play a role in its development. The pathogenetic mechanism of EoE is considered to be a Th2-type chronic allergic reaction, primarily to food allergens, and IL-5, -13, and -15, eotaxin-3, periostin, and TGF-β are considered to be the principal participants in the development of EoE [3,4]. As with many allergic diseases, including bronchial asthma, the incidence and the prevalence of EoE have been shown to be rapidly increasing, with a reported incidence in Western countries ranging from 10 to 50 per individuals in the general population [5]. Published reports of EoE from Asian countries are limited, including only observational studies using a small sample size and case reports. Because of this limited information, the prevalence of EoE in Asian countries, as well as similarities and differences in regards to the clinical characteristics of affected patients, in Western and Asian countries have not been clarified. In the present study, we surveyed original publications and case reports of EoE from Asian countries and performed a systematic review. MATERIALS AND METHODS Systematic literature search Systematic searches of PubMed and Web of Science for reports published from January 1980 to January 2015 were conducted using the following search strings: [eosinophilic esophagitis] and ([Asia] or [Asian] or [Japan] or [Japanese] or [Korea] or [Korean] or [China] or [Chinese] or [Taiwan] or [India] or [Indian] or [Indonesia] or [Cambodia] or [Singapore] or [Sri Lanka] or [Thailand] or [Nepal] or [Pakistan] or [Bangladesh] or [Timor] or [Bhutan] or [Philippines] or [Brunei] or [Viet Nam] or [Malaysia] or [Myanmar] or [Maldives] or [Mongolia] or [Laos]). All articles written in English, including original articles, case series, and individual case reports, were analyzed. Data extraction and analysis Because we were interested in the prevalence and the clinical characteristics of EoE in Asian countries, we focused on the number of cases investigated via upper gastrointestinal endoscopy. In addition, we recorded possible accompanying atopic diseases, symptoms, laboratory test results, endoscopic findings, and therapeutic responses. Statistical analysis Sample size-weighted mean values were determined for all pooled prevalence data and clinical characteristics. The statistical methods of this study were reviewed by Akira Yasuda, Department of Medical Informatics, Shimane University, Izumo, Japan. RESULTS Literature search The literature search identified 25 articles, including 8 case reports, that fulfilled the inclusion criteria for this review (Figure 1) [6-30]. Most studies were performed in Japan (n = 15), followed by Korea, Turkey, Saudi Arabia, China, and Taiwan. We did not find any reports from other Asian countries, including central and western Asian countries. Demographic characteristics The identified reports included a total of 217 Asian patients with EoE, of whom 73% were male. All studies except for 2 contained more males than females, although one report of 4 patients did not indicate their age or gender. The age of the patients in these studies ranged from 1 to 83 years, with a mean age of 40.4 years, and the mean age of the adult patients was approximately 50 years (Figure 2). Prevalence of EoE Nine studies investigated the prevalence of EoE in upper gastrointestinal cases investigated via endoscopy. Of cases in which endoscopy was used, EoE was 8434 July 21, 2015 Volume 21 Issue 27

229 Kinoshita Y et al. Eosinophilic esophagitis in Asia PubMed (n = 66) Web of science (n = 80) Duplicates removed (n = 24) Studies retrieved for detailed evaluation (n = 122) Removed after detailed evaluations including those with only animal data, confusing or duplicate data, from non- Asian countries, not written in English, without adequate information, or review articles of abstracts (n = 97) Relavant studies (n = 25) Figure 1 Flow chart of our systematic literature search. No Mean age of patients reported Authors Fujiwara 2002 [6] Furuta 2006 [7] Lu 2008 [8] Kim 2010 [9] Hasosah 2011 [10] Abe 2011 [11] Fujishiro 2011 [12] Kinoshita 2012 [13] Shi 2012 [14] Joo 2012 [15] Fujiwara 2012 [16] Bakirtaş 2012 [17] Fukuchi 2012 [18] Kinoshita 2013 [19] Al-Hussaini 2013 [20] Tomomatsu 2013 [21] Lee 2013 [25] Altun 2013 [23] Fujiwara 2013 [24] Lee 2013 [22] Abe 2014 [26] Shimura 2014 [27] Hori 2014 [28] Imai 2014 [29] Kondo 2015 [30] Total Age (yr) Figure 2 Number of patients with eosinophilic esophagitis in all 25 studies included in this review. The dots indicate the mean age, and the dot size indicates the number of patients. One report did not describe the ages of the included patients July 21, 2015 Volume 21 Issue 27

230 Kinoshita Y et al. Eosinophilic esophagitis in Asia Prevalence of EoE (patients/10 5 endoscopy-investigated cases) Korea 2011 Saudi Arabia 2013 Japan 2014 Japan 2013 Japan 2014 Japan 2012 Japan Number of cases investigated using endoscopy 2012 China 2011 Japan 50% 40% 30% 20% 10% 0% Dysphagia Heartburn Epigastralgia Failure to thrive Vomiting Chest pain Food impaction Regurgitation Abdominal pain Back pain Figure 5 Symptoms reported by patients with eosinophilic esophagitis. Twenty-four articles contained descriptions of symptoms reported by patients. The most frequently reported symptom was dysphagia, followed by heartburn. Figure 3 Reported prevalence of eosinophilic esophagitis in patients examined via upper gastrointestinal endoscopy. In the studies using a smaller sample size, the prevalence of eosinophilic esophagitis (EoE) was higher. Different indication criteria for endoscopic examination between institutions may be partially responsible for the large variation in the reported incidence of EoE. 30% 20% 10% 0% Bronchial asthma Allergic rhinitis Food allergy Atopic dermatitis Figure 4 Allergic diseases reported by patients with eosinophilic esophagitis. Twenty-one articles contained descriptions of the histories of allergic diseases among the reported patients. The most frequently reported allergic disease was bronchial asthma, followed by allergic rhinitis. found in 77 cases. The reported prevalence of EoE in these studies displayed wide variability, from 17 to 6557 per 10 5 endoscopy-investigated cases. However, the possibility of inclusion bias in the studies using a small sample size should be considered, as the studies using a small sample size showed a higher prevalence of EoE (Figure 3). Two studies that included more than endoscopy-investigated cases showed an EoE prevalence of approximately 20 in 10 5 cases, suggesting a lower prevalence in Asian countries than in Western countries. No studies investigated the population-based prevalence or incidence of EoE in Asian countries. History of allergic diseases A history of allergic diseases was reported for 175 cases (Figure 4). Bronchial asthma was reported in 42 patients, allergic rhinitis in 39 patients, food allergies in 23 patients, and atopic dermatitis in 20 patients. More than 50% of the patients with EoE had some type of allergic disease or a medical history of an allergic disease. Symptoms reported by patients Symptoms were reported in 213 cases (Figure 5), and multiple symptoms were often noted. Dysphagia and/or swallowing discomfort, the most frequently noted symptoms, were reported by 93 patients. Other reported symptoms included heartburn (n = 47), epigastralgia (n = 24), failure to thrive (n = 20, only pediatric cases), vomiting (n = 13), chest pain (n = 11), food impaction (n = 9), regurgitation (n = 8), abdominal pain (n = 6), and back pain (n = 4). Of the 40 pediatric cases, 18 reported dysphagia or swallowing discomfort. Laboratory test results The possible presence of peripheral blood eosinophilia was reported in 102 patients, 34 (33%) of whom had eosinophilia (> 500 eosinophils/μl), although highgrade eosinophilia (> 1000 eosinophils/μl) was rarely encountered. The total serum IgE concentration was reported for 76 cases, of which 45 (59%) of the cases displayed elevated IgE levels. Serum anti-helicobacter pylori (H. pylori) IgG antibody levels were reported for 24 patients, although only 4 (17%) were found to be infected by H. pylori, suggesting a lower rate of infection in EoE cases than in healthy individuals. Endoscopy Endoscopic findings were reported for 188 patients (Figure 6), of whom 154 (82%) had some endoscopic abnormalities suggesting the presence of EoE, 8436 July 21, 2015 Volume 21 Issue 27

231 Kinoshita Y et al. Eosinophilic esophagitis in Asia 60% 50% 40% 30% 20% 10% 0% Furrows Plaques Rings Edema Erythema Erosion Loss of vascular pattern Cobblestone Others Figure 6 Endoscopic abnormalities found in patients with eosinophilic esophagitis. Longitudinal furrows, white plaques, and fixed/transient concentric rings were most frequently detected. including furrows, concentric rings, and white plaques. Longitudinal furrows were the most frequently reported abnormality, observed in 52% of the patients, followed by white plaques and concentric rings. Shimura and coworkers investigated the sensitivity and the specificity of various endoscopic abnormalities in Asian patients and found that longitudinal furrows corresponded to the highest positive and negative predictive values [27]. Non-specific findings such as edema, erythema, and decreased visibility of the vasculature were reported in a small number of patients. Regarding the histological diagnosis of EoE, 7 studies employed 20 or 24 eosinophils/high power field as the minimal threshold to indicate eosinophil infiltration for EoE diagnosis. In the remaining studies, the patients were diagnosed with histological EoE when 15 or more eosinophils/high power field were found in esophageal mucosa biopsy specimens. Eosinophil micro-abscess, fibrosis in the esophageal sub-epithelial layer, and infiltration of other immunocytes into the epithelial layer have been reported to be possible characteristic histological findings of EoE, although these histological abnormalities were not used for the diagnosis of EoE in the collected publications. Additionally, the sites of biopsy sampling were not clearly described in the collected publications, despite that the sampling site may affect the sensitivity and the specificity of histological diagnosis. Therapeutic response Topical glucocorticoid therapy, elemental or elimination diet, and proton pump inhibitor (PPI) therapy were generally employed for the treatment of EoE. Some studies included PPI-responsive cases, whereas others excluded such cases. In 7 studies that included PPI-responsive cases, 23 of the 61 patients (38%) responded favorably to PPI administration and were diagnosed with PPI-responsive EoE (PPI-REE) according to the 2011 Eosinophilic Esophagitis Updated Consensus Recommendations [1]. All symptomatic patients with EoE were reported to be successfully treated via glucocorticoid or PPI administration or dietary therapy. A small number of patients had negligible symptoms that did not require therapeutic intervention or experienced spontaneous disease remission, at least temporarily, without any treatment. None of the reported patients required balloon dilatation treatment for esophageal stenosis. DISCUSSION Our review of the literature identified over 200 patients with EoE in Asian countries during the search period. An increasing trend of publication was observed since 2011, as 21 of the 25 studies surveyed were published after The age and gender ratios of the reported cases in Asian countries were very similar to those reported in Western countries [1,2,31], although the reason for the male preponderance of EoE has yet to be clarified. The prevalence of EoE in Asian countries has not been appropriately investigated via population studies, in contrast to the studies performed in Western countries [5,32]. The prevalence of cases that utilized endoscopy varied remarkably among the studies reviewed here (Figure 3), and this variability may be partially due to the different indications for which upper gastrointestinal endoscopy is used and partially because of different levels of familiarity with EoE among endoscopists in different countries. In Western countries, EoE has been reported to be found in approximately 1 out of 200 endoscopy examinations [33,34]. In contrast, studies using large a sample size performed in Asian countries have reported EoE in approximately 1 out of 5000 endoscopy examinations, indicating a much lower prevalence of EoE [12,14]. Because the accessibility of and the indication for endoscopic examination are known to differ between Western and Asian countries, a direct comparison of the EoE prevalence based on endoscopic findings between these 2 regions of the world is difficult. We believe that population-based studies in Asian countries are needed. Similar to Western EoE patients, Asian EoE patients frequently presented with comorbid atopic and allergic diseases [1,2,31]. In both regions, bronchial asthma has been shown to be the allergic disease most frequently associated with EoE. Thus, the atopic condition is considered to be at least partially involved in the development of EoE not only in Western countries but also in Asian countries. The occurrence of allergic diseases may be prevented by bacterial or parasitic infections [35,36]. In Western countries, the infection rate of H. pylori is reported to be lower in patients with EoE [33,37], and in the Asian EoE patients, eosinophilic 8437 July 21, 2015 Volume 21 Issue 27

232 Kinoshita Y et al. Eosinophilic esophagitis in Asia gastrointestinal diseases were reported to be infrequently accompanied by H. pylori infection [38,39]. The infection rate observed in the present review also suggests a lower rate of H. pylori infection in Asian EoE patients than in the general Asian population. For accurate diagnosis of EoE, a biopsy performed via upper gastrointestinal endoscopy is absolutely necessary. The presence of characteristic symptoms and endoscopic abnormalities is important for determining whether biopsy specimens should be collected. Dysphagia, the most frequently reported symptom of EoE in both Asian and Western countries, was found in nearly half of the patients reported in the studies covered by this review. Alternatively, food impaction was reported in less than 5% of Asian EoE cases, and this value was lower than that in Western countries [40,41]. Endoscopy revealed longitudinal furrows in half of the Asian patients; thus, longitudinal furrows were the most frequently observed endoscopic abnormality in both Asian and Western EoE patients [42-44]. As in Western studies, more than 80% of the Asian EoE patients showed endoscopic abnormalities characteristic of EoE, including longitudinal furrows, plaques, and concentric rings. These findings clearly indicate that Western and Asian EoE patients share similar symptoms and endoscopic abnormalities. This information is important for the accurate diagnosis of EoE. However, in Asian patients, fixed concentric rings/stenosis were not frequently found, although transient concentric rings were reported [12,19,27]. The rarity of fixed concentric rings in Asian EoE patients is reasonable given the observation that food impaction is a rare symptom reported by Asian patients with EoE. The low grade of inflammation and the early stage of EoE disease at the time of diagnosis in Asian patients may be responsible for these differences in the clinical characteristics of EoE between Asian and Western patients. EoE can be divided into two types, EoE and PPI- REE, based on the response of the disease to PPI administration. When administration of a PPI results in the resolution of EoE together with endoscopic abnormalities and symptoms, the appropriate diagnosis is PPI-REE [1,2]. Alternatively, when a response to a PPI is not observed, the patient should be diagnosed with EoE according to the consensus of the published recommendations [1,2]. However, some investigators have questioned the appropriateness of this classification. PPI-REE and EoE do not differ in regards to their clinical, endoscopic, or histological characteristics [45-47], and the messenger RNA expression profile in the esophageal mucosa of PPI-REE and EoE cases has been reported to be nearly identical [48]. In addition, PPIs have recently been shown to suppress Th2-type inflammatory responses, which are important for the development of EoE [49,50]. Together, these findings suggest the limited importance and difficultly of PPI responsiveness in the classification of EoE. As a result, some investigators included PPIresponsive EoE cases in their study population, whereas others did not. Seven studies covered by our review classified their study populations into PPI- REE and PPI-resistant EoE cases, and 23 (38%) of the 61 patients analyzed in those 7 reports exhibited PPI responsiveness. Although the percentage of PPI-REE cases reported by various studies differs remarkably in Western countries, 38% of the Asian cases were responsive to PPI administration, and this finding was generally similar to the results reported in Western countries [46,51,52]. Additionally, PPI-resistant EoE patients in Asian countries were reported to be successfully treated via administration of glucocorticoid or dietary therapies, as has been reported in Western countries. In summary, patients with EoE in Asian countries share similar clinical, endoscopic, and histopathological characteristics to those reported in Western countries, although the prevalence of EoE is lower in Asia. Onethird of the Asian EoE patients responded favorably to PPI administration, whereas the others showed a good response to glucocorticoid or dietary therapy; these results were identical to those reported in Western countries. We conclude that EoE patients in Asian countries exhibit similar characteristics to those in Western countries. COMMENTS Background The prevalence of eosinophilic esophagitis (EoE), a disease that is primarily caused by food allergies, is rapidly increasing in Western countries. EoE decreases health-related quality of life by causing dysphagia. The prevalence of EoE was reported to be approximately 50 per 100,000 individuals in the USA. However, the prevalence, the incidence, and the clinical characteristics of Asian patients with EoE have not been thoroughly investigated. Research frontiers Based on twin studies, the role of genetic factors in the development of EoE is approximately 20%. Therefore, with the westernization of social environments in Asian countries, EoE is expected to increase in a manner similar to that in Western countries. Accordingly, the prevalence and the clinical characteristics of Asian EoE patients need to be summarized and compared with those of Western EoE patients. Innovations and breakthroughs We have conducted a systematic literature search for studies on Asian patients with EoE. More than 200 such patients were found in the literature. The prevalence of EoE in Asian countries is lower than that reported in Western countries. The clinical characteristics of EoE are similar between Asian and Western countries, and common pathogenetic mechanisms are suggested. Possibly because of the lower grade of inflammation or the early stage of EoE at the time of diagnosis in Asian patients, endoscopic abnormalities and symptoms associated with EoE were less frequently observed in Asian patients than in Western patients. Applications The results of this study suggest that information concerning Western patients with EoE can be applied to Asian patients with EoE and that similar treatment strategies used in Western patients can be administered to Asian patients. Terminology The eosinophil is a type of leukocyte that increases and accumulates in allergic diseases. These cells, together with other inflammatory cells, cause inflammation in the esophageal mucosa, resulting in unpleasant symptoms. Dysphagia, or difficulty in swallowing, is the symptom most frequently reported by patients with EoE. Dysphagia significantly decreases patient quality of life. Peer-review Endoscopy examination is more popular in Asian countries, however, the 8438 July 21, 2015 Volume 21 Issue 27

233 Kinoshita Y et al. Eosinophilic esophagitis in Asia diagnosis of EoE is rare than that in Western countries. The authors reviewed the clinical characteristics of Asian EoE patients, which is helpful for the understanding of this disease in the East. REFERENCES 1 Liacouras CA, Furuta GT, Hirano I, Atkins D, Attwood SE, Bonis PA, Burks AW, Chehade M, Collins MH, Dellon ES, Dohil R, Falk GW, Gonsalves N, Gupta SK, Katzka DA, Lucendo AJ, Markowitz JE, Noel RJ, Odze RD, Putnam PE, Richter JE, Romero Y, Ruchelli E, Sampson HA, Schoepfer A, Shaheen NJ, Sicherer SH, Spechler S, Spergel JM, Straumann A, Wershil BK, Rothenberg ME, Aceves SS. Eosinophilic esophagitis: updated consensus recommendations for children and adults. J Allergy Clin Immunol 2011; 128: 3-20.e6; quiz [PMID: DOI: /j.jaci ] 2 Dellon ES, Gonsalves N, Hirano I, Furuta GT, Liacouras CA, Katzka DA; American College of Gastroenterology. ACG clinical guideline: Evidenced based approach to the diagnosis and management of esophageal eosinophilia and eosinophilic esophagitis (EoE). Am J Gastroenterol 2013; 108: ; quiz 693 [PMID: DOI: /ajg ] 3 Rothenberg ME. Molecular, genetic, and cellular bases for treating eosinophilic esophagitis. Gastroenterology 2015; 148: [PMID: DOI: /j.gastro ] 4 Wechsler JB, Bryce PJ. Allergic mechanisms in eosinophilic esophagitis. Gastroenterol Clin North Am 2014; 43: [PMID: DOI: /j.gastro ] 5 Prasad GA, Alexander JA, Schleck CD, Zinsmeister AR, Smyrk TC, Elias RM, Locke GR, Talley NJ. Epidemiology of eosinophilic esophagitis over three decades in Olmsted County, Minnesota. Clin Gastroenterol Hepatol 2009; 7: [PMID: DOI: /j.cgh ] 6 Fujiwara H, Morita A, Kobayashi H, Hamano K, Fujiwara Y, Hirai K, Yano M, Naka T, Saeki Y. Infiltrating eosinophils and eotaxin: their association with idiopathic eosinophilic esophagitis. Ann Allergy Asthma Immunol 2002; 89: [PMID: ] 7 Furuta K, Adachi K, Kowari K, Mishima Y, Imaoka H, Kadota C, Koshino K, Miyake T, Kadowaki Y, Furuta K, Kazumori H, Sato S, Ishihara S, Amano Y, Honda M, Kinoshita Y. A Japanese case of eosinophilic esophagitis. J Gastroenterol 2006; 41: [PMID: ] 8 Lu HC, Lu CL, Chang FY. Eosinophilic esophagitis in an asymptomatic Chinese. J Chin Med Assoc 2008; 71: [PMID: DOI: /S (08) ] 9 Kim NI, Jo Y, Ahn SB, Son BK, Kim SH, Park YS, Kim SH, Ju JE. A case of eosinophilic esophagitis with food hypersensitivity. J Neurogastroenterol Motil 2010; 16: [PMID: DOI: /jnm ] 10 Hasosah MY, Sukkar GA, Alsahafi AF, Thabit AO, Fakeeh ME, Al-Zahrani DM, Satti MB. Eosinophilic esophagitis in Saudi children: symptoms, histology and endoscopy results. Saudi J Gastroenterol 2011; 17: [PMID: DOI: / ] 11 Abe Y, Iijima K, Ohara S, Koike T, Ara N, Uno K, Asano N, Imatani A, Kato K, Shibuya D, Shimosegawa T. A Japanese case series of 12 patients with esophageal eosinophilia. J Gastroenterol 2011; 46: [PMID: DOI: / s ] 12 Fujishiro H, Amano Y, Kushiyama Y, Ishihara S, Kinoshita Y. Eosinophilic esophagitis investigated by upper gastrointestinal endoscopy in Japanese patients. J Gastroenterol 2011; 46: [PMID: DOI: /s ] 13 Kinoshita Y, Furuta K, Ishimura N, Ishihara S. Elevated plasma cytokines in Japanese patients with eosinophilic esophagitis and gastroenteritis. Digestion 2012; 86: [PMID: DOI: / ] 14 Shi YN, Sun SJ, Xiong LS, Cao QH, Cui Y, Chen MH. Prevalence, clinical manifestations and endoscopic features of eosinophilic esophagitis: a pathological review in China. J Dig Dis 2012; 13: [PMID: DOI: /j x] 15 Joo MK, Park JJ, Kim SH, Kim KH, Jung W, Yun JW, Lee BJ, Kim JH, Yeon JE, Kim JS, Byun KS, Lee SW, Bak YT. Prevalence and endoscopic features of eosinophilic esophagitis in patients with esophageal or upper gastrointestinal symptoms. J Dig Dis 2012; 13: [PMID: DOI: /j x] 16 Fujiwara Y, Sugawa T, Tanaka F, Tatsuwaki H, Okuyama M, Hayakawa T, Yamamori K, Wada R, Ohtani K, Uno H, Tanigawa T, Watanabe Y, Tominaga K, Watanabe T, Takaishi O, Saeki Y, Nebiki H, Oshitani N, Sato H, Arakawa T. A multicenter study on the prevalence of eosinophilic esophagitis and PPI-responsive esophageal eosinophilic infiltration. Intern Med 2012; 51: [PMID: ] 17 Bakirtaş A, Arga M, Eğrıtaş O, Topal E, Sari S, Poyraz A, Dalgiç B, Demırsoy MS, Türktaş I. The first experience of eosinophilic esophagitis in Turkish children. Turk J Gastroenterol 2012; 23: 1-7 [PMID: ] 18 Fukuchi M, Sakurai S, Fukasawa T, Suzuki M, Naitoh H, Tabe Y, Kiriyama S, Horiuchi K, Yuasa K, Kuwano H. Two Janese patients with esophageal eosinophilia detected by routine medical examination. Esophagus 2012; 9: Kinoshita Y, Furuta K, Ishimaura N, Ishihara S, Sato S, Maruyama R, Ohara S, Matsumoto T, Sakamoto C, Matsui T, Ishikawa S, Chiba T. Clinical characteristics of Japanese patients with eosinophilic esophagitis and eosinophilic gastroenteritis. J Gastroenterol 2013; 48: [PMID: DOI: / s x] 20 Al-Hussaini A, Al-Idressi E, Al-Zahrani M. The role of allergy evaluation in children with eosinophilic esophagitis. J Gastroenterol 2013; 48: [PMID: DOI: /s ] 21 Tomomatsu Y, Yoshino J, Inui K, Wakabayashi T, Kobayashi T, Miyoshi H, Kosaka T, Yamamoto S, Torii Y. Clinical features of eosinophilic esophagitis: ten Japanese cases. Dig Endosc 2013; 25: [PMID: DOI: /j x] 22 Lee BE, Kim GH. Magnifying endoscopy with narrow band imaging and endoscopic ultrasonography for assessing eosinophilic esophagitis. J Neurogastroenterol Motil 2013; 19: [PMID: DOI: /jnm ] 23 Altun R, Akbas E, Yıldırım AE, Öcal S, Korkmaz M, Selcuk H. Frequency of eosinophilic esophagitis in patients with esophageal symptoms: a single-center Turkish experience. Dis Esophagus 2013; 26: [PMID: DOI: / j x] 24 Fujiwara Y, Tanigawa T, Yamagami H, Watanabe K, Tominaga K, Watanabe T, Arakawa T. Eosinophilic esophagitis-like endoscopic findings in patients with erosive esophagitis. Esophagus 2013; 10: Lee JH, Kim MJ, Kim JH, Youn YH, Kim N, Bak YT, Jo Y, Park H. Clinical analysis of primary eosinophilic esophagitis. J Neurogastroenterol Motil 2013; 19: [PMID: DOI: /jnm ] 26 Abe Y, Iijima K, Ohara S, Koike T, Kikuchi R, Kato K, Shibuya D, Inomata Y, Oikawa K, Ueno Y. Localized esophageal eosinophilia: Is it an early manifestation of eosinophilic esophagitis or a subtype of gastroesophageal reflux disease? Dig Endosc 2014; 26: [PMID: DOI: /den.12150] 27 Shimura S, Ishimura N, Tanimura T, Yuki T, Miyake T, Kushiyama Y, Sato S, Fujishiro H, Ishihara S, Komatsu T, Kaneto E, Izumi A, Ishikawa N, Maruyama R, Kinoshita Y. Reliability of symptoms and endoscopic findings for diagnosis of esophageal eosinophilia in a Japanese population. Digestion 2014; 90: [PMID: DOI: / ] 28 Hori K, Watari J, Fukui H, Tanaka J, Tomita T, Sakurai J, Kondo T, Oshima T, Toyoshima F, Yamasaki T, Okugawa T, Miwa H. Do endoscopic features suggesting eosinophilic esophagitis represent histological eosinophilia? Dig Endosc 2014; 26: [PMID: DOI: /den.12091] 29 Imai J, Suzuki T, Mine T, Imai Y. Radiographic findings of 8439 July 21, 2015 Volume 21 Issue 27

234 Kinoshita Y et al. Eosinophilic esophagitis in Asia eosinophilic esophagitis. Intern Med 2014; 53: [PMID: ] 30 Kondo T, Uehara T, Takada T, Terada K, Ikusaka M. Recurrent back pain of eosinophilic esophagitis. Am J Med 2015; 128: e1-e2 [PMID: DOI: /j.amjmed ] 31 Furuta GT, Liacouras CA, Collins MH, Gupta SK, Justinich C, Putnam PE, Bonis P, Hassall E, Straumann A, Rothenberg ME; First International Gastrointestinal Eosinophil Research Symposium (FIGERS) Subcommittees. Eosinophilic esophagitis in children and adults: a systematic review and consensus recommendations for diagnosis and treatment. Gastroenterology 2007; 133: [PMID: ] 32 Straumann A, Simon HU. Eosinophilic esophagitis: escalating epidemiology? J Allergy Clin Immunol 2005; 115: [PMID: ] 33 Ronkainen J, Talley NJ, Aro P, Storskrubb T, Johansson SE, Lind T, Bolling-Sternevald E, Vieth M, Stolte M, Walker MM, Agréus L. Prevalence of oesophageal eosinophils and eosinophilic oesophagitis in adults: the population-based Kalixanda study. Gut 2007; 56: [PMID: ] 34 Kapel RC, Miller JK, Torres C, Aksoy S, Lash R, Katzka DA. Eosinophilic esophagitis: a prevalent disease in the United States that affects all age groups. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 35 Ben-Ami Shor D, Harel M, Eliakim R, Shoenfeld Y. The hygiene theory harnessing helminths and their ova to treat autoimmunity. Clin Rev Allergy Immunol 2013; 45: [PMID: DOI: /s ] 36 Rautava S, Ruuskanen O, Ouwehand A, Salminen S, Isolauri E. The hygiene hypothesis of atopic disease--an extended version. J Pediatr Gastroenterol Nutr 2004; 38: [PMID: ] 37 Dellon ES, Peery AF, Shaheen NJ, Morgan DR, Hurrell JM, Lash RH, Genta RM. Inverse association of esophageal eosinophilia with Helicobacter pylori based on analysis of a US pathology database. Gastroenterology 2011; 141: [PMID: DOI: /j.gastro ] 38 Zhang L, Duan L, Ding S, Lu J, Jin Z, Cui R, McNutt M, Wang A. Eosinophilic gastroenteritis: clinical manifestations and morphological characteristics, a retrospective study of 42 patients. Scand J Gastroenterol 2011; 46: [PMID: DOI: / ] 39 Furuta K, Adachi K, Aimi M, Ishimura N, Sato S, Ishihara S, Kinoshita Y. Case-control study of association of eosinophilic gastrointestinal disorders with Helicobacter pylori infection in Japan. J Clin Biochem Nutr 2013; 53: [PMID: DOI: /jcbn.13-15] 40 Hudson S, Sampson C, Muntz HR, Jackson WD, Smith ME. Foreign body impaction as presentation of eosinophilic esophagitis. Otolaryngol Head Neck Surg 2013; 149: [PMID: DOI: / ] 41 Sperry SL, Crockett SD, Miller CB, Shaheen NJ, Dellon ES. Esophageal foreign-body impactions: epidemiology, time trends, and the impact of the increasing prevalence of eosinophilic esophagitis. Gastrointest Endosc 2011; 74: [PMID: DOI: /j.gie ] 42 Müller S, Pühl S, Vieth M, Stolte M. Analysis of symptoms and endoscopic findings in 117 patients with histological diagnoses of eosinophilic esophagitis. Endoscopy 2007; 39: [PMID: ] 43 Kim HP, Vance RB, Shaheen NJ, Dellon ES. The prevalence and diagnostic utility of endoscopic features of eosinophilic esophagitis: a meta-analysis. Clin Gastroenterol Hepatol 2012; 10: e5 [PMID: DOI: /j.cgh ] 44 Hirano I, Moy N, Heckman MG, Thomas CS, Gonsalves N, Achem SR. Endoscopic assessment of the oesophageal features of eosinophilic oesophagitis: validation of a novel classification and grading system. Gut 2013; 62: [PMID: DOI: /gutjnl ] 45 Dranove JE, Horn DS, Davis MA, Kernek KM, Gupta SK. Predictors of response to proton pump inhibitor therapy among children with significant esophageal eosinophilia. J Pediatr 2009; 154: [PMID: DOI: /j.jpeds ] 46 Dellon ES, Speck O, Woodward K, Gebhart JH, Madanick RD, Levinson S, Fritchie KJ, Woosley JT, Shaheen NJ. Clinical and endoscopic characteristics do not reliably differentiate PPIresponsive esophageal eosinophilia and eosinophilic esophagitis in patients undergoing upper endoscopy: a prospective cohort study. Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ] 47 Moawad FJ, Schoepfer AM, Safroneeva E, Ally MR, Chen YJ, Maydonovitch CL, Wong RK. Eosinophilic oesophagitis and proton pump inhibitor-responsive oesophageal eosinophilia have similar clinical, endoscopic and histological findings. Aliment Pharmacol Ther 2014; 39: [PMID: DOI: /apt.12636] 48 Wen T, Dellon ES, Moawad FJ, Furuta GT, Aceves SS, Rothenberg ME. Transcriptome analysis of proton pump inhibitorresponsive esophageal eosinophilia reveals proton pump inhibitorreversible allergic inflammation. J Allergy Clin Immunol 2015; 135: [PMID: DOI: /j.jaci ] 49 Zhang X, Cheng E, Huo X, Yu C, Zhang Q, Pham TH, Wang DH, Spechler SJ, Souza RF. Omeprazole blocks STAT6 binding to the eotaxin-3 promoter in eosinophilic esophagitis cells. PLoS One 2012; 7: e50037 [PMID: DOI: /journal. pone ] 50 Cheng E, Zhang X, Huo X, Yu C, Zhang Q, Wang DH, Spechler SJ, Souza RF. Omeprazole blocks eotaxin-3 expression by oesophageal squamous cells from patients with eosinophilic oesophagitis and GORD. Gut 2013; 62: [PMID: DOI: /gutjnl ] 51 Molina-Infante J, Ferrando-Lamana L, Ripoll C, Hernandez- Alonso M, Mateos JM, Fernandez-Bermejo M, Dueñas C, Fernandez-Gonzalez N, Quintana EM, Gonzalez-Nuñez MA. Esophageal eosinophilic infiltration responds to proton pump inhibition in most adults. Clin Gastroenterol Hepatol 2011; 9: [PMID: DOI: /j.cgh ] 52 Vazquez-Elizondo G, Ngamruengphong S, Khrisna M, Devault KR, Talley NJ, Achem SR. The outcome of patients with oesophageal eosinophilic infiltration after an eight-week trial of a proton pump inhibitor. Aliment Pharmacol Ther 2013; 38: [PMID: DOI: /apt.12513] P- Reviewer: Hait EJ, Peixoto A, Zhuang ZH S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8440 July 21, 2015 Volume 21 Issue 27

235 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. Outcomes of robotic vs laparoscopic hepatectomy: A systematic review and meta-analysis META-ANALYSIS Roberto Montalti, Giammauro Berardi, Alberto Patriti, Marco Vivarelli, Roberto Ivan Troisi Roberto Montalti, Giammauro Berardi, Roberto Ivan Troisi, Department of General and Hepato-Biliary Surgery, Liver Transplantation Service, Ghent University Hospital and Medical School, 9000 Ghent, Belgium Roberto Montalti, Marco Vivarelli, Department of Gastroenterology and Transplantation Surgery, Polytechnic University of Marche-Ospedali Riuniti, Ancona, Italy Alberto Patriti, Division of General, Minimally Invasive and Robotic Surgery, General Hospital of Spoleto, Spoleto, Italy Author contributions: Montalti R and Berardi G contributed to acquisition of data, analysis and interpretation of data, drafting the article and final approval; Patriti A and Vivarelli M interpretated data, revised the article and made final approval; Troisi RI contributed to conception and design of the study, critical revision, final approval of the manuscript. Conflict-of-interest statement: The authors deny any conflict of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Roberto Ivan Troisi, MD, PhD, FEBS, Professor, Department of General and Hepato-Biliary Surgery, Liver Transplantation Service, Ghent University Hospital and Medical School, De Pintelaan 185, 2K12 IC, 9000 Ghent, Belgium. roberto.troisi@ugent.be Telephone: Fax: Received: January 11, 2015 Peer-review started: January 12, 2015 First decision: March 10, 2015 Revised: March 25, 2015 Accepted: May 7, 2015 Article in press: May 7, 2015 Published online: July 21, 2015 Abstract AIM: To perform a systematic review and metaanalysis on robotic-assisted vs laparoscopic liver resections. METHODS: A systematic literature search was performed using PubMed, Scopus and the Cochrane Library Central. Participants of any age and sex, who underwent robotic or laparoscopic liver resection were considered following these criteria: (1) studies comparing robotic and laparoscopic liver resection; (2) studies reporting at least one perioperative outcome; and (3) if more than one study was reported by the same institute, only the most recent was included. The primary outcome measures were set for estimated blood loss, operative time, conversion rate, R1 resection rate, morbidity and mortality rates, hospital stay and major hepatectomy rates. RESULTS: A total of 7 articles, published between 2010 and 2014, fulfilled the selection criteria. The laparoscopic approach was associated with a significant reduction in blood loss and lower operative time (MD = 83.96, 95%CI: , P = 0.03; MD = 68.43, 95%CI: , P < , respectively). No differences were found with respect to conversion rate, R1 resection rate, morbidity and hospital stay. CONCLUSION: Laparoscopic liver resection resulted in reduced blood loss and shorter surgical times compared to robotic liver resections. There was no difference in conversion rate, R1 resection rate, morbidity and length 8441 July 21, 2015 Volume 21 Issue 27

236 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis of postoperative stay. Key words: Laparoscopic liver resections; Robotic liver resections; Outcome; Systematic review; Meta-analysis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: No consensus is available in the literature about which technique between laparoscopic and robotic liver resection is more beneficial to the patient. This is the first systematic review and meta-analysis comparing laparoscopic and robotic liver resection. We investigated these two techniques in terms of estimated blood loss, operative time, conversion rate, R1 resection rate, morbidity and mortality rates, hospital stay and major hepatectomy rates. Montalti R, Berardi G, Patriti A, Vivarelli M, Troisi RI. Outcomes of robotic vs laparoscopic hepatectomy: A systematic review and meta-analysis. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8441.htm DOI: i INTRODUCTION Since its introduction by Reich et al [1] in 1991, laparoscopy has been increasingly used for resection of benign and malignant liver lesions, from minor resections to major hepatectomies and living liver donation [2-7]. Several studies have suggested the safety, feasibility, comparable perioperative and long-term outcomes of laparoscopy compared to the standard open approach [8-10]. In many centers, laparoscopic liver resection (LLR) is considered the first choice in wellselected patients. Current limitations include a steep learning curve [11], tumors adjacent to the hilum, the hepatic veins and the inferior vena cava, bulky tumors, difficult access to the posterior segments and the need for biliary and vascular reconstructions [9]. The reports of LLR on the posterior segments are few and have been limited to centers with a wide experience in both open and laparoscopic liver surgery. Robotics was introduced two decades ago with the aim of overcoming the intrinsic limitations of laparoscopic instruments and visualization. The da Vinci Robotic Surgical System was introduced in 2000 to improve the surgeon s dexterity by taking advantage of the camera s three-dimensional view and endowristed instruments [12-15]. Furthermore, robotics has also been described as an effective tool for nonresective and demanding hepatobiliary surgery, such as bilio-digestive reconstructions and choledocal cysts excisions [16,17]. Radical prostatectomy and various gynecological procedures currently make up the vast majority of robotic surgeries: by 2011, more than 90% of the robotic worldwide procedures were urologic and gynecological operations [18]. Perioperative and oncological outcomes are equivalent to those reported in the literature with the standard approach. Two major drawbacks are the lack of haptic feedback and high costs [19]. Many believe that robotic-assisted liver resections (RLR) could be an advantageous technique allowing for accurate tissue dissection and easier intracorporeal sewing; furthermore, it is believed that RLR may allow for the better resection of lesions adjacent to major vessels, close to the liver hilum, or in difficult anatomic positions [20]. However, its evolution to now is not what one would have expected for the LLR. Its use has been relatively unexplored, accounting for few reports with limited patient volume [21-37]. As is the case of laparoscopic surgery, several reports have documented the clinical outcomes of robotic technique compared to open procedures [18]. However, due to the limited number of reports comparing both techniques, it is not yet clear which method is more beneficial to the patient or the most useful for lesions located in difficult liver segments. Considering the lack of consensus, the objective of this study was to perform a systematic review and meta-analysis on robotic-assisted vs laparoscopic liver resections for all type of liver lesions. The primary outcome measures were estimated blood loss, operative time, conversion rate, R1 resection rate, morbidity and mortality rates, hospital stay and major hepatectomy rates. The analysis was limited to humans and to articles reported in English language but no restriction was set for type of publication, date, or publication status. MATERIALS AND METHODS Literature search PRISMA statement guidelines were followed for conducting and reporting meta-analysis data [38]. PICOS scheme was followed for reporting inclusion criteria. A systematic literature search was performed independently by two of the authors (RM and GB) using PubMed, Scopus and the Cochrane Library Central. The search was limited to humans and to articles reported in English language. No restriction was set for type of publication, date, or publication status. Participants of any age and sex who underwent robotic or laparoscopic liver resection for all type of hepatic lesions were considered; robotic liver resections were considered as the Intervention group while the laparoscopic resections were considered as the comparator group according to the PICOS scheme. The search strategy was based on different combinations of words for each database. For the PubMed database the following combination was used: (Laparoscopic or laparoscopy or laparoscopically 8442 July 21, 2015 Volume 21 Issue 27

237 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Table 1 Characteristics of included studies Ref. Country Type of study Total n. of patients Laparoscopic liver resection No. of patients Age M/F No. of patients Robotic liver resection Age M/F Score of study quality 2 Berber et al [21] United States Retro/Comparative ± / ± 6.4 7/ Ji et al [30] China Retro/Case-control NR NR (39-79) 1 9/ Troisi et al [45] Belgium-Italy Retro/Comparative ± / ± / Lai et al [41] China Retro/Comparative NR NR 33 NR NR Wu et al [47] Taiwan Retro/Comparative ± 14 28/ ± / Tsung et al [46] United States Retro/Case-control ± / ± / Spampinato et al [43] Italy Retro/Comparative (33-80) 1 10/ (32-80) 13/ Data expressed as median (range); 2 According to the NOS (Newcastle-Ottawa Scale) classification. Retro: Retrospective; NR: Not reported. or minimally invasive) and (liver resection or liver resections or hepatectomy or hepatectomies or hepatic resection or hepatic resections or liver surgery) and (robotic or robotically or robot or robot assistance or robot-assisted or robotic-assisted). For the Scopus database the following combination was used: TITLE-ABS-KEY (Laparoscopic or laparoscopy or laparoscopically or minimally invasive ) and TITLE- ABS-KEY ( liver resection or liver resections or hepatectomy or hepatectomies or hepatic resection or hepatic resections or liver surgery ) and TITLE-ABS- KEY (robotic or robotically or robot or robot assistance or robot-assisted or robotic-assisted ). The same key words were inserted in the search manager fields of the Cochrane Library Central. The search was further broadened by extensive crosschecking of reference lists of all retrieved articles fulfilling the inclusion criteria. For all databases, the last search was run on 07 July, Study selection The same two authors independently screened the titles and abstracts of the primary studies that were identified in the electronic search. Duplicate studies were excluded. The following inclusion criteria were set for inclusion in this meta-analysis: (1) Studies comparing robotic and laparoscopic liver resection for all types of hepatic lesions; (2) Studies reporting at least one perioperative outcome including blood loss, operative timing, conversion, mortality, morbidity, R1 resection rates, hospital stay and rate of major hepatectomies; and (3) If more than one study was reported by the same institute, only the most recent or the highest level of study was included. The following exclusion criteria were set: (1) Original studies assessing the outcome of either laparoscopic or robotic liver resection; (2) Review articles, letters, comments and case reports; and (3) Studies where it was impossible to retrieve or calculate data of interest. The Cohen kappa statistic was used to quantify agreement between the investigators. Data extraction The same two authors extracted the following main data (Table 1 and 2): (1) First author, year of publication and study type; (2) Number and characteristics of patients of both the laparoscopic and robotic resection groups; and (3) Treatment outcomes, including blood loss, operative timing, conversion, mortality, morbidity, R1 resection rates, hospital stay and rate of major hepatectomies. All relevant texts, tables and figures were reviewed for data extraction; whenever further information was required, the corresponding authors of the papers were contacted by . Discrepancies between the two reviewers were resolved by consensus discussion. Risk of Bias The Newcastle-Ottawa Scale was used for retrospective studies to assess quality. Funnel plots were constructed to assess the risk of publication bias across series for all outcome measures. Statistical analysis The meta-analysis was performed using RevMan software version 5.1. Odds ratios (OR) were used as a summary measure of efficacy for dichotomous data and mean differences (MD) between groups were used for continuous variables. A 95%CI was reported for both measures. If the study provided medians and interquartile ranges instead of means ± SD, the means ± SD were imputed, as described by Hozo et al [39]. The fixed-effect model was used when no heterogeneity was detected among studies, while the random-effect model was preferred when variance existed. Statistical heterogeneity was evaluated using the I 2 statistic. I 2 values of 0-25%, 25%-50% and > 50% were considered as indicative of homogeneity, moderate heterogeneity and high heterogeneity, respectively. All statistical data were considered with a P-value < The statistical methods of this study were reviewed by Filippo Oropallo from National Statistical Institute of Italy. RESULTS Study selection The literature search yielded 291 articles; after duplicate 8443 July 21, 2015 Volume 21 Issue 27

238 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Table 2 Raw data of each included study First author Blood loss (ml) Operative time (min) Conversion Morbidity R1 rate Hospital stay (d) Berber et al [21] Laparoscopic liver resection 155 ± ± % 17% NR NR Robotic liver resection 136 ± ± % 11% NR NR Ji et al [30] Laparoscopic liver resection NA 130 ± % 10% NR NA Robotic liver resection NA 338 ± % 7.80% NR NA Troisi et al [45] Laparoscopic liver resection 174 ± ± % 12.60% 5.40% 5.9 ± 3.8 Robotic liver resection 330 ± ± % 12.50% 7.50% 6.1 ± 2.6 Lai et al [41] Laparoscopic liver resection ± ± 42.7 NR 9% 9.10% NR Robotic liver resection ± ± 69.8 NR 3% 9.10% NR Wu et al [47] Laparoscopic liver resection 173 ± ± % 10% NR 7.2 ± 4.4 Robotic liver resection 325 ± ± 166 5% 8% NR 7.9 ± 4.7 Tsung et al [46] Laparoscopic liver resection 100 ± ± % 26% 8% 4 ± 0.3 Robotic liver resection 200 ± ± % 19.30% 5% 4 ± 0.6 Spampinato et al [43] Laparoscopic liver resection ± ± 105 4% 36% 9% 10.2 ± 4.2 Robotic liver resection 625 ± ± 121 4% 16% 0% 10.5 ± 4.5 NR: Not reported; NA: Not assessable. Identification Records identified through database searching (n =291) Additional records identified through other sources (n = 0) Records after duplicates removed (n = 207) Screening Records screened (n = 207) Records excluded (n =196) Eligibility Full-text articles assessed for eligibility (n =11) Studies included in qualitative synthesis (n = 7) Full-text articles excluded (n = 4) - Redundant publications coming from the same institution (n =4) Included Studies included in quantitative synthesis (meta-analysis) (n =7) Figure 1 Study selection July 21, 2015 Volume 21 Issue 27

239 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Robotic Laparoscopic Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight iv, Random, 95%CI Ⅳ, Random, 95%CI Berber (2010) % [-64.56, 26.56] Troisi (2013) % [60.49, ] Lai (2013) % [ , ] Tsung (2014) % [79.22, ] Wu (2014) % [-8.76, ] Spampinanto (2014) % [-96.82, ] Total (95%CI) % [10.51, ] Heterogeneity: Tau 2 = , χ 2 = 24.96, df = 5 (P = ); I 2 = 80% Test for overall effect: Z = 2.24 (P = 0.03) Favours [Robotic] Favours [Laparoscopic] Figure 2 Meta-analysis Forest plot concerning estimated blood loss. Robotic Laparoscopic Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight iv, Random, 95%CI Ⅳ, Random, 95%CI Berber (2010) % [5.48, 44.32] Ji (2011) % [115.38, ] Troisi (2013) % 9.00 [-25.24, 43.24] Lai (2013) % [41.38, 97.22] Spampinanto (2014) % [18.40, ] Tsung (2014) % [42.54, 66.46] Wu (2014) % [94.82, ] Total (95%CI) % [39.22, 97.65] Heterogeneity: Tau 2 = , χ 2 = 38.43, df = 6 (P < ); I 2 = 84% Test for overall effect: Z = 4.59 (P < ) Favours [Robotic] Favours [Laparoscopic] Figure 3 Meta analysis Forest plot concerning operative time. removal, 207 titles and abstracts were reviewed (Figure 1). Of these, 196 papers were excluded for the following reasons: 110 were not related to liver resections, 81 did not compare techniques, 3 were review articles and 2 were letters. Finally, eleven articles [21,30,40-48] were selected for full-text review; of these, four more were excluded because of redundant series from the same institute [40,42,44,48]. There was no disagreement regarding eligibility of full-text articles (Cohen kappa = 1). Finally, a total of 7 articles, dated between 2010 and 2014, fulfilled the selection criteria and were therefore included in this meta-analysis; all the articles finally selected were retrospective studies, of which two case-controls [30,46] and five comparative [21,41,43,45,47]. All of the studies included a total of 694 patients: 479 who underwent laparoscopic liver resection and 215 cases of robotic liver resection. The characteristics of the included studies are summarized in Table 1. According to the NOS scale, the study quality was graded 9 for two publications (both respectively for Selection, Comparability and Exposure measurements) [21,43], 8 for four (three [41,45,47] and one [46] ) and 7 for one publication (3+1+3) [30]. Three corresponding authors were contacted by for obtaining unpublished or unclear data [21,30,41] and of these, none responded addressing questions. The outcomes of interest of each single study are summarized in Table 2. Estimated blood loss Six of the included studies reported results regarding blood loss in both groups. An overall significant reduction in blood loss was observed in the laparoscopic group compared to the robotic one (MD = 83.96, 95%CI: , P = 0.03) (Figure 2). Operative time All articles were included to determine the overall effect regarding operative time. According to Figure 3, the laparoscopic approach was associated with a significantly lower operative time compared to the robotic technique (MD = 68.43, 95%CI: , P < ). Conversion Conversion was considered as switching to an open or hand assisted approach during the operation. Six of the seven papers included in the meta-analysis reported data regarding conversion, and no statistically significant overall differences were observed (OR = 1.19, 95%CI: , P = 0.71) (Figure 4). R1 resection rate No statistically significant difference was found between the two approaches with respect to the R1 resection rate, including four of the seven studies selected (OR = 1.71, 95%CI: , P = 0.07) 8445 July 21, 2015 Volume 21 Issue 27

240 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Robotic Laparoscopic Mean difference Mean difference Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Berber (2010) % 8.29 [0.31, ] Ji (2011) % 0.27 [0.01, 6.18] Troisi (2013) % 3.03 [1.21, 7.60] Wu (2014) % 0.40 [0.07, 2.20] Tsung (2014) % 0.78 [0.24, 2.62] Spampinanto (2014) % 1.00 [0.06, 16.93] Total (95%CI) % 1.19 [0.48, 2.99] Total events Heterogeneity: Tau 2 = 0.45, χ 2 = 8.03, df = 5 (P = 0.15); I 2 = 38% Test for overall effect: Z = 0.38 (P = 0.71) Favours [Robotic] Favours [Laparoscopic] Figure 4 Meta-analysis Forest plot concerning conversion. Robotic Laparoscopic Mean difference Mean difference Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Troisi (2013) % 1.43 [0.38, 5.30] Lai (2013) % 1.00 [0.19, 5.36] Tsung (2014) % 2.60 [1.20, 5.65] Spampinanto (2014) % 0.18 [0.01, 4.04] Total (95%CI) % 1.71 [0.95, 3.09] Total events Heterogeneity: χ 2 = 3.59, df = 3 (P = 0.31); I 2 = 16% Test for overall effect: Z = 1.79 (P = 0.07) Favours [Robotic] Favours [Laparoscopic] Figure 5 Meta-analysis Forest plot concerning R1 resection rate. Robotic Laparoscopic Mean difference Mean difference Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Berber (2010) % 0.59 [0.06, 6.18] Ji (2011) % 0.75 [0.06, 9.22] Lai (2013) % 0.31 [0.03, 3.17] Troisi (2013) % 0.99 [0.36, 2.75] Spampinanto (2014) % 0.34 [0.09, 1.30] Tsung (2014) % 0.70 [0.32, 1.53] Wu (2014) % 0.79 [0.17, 3.80] Total (95%CI) % 0.66 [0.40, 1.09] Total events Heterogeneity: χ 2 = 2.06, df = 6 (P = 0.91); I 2 = 0% Test for overall effect: Z = 1.62 (P = 0.10) Favours [Robotic] Favours [Laparoscopic] Figure 6 Meta-analysis Forest plot concerning morbidity. (Figure 5). Mortality and morbidity Due to the different reporting methods in the single papers, overall results regarding mortality were impossible to calculate. In some articles, 30-d mortality was reported [41], while in others, 90-d mortality was the measurement used [43,46] ; in some of the papers, no specification was given [45,47]. Finally, two articles did not report any data on mortality [21,30]. Regarding overall morbidity, data were reported in all of the included studies and no overall differences were observed (OR = 0.66, 95%CI: , P = 0.10) (Figure 6). Hospital stay Four of the seven included studies reported hospital stay outcomes. No overall differences were found between the two approaches (MD = 0.01, 95%CI: , P = 0.89, Figure 7). Major hepatectomies rate Due to the different classifications regarding major and minor hepatectomies and to the lack of reported data among studies, no overall effect was calculated. Specifically, two articles described only minor hepatectomies [21,41], one described only major hepatectomies [43] ; one paper considered a major hepatectomy as the 8446 July 21, 2015 Volume 21 Issue 27

241 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Robotic Laparoscopic Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, Random, 95%CI Ⅳ, Random, 95%CI Spampinanto (2014) % 0.30 [-2.11, 2.71] Troisi (2013) % 0.20 [-0.75, 1.15] Tsung (2014) % 0.00 [-0.17, 0.17] Wu (2014) % 0.70 [-1.31, 2.71] Total (95%CI) % 0.01 [-0.15, 0.17] Heterogeneity: χ 2 = 0.68, df = 3 (P = 0.88); I 2 = 0% Test for overall effect: Z = 0.14 (P = 0.89) Favours [Robotic] Favours [Laparoscopic] Figure 7 Meta-analysis Forest plot concerning hospital stay. A 0 B SE (log[or]) 1 SE (MD) OR MD Figure 8 Funnel plot of morbidity (A) and hospital stay (B) in all included studies. resection of 4 or more segments [46] while three articles considered a major hepatectomy as the resection of 3 or more segments [30,45,47]. Publication bias Funnel plots were constructed for each outcome and showed symmetry, suggesting that publication bias was not large and was unlikely to drive conclusions (Figure 8A). Funnel plots regarding hospital stay showed substantial asymmetry (Figure 8B). DISCUSSION Laparoscopic liver resections are considered safe and effective in well-selected patients and have shown better results in terms of blood transfusion, postoperative hospital stay and morbidity compared to open surgery, as described in the thirteen reported meta-analyses [49-61]. Several variants for the laparoscopic approach have been described, such as the pure laparoscopic, the hand-assisted, the hybrid and singleport techniques. Conversely, it is not yet clear whether robotic assistance demonstrates substantial advantage over the pure laparoscopic technique. The robotic platform is a tool with which many of the limitations of conventional laparoscopic liver surgery can be overcome: two-dimensional imaging and tremor amplification, fulcrum effect against the port, limited degrees of freedom for manipulation and awkward ergonomics. Furthermore, the augmented dexterity enabled by the endowristed movements, the software filtration of surgeon s movements and the high-definition three-dimensional vision provided by the stereoscopic camera combine to guarantee a steady and careful dissection of the structures [62]. Nevertheless, RLR has had a slower evolution over the last years; it does not currently provide some useful tools, such as an endowristed surgical aspirator or high-energy device that can fully exploit the potential of the movements and vision offered by the robot, especially when operating in a limited resection space (i.e., when approaching P-S segments). Other potential limitations of RLR concern the need of an additional attending surgeon and the high costs of robot purchasing, instrumentation and annual maintenance. There are very few centers in the world that have performed a limited number of robotic liver resections on highly selected patients. The technique has not been standardized and it is questionable whether any of these centers have gone through the learning curve. Few reports regarding laparoscopic and robotic liver resections have been published that have evaluated different outcomes and results among series; therefore, there has been difficulty not only in interpreting data but also in drawing final conclusions regarding the superiority of one approach over another. A meta-analysis, as a quantitative method for therapeutic evaluation, may be used when controversy persists in order to determine the results July 21, 2015 Volume 21 Issue 27

242 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis To our knowledge, this is the first systematic review and meta-analysis comparing robotics to laparoscopy for liver resections. In this analysis, it was possible to include only 7 studies containing 694 patients; all of these articles were retrospective of which 2 case-controls and 5 comparative; to date, this may represent the largest body of information available for the comparison of RLR and LLR. According to the Newcastle-Ottawa scale used for assessing quality of the studies, articles included in this meta-analysis were graded with 9 [21,43], 8 [41,45-47] or 7 [30], reflecting a high quality concerning selection of patients, comparability and exposure measurements. The first laparoscopic liver resection was described by Gagner et al [63] in 1992, whereas the first robotic liver resection was published in 2003 by Giulianotti et al [64]. While the laparoscopic technique has had a worldwide spread since its introduction, the robotic technique has not had the same evolution, possibly due to the significant upfront costs and the different required learning curve. In 2010, Berber et al [21] described the first study comparing the two methods. Since then, we have observed a progressive increase of publications, suggesting a growing interest in comparing both techniques. Unfortunately, in contrast with laparoscopic surgery, there have been no prospective randomized studies comparing laparoscopic and robotic techniques. The results of the present meta-analysis shows a significant increase in bleeding in RLR. This may be explained by the different techniques used for liver transection. In fact, the most prevalent technique of hepatic transection used in LLR requires the use of a harmonic scalpel for superficial liver transection; in most of the cases and accordingly to the surgeon s preference, the Cavitron Ultrasonic Surgical Aspirator (CUSA) is used for deeper transection, which is a tool that allow a meticulous and precise dissection of the parenchymal structures. Conversely, robotic liver transection is mainly based on the crush-clamping technique, which requires, in most cases, the use of an intermittent inflow occlusion (Pringles manoeuver). In this case, an increased ischemia/reperfusion injury should be anticipated when operating on a cirrhotic liver [65]. Another difference we found was that the surgical time was significantly longer in robotic hepatectomy. The difference could be due to the different technique of hepatic resection, but may also be because the robotic technique is more recent and requires greater experience and refinement; in addition, there may be a difference among standardization of the procedures and an obvious docking time of the system. The rate of conversion was comparable between RLR and LLR, which most likely indicates a similar difficulty in approaching liver surgery. The basic principle behind the oncological resection of malignant diseases is to keep a sufficient tumor-free margin in order to avoid incomplete tumor resection and possibly iatrogenic spread. Considering the fact that most of the indications for minimally invasive liver surgery are actually met in malignancies [66], margin width is a major indicator in the quality of surgical resection. With the aim of highlighting any differences between the two techniques, the third end-point of our meta-analysis was the margin width. We found that the rate of R1 resection was not statistically different between the two techniques, although there was a trend towards decreased R1 resection margins in the LLR group. These data should be analyzed in more detail in future studies, which may suggest an increased difficulty in the identification of a tumoral lesion by intraoperative ultrasound (IOUS) with the robotic technique. A possible explanation for this is the fact that the surgeon who performs the ultrasound is not the same that performs hepatectomy at the robotic console. Only very recently robotic technology has provided an IOUS guided by the surgeon at the console. According to our analysis, there was no statistically significant difference in the morbidity rate between the two analyzed techniques, although a trend toward a lower complication rate in the robotic group was observed. One might speculate that RLR offers increased surgical precision leading to meticulous dissection, individuation of small biliary structures, minimizing bile leaks and decreased overall postoperative complications. Unfortunately, we did not evaluate data in terms of the indicators of the degree of difficulty of a minimally invasive procedure performed using both approaches (i.e., resection of P-S segments or living donor hepatectomy). Therefore, we cannot conclude whether laparoscopy was performed for more technically difficult interventions or vice versa. To better characterize this issue, a comparative analysis between RLR and LLR for approaching the P-S segments is warranted. Finally, the hospital stay showed similar results between the two techniques. These are both minimally invasive procedures; patients seems to have a comparable postoperative course. The two techniques seemed to be different for the surgeon but not for the patient. The main limitation of this meta-analysis is that it is based on retrospective studies; only two of which are case-control studies. Another limitation of the study is that the included reports are highly heterogeneous in terms of disease indications, types of liver resection (minor or major) and location of liver lesions. One of the included articles was limited to liver resections for hepatocellular carcinoma [47], one of them was limited to major hepatectomies [43], two of them were for minor hepatectomies only [21,41], while four studies [40,42,44,48] were excluded from the metaanalysis because a portion of the patients described had already been considered in other series from the same institutions. In this way, a substantial number of patients were excluded from the analysis July 21, 2015 Volume 21 Issue 27

243 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis Estimated blood loss and operative time were associated with significant heterogeneity between studies. Although we used the fixed or random-effects model, as appropriate, this bias was impossible to overcome. In the present meta-analysis, we did not analyze the technical differences between the two methods in terms of trocars positioning, type/version of the robot, instrumentation for the transection of the liver, intraoperative ultrasound methodology, duration of hilar clamping, or other reported data because our outcomes were decided a priori, based on the highest clinically relevant end-points. Moreover, in the present systematic review we did not find studies, which focused on cost assessment between RLR and LLR. Ji et al [30] described a general hospital cost of $ per intervention for robotics and $7618 for the laparoscopic technique. Furthermore Packiam et al [42], compared only the direct costs of the operating room supplies, resulting in $5.130 vs $4.408 for RLR and LLR, respectively. Future research should be directed to analyze costs differences between the two procedures. No prospective randomized trials are reported, therefore, future research should be directed at performing prospective randomized trials comparing RLR to LLR. These prospective trials would have fewer ethical issues than the comparison to the open technique. In fact, RLR and LLR are both minimally invasive approaches without differences in safety and efficacy. Future research should aim to extrapolate differences in the learning curves between laparoscopic and robotic liver resection and propose a method to objectively assess the degree of difficulty in minimally invasive liver surgery; this will highlight the value of each technique, leading to better outcomes. In summary, the results of this meta-analysis of retrospective studies, demonstrated that laparoscopic liver resection resulted in less blood loss and shorter surgical times compared to robotic liver resections. There was no difference in the conversion rate, R1 resection rate, morbidity and length of postoperative stay. Future research should be directed in comparing the two techniques, also in terms of cost analysis and learning curve, especially in a prospective randomized controlled fashion. COMMENTS Background The interest in minimally invasive approaches for the surgical resection of liver lesions is growing in recent years. In several centers, laparoscopic and robotic liver surgeries are now considered as the standard of care for selected patients. Despite this, no consensus is available in the literature about which of these two techniques is more beneficial to the patient. Research frontiers Nowadays liver resections are performed with a minimally invasive approach in a growing number of centers. The worldwide research is directed towards a type of surgery in which morbidity and stress related to the patient are minimized. Innovations and breakthroughs In the present study, the authors investigated the outcomes of two worldwide spread minimally invasive techniques by pooling results from different centers. This is the first report of a meta-analysis comparing robotic and laparoscopic liver resections. Applications The present report allows understanding the role of two minimally invasive techniques for liver resections. Peer-review This systematic review and meta-analysis of retrospective studies adds useful information for practice and research, and probably for policy. REFERENCES 1 Reich H, McGlynn F, DeCaprio J, Budin R. Laparoscopic excision of benign liver lesions. Obstet Gynecol 1991; 78: [PMID: ] 2 Nguyen KT, Laurent A, Dagher I, Geller DA, Steel J, Thomas MT, Marvin M, Ravindra KV, Mejia A, Lainas P, Franco D, Cherqui D, Buell JF, Gamblin TC. Minimally invasive liver resection for metastatic colorectal cancer: a multi-institutional, international report of safety, feasibility, and early outcomes. Ann Surg 2009; 250: [PMID: DOI: /SLA.0b013e3181bc789c] 3 Descottes B, Glineur D, Lachachi F, Valleix D, Paineau J, Hamy A, Morino M, Bismuth H, Castaing D, Savier E, Honore P, Detry O, Legrand M, Azagra JS, Goergen M, Ceuterick M, Marescaux J, Mutter D, de Hemptinne B, Troisi R, Weerts J, Dallemagne B, Jehaes C, Gelin M, Donckier V, Aerts R, Topal B, Bertrand C, Mansvelt B, Van Krunckelsven L, Herman D, Kint M, Totte E, Schockmel R, Gigot JF. Laparoscopic liver resection of benign liver tumors. Surg Endosc 2003; 17: [PMID: DOI: /s ] 4 Cherqui D, Husson E, Hammoud R, Malassagne B, Stéphan F, Bensaid S, Rotman N, Fagniez PL. Laparoscopic liver resections: a feasibility study in 30 patients. Ann Surg 2000; 232: [PMID: ] 5 Cherqui D, Soubrane O, Husson E, Barshasz E, Vignaux O, Ghimouz M, Branchereau S, Chardot C, Gauthier F, Fagniez PL, Houssin D. Laparoscopic living donor hepatectomy for liver transplantation in children. Lancet 2002; 359: [PMID: DOI: /S (02) ] 6 Scatton O, Katsanos G, Boillot O, Goumard C, Bernard D, Stenard F, Perdigao F, Soubrane O. Pure laparoscopic left lateral sectionectomy in living donors: from innovation to development in France. Ann Surg 2015; 261: [PMID: DOI: /SLA ] 7 Troisi RI, Wojcicki M, Tomassini F, Houtmeyers P, Vanlander A, Berrevoet F, Smeets P, Van Vlierberghe H, Rogiers X. Pure laparoscopic full-left living donor hepatectomy for calculated small-for-size LDLT in adults: proof of concept. Am J Transplant 2013; 13: [PMID: DOI: /ajt.12362] 8 Hu BS, Chen K, Tan HM, Ding XM, Tan JW. Comparison of laparoscopic vs open liver lobectomy (segmentectomy) for hepatocellular carcinoma. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 9 Buell JF, Cherqui D, Geller DA, O Rourke N, Iannitti D, Dagher I, Koffron AJ, Thomas M, Gayet B, Han HS, Wakabayashi G, Belli G, Kaneko H, Ker CG, Scatton O, Laurent A, Abdalla EK, Chaudhury P, Dutson E, Gamblin C, D Angelica M, Nagorney D, Testa G, Labow D, Manas D, Poon RT, Nelson H, Martin R, Clary B, Pinson WC, Martinie J, Vauthey JN, Goldstein R, Roayaie S, Barlet D, Espat J, Abecassis M, Rees M, Fong Y, McMasters KM, Broelsch C, Busuttil R, Belghiti J, Strasberg S, Chari RS. The international position on laparoscopic liver surgery: The Louisville Statement, Ann Surg 2009; 250: [PMID: ] 10 Montalti R, Berardi G, Laurent S, Sebastiani S, Ferdinande L, Libbrecht LJ, Smeets P, Brescia A, Rogiers X, de Hemptinne B, Geboes K, Troisi RI. Laparoscopic liver resection compared to 8449 July 21, 2015 Volume 21 Issue 27

244 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis open approach in patients with colorectal liver metastases improves further resectability: Oncological outcomes of a case-control matched-pairs analysis. Eur J Surg Oncol 2014; 40: [PMID: DOI: /j.ejso ] 11 Vigano L, Laurent A, Tayar C, Tomatis M, Ponti A, Cherqui D. The learning curve in laparoscopic liver resection: improved feasibility and reproducibility. Ann Surg 2009; 250: [PMID: DOI: /SLA.0b013e3181bd93b2] 12 Heemskerk J, van Gemert WG, de Vries J, Greve J, Bouvy ND. Learning curves of robot-assisted laparoscopic surgery compared with conventional laparoscopic surgery: an experimental study evaluating skill acquisition of robot-assisted laparoscopic tasks compared with conventional laparoscopic tasks in inexperienced users. Surg Laparosc Endosc Percutan Tech 2007; 17: [PMID: DOI: /SLE.0b013e31805b8346] 13 Maniar HS, Council ML, Prasad SM, Prasad SM, Chu C, Damiano RJ. Comparison of skill training with robotic systems and traditional endoscopy: implications on training and adoption. J Surg Res 2005; 125: [PMID: DOI: / j.jss ] 14 Moorthy K, Munz Y, Dosis A, Hernandez J, Martin S, Bello F, Rockall T, Darzi A. Dexterity enhancement with robotic surgery. Surg Endosc 2004; 18: [PMID: DOI: / s ] 15 Mucksavage P, Kerbl DC, Lee JY. The da Vinci( ) Surgical System overcomes innate hand dominance. J Endourol 2011; 25: [PMID: DOI: /end ] 16 Carpenter SG, Grimsby G, DeMasters T, Katariya N, Hewitt WR, Moss AA, Reddy KS, Castle EP, Mulligan DC. Robotic resection of choledochocele in an adult with intracorporeal hepaticojejunostomy and Roux-en-Y anastomosis: Encouraging progress for robotic surgical treatment of biliary disease. J Rob Surg 2014; 8: Kang CM, Kim DH, Lee WJ. Ten years of experience with resection of left-sided pancreatic ductal adenocarcinoma: evolution and initial experience to a laparoscopic approach. Surg Endosc 2010; 24: [PMID: DOI: / s ] 18 Brody F, Richards NG. Review of robotic versus conventional laparoscopic surgery. Surg Endosc 2014; 28: [PMID: DOI: /s ] 19 Hyung WJ. [Robotic surgery in gastrointestinal surgery]. Korean J Gastroenterol 2007; 50: [PMID: ] 20 Abood GJ, Tsung A. Robot-assisted surgery: improved tool for major liver resections? J Hepatobiliary Pancreat Sci 2013; 20: [PMID: DOI: /s ] 21 Berber E, Akyildiz HY, Aucejo F, Gunasekaran G, Chalikonda S, Fung J. Robotic versus laparoscopic resection of liver tumours. HPB (Oxford) 2010; 12: [PMID: DOI: / j x] 22 Casciola L, Patriti A, Ceccarelli G, Bartoli A, Ceribelli C, Spaziani A. Robot-assisted parenchymal-sparing liver surgery including lesions located in the posterosuperior segments. Surg Endosc 2011; 25: [PMID: DOI: / s ] 23 Choi GH, Choi SH, Kim SH, Hwang HK, Kang CM, Choi JS, Lee WJ. Robotic liver resection: technique and results of 30 consecutive procedures. Surg Endosc 2012; 26: [PMID: DOI: /s ] 24 Choi SB, Park JS, Kim JK, Hyung WJ, Kim KS, Yoon DS, Lee WJ, Kim BR. Early experiences of robotic-assisted laparoscopic liver resection. Yonsei Med J 2008; 49: [PMID: DOI: /ymj ] 25 Giulianotti PC, Coratti A, Sbrana F, Addeo P, Bianco FM, Buchs NC, Annechiarico M, Benedetti E. Robotic liver surgery: results for 70 resections. Surgery 2011; 149: [PMID: DOI: /j.surg ] 26 Giulianotti PC, Sbrana F, Bianco FM, Addeo P. Robotassisted laparoscopic extended right hepatectomy with biliary reconstruction. J Laparoendosc Adv Surg Tech A 2010; 20: [PMID: DOI: /lap ] 27 Giulianotti PC, Sbrana F, Coratti A, Bianco FM, Addeo P, Buchs NC, Ayloo SM, Benedetti E. Totally robotic right hepatectomy: surgical technique and outcomes. Arch Surg 2011; 146: [PMID: DOI: /archsurg ] 28 Giulianotti PC, Tzvetanov I, Jeon H, Bianco F, Spaggiari M, Oberholzer J, Benedetti E. Robot-assisted right lobe donor hepatectomy. Transpl Int 2012; 25: e5-e9 [PMID: DOI: /j x] 29 Holloway RW, Brudie LA, Rakowski JA, Ahmad S. Roboticassisted resection of liver and diaphragm recurrent ovarian carcinoma: description of technique. Gynecol Oncol 2011; 120: [PMID: DOI: /j.ygyno ] 30 Ji WB, Wang HG, Zhao ZM, Duan WD, Lu F, Dong JH. Roboticassisted laparoscopic anatomic hepatectomy in China: initial experience. Ann Surg 2011; 253: [PMID: DOI: /SLA.0b013e3181ff4601] 31 Lai EC, Tang CN, Li MK. Robot-assisted laparoscopic hemihepatectomy: technique and surgical outcomes. Int J Surg 2012; 10: [PMID: DOI: /j.ijsu ] 32 Machado MA, Makdissi FF, Surjan RC, Abdalla RZ. [First robotic-assisted laparoscopic liver resection in Latin America]. Arq Gastroenterol 2009; 46: [PMID: ] 33 Panaro F, Piardi T, Cag M, Cinqualbre J, Wolf P, Audet M. Robotic liver resection as a bridge to liver transplantation. JSLS 2011; 15: [PMID: DOI: / X ] 34 Patriti A, Ceccarelli G, Bartoli A, Spaziani A, Lapalorcia LM, Casciola L. Laparoscopic and robot-assisted one-stage resection of colorectal cancer with synchronous liver metastases: a pilot study. J Hepatobiliary Pancreat Surg 2009; 16: [PMID: DOI: /s y] 35 Ryska M, Fronek J, Rudis J, Jurenka B, Langer D, Pudil J. [Manual and robotic laparoscopic liver resection. Two case-reviews]. Rozhl Chir 2006; 85: [PMID: ] 36 Vasile S, Sgarbură O, Tomulescu V, Popescu I. The robotic-assisted left lateral hepatic segmentectomy: the next step. Chirurgia (Bucur) 2008; 103: [PMID: ] 37 Wakabayashi G, Sasaki A, Nishizuka S, Furukawa T, Kitajima M. Our initial experience with robotic hepato-biliary-pancreatic surgery. J Hepatobiliary Pancreat Sci 2011; 18: [PMID: DOI: /s ] 38 Liberati A, Altman DG, Tetzlaff J, Mulrow C, Gøtzsche PC, Ioannidis JP, Clarke M, Devereaux PJ, Kleijnen J, Moher D. The PRISMA statement for reporting systematic reviews and meta-analyses of studies that evaluate health care interventions: explanation and elaboration. PLoS Med 2009; 6: e [PMID: DOI: /journal.pmed ] 39 Hozo SP, Djulbegovic B, Hozo I. Estimating the mean and variance from the median, range, and the size of a sample. BMC Med Res Methodol 2005; 5: 13 [PMID: DOI: / ] 40 Lai ECH, Tang CN, Li MKW. Conventional laparoscopic and robot-assisted laparoscopic liver resection for benign and malignant pathologies: A cohort study. J Rob Surg 2012; 6: Lai EC, Yang GP, Tang CN. Robot-assisted laparoscopic liver resection for hepatocellular carcinoma: short-term outcome. Am J Surg 2013; 205: [PMID: DOI: / j.amjsurg ] 42 Packiam V, Bartlett DL, Tohme S, Reddy S, Marsh JW, Geller DA, Tsung A. Minimally invasive liver resection: robotic versus laparoscopic left lateral sectionectomy. J Gastrointest Surg 2012; 16: [PMID: DOI: /s ] 43 Spampinato MG, Coratti A, Bianco L, Caniglia F, Laurenzi A, Puleo F, Ettorre GM, Boggi U. Perioperative outcomes of laparoscopic and robot-assisted major hepatectomies: an Italian multi-institutional comparative study. Surg Endosc 2014; 28: [PMID: DOI: /s ] 44 Tranchart H, Ceribelli C, Ferretti S, Dagher I, Patriti A. Traditional versus robot-assisted full laparoscopic liver resection: 8450 July 21, 2015 Volume 21 Issue 27

245 Montalti R et al. Robotic vs laparoscopic hepatectomy: A meta-analysis a matched-pair comparative study. World J Surg 2014; 38: [PMID: DOI: /s ] 45 Troisi RI, Patriti A, Montalti R, Casciola L. Robot assistance in liver surgery: a real advantage over a fully laparoscopic approach? Results of a comparative bi-institutional analysis. Int J Med Robot 2013; 9: [PMID: DOI: /rcs.1495] 46 Tsung A, Geller DA, Sukato DC, Sabbaghian S, Tohme S, Steel J, Marsh W, Reddy SK, Bartlett DL. Robotic versus laparoscopic hepatectomy: a matched comparison. Ann Surg 2014; 259: [PMID: DOI: /sla ] 47 Wu YM, Hu RH, Lai HS, Lee PH. Robotic-assisted minimally invasive liver resection. Asian J Surg 2014; 37: [PMID: DOI: /j.asjsur ] 48 Lai EC, Tang CN, Yang GP, Li MK. Multimodality laparoscopic liver resection for hepatic malignancy--from conventional total laparoscopic approach to robot-assisted laparoscopic approach. Int J Surg 2011; 9: [PMID: DOI: / j.ijsu ] 49 Croome KP, Yamashita MH. Laparoscopic vs open hepatic resection for benign and malignant tumors: An updated metaanalysis. Arch Surg 2010; 145: [PMID: DOI: /archsurg ] 50 Beal SM, Finch CF. An overview of retrospective case-control studies investigating the relationship between prone sleeping position and SIDS. J Paediatr Child Health 1991; 27: [PMID: ] 51 Mirnezami R, Mirnezami AH, Chandrakumaran K, Abu Hilal M, Pearce NW, Primrose JN, Sutcliffe RP. Short- and long-term outcomes after laparoscopic and open hepatic resection: systematic review and meta-analysis. HPB (Oxford) 2011; 13: [PMID: DOI: /j x] 52 Mizuguchi T, Kawamoto M, Meguro M, Shibata T, Nakamura Y, Kimura Y, Furuhata T, Sonoda T, Hirata K. Laparoscopic hepatectomy: a systematic review, meta-analysis, and power analysis. Surg Today 2011; 41: [PMID: DOI: / s ] 53 Rao A, Rao G, Ahmed I. Laparoscopic or open liver resection? Let systematic review decide it. Am J Surg 2012; 204: [PMID: DOI: /j.amjsurg ] 54 Li N, Wu YR, Wu B, Lu MQ. Surgical and oncologic outcomes following laparoscopic versus open liver resection for hepatocellular carcinoma: A meta-analysis. Hepatol Res 2012; 42: [PMID: DOI: /j X x] 55 Zhou YM, Shao WY, Zhao YF, Xu DH, Li B. Meta-analysis of laparoscopic versus open resection for hepatocellular carcinoma. Dig Dis Sci 2011; 56: [PMID: DOI: / s ] 56 Xiong JJ, Altaf K, Javed MA, Huang W, Mukherjee R, Mai G, Sutton R, Liu XB, Hu WM. Meta-analysis of laparoscopic vs open liver resection for hepatocellular carcinoma. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18. i ] 57 Yin Z, Fan X, Ye H, Yin D, Wang J. Short- and long-term outcomes after laparoscopic and open hepatectomy for hepatocellular carcinoma: a global systematic review and meta-analysis. Ann Surg Oncol 2013; 20: [PMID: DOI: / s ] 58 Wei M, He Y, Wang J, Chen N, Zhou Z, Wang Z. Laparoscopic versus open hepatectomy with or without synchronous colectomy for colorectal liver metastasis: a meta-analysis. PLoS One 2014; 9: e87461 [PMID: DOI: /journal.pone ] 59 Zhou Y, Xiao Y, Wu L, Li B, Li H. Laparoscopic liver resection as a safe and efficacious alternative to open resection for colorectal liver metastasis: a meta-analysis. BMC Surg 2013; 13: 44 [PMID: DOI: / ] 60 Rao A, Rao G, Ahmed I. Laparoscopic left lateral liver resection should be a standard operation. Surg Endosc 2011; 25: [PMID: DOI: /s ] 61 Rao AM, Ahmed I. Laparoscopic versus open liver resection for benign and malignant hepatic lesions in adults. Cochrane Database Syst Rev 2013; 5: CD [PMID: DOI: / CD pub2] 62 Kitisin K, Packiam V, Bartlett DL, Tsung A. A current update on the evolution of robotic liver surgery. Minerva Chir 2011; 66: [PMID: ] 63 Gagner M, Rheault M, Dubuc J. Laparoscopic partial hepatectomy for liver tumor. Surg Endosc 1992; 6: Giulianotti PC, Coratti A, Angelini M, Sbrana F, Cecconi S, Balestracci T, Caravaglios G. Robotics in general surgery: personal experience in a large community hospital. Arch Surg 2003; 138: [PMID: DOI: /archsurg ] 65 Sugiyama Y, Ishizaki Y, Imamura H, Sugo H, Yoshimoto J, Kawasaki S. Effects of intermittent Pringle s manoeuvre on cirrhotic compared with normal liver. Br J Surg 2010; 97: [PMID: DOI: /bjs.7039] 66 Nguyen KT, Gamblin TC, Geller DA. World review of laparoscopic liver resection-2,804 patients. Ann Surg 2009; 250: [PMID: DOI: /SLA.0b013e3181b0c4df] P- Reviewer: Lee DS, Muscat JE, Plaszewski M S- Editor: Qi Y L- Editor: A E- Editor: Liu XM 8451 July 21, 2015 Volume 21 Issue 27

246 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. CASE REPORT Unusual presentation of a pancreatic cyst resulting from osteosarcoma metastasis Burcu Akpinar, Joshua Obuch, Norio Fukami, Sajal S Pokharel Burcu Akpinar, Sajal S Pokharel, Department of Radiology, University of Colorado Hospital, Aurora, CO , United States Joshua Obuch, Norio Fukami, Division of Gastroenterology and Hepatology, University of Colorado Hospital, Aurora, CO , United States Author contributions: Akpinar B designed the report, collected and analyzed the data; Obuch J collected and analyzed the data, and revised the case report; Pokharel SS designed the report, and revised the case report; and Fukami N collected the data, and revised the case report. Institutional review board statement: The study was reviewed by Colorado Multiple Institutional Review Board with protocol number and determined as not human subject research as defined by the policies in accordance with Office for Human Research Protections and Food and Drug Administration regulations. Informed consent statement: We do not have a signed informed consent from the patient for this case report. The case report was conceived after discharge of the patient from our hospital. We kindly request an exemption from the informed consent requirement as we have not had any encounter with the patient after the last appointment in August in our hospital. Conflict-of-interest statement: Authors have no conflict of interest related to the manuscript. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Burcu Akpinar, MD, Visiting Research Scholar, Department of Radiology, University of Colorado Hospital, E. 17th Ave, Mail Stop L954, Aurora, CO United States. burcu.akpinar@ucdenver.edu Telephone: Fax: Received: October 29, 2014 Peer-review started: October 29, 2014 First decision: November 14, 2014 Revised: December 2, 2014 Accepted: January 16, 2015 Article in press: January 16, 2015 Published online: July 21, 2015 Abstract Pancreatic metastases are uncommon. They have been reported in lung cancer, gastrointestinal malignancies, breast cancer, renal cell carcinoma, melanoma, lymphoma and sarcoma, and usually have solid morphology. Cystic metastasis to the pancreas is even more rare with few case reports in the literature. However, with the increasing use of computed tomography and magnetic resonance imaging as well as endoscopic ultrasound, more such lesions may be detected. Metastasis to the pancreas from osteosarcoma is highly unusual, but can be seen with the increasing survival of patients with osteosarcoma. We present an extremely rare case of a predominantly cystic lesion of the pancreas, which was diagnosed as metastasis from osteosarcoma. The pathophysiology of the cystic component of the metastasis of osteosarcoma is unknown. Cystic necrotic degeneration of the solid metastasis or pancreatitis secondary to the metastasis with development of associated fluid collection can be considered. Metastasis should remain a differential consideration even for primarily cystic lesions of the pancreas. Key words: Pancreas; Cystic; Osteosarcoma; Cancer; Metastasis The Author(s) Published by Baishideng Publishing 8452 July 21, 2015 Volume 21 Issue 27

247 Akpinar B et al. Cystic pancreatic lesion from osteosarcoma metastasis Group Inc. All rights reserved. Core tip: Cystic pancreatic lesions are more commonly recognized and diagnosed with developing imaging technologies. Metastasis to the pancreas from osteosarcoma is unusual, but has been reported in terms of solid pancreatic masses. This case report shows that metastasis should remain in the differential diagnosis even for primarily cystic pancreatic lesions. Akpinar B, Obuch J, Fukami N, Pokharel SS. Unusual presentation of a pancreatic cyst resulting from osteosarcoma metastasis. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8452.htm DOI: i Figure 1 Non-contrast chest computed tomography demonstrates a round mass in the left inferior paramediastinal-pleural region with heterogeneous density (arrow). There is surgical hyperdense material seen at the margin of the round mass and right anterior lung region, which was from prior metastases resection. INTRODUCTION Pancreatic metastasis from osteosarcoma is an uncommon condition, seen in the very late stages of the disease. Metastatic lesions to the pancreas are usually solid masses. We present a case of cystic pancreatic metastasis in a patient with a history of osteogenic sarcoma with known metastasis involving the left lower lung lobe. CASE REPORT A 53-year-old female was referred to our hospital with abdominal pain, fullness and early satiety. She had been diagnosed with high-grade osteoblastic osteogenic sarcoma, giant cell rich, of her left distal femur four years earlier. She was treated with resection of the tumor and multiple chemotherapy agents. She developed several pulmonary metastases, with attempts at resection one year prior to the presentation. Two months prior to presentation she underwent a left video-assisted thoracoscopic surgery with resection of the lateral and posterior segment of the left lower lung (Figure 1). The final pathology from that surgery showed metastatic osteogenic sarcoma, giant cell rich, 6.5 cm in greatest dimension, invading the parietal pleura, focally involving the inked surgical margins (inferior pulmonary ligament). She had been recovering well from that surgical intervention when she was hospitalized with worsening abdominal pain, nausea, vomiting, and early satiety at an outside hospital. She was evaluated with computed tomography (CT) of the abdomen and pelvis, which showed a very large complex cystic mass anterior to the pancreas measuring 19 cm 6 cm. This appeared significantly enlarged from a month prior where an outside CT at that time showed an 11 cm 3 cm cystic pancreatic mass in the same location. The cystic mass contained enhancing soft tissue components posteriorly as well as solid components that appeared to have significantly enlarged. She was sent to interventional radiology for drainage of the cystic lesion where approximately 1400 cc s of fluid were obtained resulting in significant improvement of her symptoms. Cytologic analysis of the fluid at that time was negative for malignancy. Her pain was controlled with narcotics as needed, with plans for repeat ultrasound in two weeks for evaluation of fluid reaccumulation. Her abdominal symptoms initially were controlled, but returned several days later prompting her to present to our hospital. On initial exam at our hospital, she appeared emaciated and weak with abdominal fullness in the epigastric area without rebound appreciated on palpation. Review of her history revealed no personal history of pancreatitis or excessive alcohol use. Laboratory data showed an anemia with a hemoglobin of 8.1 g/dl, hyponatremia and hypokalemia with values of 130 mmol/l and 2.8 mmol/l respectively, and mildly elevated lipase measuring 185 U/L. Her serum CA 19-9 was elevated at 39.0 U/mL. Endoscopic ultrasound (EUS) was performed in our hospital, where extrinsic compression of the stomach was found along the posterior wall. An oval mass with both solid and cystic components was identified involving the genu, body, and tail of the pancreas. Normal pancreatic tissue was not well seen due to the size of the lesion with one large cystic component in the body and genu extending to the liver hilum (Figure 2A). The mass measured 11 cm 10 cm in size with blood flow observed within the solid component (Figure 2B). Diagnostic and therapeutic needle aspiration was performed, revealing a turbid, brown, thin liquid suggestive of old blood. Samples were sent for cell count and differential, amylase, cytology, microbiology and carcinoembryonic antigen (CEA). A total of 1000 cc s was aspirated from the cystic component, significantly reducing the cystic collection (Figure 2C). At the conclusion of the EUS, no overtly hypoechoic areas suspicious for 8453 July 21, 2015 Volume 21 Issue 27

248 Akpinar B et al. Cystic pancreatic lesion from osteosarcoma metastasis A B C Figure 2 Endoscopic ultrasound imaging. A: showing a large pancreatic cystic mass in the head/genu of the pancreas; B: showing blood flow within solid components of the pancreatic mass (blue Doppler flow); C: showing decompression of the pancreatic cystic lesion with residual solid component. malignancy were identified, with an initial differential diagnosis including solid pseudopapillary tumor vs serous cystadenoma with large cystic component. A pseudocyst was thought to be less likely due to the lack of pancreatitis by history. CT of the abdomen with and without contrast agent was performed after her EUS, showing a large multiloculated cystic mass extending from the hepatic hilum into the pelvis replacing a majority of the pancreatic parenchyma in the neck, body, and tail (Figure 3). The edges of the mass appeared to abut the liver at the gallbladder fossa as well as the right and left lobes with portions of the duodenum also encased by the mass. In addition, the distal portion of the stomach appeared compressed by the mass with resulting dilation in the fundus. The head and distal tail of the pancreas appeared normal other than possible minimal ductal dilation in the distal tail, and the bile ducts appeared non-dilated (Figure 3). Fluid analysis from her EUS guided fine needle aspiration had a cell count with /L nucleated cells and /L red blood cells. Cyst fluid CEA was 2.4 ng/ml and amylase was U/L suggesting against serous cystadenoma, pancreatic neuroendocrine tumor, solid pseudopapillary neoplasm, or mucinous cystadenoma. Cytology results confirmed malignant cells with numerous multinucleated giant cells, consistent with osteosarcoma metastasis to the pancreas. The tumor was highly cellular and showed frequent mitotic activity (17 mitoses per 10 high powered fields). When compared to the patient s prior lung resection for metastatic osteosarcoma, similar morphology was observed. While the differential for such findings also includes undifferentiated pancreatic carcinoma with osteoclast-like giant cells (which are negative for keratin markers 50% of the time), in light of the patient s oncologic history, this pancreatic cystic tumor was deemed to be an osteosarcoma metastasis. DISCUSSION Cystic pancreatic lesions may be classified into inflammatory fluid collections, non-neoplastic cysts, cystic neoplasms, and cystic degeneration of solid tumors (Table 1). Inflammatory fluid collections, which are not true epithelial cysts, can be subclassified into acute peripancreatic fluid collections, pseudocysts, acute necrotic collections, and walled-off pancreatic necrosis, according to the revised Atlanta classification [1]. Non-neoplastic pancreatic cysts have no malignant potential and include true cysts (benign epithelial cysts), retention cysts, mucinous non-neoplastic cysts [2] and lymphoepithelial cysts [3]. Pancreatic cystic neoplasms include serous cystic tumor, most of which are serous cystadenomas (SCA), mucinous cystic neoplasm (MCN), intraductal papillary mucinous neoplasm (IPMN) and solid pseudopapillary neoplasm (SPEN) [4]. MCNs and IPMNs are premalignant or malignant. SPENs are thought to have low malignant potential and SCAs have low or no malignant potential [5]. Necrotic degeneration 8454 July 21, 2015 Volume 21 Issue 27

249 Akpinar B et al. Cystic pancreatic lesion from osteosarcoma metastasis A B C Figure 3 Post-contrast venous phase abdominal computed tomography. a: demonstrating a large (20 cm 6 cm 12 cm) abdominal mass with peripheral rim enhancement as well as some areas of thickened nodular enhancement in the periphery. There is a wispy enhancing area of probable pancreatic tissue in the posterior mid aspect of the mass in the expected location of the pancreatic neck, body and proximal tail. The portal splenic confluence and downstream SMV are inseparable from the mass; B: The cystic mass abuts the liver at the gallbladder fossa, and surrounds the gallbladder (arrow); C: coronal reconstruction. Giant cysticpredominant mass (arrows) extends from the hepatic hilum, and surrounds the gallbladder. Table 1 Classification of the most common cystic pancreatic lesions Cystic pancreatic lesions Inflammatory fluid collections Acute peripancreatic fluid collections Pseudocysts Acute necrotic collections Walled-off pancreatic necrosis Non-neoplastic cysts True cysts (benign epithelial cysts) Retention cysts Mucinous non-neoplastic cysts Lymphoepithelial cysts Cystic neoplasms Serous cystadenoma Mucinous cystic neoplasm Intraductal papillary mucinous neoplasm Solid pseudopapillary neoplasm Cystic degeneration of solid tumors Neuroendocrine tumors Ductal adenocarcinoma Acinar cell carcinoma of solid tumors can be seen with neuroendocrine tumors, ductal adenocarcinomas, and acinar cell carcinoma. Follow-up and treatment options are based on the diagnostic criteria such as imaging findings and pathology results of biopsy specimens [6]. Pancreatic lesions are increasingly diagnosed with the use of radiologic examinations such as ultrasound, CT, magnetic resonance and lately EUS, which carries the benefit of needle aspiration via endosonographic guided biopsy. Pancreatic metastases are uncommon, but have been reported in malignancies originating in the lung, gastrointestinal tract, breast, kidneys, as well as in melanoma, lymphoma and sarcoma. Their incidence ranges from 1.6% to 12% at autopsy of cancer patients depending on the primary tumor location [7,8]. There are case reports of cystic metastasis to the pancreas from pulmonary carcinoma [9], as well as Merkel cell carcinoma, which is a primary neuroendocrine carcinoma of the skin [10]. Regarding osteosarcoma, it most commonly metastasizes to the lungs, followed by skeleton, pleura, heart and lymph nodes. Soft tissue or abdominal organ metastases are extremely rare but can be seen in late stages [11,12]. Calcification or ossification can be seen within the lesion [13]. There are few reports of pancreatic metastases from osteosarcoma in the literature. However, most of these are solid metastases [14-18]. There is a case report of a cystic-solid mass on the head of the pancreas with the diagnosis of metastatic osteosarcoma in an 18 year old, which was confirmed with endoscopic ultrasound-guided fine-needle aspiration of necrotic debris [19]. The pathophysiology of 8455 July 21, 2015 Volume 21 Issue 27

250 Akpinar B et al. Cystic pancreatic lesion from osteosarcoma metastasis the cystic component of the metastasis of osteosarcoma is unknown. Cystic, necrotic degeneration of the solid metastasis or pancreatitis secondary to the metastasis with development of associated fluid collection can be considered. Our current case presentation is even more unusual with a predominantly cystic osteosarcoma metastasis to the pancreas without evidence of calcification. Pancreatic metastases from osteosarcoma, although rare, may be seen more frequently with the continued improvement in treatment and increasing survival of patients with osteosarcoma. Furthermore, metastasis should remain a differential consideration even for a mostly cystic pancreatic mass in a patient with a known primary malignancy. COMMENTS Case characteristics A 53-years-old female with a history of osteosarcoma metastasize to lung presented with abdominal pain, fullness and early satiety. Clinical diagnosis Abdominal fullness in the epigastric area without rebound on palpation. Differential diagnosis Abdominal mass, enteric obstruction. Labaratory diagnosis HGB 8.1 g/dl, Na 130 mmol/l, K 2.8 mmol/l, serum lipase 185 U/L, serum CA U/mL. Imaging diagnosis Endoscopic ultrasound, computed tomography scan showed large multiloculated cystic mass (11 cm 10 cm) involving the genu, body, and tail of the pancreas, extending from the hepatic hilum into the pelvis. Pathological diagnosis Diagnostic needle aspiration cytology revealed malignant cells with numerous multinucleated giant cells, consistent with osteosarcoma metastasis to the pancreas. The tumor was highly cellular and showed frequent mitotic activity (17 mitoses per 10 high powered fields). Treatment Therapeutic needle aspiration was performed to control the abdominal symptoms. Related reports There are few reports of pancreatic metastases from osteosarcoma in the literature. However, most of these are solid metastases. The authors have found a case report of a cystic-solid mass on the head of the pancreas, which was an osteosarcoma metastasis, also diagnosed with endoscopic ultrasoundguided fine-needle aspiration of necrotic debris. Term explanation Cystic osteosarcoma metastasis to the pancreas is an unusual presentation of a metastatic lesion of pancreas, which can be seen with the increasing survival of patients with osteosarcoma. Experiences and lessons Pancreatic metastases from osteosarcoma, although rare, may be seen more frequently with the continued improvement in treatment and increasing survival of patients with osteosarcoma. Furthermore, metastasis should remain a differential consideration even if a cystic component is present within a pancreatic mass in a patient with known primary malignancy. Peer-review This is a straight forward case report of a metastatic bone tumor to the pancreas presenting as a cystic pancreatic mass lesion. The case raises several interesting points and the images are adequate. REFERENCES 1 Banks PA, Bollen TL, Dervenis C, Gooszen HG, Johnson CD, Sarr MG, Tsiotos GG, Vege SS. Classification of acute pancreatitis--2012: revision of the Atlanta classification and definitions by international consensus. Gut 2013; 62: [PMID: DOI: /gutjnl ] 2 Cao W, Adley BP, Liao J, Lin X, Talamonti M, Bentrem DJ, Rao SM, Yang GY. Mucinous nonneoplastic cyst of the pancreas: apomucin phenotype distinguishes this entity from intraductal papillary mucinous neoplasm. Hum Pathol 2010; 41: [PMID: DOI: /j.humpath ] 3 Ramsden KL, Newman J. Lymphoepithelial cyst of the pancreas. Histopathology 1991; 18: [PMID: ] 4 Aaltonen LA, Hamilton SR (Eds). Tumours of the exocrine pancreas. In: World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of the Digestive System. Lyon: IARC Press, 2000: Lee LS. Incidental Cystic Lesions in the Pancreas: Resect? EUS? Follow? Curr Treat Options Gastroenterol 2014; 12: [PMID: DOI: /s ] 6 Enestvedt BK, Ahmad N. To cease or de-cyst? The evaluation and management of pancreatic cystic lesions. Curr Gastroenterol Rep 2013; 15: 348 [PMID: DOI: /s y] 7 Adsay NV, Andea A, Basturk O, Kilinc N, Nassar H, Cheng JD. Secondary tumors of the pancreas: an analysis of a surgical and autopsy database and review of the literature. Virchows Arch 2004; 444: [PMID: ] 8 Washington K, McDonagh D. Secondary tumors of the gastrointestinal tract: surgical pathologic findings and comparison with autopsy survey. Mod Pathol 1995; 8: [PMID: ] 9 Ramirez Plaza CP, Suàrez Muñoz MA, Santoyo Santoyo J, Perez Lara FJ, Iaria M, Raso L, Fernandez Aguilar JL, Jimenez Hernandez M, Arrabal Sànchez R, Bondia Navarro JA, de la Fuente Perucho A. [Pancreatic cystic metastasis from pulmonary carcinoma. Report of a case]. Ann Ital Chir 2001; 72: [PMID: ] 10 Bachmeyer C, Alovor G, Chatelain D, Khuoy L, Turc Y, Danon O, Laurette F, Cazier A, N Guyen V. Cystic metastasis of the pancreas indicating relapse of Merkel cell carcinoma. Pancreas 2002; 24: [PMID: ] 11 Wolf R, Wolf RF, Hoekstra HJ. Recurrent, multiple, calcified soft tissue metastases from osteogenic sarcoma without pulmonary involvement. Skeletal Radiol 1999; 28: [PMID: ] 12 Kim SJ, Choi JA, Lee SH, Choi JY, Hong SH, Chung HW, Kang HS. Imaging findings of extrapulmonary metastases of osteosarcoma. Clin Imaging 2004; 28: [PMID: ] 13 Avcu S, Akdeniz H, Arslan H, Toprak N, Unal O. A case of primary vertebral osteosarcoma metastasizing to pancreas. JOP 2009; 10: [PMID: ] 14 Bertucci F, Araujo J, Giovannini M. Pancreatic metastasis from osteosarcoma and Ewing sarcoma: literature review. Scand J Gastroenterol 2013; 48: 4-8 [PMID: DOI: / ] 15 Mulligan ME, Fellows DW, Mullen SE. Pancreatic metastasis from Ewing s sarcoma. Clin Imaging 1997; 21: [PMID: ] 16 Obuz F, Kovanlikaya A, Olgun N, Sarialioğlu F, Ozer E. MR imaging of pancreatic metastasis from extraosseous Ewing s sarcoma. Pancreas 2000; 20: [PMID: ] 17 Aarvold A, Bann S, Giblin V, Wotherspoon A, Mudan SS. Osteosarcoma metastasising to the duodenum and pancreas. J Bone Joint Surg Br 2007; 89: [PMID: ] 8456 July 21, 2015 Volume 21 Issue 27

251 Akpinar B et al. Cystic pancreatic lesion from osteosarcoma metastasis 18 Lasithiotakis K, Petrakis I, Georgiadis G, Paraskakis S, Chalkiadakis G, Chrysos E. Pancreatic resection for metastasis to the pancreas from colon and lung cancer, and osteosarcoma. JOP 2010; 11: [PMID: ] 19 Jin P, Wang W, Su H, Sheng JQ. Osteosarcoma metastasizing to pancreas confirmed by endoscopic ultrasound-guided fine-needle aspiration. Endoscopy 2014; 46 Suppl 1 UCTN: E109-E110 [PMID: DOI: /s ] P- Reviewer: Mel Wilcox C S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8457 July 21, 2015 Volume 21 Issue 27

252 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. CASE REPORT Resected tumor seeding in stomach wall due to endoscopic ultrasonography-guided fine needle aspiration of pancreatic adenocarcinoma Akiko Tomonari, Akio Katanuma, Tomoaki Matsumori, Hajime Yamazaki, Itsuki Sano, Ryuki Minami, Manabu Sen-yo, Satoshi Ikarashi, Toshifumi Kin, Kei Yane, Kuniyuki Takahashi, Toshiya Shinohara, Hiroyuki Maguchi Akiko Tomonari, Akio Katanuma, Hajime Yamazaki, Itsuki Sano, Ryuki Minami, Manabu Sen-yo, Satoshi Ikarashi, Toshifumi Kin, Kei Yane, Kuniyuki Takahashi, Hiroyuki Maguchi, Center for Gastroenterology, Teine-Keijinkai Hospital, Sapporo , Japan Tomoaki Matsumori, Department of Gastroenterology and Hepatology, Kyoto University Graduate School of Medicine, Kyoto , Japan Fax: Received: December 21, 2014 Peer-review started: December 22, 2014 First decision: January 8, 2015 Revised: February 10, 2015 Accepted: March 27, 2015 Article in press: March 27, 2015 Published online: July 21, 2015 Toshiya Shinohara, Department of Pathology, Teine-Keijinkai Hospital, Sapporo , Japan Author contributions: All authors helped to perform the research; Tomonari A wrote the paper; all authors have approved the final draft of the manuscript. Institutional review board statement: Teine-keijinkei Hospital Institutional Review Board for Conduction and Submission of the study. Informed consent statement: The patient provided informed consent prior to study enrollment. Conflict-of-interest statement: To the best of our knowledge, no conflict of interest, financial or other, exists to any authors listed in this manuscript. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Akiko Tomonari, MD, Center for Gastroenterology, Teine-Keijinkai Hospital, Maeda, Teine-ku, Sapporo , Japan. narinarinarii@yahoo.co.jp Telephone: Abstract Endoscopic ultrasonography-guided fine needle aspiration (EUS-FNA) is a useful and relatively safe tool for the diagnosis and staging of pancreatic cancer. However, there have recently been several reports of tumor seeding after EUS-FNA of adenocarcinomas. A 78-year-old man was admitted to our hospital due to upper gastric pain. Examinations revealed a 20 mm mass in the pancreatic body, for which EUS-FNA was performed. The cytology of the lesion was adenocarcinoma, and the stage of the cancer was T3N0M0. The patient underwent surgery with curative intent, followed by adjuvant chemotherapy with S-1. An enlarging gastric submucosal tumor was found on gastroscopy at 28 mo after surgery accompanied by a rising level of CA19-9. Biopsy result was adenocarcinoma, consistent with a pancreatic primary tumor. Tumor seeding after EUS-FNA was strongly suspected. The patient underwent surgical resection of the gastric tumor with curative intent. The pathological result of the resected gastric specimen was adenocarcinoma with a perfectly matched mucin special stain result with the previously resected pancreatic cancer. This is the first case report of tumor seeding after EUS-FNA which was surgically resected and inspected pathologically. Key words: Endoscopic ultrasonography-guided fine 8458 July 21, 2015 Volume 21 Issue 27

253 Tomonari A et al. Tumor seeding to stomach after EUS-FNA needle aspiration; Tumor seeding; Pancreatic cancer The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: This manuscript is the first case report about tumor seeding after endoscopic ultrasonographyguided fine needle aspiration (EUS-FNA) which was surgically resected and inspected pathologically. EUS-FNA is a widely performed procedure; however, there are no clear guidelines indicating the selection of treatments in cases of tumor seeding after the procedure, as this adverse event is relatively rare. This manuscript may help in the selection of patients undergoing EUS-FNA, and clarifies the points we should be careful about after the procedure. Figure 1 Computed tomography showing a 20-mm mass lesion in the pancreatic body (arrow). Tomonari A, Katanuma A, Matsumori T, Yamazaki H, Sano I, Minami R, Sen-yo M, Ikarashi S, Kin T, Yane K, Takahashi K, Shinohara T, Maguchi H. Resected tumor seeding in stomach wall due to endoscopic ultrasonography-guided fine needle aspiration of pancreatic adenocarcinoma. World J Gastroenterol 2015; 21(27): Available from: URL: wjgnet.com/ /full/v21/i27/8458.htm DOI: org/ /wjg.v21.i INTRODUCTION Endoscopic ultrasonography-guided fine needle aspiration (EUS-FNA) is a useful and relatively safe tool for the diagnosis and staging of pancreatic cancer. The reported complication rates of EUS-FNA are low (< 1% in large centers [1] ), and the risks of tumor seeding are lower compared to transcutaneous methods [2,3]. However, there have recently been several reports of tumor seeding after EUS-FNA of non-cystic solid adenocarcinomas [4,5]. The previously reported cases were all diagnosed at unresectable stages when the tumor seeding lesions were found. This is the first case report of tumor seeding after EUS-FNA which was surgically resected and inspected pathologically. CASE REPORT A 78-year-old man with persistent upper gastric pain was referred to our center for detailed examination. Computed tomography (CT) revealed a 20-mmdiameter hypodense mass lesion in the pancreatic body, with an upstream dilatation of the main pancreatic duct (Figure 1). CA19-9 was abnormal with a level of ku/ml (normal range, ku/ml). At EUS, the patient had a 21-mm-diameter hypoechoic mass in the pancreatic body. EUS-FNA of the mass was performed using a 22-G needle (Expect, Boston Scientific, Natick, MA) (Figure 2). Suction was applied at each pass, and a total of two passes were made. Cytology of the lesion revealed an adenocarcinoma. Figure 2 Endoscopic ultrasonography-guided fine needle aspiration of the 20-mm hypoechoic mass lesion was performed using a 22-G needle. No metastatic disease was found and the patient underwent surgery with curative intent. There were no liver metastases, ascites, or peritoneal implantation at surgery. An intra-operative frozen section diagnosis of a lymph node around the abdominal aorta was performed, which revealed to be negative for metastasis. A 20-mm palpable mass was identified, with evidence of inflammation in the distal pancreas. Distal pancreatectomy and splenectomy were performed. Histology of the specimen revealed a 25 mm 25 mm mass with no lymphatic or vascular involvement, and the resection margins were negative for malignancy. There were no abnormalities in the spleen. The final diagnosis was T3N0M0 with an extension of moderately differentiated adenocarcinoma beyond the pancreas in the ventral direction. The patient underwent adjuvant chemotherapy with S-1 starting at 2 mo after surgery. At 9 mo after surgery, a periodical follow-up gastroscopy performed at a private clinic revealed a 5-mm-diameter submucosal tumor at the posterior wall of the gastric body. The patient had no symptoms at that time. The private clinician who had performed the exam made the decision to follow the submucosal tumor, and gastroscopy was repeated after 2 mo, which showed no changes in the shape or the size of the submucosal tumor. At 8 mo after surgery, CA19-9 level gradually started to rise. Gastroscopy performed at 28 mo 8459 July 21, 2015 Volume 21 Issue 27

254 Tomonari A et al. Tumor seeding to stomach after EUS-FNA A Figure 3 Submucosal tumor at the gastric body increased in size at 28 mo after surgery. B Figure 4 Computed tomography shows the submucosal tumor located adjacent to the pancreatic resection site. after surgery revealed an increase in the size of the submucosal tumor, and at this point, the patient was referred to our center for further examinations (Figure 3). Histology of the lesion indicated adenocarcinoma, consistent with a pancreatic primary tumor. CT showed a 28-mm submucosal tumor adjacent to the pancreatic resection site (Figure 4). There were no apparent metastatic lesions, and the patient underwent surgery with curative intent. Subtotal gastrectomy was performed. Histology of the specimen revealed a 32 mm 30 mm submucosal tumor, consisting of moderately to well differentiated adenocarcinoma (Figure 5). The specimen was positive for vascular and lymphatic involvement. Mucin special stain results for the resected stomach specimen were MUC1 positive, MUC2 negative, MUC5AC positive, and MUC6 negative. Mucin special stains for the previously resected specimen of the pancreas were additionally performed. The results were MUC1 positive, MUC2 negative, MUC5AC positive, and MUC6 negative, which were perfectly compatible with the resected stomach lesion. DISCUSSION Although gastric recurrence of adenocarcinoma may Figure 5 Resected specimen of the needle tract seeding in the stomach. The tumor is 25 mm 25 mm, with a whitish appearance (A). The tumor is located in the submucosal layer (B). Hematoxylin and eosin staining. occur by direct invasion, the resected specimen in this case strongly suggests tumor seeding after EUS- FNA due to the facts that its origin is submucosal, and the mucin special stains were perfectly matched to the original pancreatic cancer. There has been a retrospective study which reported that there is no association with an increased rate of gastric or peritoneal cancer recurrence following EUS-FNA [6]. However, it is also true that there have been several reports of tumor seeding after the procedure. This may be due to the rate of tumor seeding after EUS- FNA being so low that it is statistically difficult to establish an association between the procedure and the recurrence. Also, unresected recurrences are difficult to distinguish between direct invasion and tract seeding, and this may contribute to the fact that the 8460 July 21, 2015 Volume 21 Issue 27

255 Tomonari A et al. Tumor seeding to stomach after EUS-FNA reported incidence rate of seeding is so low. EUS-FNA is an important procedure usually performed pre-operatively to determine the indication of surgical resection of the tumor. The reported incidences of tumor seeding are so low that the advantage of performing EUS-FNA before surgery may not outweigh the risk of needle tract seeding. However, as the number of EUS-FNA is expected to continue to increase, the possibility of post-procedural EUS-FNA needle tract seeding should always be minded. In cases when surgical resection will not include the needle tract (e.g., resection of the tail/body of the pancreas), EUS- FNA should be either avoided, or the number of needle passes limited. When EUS-FNA is indispensable for the diagnosis and treatment of the disease, excision of the needle tract path may be necessary for consideration. When this is not possible, close periodical examinations including gastroscopy should be scheduled for patients who undergo EUS-FNA without needle tract resection. COMMENTS Case characteristics A case of tumor seeding of a pancreatic adenocarcinoma in the stomach wall at the endoscopic ultrasonography-guided fine needle aspiration (EUS-FNA) puncture site, was treated surgically and inspected pathologically. Clinical diagnosis A submucosal tumor of the stomach wall found at a periodical post-operative endoscopy was suspected as a seeding tumor recurrence of the resected pancreatic adenocarcinoma. Differential diagnosis Pancreatic adenocarcinoma metastasis or a new completely separate submucosal lesion such as a GIST. Laboratory diagnosis Periodical tumor marker follow-ups were performed, showing a gradual CA19-9 increase. Imaging diagnosis Periodical gastroscopy revealed a lesion in a submucosal tumor form at the puncture site of the EUS-FNA which was performed preoperatively. Pathological diagnosis Endoscopically performed biopsy revealed an adenocarcinoma, leading to the suspicion of a tumor recurrence as a seeding after EUS-FNA. Treatment Subtotal gastrectomy was performed, and mucin special stain results for the resected stomach specimen were perfectly compatible with the previously resected pancreatic adenocarcinoma. Experiences and lessons When EUS-FNA is indispensable for the diagnosis and treatment of the disease, excision of the needle tract path may be necessary for consideration. When this is not possible, close periodical examinations including gastroscopy should be scheduled for patients who undergo EUS-FNA without needle tract resection. Peer-review This is a rare case of tumor recurrence of a pancreatic adenocarcinoma as seeding after EUS-FNA, treated surgically and inspected pathologically. REFERENCES 1 Carrara S, Arcidiacono PG, Mezzi G, Petrone MC, Boemo C, Testoni PA. Pancreatic endoscopic ultrasound-guided fine needle aspiration: complication rate and clinical course in a single centre. Dig Liver Dis 2010; 42: [PMID: DOI: / j.dld ] 2 Smith EH. Complications of percutaneous abdominal fine-needle biopsy. Review. Radiology 1991; 178: [PMID: DOI: /radiology ] 3 Micames C, Jowell PS, White R, Paulson E, Nelson R, Morse M, Hurwitz H, Pappas T, Tyler D, McGrath K. Lower frequency of peritoneal carcinomatosis in patients with pancreatic cancer diagnosed by EUS-guided FNA vs. percutaneous FNA. Gastrointest Endosc 2003; 58: [PMID: DOI: /S (03) ] 4 Paquin SC, Gariépy G, Lepanto L, Bourdages R, Raymond G, Sahai AV. A first report of tumor seeding because of EUS-guided FNA of a pancreatic adenocarcinoma. Gastrointest Endosc 2005; 61: [PMID: DOI: /S (05) ] 5 Katanuma A, Maguchi H, Hashigo S, Kaneko M, Kin T, Yane K, Kato R, Kato S, Harada R, Osanai M, Takahashi K, Shinohara T, Itoi T. Tumor seeding after endoscopic ultrasound-guided fineneedle aspiration of cancer in the body of the pancreas. Endoscopy 2012; 44 Suppl 2 UCTN: E160-E161 [PMID: DOI: /s ] 6 Ngamruengphong S, Xu C, Woodward TA, Raimondo M, Stauffer JA, Asbun HJ, Wallace MB. Risk of gastric or peritoneal recurrence, and long-term outcomes, following pancreatic cancer resection with preoperative endosonographically guided fine needle aspiration. Endoscopy 2013; 45: [PMID: DOI: /s ] P- Reviewer: Altonbary AY, Hirahara N S- Editor: Qi Y L- Editor: Wang TQ E- Editor: Liu XM 8461 July 21, 2015 Volume 21 Issue 27

256 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. CASE REPORT Acute appendicitis following endoscopic mucosal resection of cecal adenoma Yukako Nemoto, Junya Tokuhisa, Nagasato Shimada, Tatsuya Gomi, Iruru Maetani Yukako Nemoto, Junya Tokuhisa, Nagasato Shimada, Iruru Maetani, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Toho University Ohashi Medical Center, Tokyo , Japan Tatsuya Gomi, Department of Radiology, Toho University Ohashi Medical Center, Tokyo , Japan Author contributions: Nemoto Y did study design and manuscript preparation; Nemoto Y, Tokuhisa J and Shimada N did clinical diagnosis and management; Gomi T contributed to radiological diagnosis; and Maetani I did manuscript revision. Institutional review board statement: The study was reviewed and approved by the Toho University Ohashi Medical Center Institutional Review Board. Informed consent statement: All study participants provided informed written consent prior to study enrollment. Conflict-of-interest statement: None of the authors has a conflict of interest. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Yukako Nemoto, MD, PhD, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Toho University Ohashi Medical Center, , Ohashi, Meguro-ku, Tokyo Japan. yukako.nemoto@med.toho-u.ac.jp Telephone: Fax: Received: February 9, 2015 Peer-review started: February 10, 2015 First decision: April 13, 2015 Revised: April 27, 2015 Accepted: May 21, 2015 Article in press: May 21, 2015 Published online: July 21, 2015 Abstract Endoscopic mucosal resection (EMR) allows the removal of flat or sessile lesions, laterally spreading tumors, and carcinoma of the colon or the rectum limited to the mucosa or the superficial submucosa. Acute appendicitis is the most common abdominal emergency requiring emergency surgery, and it is also a rare complication of diagnostic colonoscopy and therapeutic endoscopy, including EMR. In the case presented here, a 53-year-old female underwent colonoscopy due to a positive fecal occult blood test and was diagnosed with cecal adenoma. She was referred to our hospital and admitted for treatment. The patient had no other symptoms. EMR was performed, and 7 h after the surgery, the patient experienced right -lower abdominal pain. Laboratory tests performed the following day revealed a WBC count of 16000/mm 3, a neutrophil count of 14144/mm 3, and a C-reactive protein level of 2.20 mg/dl, indicating an inflammatory response. Computed tomography also revealed appendiceal wall thickening and swelling, so acute appendicitis following EMR was diagnosed. Antibiotics were initiated leading to total resolution of the symptoms, and the patient was discharged on the sixth post-operative day. Pathological analysis revealed a high-grade cecal tubular adenoma. Such acute appendicitis following EMR is extremely rare, and EMR of the cecum may be a rare cause of acute appendicitis. Key words: Acute appendicitis; Endoscopic mucosal resection; Cecal adenoma; Antibiotics; Computed tomography The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved July 21, 2015 Volume 21 Issue 27

257 Nemoto Y et al. Appendicitis after endoscopic mucosal resection Core tip: We report a case of a 53-year-old female who underwent colonoscopy and was diagnosed with cecal adenoma. Endoscopic mucosal resection (EMR) was performed, and she experienced right-lower abdominal pain 7 h post surgery. The following day, laboratory tests revealed a neutrophil count of 14144/mm 3, and a C-reactive protein level of 2.20 mg/dl. Computed tomography also revealed appendiceal wall thickening and swelling, so acute appendicitis following EMR was diagnosed. Antibiotics were initiated leading to total symptom resolution, and the patient was discharged on the sixth post-operative day. Acute appendicitis following EMR is rare, and cecal EMR may be a rare cause of acute appendicitis. Nemoto Y, Tokuhisa J, Shimada N, Gomi T, Maetani I. Acute appendicitis following endoscopic mucosal resection of cecal adenoma. World J Gastroenterol 2015; 21(27): Available from: URL: v21/i27/8462.htm DOI: i a large IIa LST (granular -type) was found adjacent to the orifice of appendix (Figure 1). The size of the lesion was 20 mm 12 mm 2 mm. There was no post-procedural bleeding. Pathological examination revealed a high-grade tubular adenoma. The patient was asymptomatic until developing mild rightlower abdominal pain 7 h after the EMR. At 20 h post-emr, she had low-grade fever and localized rebound tenderness was present at McBurney s point. Laboratory tests revealed a WBC count of 16000/mm 3, a neutrophil count of 14144/mm 3, and a CRP level of 2.20 mg/dl, indicating an inflammatory response. Intravenous antibiotics (fosfomycin sodium, 4 g/d) were initiated, and on the third postoperative day, the inflammation decreased, and the symptoms markedly improved. Abdominal and pelvic computed tomography (CT) revealed appendiceal wall thickening and swelling (Figures 2a and 2b), leading to a diagnosis of acute appendicitis following EMR. Oral intake was resumed on the fifth postoperative day, and the patient was discharged the following day. She has remained well and symptom free since discharge. INTRODUCTION Endoscopic mucosal resection (EMR), which involves snare resection of dysplastic lesions, is an endoscopic alternative to surgical resection of mucosal and submucosal neoplastic lesions and intra-mucosal cancers. Complications of EMR, including bleeding and perforation, have been reported. Appendicitis is one of the most common causes of acute abdomen and one of the most frequent indications for emergency abdominal surgery worldwide [1,2]. Appendicitis is also a rare complication of diagnostic colonoscopy and therapeutic endoscopic procedures, including EMR [3-7]. Here, we report a case of acute appendicitis following EMR of a cecal adenoma. Case report A 53-year-old female underwent colonoscopy following a positive fecal occult blood test, and a 15-mm cecal laterally spreading tumor (LST) was detected. The patient was then referred to our hospital and admitted for treatment of the cecal adenoma. She had no previous abdominal surgery and no history of smoking or alcohol consumption. Laboratory analysis revealed 7100 leukocytes/mm 3, and a C-reactive protein (CRP) level of 0.01 mg/dl. Other parameters were also within normal limits. On examination, the patient had a heart rate of 77 beats/min, a blood pressure of 110/62 mmhg, a temperature of 36.6, and a BMI of 18.0 kg/m 2. There was no abdominal pain, and her bowel sounds were normal on abdominal examination. Additionally, plain abdominal radiology demonstrated normal gas. The patient underwent colonoscopy for EMR, and DISCUSSION Acute appendicitis is the most frequent cause of acute abdominal emergencies [1]. Although the precise pathogenic mechanism is unknown, potential causes include one or more of the following: bacterial infection, viral infection, a foreign body, an allergic reaction, and circulatory disease (ischemia). Blockage or stenosis of the appendiceal lumen is observed in most cases of acute appendicitis, which may be caused by foreign bodies, including food residue, fecal matter, mucous membrane epithelial hyperplasia, follicular hyperplasia, adenoma, and adenocarcinoma [2]. Acute appendicitis caused by neighboring inflammatory conditions, including enteritis, and diverticulitis, is known as non-obstructive appendicitis and is managed conservatively. Non-obstructive appendicitis may be diagnosed bases on the extent and degree of abnormal findings in the neighboring intestinal tract [8]. In particular, multi-detector CT has a sensitivity of 98.5% and a specificity of 98% for detecting acute appendicitis [9]. Physical examination is crucial in the diagnosis of acute appendicitis, and emergency surgery is considered as the standard treatment. However, the treatment of acute appendicitis has diversified due to advances in imaging and antibiotics and increasing use of laparoscopic surgery. As a result, non-operative therapy, delayed appendectomy, and interval appendectomy have all become widely accepted for patients with non-perforated appendicitis [1]. Colorectal adenomas represent the single most important premalignant lesion of the gastrointestinal tract worldwide, and large (> 20-mm) colorectal polyps have been found in 0.8%-5.2% of patients 8463 July 21, 2015 Volume 21 Issue 27

258 Nemoto Y et al. Appendicitis after endoscopic mucosal resection A B C D Figure 1 Endoscopic views. a: A large IIa lesion [laterally spreading tumor (LST) of the granular type, or LST-G lesion located in the cecum. The tumor was estimated to be 15 -mm in diameter; b: After an injection of glycerol into the submucosal layer, the tumor nearly obstructed the orifice of the appendix; c: Ulcer appearance after successful endoscopic mucosal resection, without any complications; d: The ulcer was sutured using two clips, and the appendiceal orifice was avoided. A B Figure 2 Abdominal contrast-enhanced computed tomography showing appendiceal wall thickening and swelling. a: Axial section; b: Sagittal section. undergoing colonoscopy for different indications [10]. In general, when candidate polyps for colorectal EMR are smaller than 20-mm in size, EMR techniques achieve satisfactory rates of en bloc and complete resection. Currently, however, there are no uniformly accepted infection prevention techniques or electrocautery settings [11]. It is possible that more than one mechanism contributes to the inflammatory process, triggered by either the preparation and or the procedure itself [12]. In our case, colonoscopy was initially performed. Acute appendicitis following colonoscopy is thought to be caused by increased intra luminal pressure due to overinflation with air and by secondary obstruction of the appendiceal orifice due to inflammation of intestinal contents, including fecaliths and fecal matter [6]. However, regardless of whether post-colonoscopy appendicitis represents an incidental finding or a true complication of colonoscopy, it is important to consider acute appendicitis as a differential diagnosis of the acute abdomen after colonoscopy [7]. Glycerol was then injected into the submucosal layer. Submucosal injection, which elevates the mucosa to be resected and protects the muscularis propria from injury, is believed to reduce thermal injury as well as the risk of perforation and hemorrhage [13]. Although 8464 July 21, 2015 Volume 21 Issue 27

259 Nemoto Y et al. Appendicitis after endoscopic mucosal resection glycerol is not thought to cause tissue damage [14], one study reported that submucosal injection may be due to a misdirected injection outside the bowel wall [15]. In the case described here, the LST was cut using a snare and coagulative diathermy. Post-polypectomy coagulation syndrome (PPCS), also known as postpolypectomy syndrome or transmural burn syndrome, refers to the development of abdominal pain, fever, leukocytosis, and peritoneal inflammation in the absence of frank perforation following colonoscopic polypectomy with electrocoagulation [16-25]. Recognition of PPCS is important to avoid unnecessary exploratory laparotomy because the syndrome has been shown to resolve with conservative treatment in most patients. The EMR ulcer was sutured with two clips in the current case. Recently, it was reported that prophylactic clipping of the resection sites after EMR of an LST using low-power coagulation current reduced the risk of delayed postpolypectomy hemorrhage [26]. Trauma or physical irritation of the resection site during clipping is thought to be a causative factor. In our patient, submucosal glycerol injection and electrocoagulation seemed to cause a greater degree of appendicitis than in previously reported cases. As the location of the LST was adjacent to the appendiceal orifice, it led to obstruction of the appendiceal lumen. Theoretically, submucosal injection may reduce the risk of PPCS [27], and we also made a deliberate attempt to approach the injection site in a tangential fashion to avoid administering the injection outside the bowel wall. PPCS develops when the electrical current applied during colonoscopic polypectomy extends past the mucosa into the muscularis propria and serosa, resulting in a transmural burn, without perforation [20-25]. In previous reports, the median durations of therapeutic fasting, hospitalization, and antibiotic use were 3, 5.5, and 7 days, respectively [27], whereas our patient had a shorter course. Two cases of acute appendicitis after EMR have been reported [6]. Similar to the present case, these cases involved EMR of a cecal adenoma adjacent to the appendiceal orifice. One patient (without clipping) had a severe inflammatory reaction after EMR, and the other patient (with clipping) had a mild inflammatory reaction. Considering those cases along with ours, clipping does not appear to influence appendicitis. However, it might be useful to avoid clipping of the appendiceal orifice to prevent appendicitis when lesions scheduled for EMR are in close proximity to the appendix. Additionally, the clinical courses of the two previously reported cases of post-emr appendicitis were similar to those observed in PPCS, so the adenoma location is a likely risk factor for appendicitis after EMR. Furthermore, submucosal injection may obstruct the appendiceal orifice and PPCS may lead to appendiceal edema. Prophylactic antibiotic administration prior to the treatment of an appendiceal LST may be effective in preventing appendicitis, and prompt diagnosis of appendicitis following EMR can facilitate medical treatment, without the need for surgical intervention. Here, we reported a case of acute appendicitis following EMR of a cecal LST, which was successfully treated with antibiotics. Cecal EMR may thus be a rare cause of acute appendicitis. COMMENTS Case characteristics A 53-year-old female presented with right-lower abdominal pain 7 h after endoscopic mucosal resection of a cecal adenoma. Clinical diagnosis Acute appendicitis. Differential diagnosis Post-polypectomy coagulation syndrome, thermal injury, bleeding, perforation, peritonitis. Laboratory diagnosis The patient had elevated hematological values, including a neutrophil count of 14144/mm 3 and a C-reactive protein level of 2.20 mg/dl. Imaging diagnosis Competed tomography showed appendiceal wall thickening and swelling. Pathological diagnosis Pathological analysis showed a high-grade cecal tubular adenoma. Treatment Antibiotics were initiated leading to total resolution of the symptoms. Related reports Two cases of acute appendicitis following endoscopic mucosal resection (EMR) have been reported. Term explanation Acute appendicitis is the most common abdominal emergency and is also a rare complication of diagnostic colonoscopy and therapeutic endoscopy. Experiences and lessons This case report presents the clinical characteristics of acute appendicitis following EMR. Prompt diagnosis of appendicitis following EMR can facilitate medical treatment, without the need for surgical intervention. Peer-review The authors have described acute appendicitis following EMR. The article highlights the clinical characteristics of acute appendicitis following EMR and suggests that EMR of the cecum may be a rare cause of acute appendicitis. REFERENCES 1 Shogilev DJ, Duus N, Odom SR, Shapiro NI. Diagnosing appendicitis: evidence-based review of the diagnostic approach in West J Emerg Med 2014; 15: [PMID: DOI: /westjem ] 2 Humes DJ, Simpson J. Acute appendicitis. BMJ 2006; 333: [PMID: DOI: /bmj AE] 3 Houghton A, Aston N. Appendicitis complicating colonoscopy. Gastrointest Endosc 1988; 34: 489 [PMID: DOI: /S (88) ] 4 Izzedine H, Thauvin H, Maisel A, Bourry E, Deschamps A. Postcolonoscopy appendicitis: case report and review of the literature. Am J Gastroenterol 2005; 100: [PMID: DOI: /j _5.x] 5 Shaw D, Gallardo G, Basson MD. Post-colonoscopy appendicitis: A case report and systematic review. World J Gastrointest Surg 2013; 5: [PMID: DOI: /wjgs. v5.i10.259] 6 Horimatsu T, Fu KI, Sano Y, Yano T, Saito Y, Matsuda T, Fujimori T, Yoshida S. Acute appendicitis as a rare complication after endoscopic mucosal resection. Dig Dis Sci 2007; 52: [PMID: ] 8465 July 21, 2015 Volume 21 Issue 27

260 Nemoto Y et al. Appendicitis after endoscopic mucosal resection 7 Wong GYM, Stranz CV. Acute Appendicitis Following Colonoscopy. CRSLS 2014; 121 [DOI: /CRSLS ] 8 Roberts KE, Starker LF, Duffy AJ, Bell RL, Bokhari J. Stump appendicitis: a surgeon s dilemma. JSLS 2011; 15: [PMID: DOI: / X ] 9 Pickhardt PJ, Lawrence EM, Pooler BD, Bruce RJ. Diagnostic performance of multidetector computed tomography for suspected acute appendicitis. Ann Intern Med 2011; 154: , W-291 [PMID: DOI: / ] 10 Puli SR, Kakugawa Y, Gotoda T, Antillon D, Saito Y, Antillon MR. Meta-analysis and systematic review of colorectal endoscopic mucosal resection. World J Gastroenterol 2009; 15: [PMID: DOI: /wjg ] 11 Edmundowicz SA. To clip or not to clip: is that the question? Gastrointest Endosc 2013; 77: [PMID: DOI: /j.gie ] 12 Saito Y, Uraoka T, Yamaguchi Y, Hotta K, Sakamoto N, Ikematsu H, Fukuzawa M, Kobayashi N, Nasu J, Michida T, Yoshida S, Ikehara H, Otake Y, Nakajima T, Matsuda T, Saito D. A prospective, multicenter study of 1111 colorectal endoscopic submucosal dissections (with video). Gastrointest Endosc 2010; 72: [PMID: DOI: /j.gie ] 13 Yeh RW, Triadafilopoulos G. Submucosal injection: safety cushion at what cost? Gastrointest Endosc 2005; 62: [PMID: DOI: /j.gie ] 14 Fujishiro M, Yahagi N, Kashimura K, Matsuura T, Nakamura M, Kakushima N, Kodashima S, Ono S, Kobayashi K, Hashimoto T, Yamamichi N, Tateishi A, Shimizu Y, Oka M, Ichinose M, Omata M. Tissue damage of different submucosal injection solutions for EMR. Gastrointest Endosc 2005; 62: [PMID: DOI: /j.gie ] 15 Binmoeller KF. Underwater endoscopic mucosal resection. J Interv Gastroenterol 2014; 4: [DOI: /jig.168] 16 Heldwein W, Dollhopf M, Rösch T, Meining A, Schmidtsdorff G, Hasford J, Hermanek P, Burlefinger R, Birkner B, Schmitt W. The Munich Polypectomy Study (MUPS): prospective analysis of complications and risk factors in 4000 colonic snare polypectomies. Endoscopy 2005; 37: [PMID: DOI: /s ] 17 Arora G, Mannalithara A, Singh G, Gerson LB, Triadafilopoulos G. Risk of perforation from a colonoscopy in adults: a large population-based study. Gastrointest Endosc 2009; 69: [PMID: DOI: /j.gie ] 18 Watabe H, Yamaji Y, Okamoto M, Kondo S, Ohta M, Ikenoue T, Kato J, Togo G, Matsumura M, Yoshida H, Kawabe T, Omata M. Risk assessment for delayed hemorrhagic complication of colonic polypectomy: polyp-related factors and patient-related factors. Gastrointest Endosc 2006; 64: [PMID: DOI: /j.gie ] 19 Tolliver KA, Rex DK. Colonoscopic polypectomy. Gastroenterol Clin North Am 2008; 37: , ix [PMID: DOI: /j.gtc ] 20 Waye JD. Management of complications of colonoscopic polypectomy. Gastroenterologist 1993; 1: [PMID: ] 21 Waye JD, Lewis BS, Yessayan S. Colonoscopy: a prospective report of complications. J Clin Gastroenterol 1992; 15: [PMID: ] 22 Waye JD, Kahn O, Auerbach ME. Complications of colonoscopy and flexible sigmoidoscopy. Gastrointest Endosc Clin N Am 1996; 6: [PMID: ] 23 Christie JP, Marrazzo J. Mini-perforation of the colon--not all postpolypectomy perforations require laparotomy. Dis Colon Rectum 1991; 34: [PMID: ] 24 Nivatvongs S. Complications in colonoscopic polypectomy: lessons to learn from an experience with 1576 polyps. Am Surg 1988; 54: [PMID: ] 25 Nelson DB, McQuaid KR, Bond JH, Lieberman DA, Weiss DG, Johnston TK. Procedural success and complications of large-scale screening colonoscopy. Gastrointest Endosc 2002; 55: [PMID: DOI: /mge ] 26 Liaquat H, Rohn E, Rex DK. Prophylactic clip closure reduced the risk of delayed postpolypectomy hemorrhage: experience in 277 clipped large sessile or flat colorectal lesions and 247 control lesions. Gastrointest Endosc 2013; 77: [PMID: DOI: /j.gie ] 27 Cha JM, Lim KS, Lee SH, Joo YE, Hong SP, Kim TI, Kim HG, Park DI, Kim SE, Yang DH, Shin JE. Clinical outcomes and risk factors of post-polypectomy coagulation syndrome: a multicenter, retrospective, case-control study. Endoscopy 2013; 45: [PMID: DOI: /s ] P- Reviewer: Leung FW S- Editor: Ma YJ L- Editor: A E- Editor: Liu XM 8466 July 21, 2015 Volume 21 Issue 27

261 Submit a Manuscript: Help Desk: DOI: /wjg.v21.i World J Gastroenterol 2015 July 21; 21(27): ISSN (print) ISSN (online) 2015 Baishideng Publishing Group Inc. All rights reserved. CASE REPORT Primary intestinal lymphangiectasia with generalized warts Soon Jae Lee, Hyun Joo Song, Sun-Jin Boo, Soo-Young Na, Heung Up Kim, Chang Lim Hyun Soon Jae Lee, Hyun Joo Song, Sun-Jin Boo, Soo-Young Na, Heung Up Kim, Department of Internal Medicine, Jeju National University School of Medicine, Jeju , South Korea Chang Lim Hyun, Department of Pathology, Jeju National University School of Medicine, Jeju , South Korea Author contributions: Lee SJ, Song HJ, Boo SJ, Na SY and Kim hu designed the report, collected the patient s clinical data, analyzed the data and wrote the paper; Hyun cl performed the pathological analyses. Institutional review board statement: The study was reviewed and approved by the Jeju National University Hospital Institutional Review Board, No Conflict-of-interest statement: There was no conflict of interest. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Correspondence to: Hyun Joo Song, MD, PhD, Department of Internal Medicine, Jeju National University School of Medicine, Aran 13-gil 15, Jeju-Si, Jeju , South Korea. songhj@jejunu.ac.kr Telephone: Fax: Received: January 22, 2015 Peer-review started: January 22, 2015 First decision: February 10, 2015 Revised: February 25, 2015 Accepted: April 17, 2015 Article in press: April 17, 2015 Published online: July 21, 2015 Abstract Primary intestinal lymphangiectasia (PIL) is a rare protein-losing enteropathy with lymphatic leakage into the small intestine. Dilated lymphatics in the small intestinal wall and mesentery are observed in this disease. Laboratory tests of PIL patients revealed hypoalbuminemia, lymphocytopenia, hypogammaglobulinemia and increased stool α-1 antitrypsin clearance. Cell-mediated immunodeficiency is also present in PIL patients because of loss of lymphocytes. As a result, the patients are vulnerable to chronic viral infection and lymphoma. However, cases of PIL with chronic viral infection, such as human papilloma virus-induced warts, are rarely reported. We report a rare case of PIL with generalized warts in a 36-year-old male patient. PIL was diagnosed by capsule endoscopy and colonoscopic biopsy with histological tissue confirmation. Generalized warts were observed on the head, chest, abdomen, back, anus, and upper and lower extremities, including the hands and feet of the patient. Key words: Protein-losing enteropathy; Lymphocytopenia; Cell-mediated immunodeficiency; Primary intestinal lymphangiectasia; Warts The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Primary intestinal lymphangiectasia (pil) patients are associated with cell-mediated immunodeficiency. Therefore, pil patients are vulnerable to viral infection. However, pil with warts caused by human papilloma virus is very rare. We report a rare case of pil with generalized warts. Lee SJ, Song HJ, Boo SJ, Na SY, Kim HU, Hyun CL. Primary intestinal lymphangiectasia with generalized warts. World J Gastroenterol 2015; 21(27): Available from: URL: 8467 July 21, 2015 Volume 21 Issue 27

262 Lee SJ et al. Primary intestinal lymphangiectasia with generalized warts DOI: A INTRODUCTION Primary intestinal lymphangiectasia (PIL) is a rare congenital disorder, characterized by dilated intestinal lymphatics resulting in lymph leakage and proteinlosing enteropathy [1]. As a result, hypoalbuminemia, lymphopenia, and hypogammaglobulinemia are observed in PIL patients [2]. Clinical manifestations of PIL, including edema, diarrhea and ascites, present at a young age. Most patients are diagnosed in childhood, but some cases are diagnosed as adolescents or adults. However, the diagnosis of this disease is difficult and rare, the etiology and prevalence are unclear. PIL patients are associated with cell-mediated immunodeficiency caused by loss of lymphocytes, especially CD4 + T cells. Therefore, PIL patients are vulnerable to viral infection or neoplasms, such as lymphomas [3]. PIL associated with generalized warts is very rarely reported. We report a rare case of PIL with generalized warts. CASE REPORT A 36-year-old man was admitted to the hospital with a 3-mo history of diarrhea and weight loss (5 kg). He had generalized warts over his entire body, including both hands and feet, with an initial onset at age 10. He was treated for pulmonary tuberculosis in early adolescence. He had no recurrent pulmonary tuberculosis or other organism-induced infections. He had no specific family history. He was a social drinker and a 15 pack per year smoker. Height was cm, body weight 49.1 kg, and body mass index 18 kg/m 2. Physical examination of the head, chest and abdomen was normal except for generalized warts and both pretibial pitting edema. The warts were distributed on the head, chest, abdomen, back, anus, and upper and lower extremities, including the hands and feet (Figure 1). Result of a complete blood count showed normal white blood cell count of 6800/mm 3, with a differential count of 62.3% neutrophils (normal range, 50%-70%), and decreased lymphocytes (12.4%, normal range, 20%-44%). Hemoglobin was 13.9 g/dl with normal hematocrit (39.8%) and platelet count at / mm 3. Other laboratory tests showed low serum total protein level (4.5 g/dl) with hypoalbuminemia (albumin, 2.3 g/dl). There was no evidence of proteinuria on urinalysis. Liver and renal function tests were normal. Flow cytometry of peripheral blood lymphocytes revealed a decrease in CD4 + T cell rate (24.4%), normal CD8 + T cell rate (31.2%) and normal CD3 + T cell count (54.7%, normal: 49%-80%). Quantitative serum immunoglobulins showed an IgG B Figure 1 Photographs of the trunk (A) and both hands (B) of the patient, demonstrating generalized cutaneous viral warts distributed on variable regions. of mg/dl (normal range, mg/dl), IgA of (normal range, mg/dl) and an IgM of 64.2 mg/dl (normal range, mg/dl). HIV, HBV, HCV serologies were negative. Stool collection test (24-h) revealed increased stool α-1 antitrypsin clearance ( ml/24 h, normal range, 15 ± 3 ml/24 h). Abdominopelvic computerized tomography showed diffuse mucosal thickening and enhancement throughout the small bowel, with multiple lymph nodes in the left gastric, portahepatis, portocaval and mesenteric areas (Figure 2). Upper gastrointestinal endoscopy showed diffuse mucosal edema in the duodenum. Colonoscopy revealed white mucosal plaques and spots in the terminal ileum and diffuse mucosal edema of the colon (Figure 3). Capsule endoscopy showed diffuse multifocal white mucosal plaques from the proximal jejunum to the terminal ileum (Figure 4). On histological examination of the terminal biopsy specimens, an HE stain showed dilated lymphatic vessels with many foamy macrophages in the lamina propria, consistent with lymphangiectasia. CD34 staining showed normal vascular endothelial cells. D2-40 stained endothelial cells were also observed, which indicated dilated lymphatics. Also observed were CD-68 stained macrophages, which aggregated to uptake lipids leaking from dilated lymphatics (Figure 5). The patient was ultimately diagnosed with PIL, and the warts were associated with T-cell mediated 8468 July 21, 2015 Volume 21 Issue 27

263 Lee SJ et al. Primary intestinal lymphangiectasia with generalized warts Figure 4 Capsule endoscopic finding. The image shows diffuse multifocal white mucosal plaques from the proximal jejunum to the terminal ileum, which is compatible with intestinal lymphangiectasia. Figure 2 Abdominopelvic computerized tomography showing diffuse mucosal thickening and enhancement throughout the small bowel. Figure 3 Colonoscopic finding. Image shows white mucosal plaques and spots in the terminal ileum. immunological abnormalities. A low-fat/high protein diet was started to decrease lymphatic pressure and blockade. Medium chain triglycerides (MCTs) are directly absorbed into the blood stream; therefore, he was also prescribed an MCTs diet. After the dietary treatment diet, diarrhea was diminished by degrees and improved a week later. DISCUSSION Intestinal lymphangiectasia (IL) is a rare disease, characterized by an abnormal lymphatic system of small intestinal wall and mesentery inducing leakage of lymphocytes and protein loss into the gastrointestinal tract. IL can be classified as primary and secondary IL by cause. PIL is a congenital abnormality of the lymphatic system. Some studies reported genetic factors associated with the hereditary lymphatic disease, and other studies reported regulatory signals involved in lymphangiogenesis. The regulatory molecules lymphatic vessel endothelial hyaluronan receptor 1 and vascular endothelial growth factor receptor 3 are associated with intestinal lymphangiectasia [4]. Oh et al [5] suggested depletion of 4q25 is associated with lymphangiectasia. However, the relationship between gene mutation and lymphangiectasia is unclear. Secondary IL is an acquired form, by obstructed lymphatic flow, which is induced by other factors. Neoplasms (lymphoma), infections (Whipple disease, parasite infection, intestinal tuberculosis), inflammation (Crohn s disease, systemic lupus erythematosus), bowel obstruction, fibrosis of drainage tracts (sclerosing mesenteritis, retroperitoneal fibrosis, post-radiation fibrosis), hepatic cirrhosis, constrictive pericarditis, and abdominal surgery can be causes of secondary IL [6-9]. Our patient was diagnosed with PIL because his symptoms arose at an early age and showed no evidence of secondary IL. Stool collection test for 24-h was used to measure stool α-1 antitrypsin clearance to prove protein-losing enteropathy. Alpha-1 antitrypsin is an intrinsic protein, and has a similar molecular weight to albumin. It has characteristics of negative reabsorption from the intestine and negative secretion into the bowel. The 24-h stool collection test in our patient revealed increased stool α-1 antitrypsin clearance. As a cause of hypoalbuminemia and hypogammaglobulinemia, there was no evidence of increased protein catabolism status, such as infection, and lack of proteinuria in urinalysis, which suggested protein-losing enteropathy. Loss of lymphatic fluid-containing lymphocytes in the intestine is a specific finding of intestinal lymphangiectasia, which is not found in other proteinlosing enteropathies. Although B-lymphocytes, natural killer cells and CD8 + T cells may decrease in the disease, loss of CD4 + T cells is observed predominantly [10]. Humoral and cellular immunodeficiency can arise in lymphopenia; however, lack of recurrent infections was observed in the PIL patients. Lynn et al [3] reported that while naïve CD4 + T cells were decreased, memory and effector CD4 + T cells were preserved in PIL patients, 8469 July 21, 2015 Volume 21 Issue 27

264 Lee SJ et al. Primary intestinal lymphangiectasia with generalized warts A B C D Figure 5 Histological examination of the terminal biopsy specimens. A: Hematoxylin and eosin stain (magnification 100) showing dilated lymphatic vessels with many foamy macrophages in the lamina propria consistent with lymphangiectasia; B: CD34 stain showing normal vascular endothelial cells; C: D2-40 stained endothelial cells (red arrows), indicating dilated lymphatics; D: CD68-stained macrophages, which have aggregated to uptake lipids leaking from dilated lymphatics. which suggested that preserving T cells carry out the role of preventing infections. Chronic viral infections and neoplasms, such as lymphoma, may occur in patients with cell-mediated immunodeficiency [11]. PIL accompanied with viral infections and/or lymphoma has been reported in some cases. However, PIL with warts caused by human papilloma virus is very rare. To the best of our knowledge, PIL with generalized warts has been reported in only six patients in five reports. Four patients had supervening lymphoma, and all six patients had PIL with warts. The characteristics of the five case reports are summarized in table 1 [3,11-14]. Diagnosis of PIL is not easy, because abnormal lymphatic lesions are usually distributed in the small intestine. Detection of lesions by upper gastroscopy and colonoscopy is limited, and radiological examinations cannot confirm the diagnosis. As a result, double balloon enteroscopy or surgical methods are used for pathological examination in some cases. Double balloon enteroscopy can be used to perform a biopsy, and also reported much higher diagnosis rate than capsule endoscopy [15]. In our patient, the abnormal state of the small intestine tissues was determined in the terminal ileum by colonoscopic biopsy. Therefore, we performed capsule endoscopy to observe the entire small intestinal mucosa. Although capsule endoscopy cannot be used to obtain a biopsy, it is very useful and is a relatively easy, comfortable method to examine mucosal changes in the small intestine [16]. In our patient, capsule endoscopy showed multiple whitish spots, thickened villi and edematous mucosa of the small intestine. These endoscopic findings showed typical mucosal lesions of PIL. Dietary treatment is the first method recommended to treat PIL. There is no curable and standard treatment of PIL. Lipid elements in foods increase lymphatic pressure and, as a result, cause lymphatic leakage into the intestinal lumen. To lower the lymphatic pressure and ease the blockage, a low-fat/high-protein diet is prescribed to PIL patients. MCTs are directly absorbed into the bloodstream, resulting in a bypass of the lymphatic system. They are secreted into the portal systems, directly. MCTs decrease lymphatic pressure and protein loss into the intestine [17]. The use of octreotide for treatment of lymphangiectasia was reported in some cases [18]. It decreases intestinal blood flow and triglyceride absorption. Consequently, it reduces lymphatic pressure, thereby reducing the loss of protein and lymphatic fluid. However, symptoms of lymphangiectasia can relapse after the interruption of an agent, which is a limitation of octreotide treatment. Corticosteroid and antiplasmin may be prescribed in some cases, but their efficacies are variable and insufficient [19,20]. Octreotide, antiplasmin, and corticosteroid therapies can be used as an optional treatment in patients with no response after the dietary approach. Our patient improved after dietary treatment and intravenous nutrition, thus other treatment options were not considered. To summarize, PIL patients are vulnerable to 8470 July 21, 2015 Volume 21 Issue 27

265 Lee SJ et al. Primary intestinal lymphangiectasia with generalized warts Table 1 Six case reports of primary intestinal lymphangiectasia with warts Ref. Sex Age at diagnosis of PIL Accompanied disease Treatment for PIL Ross et al [12], 1971 M 30 NA Dietary therapy Diuretics Steroid Ward et al [13], 1977 M 29 Lymphoma Dietary therapy Diuretics Gumà et al [14], 1998 F 34 Lymphoma Dietary therapy Bouhnik et al [11], 2000 (2 cases) F 11 Lymphoma Dietary therapy F 58 Lymphoma NA Lynn et al [3], 2004 M 55 NA Dietary therapy, octreotide Present case M 36 No accompanying disease Dietary therapy PIL: Primary intestinal lymphangiectasia; NA: Not available. chronic viral infection and lymphoma. Cell-mediated immunodeficiency is present in PIL patients because of loss of lymphocytes. Many cases of PIL patients have been reported, but patients with PIL and generalized warts are rare. We report a rare case of PIL with generalized warts. COMMENTS Case characteristics A 36-year-old man was admitted to the hospital with a 3-mo history of diarrhea and weight loss (5 kg). Clinical diagnosis Body mass index of the patient was 18 kg/m 2 and warts were noted on the head, chest, abdomen, back, anus, and the upper and lower extremities, including the hands and feet. Differential diagnosis Protein losing enteropathy (inflammatory bowel disease, amyloidosis, congestive heart failure, portal hypertensive gastroenteropathy, intestinal lymphoma). Laboratory diagnosis Laboratory tests showed low serum total protein level (4.5 g/dl) with hypoalbuminemia (albumin, 2.3 g/dl), decreased lymphocytes (12.4%, normal range, 20%-44%) and increased stool α-1 antitrypsin clearance ( ml/24 h; normal range, 15 ± 3 ml/24 h). Imaging diagnosis Abdominopelvic computerized tomography showed diffuse mucosal thickening and enhancement throughout the small bowel, with multiple lymph nodes in the left gastric, portahepatis, portocaval and mesenteric areas. Pathological diagnosis On histological examination of the terminal biopsy specimens, the HE stain showed dilated lymphatic vessels with many foamy macrophages in the lamina propria, consistent with lymphangiectasia. A CD34 stain showed normal vascular endothelial cells. Treatment A low-fat/high protein and medium chain triglycerides (MCTs) diet was started to decrease lymphatic pressure and blockade. Related reports Many cases of PIL patients have been reported, but patients of PIL with generalized warts are rare. Term explanation PIL is a rare protein-losing enteropathy with lymphatic leakage into the small intestine. Experiences and lessons PIL patients are vulnerable to chronic viral infection and lymphoma. However, few cases of PIL with chronic viral infection, such as human papilloma virus-induced warts, have been reported. We report a rare case of PIL with generalized warts. Peer-review This is an interesting case report with a very good theoretical presentation of the underlying disease. It is well written and well presented. REFERENCES 1 Vignes S, Bellanger J. Primary intestinal lymphangiectasia (Waldmann s disease). Orphanet J Rare Dis 2008; 3: 5 [PMID: DOI: / ] 2 Brasitus TA, Bissonnette M. Protein-losing enteropathy. In: Sleisenger MH, Fordtran JS, editors. Gastrointestinal and liver diseases: pathophysiology, diagnosis and management. 6th ed. Philadelphia: WB Saunders, 1998: Lynn J, Knight AK, Kamoun M, Levinson AI. A 55-year-old man with hypogammaglobulinemia, lymphopenia, and unrelenting cutaneous warts. J Allergy Clin Immunol 2004; 114: [PMID: DOI: /j.jaci ] 4 Hokari R, Kitagawa N, Watanabe C, Komoto S, Kurihara C, Okada Y, Kawaguchi A, Nagao S, Hibi T, Miura S. Changes in regulatory molecules for lymphangiogenesis in intestinal lymphangiectasia with enteric protein loss. J Gastroenterol Hepatol 2008; 23: e88-e95 [PMID: DOI: / j x] 5 Oh TG, Chung JW, Kim HM, Han SJ, Lee JS, Park JY, Song SY. Primary intestinal lymphangiectasia diagnosed by capsule endoscopy and double balloon enteroscopy. World J Gastrointest Endosc 2011; 3: [PMID: DOI: /wjge. v3.i11.235] 6 Nelson DL, Blaese RM, Strober W, Bruce R, Waldmann TA. Constrictive pericarditis, intestinal lymphangiectasia, and reversible immunologic deficiency. J Pediatr 1975; 86: [PMID: DOI: /S (75) ] 7 Wilkinson P, Pinto B, Senior JR. Reversible protein-losing enteropathy with intestinal lymphangiectasia secondary to chronic constrictive pericarditis. N Engl J Med 1965; 273: [PMID: DOI: /NEJM ] 8 Broder S, Callihan TR, Jaffe ES, DeVita VT, Strober W, Bartter FC, Waldmann TA. Resolution of longstanding protein-losing enteropathy in a patient with intestinal lymphangiectasia after treatment for malignant lymphoma. Gastroenterology 1981; 80: [PMID: ] 9 Chew CK, Jarzylo SV, Valberg LS. Idiopathic retroperitoneal fibrosis with protein-losing enteropathy and duodenal obstruction successfully treated with corticosteroids. Can Med Assoc J 1966; 95: [PMID: ] 10 Fuss IJ, Strober W, Cuccherini BA, Pearlstein GR, Bossuyt X, Brown M, Fleisher TA, Horgan K. Intestinal lymphangiectasia, a disease characterized by selective loss of naive CD45RA+ lymphocytes into the gastrointestinal tract. Eur J Immunol 1998; 28: [PMID: DOI: /(SICI) ( )28] 8471 July 21, 2015 Volume 21 Issue 27

266 Lee SJ et al. Primary intestinal lymphangiectasia with generalized warts 11 Bouhnik Y, Etienney I, Nemeth J, Thevenot T, Lavergne-Slove A, Matuchansky C. Very late onset small intestinal B cell lymphoma associated with primary intestinal lymphangiectasia and diffuse cutaneous warts. Gut 2000; 47: [PMID: DOI: /gut ] 12 Ross JD, Reid KD, Ambujakshan VP, Kinloch JD, Sircus W. Recurrent pleural effusion, protein-losing enteropathy, malabsorption, and mosaic warts associated with generalized lymphatic hypoplasia. Thorax 1971; 26: [PMID: DOI: /thx ] 13 Ward M, Le Roux A, Small WP, Sircus W. Malignant lymphoma and extensive viral wart formation in a patient with intestinal lymphangiectasia and lymphocyte depletion. Postgrad Med J 1977; 53: [PMID: DOI: /pgmj ] 14 Gumà J, Rubió J, Masip C, Alvaro T, Borràs JL. Aggressive bowel lymphoma in a patient with intestinal lymphangiectasia and widespread viral warts. Ann Oncol 1998; 9: [PMID: DOI: /A: ] 15 Takenaka H, Ohmiya N, Hirooka Y, Nakamura M, Ohno E, Miyahara R, Kawashima H, Itoh A, Watanabe O, Ando T, Goto H. Endoscopic and imaging findings in protein-losing enteropathy. J Clin Gastroenterol 2012; 46: [PMID: DOI: /MCG.0b013e ac] 16 Chamouard P, Nehme-Schuster H, Simler JM, Finck G, Baumann R, Pasquali JL. Videocapsule endoscopy is useful for the diagnosis of intestinal lymphangiectasia. Dig Liver Dis 2006; 38: [PMID: DOI: /j.dld ] 17 Tift WL, Lloyd JK. Intestinal lymphangiectasia. Long-term results with MCT diet. Arch Dis Child 1975; 50: [PMID: DOI: /adc ] 18 Lee HL, Han DS, Kim JB, Jeon YC, Sohn JH, Hahm JS. Successful treatment of protein-losing enteropathy induced by intestinal lymphangiectasia in a liver cirrhosis patient with octreotide: a case report. J Korean Med Sci 2004; 19: [PMID: DOI: /jkms ] 19 Kondo M, Bamba T, Hosokawa K, Hosoda S, Kawai K, Masuda M. Tissue plasminogen activator in the pathogenesis of protein-losing gastroenteropathy. Gastroenterology 1976; 70: [PMID: ] 20 Fleisher TA, Strober W, Muchmore AV, Broder S, Krawitt EL, Waldmann TA. Corticosteroid-responsive intestinal lymphangiectasia secondary to an inflammatory process. N Engl J Med 1979; 300: [PMID: DOI: / NEJM ] P- Reviewer: Homan M, Tsimogiannis K S- Editor: Ma YJ L- Editor: Stewart G E- Editor: Zhang DN 8472 July 21, 2015 Volume 21 Issue 27

267 Published by Baishideng Publishing Group Inc 8226 Regency Drive, Pleasanton, CA 94588, USA Telephone: Fax: Help Desk: I S S N Baishideng Publishing Group Inc. All rights reserved.