World Journal of Gastroenterology

Transcription

1 ISSN (print) ISSN (online) World Journal of Gastroenterology World J Gastroenterol 2017 August 7; 23(29): Published by Baishideng Publishing Group Inc

2 Editorial Board The World Journal of Gastroenterology Editorial Board consists of 1375 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 68 countries, including Algeria (2), Argentina (7), Australia (31), Austria (9), Belgium (11), Brazil (20), Brunei Darussalam (1), Bulgaria (2), Cambodia (1), Canada (25), Chile (4), China (165), Croatia (2), Cuba (1), Czech (6), Denmark (2), Egypt (9), Estonia (2), Finland (6), France (20), Germany (58), Greece (31), Guatemala (1), Hungary (14), Iceland (1), India (33), Indonesia (2), Iran (10), Ireland (9), Israel (18), Italy (194), Japan (149), Jordan (1), Kuwait (1), Lebanon (7), Lithuania (1), Malaysia (1), Mexico (11), Morocco (1), Netherlands (5), New Zealand (4), Nigeria (3), Norway (6), Pakistan (6), Poland (12), Portugal (8), Puerto Rico (1), Qatar (1), Romania (10), Russia (3), Saudi Arabia (2), Singapore (7), Slovenia (2), South Africa (1), South Korea (69), Spain (51), Sri Lanka (1), Sudan (1), Sweden (12), Switzerland (5), Thailand (7), Trinidad and Tobago (1), Tunisia (2), Turkey (55), United Kingdom (49), United States (180), Venezuela (1), and Vietnam (1). EDITORS-IN-CHIEF Stephen C Strom, Stockholm Andrzej S Tarnawski, Long Beach Damian Garcia-Olmo, Madrid ASSOCIATE EDITORS Yung-Jue Bang, Seoul Vincent Di Martino, Besancon Daniel T Farkas, Bronx Roberto J Firpi, Gainesville Maria Gazouli, Athens Chung-Feng Huang, Kaohsiung Namir Katkhouda, Los Angeles Anna Kramvis, Johannesburg Wolfgang Kruis, Cologne Peter L Lakatos, Budapest Han Chu Lee, Seoul Christine McDonald, Cleveland Nahum Mendez-Sanchez, Mexico City George K Michalopoulos, Pittsburgh Suk Woo Nam, Seoul Shu-You Peng, Hangzhou Daniel von Renteln, Montreal Angelo Sangiovanni, Milan Hildegard M Schuller, Knoxville Dong-Wan Seo, Seoul Adrian John Stanley, Glasgow Jurgen Stein, Frankfurt Bei-Cheng Sun, Nanjing Yoshio Yamaoka, Yufu GUEST EDITORIAL BOARD MEMBERS Jia-Ming Chang, Taipei Jane CJ Chao, Taipei Kuen-Feng Chen, Taipei Tai-An Chiang, Tainan Yi-You Chiou, Taipei Seng-Kee Chuah, Kaohsiung Wan-Long Chuang, Kaohsiung How-Ran Guo, Tainan Ming-Chih Hou, Taipei Po-Shiuan Hsieh, Taipei Ching-Chuan Hsieh, Chiayi county Jun-Te Hsu, Taoyuan Chung-Ping Hsu, Taichung Chien-Ching Hung, Taipei Chao-Hung Hung, Kaohsiung Chen-Guo Ker, Kaohsiung Yung-Chih Lai, Taipei Teng-Yu Lee, Taichung City Wei-Jei Lee, Taoyuan Jin-Ching Lee, Kaohsiung Jen-Kou Lin, Taipei Ya-Wen Lin, Taipei Hui-kang Liu, Taipei Min-Hsiung Pan, Taipei Bor-Shyang Sheu, Tainan Hon-Yi Shi, Kaohsiung Fung-Chang Sung, Taichung Dar-In Tai, Taipei Jung-Fa Tsai, Kaohsiung Yao-Chou Tsai, New Taipei City Chih-Chi Wang, Kaohsiung Liang-Shun Wang, New Taipei City Hsiu-Po Wang, Taipei Jaw-Yuan Wang, Kaohsiung Yuan-Huang Wang, Taipei Yuan-Chuen Wang, Taichung Deng-Chyang Wu, Kaohsiung Shun-Fa Yang, Taichung Hsu-Heng Yen, Changhua MEMBERS OF THE EDITORIAL BOARD Algeria Saadi Berkane, Algiers Samir Rouabhia, Batna Argentina N Tolosa de Talamoni, Córdoba Eduardo de Santibanes, Buenos Aires Bernardo Frider, Capital Federal Guillermo Mazzolini, Pilar Carlos Jose Pirola, Buenos Aires Bernabé Matías Quesada, Buenos Aires María Fernanda Troncoso, Buenos Aires Australia Golo Ahlenstiel, Westmead Minoti V Apte, Sydney Jacqueline S Barrett, Melbourne Michael Beard, Adelaide Filip Braet, Sydney Guy D Eslick, Sydney Christine Feinle-Bisset, Adelaide Mark D Gorrell, Sydney Michael Horowitz, Adelaide I January 1, 2016

3 Gordon Stanley Howarth, Roseworthy Seungha Kang, Brisbane Alfred King Lam, Gold Coast Ian C Lawrance, PerthFremantle Barbara Anne Leggett, Brisbane Daniel A Lemberg, Sydney Rupert W Leong, Sydney Finlay A Macrae, Victoria Vance Matthews, Melbourne David L Morris, Sydney Reme Mountifield, Bedford Park Hans J Netter, Melbourne Nam Q Nguyen, Adelaide Liang Qiao, Westmead Rajvinder Singh, Adelaide Ross Cyril Smith, StLeonards Kevin J Spring, Sydney Debbie Trinder, Fremantle Daniel R van Langenberg, Box Hill David Ian Watson, Adelaide Desmond Yip, Garran Li Zhang, Sydney Austria Felix Aigner, Innsbruck Gabriela A Berlakovich, Vienna Herwig R Cerwenka, Graz Peter Ferenci, Wien Alfred Gangl, Vienna Kurt Lenz, Linz Markus Peck-Radosavljevic, Vienna Markus Raderer, Vienna Stefan Riss, Vienna Belgium Michael George Adler, Brussels Benedicte Y De Winter, Antwerp Mark De Ridder, Jette Olivier Detry, Liege Denis Dufrane Dufrane, Brussels Sven M Francque, Edegem Nikos Kotzampassakis, Liège Geert KMM Robaeys, Genk Xavier Sagaert, Leuven Peter Starkel, Brussels Eddie Wisse, Keerbergen Brazil SMP Balzan, Santa Cruz do Sul JLF Caboclo, Sao jose do rio preto Fábio Guilherme Campos, Sao Paulo Claudia RL Cardoso, Rio de Janeiro Roberto J Carvalho-Filho, Sao Paulo Carla Daltro, Salvador José Sebastiao dos Santos, Ribeirao Preto Eduardo LR Mello, Rio de Janeiro Sthela Maria Murad-Regadas, Fortaleza Claudia PMS Oliveira, Sao Paulo Júlio C Pereira-Lima, Porto Alegre Marcos V Perini, Sao Paulo Vietla Satyanarayana Rao, Fortaleza Raquel Rocha, Salvador AC Simoes e Silva, Belo Horizonte Mauricio F Silva, Porto Alefre Aytan Miranda Sipahi, Sao Paulo Rosa Leonôra Salerno Soares, Niterói Cristiane Valle Tovo, Porto Alegre Eduardo Garcia Vilela, Belo Horizonte Brunei Darussalam Vui Heng Chong, Bandar Seri Begawan Bulgaria Tanya Kirilova Kadiyska, Sofia Mihaela Petrova, Sofia Cambodia Francois Rouet, Phnom Penh Canada Brian Bressler, Vancouver Frank J Burczynski, Winnipeg Wangxue Chen, Ottawa Francesco Crea, Vancouver Jane A Foster, Hamilton Hugh J Freeman, Vancouver Shahrokh M Ghobadloo, Ottawa Yuewen Gong, Winnipeg Philip H Gordon, Quebec Rakesh Kumar, Edmonton Wolfgang A Kunze, Hamilton Patrick Labonte, Laval Zhikang Peng, Winnipeg Jayadev Raju, Ottawa Maitreyi Raman, Calgary Giada Sebastiani, Montreal Maida J Sewitch, Montreal Eldon A Shaffer, Alberta Christopher W Teshima, Edmonton Jean Sévigny, Québec Pingchang Yang, Hamilton Pingchang Yang, Hamilton Eric M Yoshida, Vancouver Bin Zheng, Edmonton Chile Marcelo A Beltran, La Serena Flavio Nervi, Santiago Adolfo Parra-Blanco, Santiago Alejandro Soza, Santiago China Zhao-Xiang Bian, Hong Kong San-Jun Cai, Shanghai Guang-Wen Cao, Shanghai Long Chen, Nanjing Ru-Fu Chen, Guangzhou George G Chen, Hong Kong Li-Bo Chen, Wuhan Jia-Xu Chen, Beijing Hong-Song Chen, Beijing Lin Chen, Beijing Yang-Chao Chen, Hong Kong Zhen Chen, Shanghai Ying-Sheng Cheng, Shanghai Kent-Man Chu, Hong Kong Zhi-Jun Dai, Xi an Jing-Yu Deng, Tianjin Yi-Qi Du, Shanghai Zhi Du, Tianjin Hani El-Nezami, Hong Kong Bao-Ying Fei, Hangzhou Chang-Ming Gao, Nanjing Jian-Ping Gong, Chongqing Zuo-Jiong Gong, Wuhan Jing-Shan Gong, Shenzhen Guo-Li Gu, Beijing Yong-Song Guan, Chengdu Mao-Lin Guo, Luoyang Jun-Ming Guo, Ningbo Yan-Mei Guo, Shanghai Xiao-Zhong Guo, Shenyang Guo-Hong Han, Xi an Ming-Liang He, Hong Kong Peng Hou, Xi an Zhao-Hui Huang, Wuxi Feng Ji, Hangzhou Simon Law, Hong Kong Yan-Chang Lei, Hangzhou Yu-Yuan Li, Guangzhou Meng-Sen Li, Haikou Shu-De Li, Shanghai Zong-Fang Li, Xi an Qing-Quan Li, Shanghai Kang Li, Lasa Han Liang, Tianjin Xing e Liu, Hangzhou Zheng-Wen Liu, Xi an Xiao-Fang Liu, Yantai Bin Liu, Tianjin Quan-Da Liu, Beijing Hai-Feng Liu, Beijing Fei Liu, Shanghai Ai-Guo Lu, Shanghai He-Sheng Luo, Wuhan Xiao-Peng Ma, Shanghai Yong Meng, Shantou Ke-Jun Nan, Xi an Siew Chien Ng, Hong Kong Simon SM Ng, Hong Kong Zhao-Shan Niu, Qingdao Di Qu, Shanghai Ju-Wei Mu, Beijing Rui-Hua Shi, Nanjing Bao-Min Shi, Shanghai Xiao-Dong Sun, Hangzhou Si-Yu Sun, Shenyang Guang-Hong Tan, Haikou Wen-Fu Tang, Chengdu Anthony YB Teoh, Hong Kong Wei-Dong Tong, Chongqing Eric Tse, Hong Kong Hong Tu, Shanghai II January 1, 2016

4 Rong Tu, Haikou Jian-She Wang, Shanghai Kai Wang, Jinan Xiao-Ping Wang, Xianyang Xiu-Yan Wang, Shanghai Dao-Rong Wang, Yangzhou De-Sheng Wang, Xi an Chun-You Wang, Wuhan Ge Wang, Chongqing Xi-Shan Wang, Harbin Wei-hong Wang, Beijing Zhen-Ning Wang, Shenyang Wai Man Raymond Wong, Hong Kong Chun-Ming Wong, Hong Kong Jian Wu, Shanghai Sheng-Li Wu, Xi an Wu-Jun Wu, Xi an Qing Xia, Chengdu Yan Xin, Shenyang Dong-Ping Xu, Beijing Jian-Min Xu, Shanghai Wei Xu, Changchun Ming Yan, Jinan Xin-Min Yan, Kunming Yi-Qun Yan, Shanghai Feng Yang, Shanghai Yong-Ping Yang, Beijing He-Rui Yao, Guangzhou Thomas Yau, Hong Kong Winnie Yeo, Hong Kong Jing You, Kunming Jian-Qing Yu, Wuhan Ying-Yan Yu, Shanghai Wei-Zheng Zeng, Chengdu Zong-Ming Zhang, Beijing Dian-Liang Zhang, Qingdao Ya-Ping Zhang, Shijiazhuang You-Cheng Zhang, Lanzhou Jian-Zhong Zhang, Beijing Ji-Yuan Zhang, Beijing Hai-Tao Zhao, Beijing Jian Zhao, Shanghai Jian-Hong Zhong, Nanning Ying-Qiang Zhong, Guangzhou Ping-Hong Zhou, Shanghai Yan-Ming Zhou, Xiamen Tong Zhou, Nanchong Li-Ming Zhou, Chengdu Guo-Xiong Zhou, Nantong Feng-Shang Zhu, Shanghai Jiang-Fan Zhu, Shanghai Zhao-Hui Zhu, Beijing Croatia Tajana Filipec Kanizaj, Zagreb Mario Tadic, Zagreb Cuba Damian Casadesus, Havana Czech Jan Bures, Hradec Kralove Marcela Kopacova, Hradec Kralove Otto Kucera, Hradec Kralove Marek Minarik, Prague Pavel Soucek, Prague Miroslav Zavoral, Prague Denmark Vibeke Andersen, Odense E Michael Danielsen, Copenhagen Egypt Mohamed MM Abdel-Latif, Assiut Hussein Atta, Cairo Ashraf Elbahrawy, Cairo Mortada Hassan El-Shabrawi, Cairo Mona El Said El-Raziky, Cairo Elrashdy M Redwan, New Borg Alrab Zeinab Nabil Ahmed Said, Cairo Ragaa HM Salama, Assiut Maha Maher Shehata, Mansoura Estonia Margus Lember, Tartu Tamara Vorobjova, Tartu Finland Marko Kalliomäki, Turku Thomas Kietzmann, Oulu Kaija-Leena Kolho, Helsinki Eija Korkeila, Turku Heikki Makisalo, Helsinki Tanja Pessi, Tampere France Armando Abergel Clermont, Ferrand Elie K Chouillard, Polssy Pierre Cordelier, Toulouse Pascal P Crenn, Garches Catherine Daniel, Lille Fanny Daniel, Paris Cedric Dray, Toulouse Benoit Foligne, Lille Jean-Noel Freund, Strasbourg Hervé Guillou, Toulouse Nathalie Janel, Paris Majid Khatib, Bordeaux Jacques Marescaux, Strasbourg Jean-Claude Marie, Paris Driffa Moussata, Pierre Benite Hang Nguyen, Clermont-Ferrand Hugo Perazzo, Paris Alain L Servin, Chatenay-Malabry Chang Xian Zhang, Lyon Germany Stavros A Antoniou, Monchengladbach Erwin Biecker, Siegburg Hubert E Blum, Freiburg Thomas Bock, Berlin Katja Breitkopf-Heinlein, Mannheim Elke Cario, Essen Güralp Onur Ceyhan, Munich Angel Cid-Arregui, Heidelberg Michael Clemens Roggendorf, München Christoph F Dietrich, Bad Mergentheim Valentin Fuhrmann, Hamburg Nikolaus Gassler, Aachen Andreas Geier, Wuerzburg Markus Gerhard, Munich Anton Gillessen, Muenster Thorsten Oliver Goetze, Offenbach Daniel Nils Gotthardt, Heidelberg Robert Grützmann, Dresden Thilo Hackert, Heidelberg Claus Hellerbrand, Regensburg Harald Peter Hoensch, Darmstadt Jens Hoeppner, Freiburg Richard Hummel, Muenster Jakob Robert Izbicki, Hamburg Gernot Maximilian Kaiser, Essen Matthias Kapischke, Hamburg Michael Keese, Frankfurt Andrej Khandoga, Munich Jorg Kleeff, Munich Alfred Koenigsrainer, Tuebingen Peter Christopher Konturek, Saalfeld Michael Linnebacher, Rostock Stefan Maier, Kaufbeuren Oliver Mann, Hamburg Marc E Martignoni, Munic Thomas Minor, Bonn Oliver Moeschler, Osnabrueck Jonas Mudter, Eutin Sebastian Mueller, Heidelberg Matthias Ocker, Berlin Andreas Ommer, Essen Albrecht Piiper, Frankfurt Esther Raskopf, Bonn Christoph Reichel, Bad Brückenau Elke Roeb, Giessen Udo Rolle, Frankfurt Karl-Herbert Schafer, Zweibrücken Peter Schemmer, Heidelberg Andreas G Schreyer, Regensburg Manuel A Silva, Penzberg Georgios C Sotiropoulos, Essen Ulrike S Stein, Berlin Dirk Uhlmann, Leipzig Michael Weiss, Halle Hong-Lei Weng, Mannheim Karsten Wursthorn, Hamburg Greece Alexandra Alexopoulou, Athens Nikolaos Antonakopoulos, Athens Stelios F Assimakopoulos, Patras Grigoris Chatzimavroudis, Thessaloniki Evangelos Cholongitas, Thessaloniki Gregory Christodoulidis, Larisa George N Dalekos, Larissa Urania Georgopoulou, Athens Eleni Gigi, Thessaloniki III January 1, 2016

5 Stavros Gourgiotis, Athens Leontios J Hadjileontiadis, Thessaloniki Thomas Hyphantis, Ioannina Ioannis Kanellos, Thessaloniki Stylianos Karatapanis, Rhodes Michael Koutsilieris, Athens Spiros D Ladas, Athens Theodoros K Liakakos, Athens Emanuel K Manesis, Athens Spilios Manolakopoulos, Athens Gerassimos John Mantzaris, Athens Athanasios D Marinis, Piraeus Nikolaos Ioannis Nikiteas, Athens Konstantinos X Papamichael, Athens George Sgourakis, Athens Konstantinos C Thomopoulos, Patras Konstantinos Triantafyllou, Athens Christos Triantos, Patras Georgios Zacharakis, Athens Petros Zezos, Alexandroupolis Demosthenes E Ziogas, Ioannina Guatemala Carlos Maria Parellada, Guatemala Hungary Mihaly Boros, Szeged Tamás Decsi, Pécs Gyula Farkas, Szeged Andrea Furka, Debrecen Y vette Mandi, Szeged Peter L Lakatos, Budapest Pal Miheller, Budapest Tamás Molnar, Szeged Attila Olah, Gyor Maria Papp, Debrecen Ferenc Sipos, Budapest Miklós Tanyi, Debrecen Tibor Wittmann, Szeged Iceland Tryggvi Bjorn Stefánsson, Reykjavík Indiad Brij B Agarwal, New Delhi Deepak N Amarapurkar, Mumbai Shams ul Bari, Srinagar Sriparna Basu, Varanasi Runu Chakravarty, Kolkata Devendra C Desai, Mumbai Nutan D Desai, Mumbai Suneela Sunil Dhaneshwar, Pune Radha K Dhiman, Chandigarh Pankaj Garg, Mohali Uday C Ghoshal, Lucknow Kalpesh Jani, Vadodara Premashis Kar, New Delhi Jyotdeep Kaur, Chandigarh Rakesh Kochhar, Chandigarh Pradyumna K Mishra, Mumbai Asish K Mukhopadhyay, Kolkata Imtiyaz Murtaza, Srinagar P Nagarajan, New Delhi Samiran Nundy, Delhi Gopal Pande, Hyderabad Benjamin Perakath, Vellore Arun Prasad, New Delhi D Nageshwar Reddy, Hyderabad Lekha Saha, Chandigarh Sundeep Singh Saluja, New Delhi Mahesh Prakash Sharma, New Delhi Sadiq Saleem Sikora, Bangalore Sarman Singh, New Delhi Rajeev Sinha, Jhansi Rupjyoti Talukdar, Hyderabad Rakesh Kumar Tandon, New Delhi Narayanan Thirumoorthy, Coimbatore Indonesia David Handojo Muljono, Jakarta Andi Utama, Jakarta Iran Arezoo Aghakhani, Tehran Seyed Mohsen Dehghani, Shiraz Ahad Eshraghian, Shiraz Hossein Khedmat, Tehran Sadegh Massarrat, Tehran Marjan Mohammadi, Tehran Roja Rahimi, Tehran Farzaneh Sabahi, Tehran Majid Sadeghizadeh, Tehran Farideh Siavoshi, Tehran Ireland Gary Alan Bass, Dublin David J Brayden, Dublin Ronan A Cahill, Dublin Glen A Doherty, Dublin Liam J Fanning, Cork Barry Philip McMahon, Dublin RossMcManus, Dublin Dervla O Malley, Cork Sinead M Smith, Dublin Israel Dan Carter, Ramat Gan Jorge-Shmuel Delgado, Metar Eli Magen, Ashdod Nitsan Maharshak, Tel Aviv Shaul Mordechai, Beer Sheva Menachem Moshkowitz, Tel Aviv William Bahij Nseir, Nazareth Shimon Reif, Jerusalem Ram Reifen, Rehovot Ariella Bar-Gil Shitrit, Jerusalem Noam Shussman, Jerusalem Igor Sukhotnik, Haifa Nir Wasserberg, Petach Tiqwa Jacob Yahav, Rehovot Doron Levi Zamir, Gedera Shira Zelber-Sagi, Haifa Romy Zemel, Petach-Tikva Italy Ludovico Abenavoli, Catanzaro Luigi Elio Adinolfi, Naples Carlo Virginio Agostoni, Milan Anna Alisi, Rome Piero Luigi Almasio, Palermo Donato Francesco Altomare, Bari Amedeo Amedei, Florence Pietro Andreone, Bologna Imerio Angriman, Padova Vito Annese, Florence Paolo Aurello, Rome Salavtore Auricchio, Naples Gian Luca Baiocchi, Brescia Gianpaolo Balzano, Milan Antonio Basoli, Rome Gabrio Bassotti, San Sisto Mauro Bernardi, Bologna Alberto Biondi, Rome Ennio Biscaldi, Genova Massimo Bolognesi, Padua Luigi Bonavina, Milano Aldo Bove, Chieti Raffaele Bruno, Pavia Luigi Brusciano, Napoli Giuseppe Cabibbo, Palermo Carlo Calabrese, Bologna Daniele Calistri, Meldola Vincenza Calvaruso, Palermo Lorenzo Camellini, Reggio Emilia Marco Candela, Bologna Raffaele Capasso, Naples Lucia Carulli, Modena Renato David Caviglia, Rome Luigina Cellini, Chieti Giuseppe Chiarioni, Verona Claudio Chiesa, Rome Michele Cicala, Roma Rachele Ciccocioppo, Pavia Sandro Contini, Parma Gaetano Corso, Foggia Renato Costi, Parma Alessandro Cucchetti, Bologna Rosario Cuomo, Napoli Giuseppe Currò, Messina Paola De Nardi, Milano Giovanni D De Palma, Naples Raffaele De Palma, Napoli Giuseppina De Petro, Brescia Valli De Re, Aviano Paolo De Simone, Pisa Giuliana Decorti, Trieste Emanuele Miraglia del Giudice, Napoli Isidoro Di Carlo, Catania Matteo Nicola Dario Di Minno, Naples Massimo Donadelli, Verona Mirko D Onofrio, Verona Maria Pina Dore, Sassari Luca Elli, Milano Massimiliano Fabozzi, Aosta Massimo Falconi, Ancona IV January 1, 2016

6 Ezio Falletto, Turin Silvia Fargion, Milan Matteo Fassan, Verona Gianfranco Delle Fave, Roma Alessandro Federico, Naples Francesco Feo, Sassari Davide Festi, Bologna Natale Figura, Siena Vincenzo Formica, Rome Mirella Fraquelli, Milan Marzio Frazzoni, Modena Walter Fries, Messina Gennaro Galizia, Naples Andrea Galli, Florence Matteo Garcovich, Rome Eugenio Gaudio, Rome Paola Ghiorzo, Genoa Edoardo G Giannini, Genova Luca Gianotti, Monza Maria Cecilia Giron, Padova Alberto Grassi, Rimini Gabriele Grassi, Trieste Francesco Greco, Bergamo Luigi Greco, Naples Antonio Grieco, Rome Fabio Grizzi, Rozzano Laurino Grossi, Pescara Simone Guglielmetti, Milan Tiberiu Hershcovici, Jerusalem Calogero Iacono, Verona Enzo Ierardi, Bari Amedeo Indriolo, Bergamo Raffaele Iorio, Naples Paola Iovino, Salerno Angelo A Izzo, Naples Loreta Kondili, Rome Filippo La Torre, Rome Giuseppe La Torre, Rome Giovanni Latella, L Aquila Salvatore Leonardi, Catania Massimo Libra, Catania Anna Licata, Palermo C armela Loguercio, Naples Amedeo Lonardo, Modena Carmelo Luigiano, Catania Francesco Luzza, Catanzaro Giovanni Maconi, Milano Antonio Macrì, Messina Mariano Malaguarnera, Catania Francesco Manguso, Napoli Tommaso Maria Manzia, Rome Daniele Marrelli, Siena Gabriele Masselli, Rome Sara Massironi, Milan Giuseppe Mazzarella, Avellino Michele Milella, Rome Giovanni Milito, Rome Antonella d Arminio Monforte, Milan Fabrizio Montecucco, Genoa Giovanni Monteleone, Rome Mario Morino, Torino Vincenzo La Mura, Milan Gerardo Nardone, Naples Riccardo Nascimbeni, Brescia Gabriella Nesi, Florence Giuseppe Nigri, Rome Erica Novo, Turin Veronica Ojetti, Rome Michele Orditura, Naples Fabio Pace, Seriate Lucia Pacifico, Rome Omero Alessandro Paoluzi, Rome Valerio Pazienza, San Giovanni Rotondo Rinaldo Pellicano, Turin Adriano M Pellicelli, Rome Nadia Peparini, Ciampino Mario Pescatori, Rome Antonio Picardi, Rome Alberto Pilotto, Padova Alberto Piperno, Monza Anna Chiara Piscaglia, Rome Maurizio Pompili, Rome Francesca Romana Ponziani, Rome Cosimo Prantera, Rome Girolamo Ranieri, Bari Carlo Ratto, Tome Barbara Renga, Perugia Alessandro Repici, Rozzano Maria Elena Riccioni, Rome Lucia Ricci-Vitiani, Rome Luciana Rigoli, Messina Mario Rizzetto, Torino Ballarin Roberto, Modena Roberto G Romanelli, Florence Claudio Romano, Messina Luca Roncucci, Modena Cesare Ruffolo, Treviso L ucia Sacchetti, Napoli Rodolfo Sacco, Pisa Lapo Sali, Florence Romina Salpini, Rome Giulio Aniello, Santoro Treviso Armando Santoro, Rozzano Edoardo Savarino, Padua Marco Senzolo, Padua Annalucia Serafino, Rome Giuseppe S Sica, Rome Pierpaolo Sileri, Rome Cosimo Sperti, Padua Vincenzo Stanghellini, Bologna Cristina Stasi, Florence Gabriele Stocco, Trieste Roberto Tarquini, Florence Mario Testini, Bari Guido Torzilli, Milan Guido Alberto Massimo, Tiberio Brescia Giuseppe Toffoli, Aviano Alberto Tommasini, Trieste Francesco Tonelli, Florence Cesare Tosetti Porretta, Terme Lucio Trevisani, Cona Guglielmo M Trovato, Catania Mariapia Vairetti, Pavia Luca Vittorio Valenti, Milano Mariateresa T Ventura, Bari Giuseppe Verlato, Verona Marco Vivarelli, Ancona Giovanni Li Volti, Catania Giuseppe Zanotti, Padua Vincenzo Zara, Lecce Gianguglielmo Zehender, Milan Anna Linda Zignego, Florence Rocco Antonio Zoccali, Messina Angelo Zullo, Rome Japan Yasushi Adachi, Sapporo Takafumi Ando, Nagoya Masahiro Arai, Tokyo Makoto Arai, Chiba Takaaki Arigami, Kagoshima Itaru Endo,Yokohama Munechika Enjoji, Fukuoka Shunji Fujimori, Tokyo Yasuhiro Fujino, Akashi Toshiyoshi Fujiwara, Okayama Yosuke Fukunaga, Tokyo Toshio Fukusato, Tokyo Takahisa Furuta, Hamamatsu Osamu Handa, Kyoto Naoki Hashimoto, Osaka Yoichi Hiasa, Toon Masatsugu Hiraki, Saga Satoshi Hirano, Sapporo Keiji Hirata, Fukuoka Toru Hiyama, Higashihiroshima Akira Hokama, Nishihara Shu Hoteya, Tokyo Masao Ichinose, Wakayama Tatsuya Ide, Kurume Masahiro Iizuka, Akita Toshiro Iizuka, Tokyo Kenichi Ikejima, Tokyo Tetsuya Ikemoto, Tokushima Hiroyuki Imaeda, Saitama Atsushi Imagawa, Kan-onji Hiroo Imazu, Tokyo Shuji Isaji, Tsu Toru Ishikawa, Niigata Toshiyuki Ishiwata, Tokyo Soichi Itaba, Kitakyushu Yoshiaki Iwasaki, Okayama Tatehiro Kagawa, Isehara Satoru Kakizaki, Maebashi Naomi Kakushima, Shizuoka Terumi Kamisawa, Tokyo Akihide Kamiya, Isehara Osamu Kanauchi, Tokyo Tatsuo Kanda, Chiba Shin Kariya, Okayama Shigeyuki Kawa, Matsumoto Takumi Kawaguchi, Kurume Takashi Kawai, Tokyo Soo Ryang Kim, Kobe Shinsuke Kiriyama, Gunma Tsuneo Kitamura, Urayasu Masayuki Kitano, Osakasayama Hirotoshi Kobayashi, Tokyo Hironori Koga, Kurume Takashi Kojima, Sapporo Satoshi Kokura, Kyoto Shuhei Komatsu, Kyoto Tadashi Kondo, Tokyo Yasuteru Kondo, Sendai Yasuhiro Kuramitsu, Yamaguchi Yukinori Kurokawa, Osaka Shin Maeda, Yokohama Koutarou Maeda, Toyoake V January 1, 2016

7 Hitoshi Maruyama, Chiba Atsushi Masamune, Sendai Hiroyuki Matsubayashi, Suntogun Akihisa Matsuda, Inzai Hirofumi Matsui, Tsukuba Akira Matsumori, Kyoto Yoichi Matsuo, Nagoya Y Matsuzaki, Ami Toshihiro Mitaka, Sapporo Kouichi Miura, Akita Shinichi Miyagawa, Matumoto Eiji Miyoshi, Suita Toru Mizuguchi, Sapporo Nobumasa Mizuno, Nagoya Zenichi Morise, Nagoya Tomohiko Moriyama, Fukuoka Kunihiko Murase, Tusima Michihiro Mutoh, Tsukiji Akihito Nagahara, Tokyo Hikaru Nagahara, Tokyo Hidenari Nagai, Tokyo Koichi Nagata, Shimotsuke-shi Masaki Nagaya, Kawasaki Hisato Nakajima, Nishi-Shinbashi Toshifusa Nakajima, Tokyo Hiroshi Nakano, Kawasaki Hiroshi Nakase, Kyoto Toshiyuki Nakayama, Nagasaki Takahiro Nakazawa, Nagoya Shoji Natsugoe, Kagoshima City Tsutomu Nishida, Suita Shuji Nomoto, Naogya Sachiyo Nomura, Tokyo Takeshi Ogura, Takatsukishi Nobuhiro Ohkohchi, Tsukuba Toshifumi Ohkusa, Kashiwa Hirohide Ohnishi, Akita Teruo Okano, Tokyo Satoshi Osawa, Hamamatsu Motoyuki Otsuka, Tokyo Michitaka Ozaki, Sapporo Satoru Saito, Yokohama Naoaki Sakata, Sendai Ken Sato, Maebashi Toshiro Sato, Tokyo Tomoyuki Shibata, Toyoake Tomohiko Shimatani, Kure Yukihiro Shimizu, Nanto Tadashi Shimoyama, Hirosaki Masayuki Sho, Nara Ikuo Shoji, Kobe Atsushi Sofuni, Tokyo Takeshi Suda, Niigata M Sugimoto, Hamamatsu Ken Sugimoto, Hamamatsu Haruhiko Sugimura, Hamamatsu Shoichiro Sumi, Kyoto Hidekazu Suzuki, Tokyo Masahiro Tajika, Nagoya Hitoshi Takagi, Takasaki Toru Takahashi, Niigata Yoshihisa Takahashi, Tokyo Shinsuke Takeno, Fukuoka Akihiro Tamori, Osaka Kyosuke Tanaka, Tsu Shinji Tanaka, Hiroshima Atsushi Tanaka, Tokyo Yasuhito Tanaka, Nagoya Shinji Tanaka, Tokyo Minoru Tomizawa, Yotsukaido City Kyoko Tsukiyama-Kohara, Kagoshima Takuya Watanabe, Niigata Kazuhiro Watanabe, Sendai Satoshi Yamagiwa, Niigata Takayuki Yamamoto, Yokkaichi Hiroshi Yamamoto, Otsu Kosho Yamanouchi, Nagasaki Ichiro Yasuda, Gifu Yutaka Yata, Maebashi-city Shin-ichi Yokota, Sapporo Norimasa Yoshida, Kyoto Hiroshi Yoshida, Tama-City Hitoshi Yoshiji, Kashihara Kazuhiko Yoshimatsu, Tokyo Kentaro Yoshioka, Toyoake Nobuhiro Zaima, Nara Jordan Khaled Ali Jadallah, Irbid Kuwait Islam Khan, Kuwait Lebanon Bassam N Abboud, Beirut Kassem A Barada, Beirut Marwan Ghosn, Beirut Iyad A Issa, Beirut Fadi H Mourad, Beirut AIa Sharara, Beirut Rita Slim, Beirut Lithuania Antanas Mickevicius, Kaunas Malaysia Huck Joo Tan, Petaling Jaya Mexico Richard A Awad, Mexico City Carlos R Camara-Lemarroy, Monterrey Norberto C Chavez-Tapia, Mexico City Wolfgang Gaertner, Mexico City Diego Garcia-Compean, Monterrey Arturo Panduro, Guadalajara OT Teramoto-Matsubara, Mexico City Felix Tellez-Avila, Mexico City Omar Vergara-Fernandez, Mexico City Saúl Villa-Trevino, Cuidad de México Morocco Samir Ahboucha, Khouribga Netherlands Robert J de Knegt, Rotterdam Tom Johannes Gerardus Gevers, Nijmegen Menno Hoekstra, Leiden BW Marcel Spanier, Arnhem Karel van Erpecum, Utrecht New Zealand Leo K Cheng, Auckland Andrew Stewart Day, Christchurch Jonathan Barnes Koea, Auckland Max Petrov, Auckland Nigeria Olufunmilayo Adenike Lesi, Lagos Jesse Abiodun Otegbayo, Ibadan Stella Ifeanyi Smith, Lagos Norway Trond Berg, Oslo Trond Arnulf Buanes, Krokkleiva Thomas de Lange, Rud Magdy El-Salhy, Stord Rasmus Goll, Tromso Dag Arne Lihaug Hoff, Aalesund Pakistan Zaigham Abbas, Karachi Usman A Ashfaq, Faisalabad Muhammad Adnan Bawany, Hyderabad Muhammad Idrees, Lahore Saeed Sadiq Hamid, Karachi Yasir Waheed, Islamabad Poland Thomas Brzozowski, Cracow Magdalena Chmiela, Lodz Krzysztof Jonderko, Sosnowiec Anna Kasicka-Jonderko, Sosnowiec Michal Kukla, Katowice Tomasz Hubert Mach, Krakow Agata Mulak, Wroclaw Danuta Owczarek, Kraków Piotr Socha, Warsaw Piotr Stalke, Gdansk Julian Teodor Swierczynski, Gdansk Anna M Zawilak-Pawlik, Wroclaw Portugal Marie Isabelle Cremers, Setubal Ceu Figueiredo, Porto Ana Isabel Lopes, LIsbon M Paula Macedo, Lisboa Ricardo Marcos, Porto Rui T Marinho, Lisboa Guida Portela-Gomes, Estoril VI January 1, 2016

8 Filipa F Vale, Lisbon Puerto Rico Caroline B Appleyard, Ponce Qatar Abdulbari Bener, Doha Romania Mihai Ciocirlan, Bucharest Dan LucianDumitrascu, Cluj-Napoca Carmen Fierbinteanu-Braticevici, Bucharest Romeo G Mihaila, Sibiu Lucian Negreanu, Bucharest Adrian Saftoiu, Craiova Andrada Seicean, Cluj-Napoca Ioan Sporea, Timisoara Letiţia Adela Maria Streba, Craiova Anca Trifan, Iasi Russia Victor Pasechnikov, Stavropol Vasiliy Ivanovich Reshetnyak, Moscow Vitaly Skoropad, Obninsk Saudi Arabia Abdul-Wahed N Meshikhes, Dammam M Ezzedien Rabie, Khamis Mushait Singapore Brian KP Goh, Singapore Richie Soong, Singapore Ker-Kan Tan, Singapore Kok-Yang Tan, Singapore Yee-Joo Tan, Singapore Mark Wong, Singapore Hong Ping Xia, Singapore Slovenia Matjaz Homan, Ljubljana Martina Perse, Ljubljana South Korea Sang Hoon Ahn, Seoul Seung Hyuk Baik, Seoul Soon Koo Baik, Wonju Soo-Cheon Chae, Iksan Byung-Ho Choe, Daegu Suck Chei Choi, Iksan Hoon Jai Chun, Seoul Yeun-Jun Chung, Seoul Young-Hwa Chung, Seoul Ki-Baik Hahm, Seongnam Sang Young Han, Busan Seok Joo Han, Seoul Seung-Heon Hong, Iksan Jin-Hyeok Hwang, Seoungnam Jeong Won Jang, Seoul Jin-Young Jang, Seoul Dae-Won Jun, Seoul Young Do Jung, Kwangju Gyeong Hoon Kang, Seoul Sung-Bum Kang, Seoul Koo Jeong Kang, Daegu Ki Mun Kang, Jinju Chang Moo Kang, Seodaemun-gu Gwang Ha Kim, Busan Sang Soo Kim, Goyang-si Jin Cheon Kim, Seoul Tae Il Kim, Seoul Jin Hong Kim, Suwon Kyung Mo Kim, Seoul Kyongmin Kim, Suwon Hyung-Ho Kim, Seongnam Seoung Hoon Kim, Goyang Sang Il Kim, Seoul Hyun-Soo Kim, Wonju Jung Mogg Kim, Seoul Dong Yi Kim, Gwangju Kyun-Hwan Kim, Seoul Jong-Han Kim, Ansan Sang Wun Kim, Seoul Ja-Lok Ku, Seoul Kyu Taek Lee, Seoul Hae-Wan Lee, Chuncheon Inchul Lee, Seoul Jung Eun Lee, Seoul Sang Chul Lee, Daejeon Song Woo Lee, Ansan-si Hyuk-Joon Lee, Seoul Seong-Wook Lee, Yongin Kil Yeon Lee, Seoul Jong-Inn Lee, Seoul Kyung A Lee, Seoul Jong-Baeck Lim, Seoul Eun-Yi Moon, Seoul SH Noh, Seoul Seung Woon Paik, Seoul Won Sang Park, Seoul Sung-Joo Park, Iksan Kyung Sik Park, Daegu Se Hoon Park, Seoul Yoonkyung Park, Gwangju Seung-Wan Ryu, Daegu Il Han Song, Cheonan Myeong Jun Song, Daejeon Yun Kyoung Yim, Daejeon Dae-Yeul Yu Daejeon Spain Mariam Aguas, Valencia Raul J Andrade, Málaga Antonio Arroyo, Elche Josep M Bordas, Barcelona Lisardo Boscá, Madrid Ricardo Robles Campos, Murcia Jordi Camps, Reus Carlos Cervera Barcelona Alfonso Clemente, Granada Pilar Codoner-Franch, Valencia Fernando J Corrales, Pamplona Fermin Sánchez de Medina, Granada Alberto Herreros de Tejada, Majadahonda Enrique de-madaria, Alicante JE Dominguez-Munoz, Santiago de Compostela Vicente Felipo, Valencia CM Fernandez-Rodriguez, Madrid Carmen Frontela-Saseta, Murcia Julio Galvez, Granada Maria Teresa García, Vigo MI Garcia-Fernandez, Málaga Emilio Gonzalez-Reimers, La Laguna Marcel Jimenez, Bellaterra Angel Lanas, Zaragoza Juan Ramón Larrubia, Guadalajara Antonio Lopez-Sanroman, Madrid Vicente Lorenzo-Zuniga, Badalona Alfredo J Lucendo, Tomelloso Vicenta Soledad Martinez-Zorzano, Vigo José Manuel Martin-Villa, Madrid Julio Mayol, Madrid Manuel Morales-Ruiz, Barcelona Alfredo Moreno-Egea, Murcia Albert Pares, Barcelona Maria Pellise, Barcelona José Perea, Madrid Miguel Angel Plaza, Zaragoza María J Pozo, Cáceres Enrique Quintero, La Laguna Jose M Ramia, Madrid Francisco Rodriguez-Frias, Barcelona Silvia Ruiz-Gaspa, Barcelona Xavier Serra-Aracil, Barcelona Vincent Soriano, Madrid Javier Suarez, Pamplona Carlos Taxonera, Madrid M Isabel Torres, Jaén Manuel Vazquez-Carrera, Barcelona Benito Velayos, Valladolid Silvia Vidal, Barcelona Sri Lanka Arjuna Priyadarsin De Silva, Colombo Sudan Ishag Adam, Khartoum Sweden Roland G Andersson, Lund Bergthor Björnsson, Linkoping Johan Christopher Bohr, Örebro Mauro D Amato, Stockholm Thomas Franzen, Norrkoping Evangelos Kalaitzakis, Lund Riadh Sadik, Gothenburg Per Anders Sandstrom, Linkoping Ervin Toth, Malmö Konstantinos Tsimogiannis, Vasteras Apostolos V Tsolakis, Uppsala VII January 1, 2016

9 Switzerland Gieri Cathomas, Liestal Jean Louis Frossard, Geneve Christian Toso, Geneva Stephan Robert Vavricka, Zurich Dominique Velin, Lausanne Thailand Thawatchai Akaraviputh, Bangkok P Yoysungnoen Chintana, Pathumthani Veerapol Kukongviriyapan, Muang Vijittra Leardkamolkarn, Bangkok Varut Lohsiriwat, Bangkok Somchai Pinlaor, Khaon Kaen D Wattanasirichaigoon, Bangkok Trinidad and Tobago B Shivananda Nayak, Mount Hope Tunisia Ibtissem Ghedira, Sousse Lilia Zouiten-Mekki, Tunis Turkey Inci Alican, Istanbul Mustafa Altindis, Sakarya Mutay Aslan, Antalya Oktar Asoglu, Istanbul Yasemin Hatice Balaban, Istanbul Metin Basaranoglu, Ankara Yusuf Bayraktar, Ankara Süleyman Bayram, Adiyaman Ahmet Bilici, Istanbul Ahmet Sedat Boyacioglu, Ankara Züleyha Akkan Cetinkaya, Kocaeli Cavit Col, Bolu Yasar Colak, Istanbul Cagatay Erden Daphan, Kirikkale Mehmet Demir, Hatay Ahmet Merih Dobrucali, Istanbul Gülsüm Ozlem Elpek, Antalya Ayse Basak Engin, Ankara Eren Ersoy, Ankara Osman Ersoy, Ankara Yusuf Ziya Erzin, Istanbul Mukaddes Esrefoglu, Istanbul Levent Filik, Ankara Ozgur Harmanci, Ankara Koray Hekimoglu, Ankara Abdurrahman Kadayifci, Gaziantep Cem Kalayci, Istanbul Selin Kapan, Istanbul Huseyin Kayadibi, Adana Sabahattin Kaymakoglu, Istanbul Metin Kement, Istanbul Mevlut Kurt, Bolu Resat Ozaras, Istanbul Elvan Ozbek, Adapazari Cengiz Ozcan, Mersin Hasan Ozen, Ankara Halil Ozguc, Bursa Mehmet Ozturk, Izmir Orhan V Ozkan, Sakarya Semra Paydas, Adana Ozlem Durmaz Suoglu, Istanbul Ilker Tasci, Ankara Müge Tecder-ünal, Ankara Mesut Tez, Ankara Serdar Topaloglu, Trabzon Murat Toruner, Ankara Gokhan Tumgor, Adana Oguz Uskudar, Adana Mehmet Yalniz, Elazig Mehmet Yaman, Elazig Veli Yazisiz, Antalya Yusuf Yilmaz, Istanbul Ozlem Yilmaz, Izmir Oya Yucel, Istanbul Ilhami Yuksel, Ankara United Kingdom Nadeem Ahmad Afzal, Southampton Navneet K Ahluwalia, Stockport Yeng S Ang, Lancashire Ramesh P Arasaradnam, Coventry Ian Leonard Phillip Beales, Norwich John Beynon, Swansea Barbara Braden, Oxford Simon Bramhall, Birmingham Geoffrey Burnstock, London Ian Chau, Sutton Thean Soon Chew, London Helen G Coleman, Belfast Anil Dhawan, London Sunil Dolwani, Cardiff Piers Gatenby, London Anil T George, London Pasquale Giordano, London Paul Henderson, Edinburgh Georgina Louise Hold, Aberdeen Stefan Hubscher, Birmingham Robin D Hughes, London Nusrat Husain, Manchester Matt W Johnson, Luton Konrad Koss, Macclesfield Anastasios Koulaouzidis, Edinburgh Simon Lal, Salford John S Leeds, Aberdeen JK K Limdi, Manchester Hongxiang Liu, Cambridge Michael Joseph McGarvey, London Michael Anthony Mendall, London Alexander H Mirnezami, Southampton J Bernadette Moore, Guildford Claudio Nicoletti, Norwich Savvas Papagrigoriadis, London Sylvia LF Pender, Southampton David Mark Pritchard, Liverpool James A Ross, Edinburgh Kamran Rostami, Worcester Xiong Z Ruan, London Frank I Tovey, London Dhiraj Tripathi, Birmingham Vamsi R Velchuru, Great Yarmouth Nicholas T Ventham, Edinburgh Diego Vergani, London Jack Westwood Winter, Glasgow Terence Wong, London Ling Yang, Oxford United States Daniel E Abbott, Cincinnati Ghassan K Abou-Alfa, New York Julian Abrams, New York David William Adelson, Los Angeles Jonathan Steven Alexander, Shreveport Tauseef Ali, Oklahoma City Mohamed R Ali, Sacramento Rajagopal N Aravalli, Minneapolis Hassan Ashktorab, Washington Shashi Bala, Worcester Charles F Barish, Raleigh P Patrick Basu, New York Robert L Bell, Berkeley Heights David Bentrem, Chicago Henry J Binder, New Haven Joshua Bleier, Philadelphia Wojciech Blonski, Johnson City Kenneth Boorom, Corvallis Brian Boulay, Chicago Carla W Brady, Durham Kyle E Brown, Iowa City Adeel A Butt, Pittsburgh Weibiao Cao, Providence Andrea Castillo, Cheney Fernando J Castro, Weston Adam S Cheifetz, Boston Xiaoxin Luke Chen, Durham Ramsey Cheung, Palo Alto Parimal Chowdhury, Little Rock Edward John Ciaccio, New York Dahn L Clemens, Omaha Yingzi Cong, Galveston Laura Iris Cosen-Binker, Boston Joseph John Cullen, Lowa Mark J Czaja, Bronx Mariana D Dabeva, Bronx Christopher James Damman, Seattle Isabelle G De Plaen, Chicago Punita Dhawan, Nashville Hui Dong, La Jolla Wael El-Rifai, Nashville Sukru H Emre, New Haven Paul Feuerstadt, Hamden Josef E Fischer, Boston Laurie N Fishman, Boston Joseph Che Forbi, Atlanta Temitope Foster, Atlanta Amy E Foxx-Orenstein, Scottsdale Daniel E Freedberg, New York Shai Friedland, Palo Alto Virgilio George, Indianapolis Ajay Goel, Dallas Oliver Grundmann, Gainesville Stefano Guandalini, Chicago Chakshu Gupta, St. Joseph Grigoriy E Gurvits, New York VIII January 1, 2016

10 Xiaonan Han, Cincinnati Mohamed Hassan, Jackson Martin Hauer-Jensen, Little Rock Koichi Hayano, Boston Yingli Hee, Atlanta Samuel B Ho, San Diego Jason Ken Hou, Houston Lifang Hou, Chicago K-Qin Hu, Orange Jamal A Ibdah, Columbia Robert Thomas Jensen, Bethesda Huanguang Charlie Jia, Gainesville Rome Jutabha, Los Angeles Andreas M Kaiser, Los Angeles Avinash Kambadakone, Boston David Edward Kaplan, Philadelphia Randeep Kashyap, Rochester Rashmi Kaul, Tulsa Ali Keshavarzian, Chicago Amir Maqbul Khan, Marshall Nabeel Hasan Khan, New Orleans Sahil Khanna, Rochester Kusum K Kharbanda, Omaha Hyun Sik Kim, Pittsburgh Joseph Kim, Duarte Jae S Kim, Gainesville Miran Kim, Providence Timothy R Koch, Washington Burton I Korelitz, New York Betsy Kren, Minneapolis Shiu-Ming Kuo, Buffalo Michelle Lai, Boston Andreas Larentzakis, Boston Edward Wolfgang Lee, Los Angeles Daniel A Leffler, Boston Michael Leitman, New York Suthat Liangpunsakul, Indianapolis Joseph K Lim, New Haven Elaine Y Lin, Bronx Henry C Lin, Albuquerque Rohit Loomba, La Jolla James David Luketich, Pittsburgh Li Ma, Stanford Mohammad F Madhoun, Oklahoma City Thomas C Mahl, Buffalo Ashish Malhotra, Bettendorf Pranoti Mandrekar, Worcester John Marks, Wynnewood Wendy M Mars, Pittsburgh Julien Vahe Matricon, San Antonio Craig J McClain, Louisville Tamir Miloh, Phoenix Ayse Leyla Mindikoglu, Baltimore Huanbiao Mo, Denton Klaus Monkemuller, Birmingham John Morton, Stanford Adnan Muhammad, Tampa Michael J Nowicki, Jackson Patrick I Okolo, Baltimore Giusepp Orlando, Winston Salem Natalia A Osna, Omaha Virendra N Pandey, Newark Mansour A Parsi, Cleveland Michael F Picco, Jacksonville Daniel S Pratt, Boston Xiaofa Qin, Newark Janardan K Reddy, Chicago Victor E Reyes, Galveston Jon Marc Rhoads, Houston Giulia Roda, New York Jean-Francois Armand Rossignol, Tampa Paul A Rufo, Boston Madhusudana Girija Sanal, New York Miguel Saps, Chicago Sushil Sarna, Galveston Ann O Scheimann, Baltimore Bernd Schnabl, La Jolla Matthew J Schuchert, Pittsburgh Ekihiro Seki, La Jolla Chanjuan Shi, Nashville David Quan Shih, Los Angeles Shadab A Siddiqi, Orlando William B Silverman, Iowa City Shashideep Singhal, New York Bronislaw L Slomiany, Newark Steven F Solga, Bethlehem Byoung-Joon Song, Bethesda Dario Sorrentino, Roanoke Scott R Steele, Fort Lewis Branko Stefanovic, Tallahassee Arun Swaminath, New York Kazuaki Takabe, Richmond Naoki Tanaka, Bethesda Hans Ludger Tillmann, Durham George Triadafilopoulos, Stanford John Richardson Thompson, Nashville Andrew Ukleja, Weston Miranda AL van Tilburg, Chapel Hill Gilberto Vaughan, Atlanta Vijayakumar Velu, Atlanta Gebhard Wagener, New York Kasper Saonun Wang, Los Angeles Xiangbing Wang, New Brunswick Daoyan Wei, Houston Theodore H Welling, Ann Arbor C Mel Wilcox, Birmingham Jacqueline Lee Wolf, Boston Laura Ann Woollett, Cincinnati Harry Hua-Xiang Xia, East Hanover Wen Xie, Pittsburgh Guang Yu Yang, Chicago Michele T Yip-Schneider, Indianapolis Sam Zakhari, Bethesda Kezhong Zhang, Detroit Huiping Zhou, Richmond Xiao-Jian Zhou, Cambridge Richard Zubarik, Burlington Venezuela Miguel Angel Chiurillo, Barquisimeto Vietnam Van Bang Nguyen, Hanoi IX January 1, 2016

11 S Contents Weekly Volume 23 Number 29 August 7, 2017 EDITORIAL 5257 Liver and the defects of cholesterol and bile acids biosynthesis: Rare disorders many diagnostic pitfalls Corso G, Dello Russo A, Gelzo M REVIEW 5266 Contribution of galectin-1, a glycan-binding protein, to gastrointestinal tumor progression Bacigalupo ML, Carabias P, Troncoso MF 5282 From diagnosis to treatment of hepatocellular carcinoma: An epidemic problem for both developed and developing world Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, Athanasiou A, Moris D, Sakellariou S, Kykalos S, Tsourouflis G, Garmpi A, Delladetsima I, Kontzoglou K, Kouraklis G ORIGINAL ARTICLE Basic Study 5295 Partial external biliary diversion in bile salt export pump deficiency: Association between outcome and mutation Ellinger P, Stindt J, Dröge C, Sattler K, Stross C, Kluge S, Herebian D, Smits SHJ, Burdelski M, Schulz-Jürgensen S, Ballauff A, Schulte am Esch J, Mayatepek E, Häussinger D, Kubitz R, Schmitt L 5304 Celecoxib-induced gastrointestinal, liver and brain lesions in rats, counteraction by BPC 157 or L-arginine, aggravation by L-NAME Drmic D, Kolenc D, Ilic S, Bauk L, Sever M, Zenko Sever A, Luetic K, Suran J, Seiwerth S, Sikiric P 5313 Hwangryunhaedok-tang induces the depolarization of pacemaker potentials through 5-HT3 and 5-HT4 receptors in cultured murine small intestine interstitial cells of Cajal Kim HJ, Lee GS, Kim H, Kim BJ 5324 MicroRNA exhibit altered expression in the inflamed colonic mucosa of ulcerative colitis patients Valmiki S, Ahuja V, Paul J 5333 Salvianolic acid B protects hepatocytes from H2O2 injury by stabilizing the lysosomal membrane Yan XF, Zhao P, Ma DY, Jiang YL, Luo JJ, Liu L, Wang XL 5345 PBX1 attributes as a determinant of connexin 32 downregulation in Helicobacter pylori -related gastric carcinogenesis Liu XM, Xu CX, Zhang LF, Huang LH, Hu TZ, Li R, Xia XJ, Xu LY, Luo L, Jiang XX, Li M August 7, 2017 Volume 23 Issue 29

12 Contents World Journal of Gastroenterology Volume 23 Number 29 August 7, 2017 Case Control Study 5356 Influence of dietary isoflavone intake on gastrointestinal symptoms in ulcerative colitis individuals in remission Głąbska D, Guzek D, Grudzińska D, Lech G 5364 Genetic polymorphisms of MAFK, encoding a small Maf protein, are associated with susceptibility to ulcerative colitis in Japan Arisawa T, Nakamura M, Otsuka T, Jing W, Sakurai N, Takano H, Hayashi T, Ota M, Nomura T, Hayashi R, Shimasaki T, Tahara T, Shibata T Retrospective Study 5371 Elaboration and validation of Crohn s disease anoperineal lesions consensual definitions Horaist C, de Parades V, Abramowitz L, Benfredj P, Bonnaud G, Bouchard D, Fathallah N, Sénéjoux A, Siproudhis L, Staumont G, Viguier M, Marteau P 5379 Efficacy of tolvaptan for the patients with advanced hepatocellular carcinoma Miyazaki M, Yada M, Tanaka K, Senjyu T, Goya T, Motomura K, Kohjima M, Kato M, Masumoto A, Kotoh K 5386 Outcomes of preoperative endoscopic nasobiliary drainage and endoscopic retrograde biliary drainage for malignant distal biliary obstruction prior to pancreaticoduodenectomy Zhang GQ, Li Y, Ren YP, Fu NT, Chen HB, Yang JW, Xiao WD Clinical Trials Study 5395 Phase I clinical study of personalized peptide vaccination combined with radiotherapy for advanced hepatocellular carcinoma Shen J, Wang LF, Zou ZY, Kong WW, Yan J, Meng FY, Chen FJ, Du J, Shao J, Xu QP, Ren HZ, Li RT, Wei J, Qian XP, Liu BR Observational Study 5405 Transition clinic attendance is associated with improved beliefs and attitudes toward medicine in patients with inflammatory bowel disease Fu N, Jacobson K, Round A, Evans K, Qian H, Bressler B 5412 Gut barrier failure biomarkers are associated with poor disease outcome in patients with primary sclerosing cholangitis Tornai T, Palyu E, Vitalis Z, Tornai I, Tornai D, Antal-Szalmas P, Norman GL, Shums Z, Veres G, Dezsofi A, Par G, Par A, Orosz P, Szalay F, Lakatos PL, Papp M 5422 Efficacy of forced coagulation with low high-frequency power setting during endoscopic submucosal dissection Ishida T, Toyonaga T, Ohara Y, Nakashige T, Kitamura Y, Ariyoshi R, Takihara H, Baba S, Yoshizaki T, Kawara F, Tanaka S, Morita Y, Umegaki E, Hoshi N, Azuma T II August 7, 2017 Volume 23 Issue 29

13 Contents World Journal of Gastroenterology Volume 23 Number 29 August 7, 2017 Prospective Study 5431 Clinical outcomes of isolated renal failure compared to other forms of organ failure in patients with severe acute pancreatitis Gougol A, Dugum M, Dudekula A, Greer P, Slivka A, Whitcomb DC, Yadav D, Papachristou GI SYSTEMATIC REVIEW 5438 Laparoscopic ultrasonography as an alternative to intraoperative cholangiography during laparoscopic cholecystectomy Dili A, Bertrand C III August 7, 2017 Volume 23 Issue 29

14 Contents World Journal of Gastroenterology Volume 23 Number 29 August 7, 2017 ABOUT COVER Editorial board member of World Journal of Gastroenterology, Shinji Tanaka, MD, PhD, Professor, Department of Endoscopy, Hiroshima University Hospital, Hiroshima , Japan AIMS AND SCOPE World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1375 experts in gastroenterology and hepatology from 68 countries. The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. INDEXING/ABSTRACTING World Journal of Gastroenterology (WJG) is now indexed in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central and Directory of Open Access Journals. The 2017 edition of Journal Citation Reports cites the 2016 impact factor for WJG as (5-year impact factor: 3.176), ranking WJG as 29 th among 79 journals in gastroenterology and hepatology (quartile in category Q2). FLYLEAF I-IX Editorial Board EDITORS FOR THIS ISSUE Responsible Assistant Editor: Xiang Li Responsible Electronic Editor: Dan Li Proofing Editor-in-Chief: Lian-Sheng Ma Responsible Science Editor: Ze-Mao Gong Proofing Editorial Office Director: Jin-Lei Wang NAME OF JOURNAL World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) LAUNCH DATE October 1, 1995 FREQUENCY Weekly EDITORS-IN-CHIEF Damian Garcia-Olmo, MD, PhD, Doctor, Professor, Surgeon, Department of Surgery, Universidad Autonoma de Madrid; Department of General Surgery, Fundacion Jimenez Diaz University Hospital, Madrid 28040, Spain Stephen C Strom, PhD, Professor, Department of Laboratory Medicine, Division of Pathology, Karolinska Institutet, Stockholm , Sweden Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States EDITORIAL BOARD MEMBERS All editorial board members resources online at EDITORIAL OFFICE Jin-Lei Wang, Director Yuan Qi, Vice Director Ze-Mao Gong, Vice Director World Journal of Gastroenterology Baishideng Publishing Group Inc 7901 Stoneridge Drive, Suite 501, Pleasanton, CA 94588, USA Telephone: Fax: editorialoffice@wjgnet.com Help Desk: PUBLISHER Baishideng Publishing Group Inc 7901 Stoneridge Drive, Suite 501, Pleasanton, CA 94588, USA Telephone: Fax: bpgoffice@wjgnet.com Help Desk: PUBLICATION DATE August 7, 2017 COPYRIGHT 2017 Baishideng Publishing Group Inc. Articles published by this Open-Access journal are distributed under the terms of the Creative Commons Attribution Noncommercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. SPECIAL STATEMENT All articles published in journals owned by the Baishideng Publishing Group (BPG) represent the views and opinions of their authors, and not the views, opinions or policies of the BPG, except where otherwise explicitly indicated. INSTRUCTIONS TO AUTHORS Full instructions are available online at wjgnet.com/bpg/gerinfo/204 ONLINE SUBMISSION IV August 7, 2017 Volume 23 Issue 29

15 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) liver and the defects of cholesterol and bile acids biosynthesis: rare disorders many diagnostic pitfalls EDITORIAL Gaetano Corso, Antonio Dello Russo, Monica Gelzo Gaetano Corso, Department of Clinical and Experimental Medicine, University of Foggia, Foggia, Italy Antonio Dello Russo, Monica Gelzo, Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico Ⅱ, Naples, Italy Author contributions: Corso G and Gelzo M have substantially contributed to conception and design of the study and writing the manuscript; Dello Russo A has contributed to the critical discussion of the manuscript. Conflict-of-interest statement: The authors declare no conflict of interest related to this publication. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Monica Gelzo, PhD, Researcher, Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico Ⅱ, Via Pansini 5, Naples, Italy. monicagelzo@gmail.com Telephone: Fax: Received: March 18, 2017 Peer-review started: March 21, 2017 First decision: April 26, 2017 Revised: may 1, 2017 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, 2017 Abstract In recent decades, biotechnology produced a growth of knowledge on the causes and mechanisms of metabolic diseases that have formed the basis for their study, diagnosis and treatment. Unfortunately, it is well known that the clinical features of metabolic diseases can manifest themselves with very different characteristics and escape early detection. Also, it is well known that the prognosis of many metabolic diseases is excellent if diagnosed and treated early. In this editorial we briefly summarized two groups of inherited metabolic diseases, the defects of cholesterol biosynthesis and those of bile acids. Both groups show variable clinical manifestations but some clinical signs and symptoms are common in both the defects of cholesterol and bile acids. The differential diagnosis can be made analyzing sterol profiles in blood and/ or bile acids in blood and urine by chromatographic techniques (GC-MS and LC-MS/MS). Several defects of both biosynthetic pathways are treatable so early diagnosis is crucial. Unfortunately their diagnosis is made too late, due either to the clinical heterogeneity of the syndromes (severe, mild and very mild) that to the scarcity of scientific dissemination of these rare diseases. Therefore, the delay in diagnosis leads the patient to the medical observation when the disease has produced irreversible damages to the body. Here, we highlighted simple clinical and laboratory descriptions that can potentially make you to suspect a defect in cholesterol biosynthesis and/or bile acids, as well, we suggest appropriate request of the laboratory tests that along with common clinical features can help to diagnose these defects. Key words: Cholesterol; Bile acids; liver metabolism; gas chromatography coupled to mass spectrometry; liquid chromatography coupled to tandem mass spectrometry The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: The genetic defects of cholesterol and bile acid biosynthesis are characterized by a diversity 5257 August 7, 2017 Volume 23 Issue 29

16 Corso G et al. Cholesterol and bile acids biosynthesis defects of clinical findings affecting the liver, the intestine, and the nervous system. Many of these defects are efficaciously treatable but owing to mild phenotypes many cases can escape to an earlier diagnosis and are identified after few years or adulthood with irreversible injuries or more difficult to treat. Here, we highlighted simple clinical and laboratory descriptions that can potentially make you to suspect a defect in cholesterol biosynthesis and/or bile acids, in order to reduce the diagnostic delay and to improve the prognosis of these defects. Corso G, Dello Russo A, Gelzo M. liver and the defects of cholesterol and bile acids biosynthesis: Rare disorders many diagnostic pitfalls. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5257.htm DOI: i INTRODUCTION Metabolic diseases are genetic based conditions in which the defective gene results in deficiency of an enzyme that leads to metabolic disorders. Today, several hundred of genetic metabolic disorders are known, and their symptoms, treatments, and prognosis vary widely. The genetic defects in the biosynthesis of cholesterol and bile acids have been well studied in recent decades and several of these defects are treatable with results that greatly improve the prognosis and the patient s health. Cholesterol is essential for the maintenance of life in vertebrates [1]. It is an essential metabolite of cellular membrane structure, and is also the precursor of bile acids, steroid hormones, and oxysterols, which play multiple and important biological functions throughout the body [2,3]. Especially, the synthesis of bile acids and the bile formation plays a pivotal role to survival of organism. Body cholesterol levels are finely regulated by the balance between mechanisms of diet cholesterol absorption, liver synthesis, biliary excretion, and peripheral tissue uptake. All this requires close molecular collaboration between the liver, the intestine and all the tissues of the whole organism [4]. Plasma levels of cholesterol are controlled by the liver through specific lipoprotein receptors, sterol transporters and intracellular nuclear receptors, which translate the signals derived from variations of cholesterol levels in selective variations of gene expression [5-8]. The liver is the main organ of cholesterol synthesis in most mammals [9,10], through an intricate pathway involving more than 30 enzymatic steps [11,12]. The intestine plays a pivotal role in the homeostasis of cholesterol. In fact, it is the main site for cholesterol absorption and excretion. Cholesterol that is absorbed into the lumen of the small intestine derives from food digestion, partial reabsorption of biliary cholesterol, and from that one released by the intestinal epithelial cells. The presence of bile acids as detergents is obligatory for the solubilization and uptake of intestinal cholesterol. They are excreted from liver and reabsorbed from the intestinal lumen back to the liver through the enterohepatic circulation [13]. Beside cholesterol, also plant sterols (e.g., campesterol and β-sitosterol) and stanols are absorbed by Niemann-Pick C1 Like 1 (NPC1L1), a transporter localized in the microvilli cells of small intestine in the apical plasma membrane, which facilitates their uptake and transport. NPC1L1 is also localized near to other transporters such as ATP-binding cassette G5/G8 (ABCG5/G8) that act as inverted transporters pumping cholesterol and other sterols from enterocytes back to the intestinal lumen, as well as from hepatocytes to bile ducts. Instead, the bile acids are excreted into bile via specific pump proteins (BSEP or ABCB11) [14,15]. Mutations in ABCG5/G8 genes cause Sitosterolemia (STSL, OMIM #210250), a rare autosomal recessive lipid storage disease where it is found elevated plasma levels of cholesterol and non-cholesterol sterols due to impaired intestinal absorption and biliary sterol excretion [16]. ABCG5/G8 are controlled by cholesterol through liver X receptors (LXRs), which in turn are activated by oxysterols and other plant sterol derivatives [17]. Another target of LXR is ABCA1, which is the reverse transporter of cholesterol. By this mechanism the surplus of free cholesterol is eliminated from peripheral tissues through biliary excretion or non-biliary trans-intestinal cholesterol efflux (TICE) that, to our knowledge, has been demonstrated only in animal models [18,19]. The fecal excretion of neutral and acidic sterols, coming from cholesterol and non-cholesterol sterols, also contributes to cholesterol balance in whole body. The production of bile acids from cholesterol is the main mechanism for removing sterols from our body. At the same time, it has been showed that bile acids play various functions in signal transduction pathways for energy metabolism regulation. Biosynthesis of bile acids occurs through two main pathways involving 17 different enzymes, many of which are predominantly expressed in the liver [20]. Since excess and cholesterol deficiency can cause serious damage to our body s structures, cholesterol homeostasis is required to be tightly controlled. In fact, hypercholesterolemia is the main risk factor for the development of atherosclerosis and consequently of cardiovascular disease [21,22]. The different types of hypercholesterolemia, such as familial hypercholesterolemia, secondary hypercholesterolemia, polygenic hypercholesterolemia, have been well characterized [23] and will not be reported here. Instead, inherited defects of cholesterol biosynthesis lead to severe clinical phenotypes; for example, the absence of 3-hydroxy-3-methylglutaryl CoA (HMG August 7, 2017 Volume 23 Issue 29

17 Corso G et al. Cholesterol and bile acids biosynthesis defects CoA) reductase, which is the main regulatory enzyme of cholesterol biosynthesis, is not compatible with life [24]. In addition, the liver cholesterol catabolism disorders, such as the synthesis of bile acids, can be the cause or can be secondary to biliary stasis, which acts significantly on the effectiveness of regulatory mechanisms in the liver and intestine [4]. This work aims to draw the attention of physicians on clinical, diagnostic, and therapeutic knowledge published on some defects of biosynthesis of cholesterol and of bile acids. These defects have a widely variable clinical phenotype, but some signs and symptoms are common to the different genetic forms known so far. Unfortunately, since these defects also have mild phenotypes or even very mild, they can escape to an earlier diagnosis, and many cases are identified after a few years or in adulthood with irreversible injuries or more difficult to treat [25,26]. The diagnostic laboratory path of inborn errors of biosynthesis of cholesterol [27-29] and of bile acids [26,30] is of fundamental importance for the differential diagnosis and the diagnostic accuracy of these diseases. Therefore, we need of knowledge about the laboratory tests for the metabolic study of patients that putatively suffer from these defects. Today, the applications in the clinical field of mass spectrometry coupled with chromatography methods (gaseous or liquid) are already widely used in many laboratories, and the determination of metabolic profiles, such as sterols [31-34] or bile acids [35], in biological fluids (blood, plasma, urine) facilitates the study of many inborn errors of metabolism including cholesterol and bile acids. Here, we will focus on some treatable disorders for which the early diagnosis is fundamental, and this article also provides a simple diagnostic flow chart together to clinical characteristics that could be useful for the clinicians in the investigation of cholesterol and bile acid disorders. CHOLESTEROL BIOSYNTHESIS DEFECTS After the discovery that Smith-Lemli-Opitz syndrome (SLOS, OMIM # ), a congenital multi-malformative syndrome, is due by a disorder of post-squalene cholesterol biosynthesis caused by defects in 7-dehydrocholesterol reductase [36], other malformative syndromes have been discovered in humans caused by other cholesterol biosynthesis defects. In table 1 are reported all defects to date discovered in the pathway of cholesterol synthesis in humans [25,28,36-52]. Generally, the onset of these diseases occurs at birth, even though some phenotypes may present during the first months of life (CDPX2) [25] or in the early infancy (SC4MOL deficiency) [49,50]. Since the phenotypes of these defects can be highly variable, in particular the patients with a mild phenotype, the diagnosis can be missed at birth and can be made very belatedly. The phenotypic spectrum of SLOS is extremely wide, and the cases more severely affected by malformations die in utero or early after birth. Instead, the patients mildly affected suffer from less severe malformations, intellectual disability and behavioral problems [28]. Plasma sterol analysis by gas chromatography is a useful screening test for most of these disorders, even though a negative result in plasma does not exclude disorders such as CHILD, CK, and mild CDPX2 syndromes (table 1). The cholesterol plasma levels in severe cases of SLOS are very low (< 20 mg/dl), while in the patients with mild phenotype may have total cholesterol levels quite variables ranging from low (< 100 mg/dl) to normal levels [27]. In fact, the mild cases of SLOS can be treated using cholesterol supplementation and simvastatin [28]. Instead, all other defects, with the exception of lathosterolosis and SC4MOL, there are no treatments that correct or attenuate the metabolic condition. Therefore, they are cured with surgical or medical treatments needed to alleviate symptoms [25,45]. Lathosterolosis is a very rare disease with only four cases reported in literature [40-43,53], of which two patients survived [40,43]. In particular, the first described patient [40] showed a progressive intrahepatic cholestasis that had caused liver failure at seven years when she was subjected to liver transplantation (LT), which removed liver disease, corrected the defect in cholesterol metabolism, and also improved some neurologic symptoms [54,55]. In some conditions that influence cholesterol metabolism, LT acts as a gene therapy or as a healthy gene producer [18]. Furthermore, the normal gene expression of cholesterol biosynthesis and its physiological levels in the liver graft may influence intrahepatic availability of cholesterol, which is essential for liver-regenerative capacity [56]. Instead, the last case of lathosterolosis has been diagnosed in a 22 mo-old male with a mild clinical and biochemical phenotype. One month after diagnosis, the patient was treated with simvastatin and it resulted in normalization of lathosterol level and neurodevelopmental improvement [43]. SC4MOL deficiency is a recently discovered defect into the C-4 demethylase complex of cholesterol biosynthesis well described by He et al [49]. Until now, only five SC4MOL patients have been reported with a high variable phenotype [50]. The first patient presented the more severe phenotype characterized by a psoriasiform dermatitis, she was treated by oral statin and supplementation with cholesterol plus bile acids. After two years of treatment, the symptoms dramatically ameliorated and methylsterol levels normalized. BILE ACIDS SYNTHESIS DEFECTS Hereditary biosynthesis defects of biliary acids cause fatal liver disease during childhood and/or progressive neurological diseases that occur later in infancy or in 5259 August 7, 2017 Volume 23 Issue 29

18 Corso G et al. Cholesterol and bile acids biosynthesis defects Table 1 Inherited defects of cholesterol biosynthesis in humans Disorder OMIM# Frequency Enzyme (blood biomarkers) Primary site of expression Treatable Ref. SLOS :20000/1: dehydrocholesterol reductase (7-dehydrocholesterol, 8-dehydrocholesterol) Desmosterolosis cases 3β-hydroxysterol- 24-reductase (desmosterol) CDPX : β-hydroxysteroid- 8, 7-sterol isomerase [8-dehydrocholesterol, cholesta-8(9)-en-3β-ol] CHILD syndrome < 1: β-hydroxysteroid dehydrogenase [4α-carboxymethylcholest-8(9)- en-3β-ol, 4α-monomethyl-and 4,4 -dimethylsterols] 2 Lathosterolosis cases 3β-hydroxysteroid- 5-desaturase (lathosterol) Multisystemic Yes [28,36] mild cases Multisystemic No [25,37] Skin and skeletal systems No [25,38] Skin and skeletal systems No [25,39] Multisystemic Yes [40-43] two cases Skin and genital systems No [44,45] Skeletal system No [25,46] Antley-Bixler syndrome > 100 cases lanosterol 14α-demethylase (lanosterol, dihydrolanosterol) 2 Greenberg dysplasia cases sterol- 14-reductase (cholesta-8,14-dien- 3β-ol, cholesta-8,14,24-trien-3β-ol) 2 CK syndrome cases 3β-hydroxysteroid dehydrogenase (4α-monomethyl- and 4,4 -dimethylsterols) 2 Nervous system No [25,47,48] SC4MOL deficiency cases sterol-c4-methyl oxidase (4α-monomethyl- and 4,4 -dimethylsterols) Skin and eye Yes [49,50,88] Systems one case 1 an hypomorphic variant (#300960) has been reported in 10 male patients [25,51] ; 2 presence of biomarkers in tissue and/or cultured cells only; 3 a variant form (#613571) due to deficiency of cytochrome P450 oxidoreductase has been reported 9 subjects [45,52]. CDPX2: X-linked dominant disorder chondrodysplasia punctata-2; CHILD: congenital hemidysplasia with ichthyosiformerythroderma and limb defects; CK: eponym derived from the first case; SC4MOL: sterol- C4-methyl oxidase; SLOS: Smith-Lemli-Opitz syndrome. the adult. Some of these diseases can be effectively treated by the administration of bile acids, so early diagnosis of these disorders is very important and lifesaving. Recently, Clayton [26] and Heubi et al [35] reviewed the defects to date discovered in the pathway of bile acid synthesis, which are reported in table 2 [26,35,57-77]. The onset of these defects usually occurs in neonatal period or childhood with cholestasis, vitamin deficiency (fat-soluble), and with rickets, or hypoprothrombinemia, chronic liver disease or growth failure. Differently, the mean age of onset of symptoms for CTX is 19 years [26,30,35] and CYP7A1 deficiency usually present in adult life with hyperlipidemia [35,77], whereas SPG5A is characterized by a high variable age of onset (from 8 to 40 years of life) with a wide phenotypic spectrum (spastic paraplegia with or without additional manifestations, including optic atrophy or cerebellar ataxia) [66-69]. The defect in bile acid synthesis causes a reduction of hepatic conversion of cholesterol to cholic acid and chenodeoxycholic acid (CDCA) [78]. Canalicular bile flow is stimulated by the increase of bile acids synthesis, even though a bile salts-independent bile flow is always present as basal state. Therefore, the lack or the reduced synthesis of bile acids causes a more or less serious reduction of bile flow (cholestasis) and regurgitation in the blood stream of normally excreted compounds (i.e., conjugate bilirubin). In addition, the presence of bile acids promotes the release of gamma-glutamyl transpeptidase (γ-gt) from the canalicular membrane, while the absence of bile acids in the bile, except for some cases, does not result in increased plasma γ-gt. In addition, since bile acids act as detergent for lipid absorption in the intestine, congenital bile acid synthesis errors can lead to steatorrhea, growth delay, and deficiencies in fatsoluble vitamins. Among these disorders, we focused on Cerebrotendinous Xanthomatosis (CTX, OMIM # ), the most common inborn error of bile acids synthesis. The clinical findings of CTX are tendon xanthomas, diarrhea, cataracts, neurological manifestations, such as polyneuropathy, pyramidal and/or cerebellar signs, intellectual disability, psychiatric disturbance, and seizures [30,79,80]. In spite of the xanthomas and premature atherosclerosis, CTX patients are usually normocholesterolemic [81]. In these patients the 25-hydroxylated C27-bile alcohols are abundantly excreted in the urine and other biological materials, the accumulation of these metabolites is due to the incomplete oxidation of the cholesterol side-chain [82]. Instead, the production of CDCA is markedly reduced and in face of almost normal production of cholic acid [83]. In addition, the reduced levels of bile acids decreased the negative feedback on two regulatory enzymes, the cholesterol 7-hydroxylase, the first ratelimiting enzyme in bile acid pathway, and the HMG- CoA reductase, which regulates cholesterol production. As a result, the increased activities of both enzymes 5260 August 7, 2017 Volume 23 Issue 29

19 Corso G et al. Cholesterol and bile acids biosynthesis defects Table 2 Inherited defects of bile acids biosynthesis in humans Disorder OMIM# Frequency Enzyme (urine biomarkers) 1 Primary site of expression Treatable Ref. CTX :50000 Sterol 27-hydroxylase (tetrahydroxy-, pentahydroxy- and hexahydroxy-bile alcohols) 2 CBAS cases 3β-hydroxy- 5-C27-steroid oxidoreductase (3β-hydroxy- 5 bile acids) Eye, central and peripheral Yes [26,30,35] nervous systems Liver Yes [26,35,57,58] CBAS cases 4-3-oxosteroid 5β-reductase ( 4-3-oxo bile acids) Liver Yes [35,59-65] SPG5A cases Oxysterol 7α-hydroxylase (27-hydroxycholesterol) 3 Central and peripheral No [66-69] nervous systems FHCA cases BAAT 4 (unconjugated cholic acid) 3 Liver and intestine Yes [35,70,71] CBAS cases α-methylacyl-coa racemase (THCA) 5 Liver, intestine and Yes [35,72,73] peripheral nervous systems CBAS cases oxysterol 7α-hydroxylase (3β-hydroxy-5-cholenoic Liver No [35,74,75] and 3β-hydroxy-5-cholestenoic acids) BACL deficiency NR 8 cases Bile acid-coa ligase (unconjugated cholic acid) 3 Liver and intestine No [76] CYP7A1 deficiency NR < 1: CYP7A1 (3β-hydroxy-5-cholenoic and 3β-hydroxy- 5-cholestenoic acids, 27-hydroxycholesterol) 6 Cardiovascular system No [35,77] 1 conjugated form unless otherwise noted; 2 plasma and tissue accumulation of cholestanol and cholesterol precursors; 3 presence also in serum; 4 FHCA can be due also to mutations in Tight junction protein-2 and Microsomal epoxide hydrolase-1 genes; 5 plasma and tissue accumulation of phytanic and pristanic acids; 6 high plasma levels of total and LDL-cholesterol, and 27-hydroxycholesterol. BAAT: bile acids-coa aminoacid N-acyltransferase; CTX: cerebrotendinous xanthomatosis; CYP7A1: cholesterol 7α-hydroxylase; FHCA: familial hypercholanemia; NR: not reported; SPG5A: spastic paraplegia-5a; THCA: 3α,7α,12α-trihydroxy-5β-cholestan-26-oic acid. lead to an accumulation of bile acid precursors, such as cholestanol and various bile alcohols, and of intermediates of cholesterol biosynthesis [84]. In fact plasma sterol analyses in CTX patients reveal elevated cholestanol and cholesterol precursors levels [30,81,85]. Treatment of CTX patients with CDCA by a negative feedback inhibits the 7α-hydroxylase and the production of toxic bile acid intermediates, and reduces the production of cholesterol by the liver [82]. Clinical and laboratory parameters are improved by longterm oral administration of CDCA and without toxic effects [79]. In particular, when initiated in childhood, CDCA therapy may arrest the progression of disease and prevent neurological deterioration. Instead, once neurological impairment is manifest, a poor response to CDCA treatment may be recorded [79]. CDCA and statins therapy inhibits cholesterol synthesis reducing cholesterol precursors and cholestanol levels in plasma, and can improve lipoprotein metabolism [84]. The efficacy of treatment with HMG-CoA reductase inhibitors alone is controversial, and some adverse effects such as hepatic dysfunction and rhabdomyolysis may be observed [79,80,84]. DIFFERENTIAL DIAGNOSIS OF CHOLESTEROL AND BILE ACID BIOSYNTHESIS DEFECTS Some treatable defects of cholesterol and bile acid biosynthesis that share different clinical findings are reported in Table 3. Nevertheless, these disorders are characterized by the accumulation of specific biomarkers (Tables 1 and 2) in blood and/or urine of affected patients [25,26,86,87]. Hence, accurate identification and quantification of these metabolites are essential to address the diagnostic-therapeutic process of these defects. The sterol profile can be easily analyzed by gas chromatography coupled to mass spectrometry (GC- MS; Table 3) in plasma, dried blood spot, red blood cell membrane and tissue homogenates [25,27,31,33]. Furthermore, an useful screening test for many of bile acid synthesis defects is the analysis of bile acids and bile alcohols in urine, which is easily performed by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS; Table 3) [26,30,35]. CONCLUSION In this editorial, we have briefly focused on the main clinical signs and laboratory findings of the inherited defects of cholesterol and bile acids synthesis. In summary, the liver and the intestine are the strategic organs in the control of cholesterol and bile acids in biological fluids. Moreover, the physiologic biosynthesis of cholesterol and bile acids is essential for the most important functions of our body, including embryonic development and neuronal functions. To date, as summarized here, in humans have been discovered nine inborn defects of cholesterol synthesis and nine of the bile acids. Although these diseases are rare and some ones very rare, it is commonly believed that their frequency has been underestimated, particularly in those patients affected by mild forms. This may be due to the heterogeneity of clinical and laboratory features of these diseases, which represent the pitfalls that mask their early diagnosis but, more important, it is the lost of all cases that are never diagnosed. Moreover, many of the defects reported here are treatable and 5261 August 7, 2017 Volume 23 Issue 29

20 Corso G et al. Cholesterol and bile acids biosynthesis defects Table 3 Clinical and laboratory findings shared by some treatable defects of cholesterol and bile acid biosynthesis Clinical features SLOS 1 LATHO SC4MOL CTX CBAS1 CBAS2 CBAS4 Shared findings Microcephaly Yes Yes Yes No No No No 3/7 Congenital cataracts Yes Yes Yes Yes No No No 4/7 Intellectual disability Yes Yes Yes Yes No No No 4/7 Neurological disease No No No Yes No No Yes 2/7 Developmental delay Yes Yes Yes No No No No 3/7 Cholestasis No Yes No Yes Yes Yes Yes 5/7 Steatosis No Yes No No No Yes No 2/7 AST Normal High Normal High High High Normal 4/7 ALT Normal High Normal High High High Normal 4/7 γgt Normal High Normal Normal Normal High Normal 2/7 Conjugated bilirubin Normal High Normal High High High Normal 4/7 Total cholesterol Very low to normal Low to normal Low to normal Normal to high Normal Normal Normal n.a. Fat-soluble vitamin Normal Low Normal Normal Low Low Low 4/7 Diagnostic method GC-MS Sterols (p) Sterols (p) Sterols (p) Sterols (p) LC-MS/MS HBA (u) BA (u) BA (u, p) BA (u, p) Treatment Cholesterol plus statins Statins or LT Cholesterol plus statins and bile acids CDCA plus statins Cholic acid UDCA or cholic acid Cholic acid 2 1 mild phenotypes; 2 associated with a phytanic/pristanic acid-restricted diet. BA: Bile acids; CDCA: chenodeoxycholic acid; HBA: Hydroxy bile alcohols; LATHO: lathosterolosis; LT: liver transplant; n.a.: not applicable; (p): plasma; (u): urine; UDCA: ursodeoxycholic acid. GC-MS: gas chromatography coupled to mass spectrometry; LC-MS/MS: liquid chromatography coupled to tandem mass spectrometry. with good results in most of them, therefore this fact should prompt us to pay more attention to the patient history, particularly that of childhood, with symptoms compatible with these defects. Therefore, we hope that this editorial will stimulate the reader s thinking to extend their knowledge and to take into account that today we have many clinical and laboratory tools to suspect and diagnose a rare disease including the defects of cholesterol and bile acids biosynthesis. REFERENCES 1 Maxfield FR, van Meer G. Cholesterol, the central lipid of mammalian cells. Curr Opin Cell Biol 2010; 22: [PMID: DOI: /j.ceb ] 2 Režen T. The impact of cholesterol and its metabolites on drug metabolism. Expert Opin Drug Metab Toxicol 2011; 7: [PMID: DOI: / ] 3 Rezen T, Rozman D, Pascussi JM, Monostory K. Interplay between cholesterol and drug metabolism. Biochim Biophys Acta 2011; 1814: [PMID: DOI: /j.bbapap ] 4 Groen AK, Bloks VW, Verkade H, Kuipers F. Cross-talk between liver and intestine in control of cholesterol and energy homeostasis. Mol Aspects Med 2014; 37: [PMID: DOI: /j.mam ] 5 Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 1990; 343: [PMID: DOI: /343425a0] 6 Sato R. Sterol metabolism and SREBP activation. Arch Biochem Biophys 2010; 501: [PMID: DOI: / j.abb ] 7 Zhao C, Dahlman-Wright K. Liver X receptor in cholesterol metabolism. J Endocrinol 2010; 204: [PMID: DOI: /JOE ] 8 Go GW, Mani A. Low-density lipoprotein receptor (LDLR) family orchestrates cholesterol homeostasis. Yale J Biol Med 2012; 85: [PMID: ] 9 Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993; 34: [PMID: ] 10 Turley SD, Spady DK, Dietschy JM. Role of liver in the synthesis of cholesterol and the clearance of low density lipoproteins in the cynomolgus monkey. J Lipid Res 1995; 36: [PMID: ] 11 Gaylor JL. Membrane-bound enzymes of cholesterol synthesis from lanosterol. Biochem Biophys Res Commun 2002; 292: [PMID: DOI: /bbrc ] 12 Lange BM, Rujan T, Martin W, Croteau R. Isoprenoid biosynthesis: the evolution of two ancient and distinct pathways across genomes. Proc Natl Acad Sci USA 2000; 97: [PMID: DOI: /pnas ] 13 Wang DQ. Regulation of intestinal cholesterol absorption. Annu Rev Physiol 2007; 69: [PMID: DOI: / annurev.physiol ] 14 Dikkers A, Tietge UJ. Biliary cholesterol secretion: more than a simple ABC. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg.v16.i ] 15 van der Wulp MY, Verkade HJ, Groen AK. Regulation of cholesterol homeostasis. Mol Cell Endocrinol 2013; 368: 1-16 [PMID: DOI: /j.mce ] 16 Yoo EG. Sitosterolemia: a review and update of pathophysiology, clinical spectrum, diagnosis, and management. Ann Pediatr Endocrinol Metab 2016; 21: 7-14 [PMID: DOI: /apem ] 17 Sudhop T, Lütjohann D, von Bergmann K. Sterol transporters: targets of natural sterols and new lipid lowering drugs. Pharmacol Ther 2005; 105: [PMID: DOI: /j.pharm thera ] 18 Nemes K, Åberg F, Gylling H, Isoniemi H. Cholesterol metabolism in cholestatic liver disease and liver transplantation: From molecular mechanisms to clinical implications. World J Hepatol 2016; 8: [PMID: DOI: /wjh.v8.i22.924] 19 Degirolamo C, Sabbà C, Moschetta A. Intestinal nuclear receptors in HDL cholesterol metabolism. J Lipid Res 2015; 56: [PMID: DOI: /jlr.R052704] 20 Russell DW. The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 2003; 72: [PMID: DOI: /annurev.biochem ] 21 Kannel WB, Castelli WP, Gordon T. Cholesterol in the prediction 5262 August 7, 2017 Volume 23 Issue 29

21 Corso G et al. Cholesterol and bile acids biosynthesis defects of atherosclerotic disease. New perspectives based on the Framingham study. Ann Intern Med 1979; 90: [PMID: ] 22 Liu J, Sempos CT, Donahue RP, Dorn J, Trevisan M, Grundy SM. Non-high-density lipoprotein and very-low-density lipoprotein cholesterol and their risk predictive values in coronary heart disease. Am J Cardiol 2006; 98: [PMID: DOI: /j.amjcard ] 23 Utermann G, Menzel HJ. Genetic disorders of lipoprotein metabolism. In: Schettler, Habenicht AJR. Principles and treatment of lipoprotein disorders. Berlin: Springer Science Business Media, 2012: Ohashi K, Osuga J, Tozawa R, Kitamine T, Yagyu H, Sekiya M, Tomita S, Okazaki H, Tamura Y, Yahagi N, Iizuka Y, Harada K, Gotoda T, Shimano H, Yamada N, Ishibashi S. Early embryonic lethality caused by targeted disruption of the 3-hydroxy-3- methylglutaryl-coa reductase gene. J Biol Chem 2003; 278: [PMID: DOI: /jbc.M ] 25 Herman GE, Kratz L. Disorders of sterol synthesis: beyond Smith-Lemli-Opitz syndrome. Am J Med Genet C Semin Med Genet 2012; 160C: [PMID: DOI: / ajmg.c.31340] 26 Clayton PT. Disorders of bile acid synthesis. J Inherit Metab Dis 2011; 34: [PMID: DOI: /s ] 27 Corso G, Gelzo M, Barone R, Clericuzio S, Pianese P, Nappi A, Dello Russo A. Sterol profiles in plasma and erythrocyte membranes in patients with Smith-Lemli-Opitz syndrome: a sixyear experience. Clin Chem Lab Med 2011; 49: [PMID: DOI: /CCLM ] 28 DeBarber AE, Eroglu Y, Merkens LS, Pappu AS, Steiner RD. Smith-Lemli-Opitz syndrome. Expert Rev Mol Med 2011; 13: e24 [PMID: DOI: /S X] 29 Kanungo S, Soares N, He M, Steiner RD. Sterol metabolism disorders and neurodevelopment-an update. Dev Disabil Res Rev 2013; 17: [PMID: DOI: /ddrr.1114] 30 Di Taranto MD, Gelzo M, Giacobbe C, Gentile M, Marotta G, Savastano S, Dello Russo A, Fortunato G, Corso G. Cerebrotendinous xanthomatosis, a metabolic disease with different neurological signs: two case reports. Metab Brain Dis 2016; 31: [PMID: DOI: /s y] 31 Corso G, D Apolito O, Gelzo M, Paglia G, Dello Russo A. A powerful couple in the future of clinical biochemistry: in situ analysis of dried blood spots by ambient mass spectrometry. Bioanalysis 2010; 2: [PMID: DOI: / bio ] 32 Paglia G, D Apolito O, Gelzo M, Dello Russo A, Corso G. Direct analysis of sterols from dried plasma/blood spots by an atmospheric pressure thermal desorption chemical ionization mass spectrometry (APTDCI-MS) method for a rapid screening of Smith-Lemli-Opitz syndrome. Analyst 2010; 135: [PMID: DOI: /b919622f] 33 Gelzo M, Clericuzio S, Barone R, D Apolito O, Dello Russo A, Corso G. A routine method for cholesterol and 7-dehydrocholesterol analysis in dried blood spot by GC-FID to diagnose the Smith- Lemli-Opitz syndrome. J Chromatogr B Analyt Technol Biomed Life Sci 2012; 907: [PMID: DOI: / j.jchromb ] 34 Gelzo M, Dello Russo A, Corso G. Stability study of dehydrocholesterols in dried spot of blood from patients with Smith- Lemli-Opitz syndrome, using filter-paper treated with butylated hydroxytoluene. Clin Chim Acta 2012; 413: [PMID: DOI: /j.cca ] 35 Heubi JE, Setchell KD, Bove KE. Inborn errors of bile acid metabolism. Semin Liver Dis 2007; 27: [PMID: DOI: /s ] 36 Tint GS, Irons M, Elias ER, Batta AK, Frieden R, Chen TS, Salen G. Defective cholesterol biosynthesis associated with the Smith- Lemli-Opitz syndrome. N Engl J Med 1994; 330: [PMID: DOI: /NEJM ] 37 FitzPatrick DR, Keeling JW, Evans MJ, Kan AE, Bell JE, Porteous ME, Mills K, Winter RM, Clayton PT. Clinical phenotype of desmosterolosis. Am J Med Genet 1998; 75: [PMID: ] 38 Kelley RI, Wilcox WG, Smith M, Kratz LE, Moser A, Rimoin DS. Abnormal sterol metabolism in patients with Conradi-Hünermann- Happle syndrome and sporadic lethal chondrodysplasia punctata. Am J Med Genet 1999; 83: [PMID: ] 39 Grange DK, Kratz LE, Braverman NE, Kelley RI. CHILD syndrome caused by deficiency of 3beta-hydroxysteroid-delta8, delta7-isomerase. Am J Med Genet 2000; 90: [PMID: ] 40 Brunetti-Pierri N, Corso G, Rossi M, Ferrari P, Balli F, Rivasi F, Annunziata I, Ballabio A, Russo AD, Andria G, Parenti G. Lathosterolosis, a novel multiple-malformation/mental retardation syndrome due to deficiency of 3beta-hydroxysteroid-delta5- desaturase. Am J Hum Genet 2002; 71: [PMID: DOI: /342668] 41 Krakowiak PA, Wassif CA, Kratz L, Cozma D, Kovárová M, Harris G, Grinberg A, Yang Y, Hunter AG, Tsokos M, Kelley RI, Porter FD. Lathosterolosis: an inborn error of human and murine cholesterol synthesis due to lathosterol 5-desaturase deficiency. Hum Mol Genet 2003; 12: [PMID: ] 42 Rossi M, D Armiento M, Parisi I, Ferrari P, Hall CM, Cervasio M, Rivasi F, Balli F, Vecchione R, Corso G, Andria G, Parenti G. Clinical phenotype of lathosterolosis. Am J Med Genet A 2007; 143A: [PMID: DOI: /ajmg.a.31929] 43 Ho AC, Fung CW, Siu TS, Ma OC, Lam CW, Tam S, Wong VC. Lathosterolosis: a disorder of cholesterol biosynthesis resembling smith-lemli-opitz syndrome. JIMD Rep 2014; 12: [PMID: DOI: /8904_2013_255] 44 Kelley RI, Kratz LE, Glaser RL, Netzloff ML, Wolf LM, Jabs EW. Abnormal sterol metabolism in a patient with Antley-Bixler syndrome and ambiguous genitalia. Am J Med Genet 2002; 110: [PMID: DOI: /ajmg.10510] 45 Porter FD, Herman GE. Malformation syndromes caused by disorders of cholesterol synthesis. J Lipid Res 2011; 52: 6-34 [PMID: DOI: /jlr.R009548] 46 Waterham HR, Koster J, Mooyer P, Noort Gv Gv, Kelley RI, Wilcox WR, Wanders RJ, Hennekam RC, Oosterwijk JC. Autosomal recessive HEM/Greenberg skeletal dysplasia is caused by 3 beta-hydroxysterol delta 14-reductase deficiency due to mutations in the lamin B receptor gene. Am J Hum Genet 2003; 72: [PMID: ] 47 du Souich C, Chou A, Yin J, Oh T, Nelson TN, Hurlburt J, Arbour L, Friedlander R, McGillivray BC, Tyshchenko N, Rump A, Poskitt KJ, Demos MK, Van Allen MI, Boerkoel CF. Characterization of a new X-linked mental retardation syndrome with microcephaly, cortical malformation, and thin habitus. Am J Med Genet A 2009; 149A: [PMID: DOI: /ajmg.a.33071] 48 McLarren KW, Severson TM, du Souich C, Stockton DW, Kratz LE, Cunningham D, Hendson G, Morin RD, Wu D, Paul JE, An J, Nelson TN, Chou A, DeBarber AE, Merkens LS, Michaud JL, Waters PJ, Yin J, McGillivray B, Demos M, Rouleau GA, Grzeschik KH, Smith R, Tarpey PS, Shears D, Schwartz CE, Gecz J, Stratton MR, Arbour L, Hurlburt J, Van Allen MI, Herman GE, Zhao Y, Moore R, Kelley RI, Jones SJ, Steiner RD, Raymond FL, Marra MA, Boerkoel CF. Hypomorphic temperature-sensitive alleles of NSDHL cause CK syndrome. Am J Hum Genet 2010; 87: [PMID: DOI: /j.ajhg ] 49 He M, Kratz LE, Michel JJ, Vallejo AN, Ferris L, Kelley RI, Hoover JJ, Jukic D, Gibson KM, Wolfe LA, Ramachandran D, Zwick ME, Vockley J. Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay. J Clin Invest 2011; 121: [PMID: DOI: /JCI42650] 50 He M, Smith LD, Chang R, Li X, Vockley J. The role of sterol- C4-methyl oxidase in epidermal biology. Biochim Biophys Acta 2014; 1841: [PMID: DOI: / j.bbalip ] 51 Arnold AW, Bruckner-Tuderman L, Has C, Happle R. Conradi August 7, 2017 Volume 23 Issue 29

22 Corso G et al. Cholesterol and bile acids biosynthesis defects Hünermann-Happle syndrome in males vs MEND syndrome (male EBP disorder with neurological defects). Br J Dermatol 2012; 166: [PMID: DOI: /j x] 52 Flück CE, Tajima T, Pandey AV, Arlt W, Okuhara K, Verge CF, Jabs EW, Mendonça BB, Fujieda K, Miller WL. Mutant P450 oxidoreductase causes disordered steroidogenesis with and without Antley-Bixler syndrome. Nat Genet 2004; 36: [PMID: DOI: /ng1300] 53 Parnes S, Hunter AG, Jimenez C, Carpenter BF, MacDonald I. Apparent Smith-Lemli-Opitz syndrome in a child with a previously undescribed form of mucolipidosis not involving the neurons. Am J Med Genet 1990; 35: [PMID: DOI: / ajmg ] 54 Rossi M, Vajro P, Iorio R, Battagliese A, Brunetti-Pierri N, Corso G, Di Rocco M, Ferrari P, Rivasi F, Vecchione R, Andria G, Parenti G. Characterization of liver involvement in defects of cholesterol biosynthesis: long-term follow-up and review. Am J Med Genet A 2005; 132A: [PMID: DOI: /ajmg. a.30426] 55 Calvo PL, Brunati A, Spada M, Romagnoli R, Corso G, Parenti G, Rossi M, Baldi M, Carbonaro G, David E, Pucci A, Amoroso A, Salizzoni M. Liver transplantation in defects of cholesterol biosynthesis: the case of lathosterolosis. Am J Transplant 2014; 14: [PMID: DOI: /ajt.12645] 56 Ginanni Corradini S, Siciliano M, Parlati L, Molinaro A, Cantafora A, Poli E, Mennini G, Melandro F, Vestri AR, Merli M, Bianco P, Corsi A, Toniutto P, Bitetto D, Falleti E, Attili AF, Berloco P, Rossi M. Recipient perioperative cholesterolaemia and graft cholesterol metabolism gene expression predict liver transplant outcome. Liver Int 2014; 34: e290-e301 [PMID: DOI: /liv.12351] 57 Schwarz M, Wright AC, Davis DL, Nazer H, Björkhem I, Russell DW. The bile acid synthetic gene 3beta-hydroxy-Delta(5)-C(27)- steroid oxidoreductase is mutated in progressive intrahepatic cholestasis. J Clin Invest 2000; 106: [PMID: DOI: /JCI10902] 58 Cheng JB, Jacquemin E, Gerhardt M, Nazer H, Cresteil D, Heubi JE, Setchell KD, Russell DW. Molecular genetics of 3betahydroxy-Delta5-C27-steroid oxidoreductase deficiency in 16 patients with loss of bile acid synthesis and liver disease. J Clin Endocrinol Metab 2003; 88: [PMID: DOI: /jc ] 59 Setchell KD, Suchy FJ, Welsh MB, Zimmer-Nechemias L, Heubi J, Balistreri WF. Delta 4-3-oxosteroid 5 beta-reductase deficiency described in identical twins with neonatal hepatitis. A new inborn error in bile acid synthesis. J Clin Invest 1988; 82: [PMID: DOI: /JCI113837] 60 Daugherty CC, Setchell KD, Heubi JE, Balistreri WF. Resolution of liver biopsy alterations in three siblings with bile acid treatment of an inborn error of bile acid metabolism (delta 4-3-oxosteroid 5 beta-reductase deficiency). Hepatology 1993; 18: [PMID: ] 61 Shneider BL, Setchell KD, Whitington PF, Neilson KA, Suchy FJ. Delta 4-3-oxosteroid 5 beta-reductase deficiency causing neonatal liver failure and hemochromatosis. J Pediatr 1994; 124: [PMID: ] 62 Siafakas CG, Jonas MM, Perez-Atayde AR. Abnormal bile acid metabolism and neonatal hemochromatosis: a subset with poor prognosis. J Pediatr Gastroenterol Nutr 1997; 25: [PMID: ] 63 Kimura A, Kondo KH, Okuda KI, Higashi S, Suzuki M, Kurosawa T, Tohma M, Inoue T, Nishiyori A, Yoshino M, Kato H, Setoguchi T. Diagnosis of the first Japanese patient with 3-oxo-delta4-steroid 5beta-reductase deficiency by use of immunoblot analysis. Eur J Pediatr 1998; 157: [PMID: ] 64 Clayton PT, Mills KA, Johnson AW, Barabino A, Marazzi MG. Delta 4-3-oxosteroid 5 beta-reductase deficiency: failure of ursodeoxycholic acid treatment and response to chenodeoxycholic acid plus cholic acid. Gut 1996; 38: [PMID: ] 65 Lemonde HA, Custard EJ, Bouquet J, Duran M, Overmars H, Scambler PJ, Clayton PT. Mutations in SRD5B1 (AKR1D1), the gene encoding delta(4)-3-oxosteroid 5beta-reductase, in hepatitis and liver failure in infancy. Gut 2003; 52: [PMID: ] 66 Tsaousidou MK, Ouahchi K, Warner TT, Yang Y, Simpson MA, Laing NG, Wilkinson PA, Madrid RE, Patel H, Hentati F, Patton MA, Hentati A, Lamont PJ, Siddique T, Crosby AH. Sequence alterations within CYP7B1 implicate defective cholesterol homeostasis in motor-neuron degeneration. Am J Hum Genet 2008; 82: [PMID: DOI: /j.ajhg ] 67 Schüle R, Brandt E, Karle KN, Tsaousidou M, Klebe S, Klimpe S, Auer-Grumbach M, Crosby AH, Hübner CA, Schöls L, Deufel T, Beetz C. Analysis of CYP7B1 in non-consanguineous cases of hereditary spastic paraplegia. Neurogenetics 2009; 10: [PMID: DOI: /s ] 68 Biancheri R, Ciccolella M, Rossi A, Tessa A, Cassandrini D, Minetti C, Santorelli FM. White matter lesions in spastic paraplegia with mutations in SPG5/CYP7B1. Neuromuscul Disord 2009; 19: [PMID: DOI: /j.nmd ] 69 Criscuolo C, Filla A, Coppola G, Rinaldi C, Carbone R, Pinto S, Wang Q, de Leva MF, Salvatore E, Banfi S, Brunetti A, Quarantelli M, Geschwind DH, Pappatà S, De Michele G. Two novel CYP7B1 mutations in Italian families with SPG5: a clinical and genetic study. J Neurol 2009; 256: [PMID: DOI: /s ] 70 Carlton VE, Harris BZ, Puffenberger EG, Batta AK, Knisely AS, Robinson DL, Strauss KA, Shneider BL, Lim WA, Salen G, Morton DH, Bull LN. Complex inheritance of familial hypercholanemia with associated mutations in TJP2 and BAAT. Nat Genet 2003; 34: [PMID: DOI: / ng1147] 71 Setchell KD, Heubi JE, Shah S, Lavine JE, Suskind D, Al-Edreesi M, Potter C, Russell DW, O Connell NC, Wolfe B, Jha P, Zhang W, Bove KE, Knisely AS, Hofmann AF, Rosenthal P, Bull LN. Genetic defects in bile acid conjugation cause fat-soluble vitamin deficiency. Gastroenterology 2013; 144: e6; quiz e14-15 [PMID: DOI: /j.gastro ] 72 Ferdinandusse S, Denis S, Clayton PT, Graham A, Rees JE, Allen JT, McLean BN, Brown AY, Vreken P, Waterham HR, Wanders RJ. Mutations in the gene encoding peroxisomal alpha-methylacyl- CoA racemase cause adult-onset sensory motor neuropathy. Nat Genet 2000; 24: [PMID: DOI: /72861] 73 Setchell KD, Heubi JE, Bove KE, O Connell NC, Brewsaugh T, Steinberg SJ, Moser A, Squires RH Jr. Liver disease caused by failure to racemize trihydroxycholestanoic acid: gene mutation and effect of bile acid therapy. Gastroenterology 2003; 124: [PMID: DOI: /gast ] 74 Setchell KD, Schwarz M, O Connell NC, Lund EG, Davis DL, Lathe R, Thompson HR, Weslie Tyson R, Sokol RJ, Russell DW. Identification of a new inborn error in bile acid synthesis: mutation of the oxysterol 7alpha-hydroxylase gene causes severe neonatal liver disease. J Clin Invest 1998; 102: [PMID: DOI: /JCI2962] 75 Ueki I, Kimura A, Nishiyori A, Chen HL, Takei H, Nittono H, Kurosawa T. Neonatal cholestatic liver disease in an Asian patient with a homozygous mutation in the oxysterol 7alpha-hydroxylase gene. J Pediatr Gastroenterol Nutr 2008; 46: [PMID: DOI: /MPG.0b013e31815a9911] 76 Chong CP, Mills PB, McClean P, Gissen P, Bruce C, Stahlschmidt J, Knisely AS, Clayton PT. Bile acid-coa ligase deficiency--a new inborn error of bile acid metabolism. J Inherit Metab Dis 2012; 35: [PMID: DOI: /s ] 77 Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK, Verhagen A, Rivera CR, Mulvihill SJ, Malloy MJ, Kane JP. Human cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest 2002; 110: [PMID: DOI: /JCI15387] 78 Cali JJ, Hsieh CL, Francke U, Russell DW. Mutations in the bile acid biosynthetic enzyme sterol 27-hydroxylase underlie 5264 August 7, 2017 Volume 23 Issue 29

23 Corso G et al. Cholesterol and bile acids biosynthesis defects cerebrotendinous xanthomatosis. J Biol Chem 1991; 266: [PMID: ] 79 Mignarri A, Gallus GN, Dotti MT, Federico A. A suspicion index for early diagnosis and treatment of cerebrotendinous xanthomatosis. J Inherit Metab Dis 2014; 37: [PMID: DOI: /s ] 80 Nie S, Chen G, Cao X, Zhang Y. Cerebrotendinous xanthomatosis: a comprehensive review of pathogenesis, clinical manifestations, diagnosis, and management. Orphanet J Rare Dis 2014; 9: 179 [PMID: DOI: /s ] 81 Björkhem I. Cerebrotendinous xanthomatosis. Curr Opin Lipidol 2013; 24: [PMID: DOI: /MOL.0b0 13e328362df13] 82 Batta AK, Shefer S, Batta M, Salen G. Effect of chenodeoxycholic acid on biliary and urinary bile acids and bile alcohols in cerebrotendinous xanthomatosis; monitoring by high performance liquid chromatography. J Lipid Res 1985; 26: [PMID: ] 83 Salen G, Shefer S, Tint GS, Nicolau G, Dayal B, Batta AK. Biosynthesis of bile acids in cerebrotendinous xanthomatosis. Relationship of bile acid pool sizes and synthesis rates to hydroxylations at C-12, C-25, and C-26. J Clin Invest 1985; 76: [PMID: DOI: /JCI112030] 84 Kuriyama M, Tokimura Y, Fujiyama J, Utatsu Y, Osame M. Treatment of cerebrotendinous xanthomatosis: effects of chenodeoxycholic acid, pravastatin, and combined use. J Neurol Sci 1994; 125: [PMID: ] 85 de Sain-van der Velden MG, Verrips A, Prinsen BH, de Barse M, Berger R, Visser G. Elevated cholesterol precursors other than cholestanol can also be a hallmark for CTX. J Inherit Metab Dis 2008; 31 Suppl 2: S387-S393 [PMID: DOI: / s ] 86 Kuksis A. Plasma non-cholesterol sterols. J Chromatogr A 2001; 935: [PMID: ] 87 Waterham HR. Defects of cholesterol biosynthesis. FEBS Lett 2006; 580: [PMID: DOI: / j.febslet ] 88 Frisso G, Gelzo M, Procopio E, Sica C, Lenza MP, Dello Russo A, Donati MA, Salvatore F, Corso G. A rare case of sterol-c4- methyl oxidase deficiency in a young Italian male: Biochemical and molecular characterization. Mol Genet Metab 2017; 121: [PMID: DOI: /j.ymgme ] P- Reviewer: Schmidt HHJ S- Editor: Gong ZM L- Editor: A E- Editor: Li D 5265 August 7, 2017 Volume 23 Issue 29

24 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Contribution of galectin-1, a glycan-binding protein, to gastrointestinal tumor progression REVIEW María L Bacigalupo, Pablo Carabias, María F Troncoso María L Bacigalupo, Pablo Carabias, María F Troncoso, Facultad de Farmacia y Bioquímica, Instituto de Química y Fisicoquímica Biológicas (IQUIFIB), Consejo Nacional de lnvestigaciones Científicas y Técnicas, Universidad de Buenos Aires, Buenos Aires C1113AAD, Argentina Author contributions: Bacigalupo ML and Carabias P contributed to literature search, manuscript writing; Bacigalupo ML contributed to figure composing and final revision of the article; Troncoso MF contributed to the study idea and design, manuscript writing, figure composing and final revision of the article. Supported by CONICET (PIP-647); and UBA (Programación Científica , No BA) to Troncoso MF. Conflict-of-interest statement: The authors declare no conflict of interest related to this publication. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0 Manuscript source: Invited manuscript Correspondence to: María F Troncoso, PhD, Facultad de Farmacia y Bioquímica, Instituto de Química y Fisicoquímica Biológicas (IQUIFIB), Consejo Nacional de lnvestigaciones Científicas y Técnicas, Universidad de Buenos Aires, Junín 956, Buenos Aires C1113AAD, Argentina. fernanda@qb.ffyb.uba.ar Telephone: Fax: Received: February 10, 2017 Peer-review started: February 14, 2017 First decision: April 21, 2017 Revised: May 4, 2017 Accepted: June 18, 2017 Article in press: June 19, 2017 Published online: August 7, 2017 Abstract Gastrointestinal cancer is a group of tumors that affect multiple sites of the digestive system, including the stomach, liver, colon and pancreas. These cancers are very aggressive and rapidly metastasize, thus identifying effective targets is crucial for treatment. Galectin-1 (Gal-1) belongs to a family of glycan-binding proteins, or lectins, with the ability to cross-link specific glycoconjugates. A variety of biological activities have been attributed to Gal-1 at different steps of tumor progression. Herein, we summarize the current literature regarding the roles of Gal-1 in gastrointestinal malignancies. Accumulating evidence shows that Gal-1 is drastically up-regulated in human gastric cancer, hepatocellular carcinoma, colorectal cancer and pancreatic ductal adenocarcinoma tissues, both in tumor epithelial and tumor-associated stromal cells. Moreover, Gal-1 makes a crucial contribution to the pathogenesis of gastrointestinal malignancies, favoring tumor development, aggressiveness, metastasis, immunosuppression and angiogenesis. We also highlight that alterations in Gal-1-specific glycoepitopes may be relevant for gastrointestinal cancer progression. Despite the findings obtained so far, further functional studies are still required. Elucidating the precise molecular mechanisms modulated by Gal-1 underlying gastrointestinal tumor progression, might lead to the development of novel Gal-1-based diagnostic methods and/or therapies. Key words: Galectin-1; Gastric cancer; Hepatocellular carcinoma; Colorectal carcinoma; Pancreatic cancer; β1,6-n -acetylglucosaminyltransferase V The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved August 7, 2017 Volume 23 Issue 29

25 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies Core tip: Gastrointestinal cancer is a group of tumors that affect multiple sites of the digestive system, including the stomach, liver, colon and pancreas. Galectin-1 (Gal-1) is a β-galactoside-binding protein with the ability to crosslink specific glycoconjugates. Accumulating evidence shows that Gal-1 in human gastric cancer, hepatocellular carcinoma, colorectal cancer and pancreatic ductal adenocarcinoma tissues is up-regulated. Moreover, high levels of this galectin correlate with tumor development, aggressiveness, metastasis, immunosupression and angiogenesis. We also highlight that alterations in Gal-1- specific glycoepitopes may be relevant for gastrointestinal cancer progression. Bacigalupo ML, Carabias P, Troncoso MF. Contribution of galectin-1, a glycan-binding protein, to gastrointestinal tumor progression. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5266.htm DOI: i INTRODUCTION Gastrointestinal cancer is the most common group of malignancies. It refers to tumors developed at multiple sites of the gastrointestinal tract, including stomach, liver, colon and pancreas. During the past decade, advances in molecular medicine have led to improve prevention, diagnosis and therapy. Nevertheless, most of these cancers are very aggressive and rapidly metastasize and therefore, they are among the most deadly [1]. Thus, the identification of new molecular targets is crucial to develop more effective therapeutic strategies. Galectins are proteins that decode and interpret the glycome. This is a family of glycan-binding proteins (lectins) with affinity for β-galactoside-containing N-glycans [2]. This affinity for N-glycans increases in proportion to β1-6 branching, which is mediated by the β1,6-n-acetylglucosaminyltransferase V (GnTV) [3] and extension with poly-n-acetyllactosamine [4]. Interestingly, the altered expression of galectins is considered a hallmark of cancer and mounting evidence illustrates their fundamental roles in tumor biology [5,6]. Besides, important changes in glycosylation occur during tumorigenesis and metastasis, including the increase in N-glycan size in several cancer-associated glycoproteins [7]. One member of this family is galectin-1 (Gal-1), which possesses specific structural features. It is secreted from cells and is able to bind and cross-link glycoconjugates on cell surfaces, including different integrins and glycoproteins of the extracellular matrix (ECM) [8]. Consequently, Gal-1 modulates cell adhesion, migration, survival and signaling [9]. Intracellularly, Gal-1 interacts with the RAS binding domain of RAF effectors and increases H-RAS nanoclustering driving tumor transformation [10]. Gal-1 expression is frequently increased in tumor tissues [11,12]. Elevated levels of Gal-1 secreted to the extracellular space of tumor and tumor-associated stromal cells, often correlate with tumor aggressiveness and acquisition of a metastatic phenotype [13]. This lectin also plays fundamental roles in tumor angiogenesis by modulating endothelial cell biology [14-16] and contributes to tumor immunoevasive programs [17]. Given these tumor-promoting activities, Gal-1 is considered a potential target for cancer therapy [13]. Important roles of some members of the galectin family have been described in gastrointestinal tumors [18-22]. In this review, we summarize the current knowledge regarding the expression and roles of Gal-1 in gastrointestinal malignancies, focusing on gastric cancer, hepatocellular carcinoma, colorectal carcinoma and pancreatic cancer. We also highlight that alterations in Gal-1-specific glycoepitopes may be relevant for gastrointestinal cancer progression. Our aim is to encourage researchers to continue exploring the complex roles of Gal-1 in gastrointestinal tumors. We are confident that basic and translational research in this field will lead to the development of Gal-1- targeted therapies for gastrointestinal cancer patients in the future. ROLES OF GAL-1 IN GASTRIC CANCER Gastric cancer (GC) ranks second for cancer deaths [1]. Most of these cancers are adenocarcinomas, which are subdivided into intestinal or diffuse types. In intestinaltype cancer, tumor cells exhibit intercellular adhesion and are arranged in tubular structures [23]. By contrast, in the diffuse type, tumor cells are poorly cohesive and infiltrate the stroma as small subgroups [23,24]. Although these subtypes are biological, clinical and epidemiologically different, in clinical practice this classification is not useful for predicting treatment response or survival [23]. Besides, according to the anatomical location, adenocarcinomas are classified as proximal and distal. Risk factors for proximal GC include increased body weight, gastro-esophageal reflux disease and Barrett s esophagus, while chronic infection with Helicobacter pylori (H. pylori) is the strongest risk factor for distal GC [25,26]. Besides, gene amplification of human epithelial growth factor receptor 2 (HER2), a proto-oncogene, is found in approximately 17% of GC samples [27]. GC is often diagnosed at advanced stages and therapy includes surgery with adjuvant chemotherapy or chemoradiation. Advances in the understanding of the molecular profiling of GC led to the development of trastuzumab and ramucirumab, humanized monoclonal antibodies anti-her2 and anti-vascular endothelial growth factor receptor 2 (VEGFR-2), respectively [28]. However, the median survival at advanced stage is less than 1 year, pointing out the need to identify new molecular targets and biomarkers [29] August 7, 2017 Volume 23 Issue 29

26 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies Gal-1 in hepatocellular carcinoma Up-regulated, mainly in stroma Correlates with tumor size, TNM stage, invasion, metastasis, recurrence, poor survival Increased levels in serum correlate with poor survival and reduced sorafenib treatment efficacy Gal-1 in colorectal cancer Gal-1 in gastric cancer Up-regulated, mainly in stroma Correlates with TNM stage, invasion, lymph node metastasis, poor survival Gal-1 in pancreatic cancer Up-regulated, mainly in stroma Correlates with tumor size, TNM stage, invasion, lymph node metastasis, poor survival Up-regulated, mainly in stroma Correlates with invasion, lymph node metastasis, poor survival Increased levels in serum correlate with tumor stage, liver and lymph node metastasis Figure 1 Galectin-1 expression in gastrointestinal tumors and correlation with clinicopathological parameters. Galectin-1 is drastically up-regulated in human gastric cancer, hepatocellular carcinoma, colorectal cancer and pancreatic ductal adenocarcinoma tissues, mainly in stroma. High levels of Gal-1 correlate with tumor aggressiveness, the acquisition of a metastatic phenotype and patient poor survival. TNM: Tumor/node/metastasis; Gal-1: Galectin-1. In this section we summarize the available knowledge of Gal-1 expression in GC and its contribution to progression. Gal-1 expression in human GC tissues, correlation with clinicopathological parameters and prognostic significance One of the main features of intestinal-type GC is chronic inflammation, which leads to precancerous lesions. High Gal-1 immunostaining was observed in premalignant chronic gastritis, gastric ulcer and intestinal metaplasia lesions, both in epithelium and stroma, suggesting Gal-1 involvement in gastric carcinogenesis [30,31]. In addition, Gal-1 overexpression in gastric adenocarcinoma tissues vs normal mucosa was reported [30-34]. Gal-1 was highly expressed in tumorassociated stromal cells and weakly expressed in cancer epithelial cells. Interestingly, Gal-1 staining intensity in tumor-associated stroma significantly correlated with tumor location, invasion, differentiation, tumor stage and lymph node metastasis [32,33,35-37]. Moreover, patients with high stromal Gal-1 expression exhibited a lower five-year survival rate respect to patients with low expression [32,33,37]. Although low Gal-1 expression in cancer epithelial cells in intestinal-type GC was observed, this galectin was detected in tumor cells of signet ring cell carcinoma (SRCC), a diffuse type of gastric carcinoma [38]. These differences could be explained by the specific SRCC oncogenesis which differs from that of tubular gastric adenocarcinoma [39]. A crucial step during cancer progression is epithelialmesenchymal transition (EMT), which involves changes in cell-cell and cell-matrix interactions and cell motility, allowing tissue epithelial cancers to invade and metastasize [40]. During EMT, tumor cells change their epithelial cell morphology toward a fibroblastoid phenotype, being this process favored by the downregulation of epithelial cell markers and the up-regulation of mesenchymal markers. In GC, EMT is regulated through activation of glioma-associated oncogene 1 (Gli1), a key member of the Hedgehog (Hh) signaling pathway. The adherens protein E-cadherin is an epithelial marker which expression and localization are frequently deregulated in GC. It was found that Gal-1 expression in GC tissues was positively correlated with Gli-1 and vimentin (a mesenchymal cell marker) expression but negatively associated with E-cadherin expression [36,37]. Furthermore, Gal-1 was positively associated with VEGF, suggesting that both molecules can serve as indicators of poor prognosis for GC patients [32,41]. Cancer-associated fibroblasts (CAFs), one of the major components of tumor stroma, contribute to cancer cell proliferation, invasion and metastasis. A potent inducer of fibroblast transformation into CAFs is transforming growth factor beta 1 (TGF-β1), a cytokine elevated in tumor microenvironments. Interestingly, increased levels of Gal-1 were observed in CAFs isolated from GC patient tissues compared to fibroblasts from adjacent normal mucosa (NFs) [33,34,41]. Also, a positive correlation between Gal-1 and TGF-β1 in GC tissues was described [33]. Moreover, Gal-1 expression in CAFs correlated with β 1 integrin expression in GC tissues [34]. This integrin is a cell adhesion receptor with various functions in cancer biology, such as proliferation, invasion and migration. Staining intensities of both β 1 integrin and Gal-1 were associated with lymph node and distant metastasis and tumor/node/metastasis (TNM) stage of clinicopathological parameters. Strong intensity of double positive samples was associated with poor prognostic and low survival [34]. Therefore, elevated Gal-1 levels in GC tissues, mainly in stromal cells, are associated with tumor progression (Figure 1). Besides, Gal-1 expression may be related to EMT and metastasis. Further studies are required to confirm the usefulness of Gal-1 as a prognostic factor for GC August 7, 2017 Volume 23 Issue 29

27 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies Gal-1 contribution to GC development and angiogenesis in experimental models The administration of N-methyl-N -nitro-n-nitrosoguanidine (MNNG), a carcinogen that destroys stomach mucous barrier, constitutes a rat GC model in which animals develop benign and malignant lesions with an inflammatory cell-enriched stroma [42]. Enteric nervous system regulates immune and inflammatory processes thus, chemical myenteric denervation reduces MNNG-induced GC incidence [43]. Remarkably, Gal-1 was highly expressed in nondenervated-rat stomachs, whereas chemical myenteric denervation downregulated Gal-1 expression [42]. Thus, the decrease in Gal-1 levels had a protective role in this model, associated with a reduced density of inflammatory cells. Further, the role of CAF-derived Gal-1 in tumor growth and angiogenesis was studied using the chick embryo chorioallantoic membrane (CAM) assay [41]. NFs or CAFs obtained from human samples were co-cultured with SGC7901 GC cells and injected into CAMs. Also, Gal-1 was overexpressed or silenced in CAFs. Both tumor volume and number of blood vessels were significantly higher with Gal-1-overexpressing CAFs respect to control CAFs and NFs [41]. These results suggest that Gal-1 participates in the development of experimental GC and that CAF-derived Gal-1 promotes gastric tumor growth and angiogenesis (Figure 2). Molecular mechanisms associated with GC progression induced by Gal-1 Studies in human tissues suggest an association between Gal-1 expression and EMT in GC. Interestingly, the expression of cell adhesion-related genes in H. pylori-infected AGS GC cells was analysed by cdna microarray. It was found that Gal-1 and α 5 integrin genes were up-regulated, whereas E-cadherin gene was downregulated, compared to cells without infection [44]. Furthermore, Gal-1, β -catenin, vimentin, α 6 and β 4 integrin expression was elevated in high metastatic GC cell lines compared with low metastatic cells [36,45]. Besides, Gal-1 overexpression in MKN-74 low invasive cells decreased E-cadherin and increased Gli1 levels, activating Hh pathway and favoring cell invasion [36]. Further, the role of Gal-1 in the interaction between GC and stromal cells was studied. TGF-β1 secreted by MKN7 GC cells up-regulated Gal-1 in NFs in a phosphoinositide 3-kinase (PI3K)/AKT-dependent manner. Interestingly, Gal-1 induced the expression of α-smooth muscle actin (α-sma, a myofibroblast marker) favoring transformation from NFs to CAFs [33]. Besides, CAF-derived Gal-1 inhibited apoptosis and promoted EMT, migration and invasion of several GC cell lines, decreasing E-cadherin expression but enhancing vimentin, Gli1 [37], matrix metallopeptidase (MMP) 9 [33], β 1 integrin [34] and VEGF [41] expression. Moreover, silencing β 1 integrin in GC cells prevented the up-regulation of Gli1 [37] and the invasion-promoting effect of CAF-derived Gal-1 [34]. These results suggest an essential role of β 1 integrin in the Gal-1-induced EMT and metastasis in GC. Moreover, high expression of Gal-1 in gastric CAFs increased human umbilical vein endothelial cell proliferation, migration, tube formation and VEGFR-2 phosphorylation [41]. The immunosuppressive transcription factor FoxP3 was found to be expressed not only in regulatory T cells (Tregs) but also in SRCC tissues. Remarkably, Gal-1 expression was downregulated when FoxP3 was silenced in SRCCderived OCUM-2M cells [38]. These findings suggest that FoxP3 expressed both in Tregs and SRCC tumor tissues may be important for Gal-1 tumor expression, which may subsequently induce immunosuppression. As Gal-1 is a glycan-binding protein, alterations in the glycosylation pattern of its ligands within tumor microenvironment may affect galectin functions. For example, GnTV deficiency prevented Gal-1 binding to endothelial cells and decreased tumor growth by attenuating aberrant vascularization [46]. Particularly in GC, diverse alterations in cell glycosylation pattern modulate tumor cell behavior. GnTV overexpression in GC contributes to cell invasion and metastasis [47-49]. Interestingly, GnTV up-regulation in MKN45 GC cells induced cell migration mediated by α3β1 integrin glycosylation [50] and EMT involving E-cadherin glycosylation [51]. Thus, not only an alteration in Gal-1 protein levels but also the aberrant glycosylation pattern of its ligands, such as integrins, may contribute to GC progression. Thus, Gal-1 has a relevant role in the crosstalk between GC and stromal cells, favoring tumor cell proliferation, EMT and dissemination and angiogenesis (Figure 2). Altogether, these findings point that Gal-1 regulates key steps during GC progression. ROLES OF GAL-1 IN HEPATOCELLULAR CARCINOMA Hepatocellular carcinoma (HCC), the most common type of liver cancer, is the third cause of cancer-related deaths. Risk factors include chronic hepatitis B or C virus infection, alcohol abuse and non-alcoholic fatty liver disease [52]. HCC usually develops in the background of chronic liver inflammation, advanced fibrosis and cirrhosis [53]. Thus, it arises not only as a consequence of the molecular changes that occur in transformed hepatocytes, but also due to the crosstalk between diverse cells and molecules within tumor microenvironment [54]. During the past decade new advances led to an earlier detection of HCC [55]. Additionally, current therapies such as, resection, transplantation and chemoembolization, benefit patients diagnosed at early HCC stages improving and extending their survival [56,57]. However, most patients are diagnosed at advanced stages and therefore, they are not amenable to surgery. Even after resection or transplantation, the prognosis remains unsatisfactory 5269 August 7, 2017 Volume 23 Issue 29

28 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies Gastric cancer Gastric cells Hepatocellular carcinoma Hepatocytes Space of disse GnTV GnTV Tumor growth Fibroblast TGF-β1 Apoptosis HSC Proliferation Migration Activated HSC Adhesion to ECM EMT Migration Cancer-associated fibroblasts Angiogenesis Migration Invasion T regs Immune evasion T-cell apoptosis Angiogenesis GnTV Adhesion to endothelium Blood vessel Liver sinusoid Colorectal cancer Pancreatic ductal adenocarcinoma Colon cells Pancreatic cells Tumor growth GnTV Adhesion to ECM GnTV Tumor growth PSC Migration Blood vessel Metastasis GnTV? Migration Gal-1 Proliferation Migration Invasion Activated PSC Collagen Fibrosis Neutrophil Immune evasion T-cell apoptosis Angiogenesis Blood vessel Figure 2 Proposed models of Galectin-1 contribution to the progression of gastric cancer, hepatocellular carcinoma, colorectal cancer and pancreatic ductal adenocarcinoma. Galectin-1 (Gal-1) has key functions in tumor and tumor-associated stromal cells, favoring tumor cell proliferation and dissemination, angiogenesis and immunosuppression. A high exposure of Gal-1 glycan partners also contribute to tumor progression. ECM: Extracellular matrix; EMT: Epithelialmesenchymal transition; GnTV: β1,6-n-acetylglucosaminyltransferase V; HSC: Hepatic stellate cell; PSC: Pancreatic stellate cell; TGF-β1: Transforming growth factor beta 1. due to recurrence, metastasis and the development of new primary tumors [58,59]. Recent progress toward a better understanding of HCC has shed light on new molecular targeted and systemic therapies. Sorafenib, a multikinase inhibitor targeting VEGF, platelet-derived growth factor and RAF signaling pathways, prolongs survival in patients with advanced unresectable HCC [60,61]. Despite the modest increase in survival [60], undoubtedly the approval of oral administration of sorafenib highlights the importance of elucidating the molecular mechanisms underlying HCC progression for the development of novel therapies. Here we review the accumulating evidence that points towards a remarkable role of Gal-1 in HCC progression, aggressiveness and metastasis. Gal-1 expression in human HCC tissues, correlation with clinicopathological parameters and prognostic value While in human normal or adjacent non-tumor liver tissues Gal-1 is expressed at low levels, in HCC its expression is dramatically up-regulated [62-66]. The transcription start site of Gal-1 gene promoter was 5270 August 7, 2017 Volume 23 Issue 29

29 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies frequently methylated in non-tumor liver, whereas it was hypomethylated in HCC tissues [63]. Besides, Gal-1 was significantly increased in HCC samples from patients with metastasis compared to those harboring a non-metastatic primary tumor and it was found accumulated in the stroma surrounding tumor hepatocytes [64]. Accordingly, Gal-1 was highly expressed in stromal α-sma-positive cells in HCC, indicating that Gal-1 is overexpressed in hepatic stellate cells (HSCs) [66]. The prognostic value of Gal-1 in HCC patients was recently evaluated. Elevated Gal-1 expression in HCC was significantly associated with tumor aggressiveness (vascular invasion, incomplete encapsulation, poor differentiation and large tumor size), dissemination and enhanced risk of post-operative recurrence [65]. Additionally, high stromal Gal-1 expression in HCC was correlated with tumor size, TNM stage and distant metastasis and negatively correlated with patient prognosis [66]. Moreover, in HCC samples, an inverse correlation between mir-22 and Gal-1 expression was found [66]. mir-22 is downregulated in HCC [67] and Gal-1 has been predicted to be a target of mir-22. Furthermore, a positive correlation was observed between Gal-1 expression and tumor-infiltrating FoxP3 + Tregs in HCC tissues [65]. Since Gal-1 is a key regulator of CD4 + CD25 + Tregs, which in turn play an essential role in suppression of anticancer immunity [68], the interaction between Gal-1 and Tregs might play a role in immunosuppression against HCC. Recently, it was shown that patients with advanced HCC had significantly higher serum Gal-1 levels than healthy volunteers [69]. These elevated serum levels correlated with poor treatment efficacy of sorafenib and were an independent factor associated with poor progress-free survival and overall survival [69]. These findings demonstrate that Gal-1 overexpression in HCC tissues correlate with tumor aggressiveness and support the potential use of Gal-1 as a novel predictive and prognostic biomarker of HCC (Figure 1). Gal-1 contribution to tumorigenesis, metastasis and chemoresistance in HCC experimental models Gal-1 role in HCC tumor growth and metastasis in vivo was evidenced. We found an increase in tumor volume and in the number of draining-tumor lymph nodes in athymic mice injected with Gal-1-overexpressing human HepG2 HCC cells, respect to control mice [70]. Recently, Gal-1 involvement in HCC chemoresistance was also demonstrated. Cisplatin anti-tumor activity was enhanced with the administration of the galectin inhibitor thiodigalactoside in a mouse hepatoma model [71]. Interestingly, a dual role of Gal-1 in liver inflammation and tumorigenesis has been dissected in multidrug resistant knock-out mice [72]. This is an experimental model of inflammation-induced chronic cholestatic hepatitis at an early age and HCC at a later age, which together mimic the evolution of human disease [73]. Gal-1 showed a strain-dependent protective antiinflammatory function at early stages delaying HCC development. Remarkably, Gal-1 deficiency in knockout mice resulted in a significant retardation of liver regeneration, evidenced by a delay in hepatocyte proliferation, liver mass restoration and macrophage recruitment and a decrease in transient liver postpartial hepatectomy steatosis [74]. These findings revealed that Gal-1 controls hepatocarcinogenesis. It may act as a protective antiinflammatory agent at early stages of the chronic liver pathology, but as a pro-tumorigenic agent at late stages, contributing to HCC growth and metastasis (Figure 2). Functional studies associated with HCC progression, dissemination and chemoresistance induced by Gal-1 Gal-1 overexpression observed in HCC human tissues was confirmed in cell lines [63,64]. In fact, Gal-1 mrna levels were higher in more invasive and undifferentiated human HCC cell lines as compared to welldifferentiated HCC cells and normal liver cells. Interestingly, a methylation-sensitive factor was essential for Gal-1 gene activation in HCC cells [63]. Furthermore, the correlation between increased expression of Gal-1 in HCC and the presence of metastasis was validated by in vitro functional studies. Notably, Gal-1 overexpression increased human HuH-7 HCC cell migration and invasion through Sky receptor tyrosine kinase phosphorylation [64]. Next, our studies provided evidence of Gal-1 as a glycan-dependent modulator of HepG2 cell adhesion and polarization [70]. The pro-adhesive effect of Gal-1 was mediated by α1, α2, α3, αv and β 1 integrins and PI3K and/or extracellular signal-regulated kinase (ERK) 1/2 signaling pathways [70]. Recently, we also demonstrated that increased levels of Gal-1 induced EMT in HCC cells, involving PI3K/AKT and WNT/β-catenin proliferative signaling pathways [75]. Gal-1 up-regulation in HepG2 cells induced E-cadherin downregulation and increased levels of the transcription factor Snail, one of the main inducers of EMT in HCC. Moreover, enhanced Gal-1 expression favored the transition from an epithelial cell morphology toward a fibroblastoid phenotype, vimentin up-regulation and resistance to anoikis (programmed cell death induced upon cell detachment from extracellular matrix) [75]. The glycosylation pattern of HCC cells also changes during EMT. Particularly, an increase of GnTV-mediated β1-6 N-glycan branching and a decrease of α2,6 sialylation (structure capable of precluding Gal-1 binding) were observed in HuH-7 cells undergoing EMT [76]. Interestingly, GnTV was increased in high metastatic HCC cells as compared to low metastatic cells [77], in the liver of a murine model of hepatocarcinogenesis as well as in regenerative liver [78]. Further, tetra-antennary glycans and GnTV expression were increased in HCC samples and positively correlated with TNM stage and 5271 August 7, 2017 Volume 23 Issue 29

30 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies impaired clinical outcome in patients [79,80]. Thus, these findings suggest that Gal-1-specific glycan epitopes are more exposed during HCC cell dissemination. Regarding HCC cell growth and/or proliferation, extracellular Gal-1 (recombinant protein) attenuated cell cycle progression and induced apoptosis of HepG2 cells via interaction with α 5β 1 integrin [81,82]. Remarkably, during the early stages of HCC, TGF-β1 acts as a tumor suppressor; however in advanced stages, HCC cells lose their cytostatic response to this cytokine and undergo EMT. Recently, we demonstrated that TGF-β1 induced Gal-1 expression and secretion by HepG2 and HuH-7 cells. At the same time, intracellular Gal-1 modulated HepG2 cell proliferation and sensitivity to TGF-β1-induced growth inhibition [83]. Therefore, Gal-1 and TGF-β1 might function coordinately within the HCC microenvironment to regulate tumor growth, invasion and metastasis. Concerning the interaction between tumor hepatocytes and stromal cells, we demonstrated that Gal-1 secreted from HCC cells promoted human SK-HEP-1 liver sinusoidal endothelial cell (LSEC) proliferation and migration and glycan-dependent HCC cell adhesion to LSECs [83]. Also, Gal-1 was augmented in activated compared to quiescent rat and human HSCs [66,84] and stimulated HSC proliferation and migration through carbohydrate-dependent mechanisms via ERK1/2 signaling pathway [85]. Recently, it was shown that HSCderived Gal-1 promoted CD3 + T-cell apoptosis and Th1/Th2 cytokine balance skewing [66]. Remarkably, mir-22 inhibited Gal-1 expression in HSCs and its immunosuppressive function. Furthermore, HSCs isolated from HCC tissues exhibited higher Gal-1 expression and more powerful immunosuppression than HSCs derived from normal liver samples [66]. As for the role in HCC chemoresistance, Gal-1 expression and secretion increased in sorafenib-resistant HuH-7 cells (HuH-7-R) through the AKT/mammalian target of rapamycin (mtor)/hypoxia inducible factor (HIF)-1α pathway. Interestingly, Gal-1 downregulation suppressed migratory and invasive abilities of HuH-7-R cells and restored sorafenib sensitivity [69]. Besides, Gal-1 induced chemoresistance to cisplatin in HepG2 and HuH-7 cells in a glycan-dependent manner, inhibiting AKT/mTOR signaling and triggering autophagy [71]. Thus, high levels of Gal-1 in tumor microenvironment induce HCC cell proliferation, EMT and dissemination, angiogenesis, immunosuppression and chemoresistance (Figure 2). Collectively, these findings reveal key roles of Gal-1 in HCC progression. Furthermore, Gal-1 represents a promising target to confront HCC chemoresistance. ROLES OF GAL-1 IN COLORECTAL CANCER Colorectal cancer (CRC) is the fourth cause of cancerrelated deaths [1]. Nowadays, various techniques are available to detect CRC as precursor lesions [86]. Patients early diagnosed have a 5-year survival rate of 90%-95% following surgical resection. However, metastasis are present in approximately 20% of patients at initial diagnosis [87] and half patients will develop metastatic disease [88,89]. When diagnosed at advanced stages, treatment consists of a combination of surgery, chemotherapy and radiotherapy and the 5-year survival rate is only 5%-10% [90]. The greatest risk factor for CRC is increasing age [89]. Sporadic CRC, due to somatic mutations, account for about 70% of all cases. Familial CRC, a group of diseases harboring familial predisposition to develop CRC, is about 10%-30%, whereas hereditary diseases are 5%-7% [91]. CRC develops through a gradual accumulation of genetic and epigenetic changes, leading to the transformation of normal colonic mucosa into invasive cancer [86,89]. Some typical activating gene mutations arise on members of WNT signaling pathway and KRAS oncogene and inactivating mutations occur on the TP53 tumor suppressor gene [92]. Despite the recent achievements in the understanding of colorectal carcinogenesis, the incidence and mortality rates highlight the need for new diagnostic markers of early disease, an improved understanding of tumor progression and the identification of new genes and/or pathways contributing to malignancy. In this section we analyze the current knowledge on the roles of Gal-1 in CRC progression and its potential use as therapeutic target. Gal-1 expression in human CRC tissues, correlation with clinical features and potential use as biomarker Positive Gal-1 expression was detected in CRC tissues many years ago, by immunohistochemistry and Western blot [93,94]. Gal-1 levels were low in normal and neoplastic epithelial cells, but the stroma showed a progressive Gal-1 overexpression from normal mucosa to adenomas and carcinomas [95]. Gal-1 increase in CRC tissues was further confirmed by several studies, but discrepancies on Gal-1 localization were found [96-101]. Some studies reported marked Gal-1 expression both in epithelial and stromal compartments, while others emphasized Gal-1 strong expression mainly in stroma. In addition, Gal-1 staining was faint in endothelial cells of normal tissues but strong in CRC-associated endothelium, especially in proliferating endothelial cells [15]. Concerning the correlation with patient clinical features, contradictory results were obtained. Epithelial Gal-1 levels in early stage samples were associated with short survival [97]. Furthermore, Gal-1 expression was related to tumor invasion and lymph node involvement, but not to tumor differentiation [98]. However, no correlation was found between stromal Gal-1 expression and tumor size, stage, differentiation, nor with patient survival or relapse-free probability [95]. Hence, increasing the number of cases analysed is crucial to reach a more reliable conclusion. Gal-1 expression was also higher in biopsies from radiotherapy August 7, 2017 Volume 23 Issue 29

31 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies responder patients with rectal cancer than in those from nonresponders [102]. Thus, Gal-1 gene expression profiling was suggested to be useful in predicting the response to radiotherapy. Some studies focused on the evaluation of circulating Gal-1 levels as possible biomarkers or prognosis predictors. An increase of plasma Gal-1 levels in CRC patients respect to healthy controls was detected. These levels were already increased in CRC early stages and importantly, were found decreased after patient surgery [101]. Also, high serum Gal-1 positively correlated with tumor stage and lymph node metastasis [19,103]. The expression of accessible binding sites specific for Gal-1 (determined by biotinylated Gal-1) increased with dysplastic and malignant progression [96]. Moreover, the increase in β1,6-branched structures in CRC human samples was associated with lymph node metastasis and decreased survival rates in CRC patients [104]. Accordingly, GnTV overexpressed in CRC tissues correlated with metastasis [105]. Remarkably, the up-regulation of a novel glycosiltransferase, β3gnt8, which can extend polylactosamine on N-glycans, was also described in CRC tissues [106]. Thus, overexpression of Gal-1 and a high exposure of its glycan partners in CRC tissues correlate with tumor progression. Further studies are required to confirm its potential use as a biomarker for CRC (Figure 1). Molecular mechanisms associated with CRC cell adhesion, migration and growth/proliferation modulated by Gal-1 Gal-1 expression was analysed in many cell lines. Gal-1 mrna was detected in normal colon and CRC cells, whereas Western blot analysis showed variable Gal-1 expression [96, ]. Further, when global protein expression was analysed in human poor and high metastatic CRC cell lines, Gal-1 was identified as a protein differentially expressed [110]. Mechanisms accounting for gene regulation were also studied. Gal-1 expression was induced by sodium butyrate, a differentiation-inducing agent and by the hypoxia-related transcription factor HIF-1α in CRC cells [98,108,111,112]. Interestingly, epigenetic regulation of Gal-1 expression was also observed. It was revealed that promoter methylation contributes to silencing Gal-1 gene transcription in CRC cells [108]. The role of Gal-1 and its cell surface glycan partners in CRC cell adhesion was evaluated. The inhibitor of N-acetyllactosamine synthesis, 2-Acetamido-l,3,6- tri-o-acetyl-4-deoxy-4-fluoro-a-d-glycopyranose, impaired HT-29 cell adhesion to Gal-1. This decreased attachment correlated with reduced levels of cell surface lysosome-associated membrane proteins (LAMP) [113]. Moreover, LAMP-1, LAMP-2 and carcinoembryonic antigen were identified as the major Gal- 1-binding glycoproteins in CRC cells [112]. Gal-1 was capable as well of inducing Colo201 CRC cell adhesion to ECM glycoproteins [114]. Moreover, Gal-1 pro-adhesive effect was glycan-dependent with the involvement of PI3K and mitogen-activated protein kinase signaling pathways [114]. Of note, GnTV overexpression in CRC cell lines induced resistance to anoikis and WNT signaling activation [115]. Other Gal-1 roles in CRC cells seem to depend on whether the lectin is localized intra- or extracellularly and the cell line analysed. A Gal-1-enriched ECM decreased HCT-15, LoVo and CoLo201 cell motility [96], thus extracellular Gal-1 reduces CRC cell migration. Instead, contradictory effects were observed modifying intracellular Gal-1 expression. Silencing Gal-1 inhibited SW620 cell invasion and migration induced by hypoxia [98]. In contrast, Gal-1 up-regulation in LS-180 cells significantly decreased cell migration and invasion [108]. Regarding cell viability, Gal-1 overexpression induced Colo201 and LS-180 cell apoptosis [108,114], but extracellular Gal-1 had no effect on HCT-15, LoVo, DLD-1, HT-29, Caco-2 and Colo201 cell growth [81,96,114]. Interestingly, α 5 integrin ectopic expression sensitized HT-29 and Caco-2 cells to exogenous Gal-1-induced growth inhibition, indicating that Gal-1-α 5 integrin interaction attenuated cell cycle progression [81]. Further, Gal-1 overexpression induced LS-180 cell cycle arrest and apoptosis with concomitant downregulation of WNT and nuclear factor kappa B (NF-κB) signaling pathways [108]. Conversely, Gal-1 interaction with protocadherin-24 (a non-classical cadherin downregulated in CRC cells) enhanced Gal-1 retention in HCT116 CRC cell membranes. This interaction abolished Gal-1-mediated PI3K activation and decreased nuclear β-catenin in cells [116], suggesting that protocadherin-24 loss and Gal-1 up-regulation may lead to proliferative WNT signaling activation in these cells. These findings show the relevance of Gal-1-glycan interaction in CRC cell adhesion and the complexity of Gal-1 function in CRC cell migration and growth (Figure 2). Therefore, further studies are required to decipher the mechanisms by which proliferative signaling pathways are regulated in CRC cells expressing endogenous Gal-1. In vivo studies of Gal-1 role in CRC Nonsteroidal anti-inflammatory drugs such as indomethacin (IN) exert anti-crc activity via a cyclooxygenase-independent mechanism. Oral administration of IN significantly suppressed CRC growth of HCT116 xenografts in BALB/c-nude mice [117]. Of note, by using proteomic tools, it was demonstrated that IN downregulated Gal-1 expression in CRC, suggesting that IN-anti-proliferative activity against this tumor might be related to Gal-1 [118]. However, the role of Gal-1 in CRC tumor growth still remains uncertain. Alternatively, GnTV involvement in colon tumorigenesis was already investigated. Interestingly, 5273 August 7, 2017 Volume 23 Issue 29

32 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies GnTV levels in CRC cells injected into nude mice were positively associated with tumor growth. Moreover, using a CRC murine model (Apc min/- ) with different GnTV backgrounds, it was shown that GnTV knockout resulted in reduced tumor size, increased animal survival and a decrease in colon cancer stem cell population. Furthermore, GnTV regulated WNT/β-catenin signaling pathway [115]. Strikingly, although much research focused on Gal-1 expression and function in human CRC tissues and cell lines, no confirmation of Gal-1 roles on CRC progression was obtained through experimental models. Even though extensive studies are required to evaluate Gal-1 function in vivo, we can speculate that Gal-1 and GnTV may act coordinately to influence CRC progression. ROLES OF GAL-1 IN PANCREATIC CANCER Pancreatic cancer (PC) is a highly lethal disease, for which incidence matches mortality. Pancreatic ductal adenocarcinoma (PDAC), the most common type of PC, is one of the most aggressive tumors. The overall 5-year survival rate for this malignancy remains the lowest of any cancer (7%), due to limited diagnostic methods, disease aggressiveness and lack of targeted therapeutic interventions [119]. Major risk factor for PC is chronic pancreatitis. Tumors often develop from microscopic non-invasive epithelial proliferations within the pancreatic ducts, referred to as pancreatic intraepithelial neoplasias (PanINs) [120]. Mutations in KRAS, CDKN2A and TP53 oncogenes and in tumor suppressor gene SMAD4 usually drive to PDAC [121]. Emerging data have highlighted the important contribution of tumor stroma in PC maintenance, progression and also, in chemotherapy resistance [122]. Treatment options have improved throughout the last decades. However, surgery remains the primary therapy and candidates to this intervention represent a very low percentage [121]. Furthermore, efficacy of conventional chemoradiotherapy for PDAC patients is limited [123]. Hence, a better understanding of the mechanisms underlying PC development and progression is needed. In this section we provide an overview of the relevant contribution of Gal-1 to PC progression. Gal-1 expression in human PC tissues, correlation with clinicopathological parameters and prognostic significance Proteomic approaches were applied to identify proteins differentially expressed in normal and pathological human pancreas. While Gal-1 was undetectable in normal pancreas, its expression was up-regulated in PC [ ]. These results, validated by Western blot and immunohistochemistry, showed that Gal-1 protein expression and staining intensity increased gradually from normal pancreas to chronic pancreatitis, PanIN lessions and PDAC [125, ]. Moreover, Gal-1 expression was significantly higher in poorly differentiated PDAC tumors compared to well/moderately differentiated ones [133,134]. Gal-1 expression was essentially restricted to the peritumoral stroma, with low expression within the neoplastic epithelium [125,126, ]. Concomitantly, stromal Gal-1 expression correlated with pancreatic fibrosis, a process that can develop cancer [135]. Within tumor stroma, Gal-1 was detected in α-sma positive regions (activated pancreatic stellate cells, PSCs). Gal-1-expressing PSCs were scattered in chronic pancreatitis tissues, but they formed a tight fibrotic barrier surrounding the tumor in PC samples. Interestingly, CD3 + T cells were found to surround malignant cells in PDAC tissues with few infiltrating T cells in the tumor parenchyma. These results suggested that Gal-1-expressing PSCs can prevent CD3 + T cells from infiltrating the pancreatic tumor [132]. Notably, stromal Gal-1 expression in PC tissues was associated with an increase in tumor size, lymph node metastasis, perineural invasion and differentiation and served as an indicator of poor survival [130,134]. Accordingly, after quantitative proteomic profiling analysis of PDAC tissues, Gal-1 was suggested as a negative predictor of PC survival [131]. Thus, high levels of Gal-1, mainly in stroma, play fundamental roles early in PC tumorigenesis and progression (Figure 1). Gal-1 involvement in PC progression in experimental models Transgenic mice overexpressing the oncogene Myc under the control of elastase promoter (Ela-myc) constitute a well-characterized model of PC [136,137]. In tumors from Ela-myc mice, strong Gal-1 expression was detected in both epithelial and stromal cells [138,139]. Interestingly, Gal-1 depletion in these mice resulted in tumor microenvironment remodeling, rendering a decrease in tumor proliferation, angiogenesis and fibroblasts activation and an increase in T-cell and neutrophil infiltration and animal survival. Furthermore, levels of transcription factor Gli and Hh receptor Patched were reduced in Gal-1-depleted mice [138]. Hh- Gli pathway is involved in the initiation and progression of PDAC. Thus, these findings evidence a critical role of Gal-1 in PC development and progression through the Hh-Gli pathway. Moreover, xenografts of wild-type or Gal-1-depleted PC cells injected in nude mice showed no differences in tumor progression [138]. Accordingly, implanted PC cells produced small tumors, which progressed slowly; whereas addition of PSCs to the implanted cancer cells resulted in large tumors with quick progression [130]. Also, cancer cells implanted with PC-associated PSCs exhibiting high levels of Gal-1 developed larger tumors, than those that were implanted with PSCs from normal pancreas [130]. These results point out the 5274 August 7, 2017 Volume 23 Issue 29

33 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies crucial contribution of tumor microenvironment in Gal-1- induced effects in pancreatic carcinogenesis. The field of nano-oncology offers the possibility to use glycan-based galectin inhibitors or glycan ligandbased functionalized nanoparticles for diagnostic, prognosis and therapeutic purposes [7]. In this regard, taking advantage of Gal-1 up-regulation in PC, the delivery of magnetic nanoparticles using Gal-1 as a target receptor to PC tissues was described [140]. As targeting moieties, glycosylated peptides derived from tissue plasminogen activator (tpa) were covalently attached onto the nanoparticle surfaces [140]. tpa is a multifunctional protein overexpressed in PDAC and was described as a ligand of Gal-1 in pancreatic tissues [139,141]. Through magnetic resonance imaging of mouse PANC-1 xenografts, an increased uptake of targeted nanoparticles vs non-targeted nanoparticles was shown [140]. This result suggests that Gal-1 may serve as a strong candidate for PC therapy and opens up a window of theranostics (integrated diagnostic imaging and therapy) for this disease. Functional studies associated with PC progression induced by Gal-1 Gal-1 expression was detected in several PC cell lines. During CFPAC-1 cell migration, Gal-1 localized at cell membranes, at the migration front [139]. There, it colocalized with its ligand tpa [139,141]. Gal-1 downregulation in CFPAC-1 cells markedly decreased tpa-induced ERK1/2 activation, cell proliferation, migration and invasion [139]. These findings support a new molecular mechanism by which Gal-1 interaction with tpa contributes to PDAC progression. In this interaction, tpa glycosylation was required. Interestingly, the modulation of glycosylation via galectin binding, with functional implications, was reported [ ]. The tumor suppressor p16ink4a induced Gal-1 up-regulation and increased expression of α 5β 51 integrin at cell surfaces. Besides, p16ink4a changed cell glycosylation pattern, reducing glycoprotein α2,6 sialylation. As a consequence, the susceptibility to carbohydratedependent induction of anoikis was increased through Gal-1-α 5β 51 integrin interaction [ ]. Moreover, the downregulation of MUC16, a heavily glycosylated type-i transmembrane mucin overexpressed in PDAC decreased PC cell adhesion to Gal-1 [145]. Global analysis of differentially expressed genes in control and Gal-1-silenced PANC-1 cells revealed that Gal-1 levels correlate with genes involved in cell migration, adhesion and malignant transformation and with genes of the Hh-Gli axis [138]. Gal-1 downregulation reduced PANC-1 cell migration, motility and resistance to anoikis and increased the expression of fibronectin-1, integrin-α 5, thrombospondin-1 and E-cadherin [138]. Moreover, Gal-1 silencing decreased the expression of upstream and downstream effectors of Hh-Gli axis both in PC cells and PSCs. On the contrary, Gal-1 overexpression in PDAC cells led to increased Gli transcriptional activity [138]. Interestingly, several studies demonstrated that activated PSCs express and secrete high levels of Gal-1. The expression of this galectin was higher in PSCs isolated from PDAC samples (CaPSCs) than those isolated from normal pancreatic tissues (NPSCs) [130,132,134, ]. Remarkably, Gal-1 knock-down in human PSCs reduced cell migration and invasion. Besides, exogenous Gal-1 was capable of inducing proliferation, collagen synthesis and chemokine production in rat PSCs, involving MEK1/2-ERK1/2 and c-jun N-terminal kinase signaling pathways and transcription factors NF-κB and activator protein-1 activation [148,149]. Further, Gal-1 expression in PSCs was induced by conditioned media from CFPAC-1 PC cells [146]. Besides, CFPAC-1 cells co-cultured with PSCs showed an increase in MMP-2 and MMP-9 expression and a stronger ability to proliferate and invade than their counterparts alone. These effects were more pronounced in cancer cells co-cultured with CaPSCs than those ones with NPSCs and were partially blocked in the presence of lactose, a galectin inhibitor [130,146]. Furthermore, PSC-derived Gal-1 involvement in tumor immunosuppression was reported. Gal-1-overexpression in activated PSCs decreased CD3 + T cell viability and skewed the cytokine secretion balance towards a Th2 immune response [132,134]. Altogether, the results discussed herein reveal that a coordinated regulation of Gal-1/Gal-1 counterreceptor expression and glycosylation may lead to PC progression. Besides, Gal-1 might mediate the crosstalk between PC and the surrounding stroma by modulating Hh-Gli signaling pathway, favoring EMT, migration and immunosuppression (Figure 2). CONCLUSION The evidence we summarized here reveals the crucial contribution of Gal-1 to the pathogenesis of gastrointestinal malignancies. Remarkably, increased levels of Gal-1 in gastrointestinal tumor microenvironment favor progression, aggressiveness and metastasis. We also highlighted that alterations in Gal-1-specific glycoepitopes may be relevant for gastrointestinal cancer development. Undoubtedly, further functional studies are required. Yet, we are hopeful that researchers will get inspired by the findings obtained so far and will join efforts to elucidate the fascinating roles of Gal-1 and its glycan-partners, in these diseases. Thus, Gal-1-targeted therapies could be implemented in future interventions in gastrointestinal tumors. ACKNOWLEDGMENTS We apologize to the many authors whose papers could not be cited owing to space limitations. REFERENCES 1 Global Burden of Disease Cancer Collaboration, Fitzmaurice C, 5275 August 7, 2017 Volume 23 Issue 29

34 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies Dicker D, Pain A, Hamavid H, Moradi-Lakeh M, MacIntyre MF, Allen C, Hansen G, Woodbrook R, Wolfe C, Hamadeh RR, Moore A, Werdecker A, Gessner BD, Te Ao B, McMahon B, Karimkhani C, Yu C, Cooke GS, Schwebel DC, Carpenter DO, Pereira DM, Nash D, Kazi DS, De Leo D, Plass D, Ukwaja KN, Thurston GD, Yun Jin K, Simard EP, Mills E, Park EK, Catalá-López F, deveber G, Gotay C, Khan G, Hosgood HD 3rd, Santos IS, Leasher JL, Singh J, Leigh J, Jonas JB, Sanabria J, Beardsley J, Jacobsen KH, Takahashi K, Franklin RC, Ronfani L, Montico M, Naldi L, Tonelli M, Geleijnse J, Petzold M, Shrime MG, Younis M, Yonemoto N, Breitborde N, Yip P, Pourmalek F, Lotufo PA, Esteghamati A, Hankey GJ, Ali R, Lunevicius R, Malekzadeh R, Dellavalle R, Weintraub R, Lucas R, Hay R, Rojas-Rueda D, Westerman R, Sepanlou SG, Nolte S, Patten S, Weichenthal S, Abera SF, Fereshtehnejad SM, Shiue I, Driscoll T, Vasankari T, Alsharif U, Rahimi-Movaghar V, Vlassov VV, Marcenes WS, Mekonnen W, Melaku YA, Yano Y, Artaman A, Campos I, MacLachlan J, Mueller U, Kim D, Trillini M, Eshrati B, Williams HC, Shibuya K, Dandona R, Murthy K, Cowie B, Amare AT, Antonio CA, Castañeda-Orjuela C, van Gool CH, Violante F, Oh IH, Deribe K, Soreide K, Knibbs L, Kereselidze M, Green M, Cardenas R, Roy N, Tillmann T, Li Y, Krueger H, Monasta L, Dey S, Sheikhbahaei S, Hafezi-Nejad N, Kumar GA, Sreeramareddy CT, Dandona L, Wang H, Vollset SE, Mokdad A, Salomon JA, Lozano R, Vos T, Forouzanfar M, Lopez A, Murray C, Naghavi M. The Global Burden of Cancer JAMA Oncol 2015; 1: [PMID: DOI: /jamaoncol ] 2 Yang RY, Rabinovich GA, Liu FT. Galectins: structure, function and therapeutic potential. Expert Rev Mol Med 2008; 10: e17 [PMID: DOI: /S ] 3 Lau KS, Dennis JW. N-Glycans in cancer progression. Glycobiology 2008; 18: [PMID: DOI: / glycob/cwn071] 4 Hirabayashi J, Hashidate T, Arata Y, Nishi N, Nakamura T, Hirashima M, Urashima T, Oka T, Futai M, Muller WE, Yagi F, Kasai K. Oligosaccharide specificity of galectins: a search by frontal affinity chromatography. Biochim Biophys Acta 2002; 1572: [PMID: ] 5 Liu FT, Rabinovich GA. Galectins as modulators of tumour progression. Nat Rev Cancer 2005; 5: [PMID: DOI: /nrc1527] 6 Compagno D, Laderach DJ, Gentilini L, Jaworski FM, Rabinovich GA. Delineating the galectin signature of the tumor microenvironment. Oncoimmunology 2013; 2: e23565 [PMID: DOI: /onci.23565] 7 Hockl PF, Wolosiuk A, Pérez-Sáez JM, Bordoni AV, Croci DO, Toum-Terrones Y, Soler-Illia GJ, Rabinovich GA. Glyco-nanooncology: Novel therapeutic opportunities by combining small and sweet. Pharmacol Res 2016; 109: [PMID: DOI: /j.phrs ] 8 Camby I, Le Mercier M, Lefranc F, Kiss R. Galectin-1: a small protein with major functions. Glycobiology 2006; 16: 137R-157R [PMID: DOI: /glycob/cwl025] 9 Elola MT, Wolfenstein-Todel C, Troncoso MF, Vasta GR, Rabinovich GA. Galectins: matricellular glycan-binding proteins linking cell adhesion, migration, and survival. Cell Mol Life Sci 2007; 64: [PMID: DOI: / s ] 10 Blaževitš O, Mideksa YG, Šolman M, Ligabue A, Ariotti N, Nakhaeizadeh H, Fansa EK, Papageorgiou AC, Wittinghofer A, Ahmadian MR, Abankwa D. Galectin-1 dimers can scaffold Rafeffectors to increase H-ras nanoclustering. Sci Rep 2016; 6: [PMID: DOI: /srep24165] 11 Thijssen VL, Heusschen R, Caers J, Griffioen AW. Galectin expression in cancer diagnosis and prognosis: A systematic review. Biochim Biophys Acta 2015; 1855: [PMID: DOI: /j.bbcan ] 12 Demydenko D, Berest I. Expression of galectin-1 in malignant tumors. Exp Oncol 2009; 31: [PMID: ] 13 Astorgues-Xerri L, Riveiro ME, Tijeras-Raballand A, Serova M, Neuzillet C, Albert S, Raymond E, Faivre S. Unraveling galectin-1 as a novel therapeutic target for cancer. Cancer Treat Rev 2014; 40: [PMID: DOI: /j.ctrv ] 14 Thijssen VL, Barkan B, Shoji H, Aries IM, Mathieu V, Deltour L, Hackeng TM, Kiss R, Kloog Y, Poirier F, Griffioen AW. Tumor cells secrete galectin-1 to enhance endothelial cell activity. Cancer Res 2010; 70: [PMID: DOI: / CAN ] 15 Thijssen VL, Postel R, Brandwijk RJ, Dings RP, Nesmelova I, Satijn S, Verhofstad N, Nakabeppu Y, Baum LG, Bakkers J, Mayo KH, Poirier F, Griffioen AW. Galectin-1 is essential in tumor angiogenesis and is a target for antiangiogenesis therapy. Proc Natl Acad Sci USA 2006; 103: [PMID: DOI: /pnas ] 16 Croci DO, Salatino M, Rubinstein N, Cerliani JP, Cavallin LE, Leung HJ, Ouyang J, Ilarregui JM, Toscano MA, Domaica CI, Croci MC, Shipp MA, Mesri EA, Albini A, Rabinovich GA. Disrupting galectin-1 interactions with N-glycans suppresses hypoxia-driven angiogenesis and tumorigenesis in Kaposi s sarcoma. J Exp Med 2012; 209: [PMID: DOI: /jem ] 17 Rabinovich GA, Conejo-García JR. Shaping the Immune Landscape in Cancer by Galectin-Driven Regulatory Pathways. J Mol Biol 2016; 428: [PMID: DOI: / j.jmb ] 18 Bacigalupo ML, Manzi M, Rabinovich GA, Troncoso MF. Hierarchical and selective roles of galectins in hepatocarcinogenesis, liver fibrosis and inflammation of hepatocellular carcinoma. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i ] 19 Barrow H, Guo X, Wandall HH, Pedersen JW, Fu B, Zhao Q, Chen C, Rhodes JM, Yu LG. Serum galectin-2, -4, and -8 are greatly increased in colon and breast cancer patients and promote cancer cell adhesion to blood vascular endothelium. Clin Cancer Res 2011; 17: [PMID: DOI: / CCR ] 20 Jung JH, Kim HJ, Yeom J, Yoo C, Shin J, Yoo J, Kang CS, Lee C. Lowered expression of galectin-2 is associated with lymph node metastasis in gastric cancer. J Gastroenterol 2012; 47: [PMID: DOI: /s ] 21 Wang Y, Sun J, Ma C, Gao W, Song B, Xue H, Chen W, Chen X, Zhang Y, Shao Q, Wang Q, Zhao L, Liu J, Wang X, Wang H, Zhang Y, Yang M, Qu X. Reduced Expression of Galectin-9 Contributes to a Poor Outcome in Colon Cancer by Inhibiting NK Cell Chemotaxis Partially through the Rho/ROCK1 Signaling Pathway. PLoS One 2016; 11: e [PMID: DOI: /journal.pone ] 22 Wu KL, Huang EY, Jhu EW, Huang YH, Su WH, Chuang PC, Yang KD. Overexpression of galectin-3 enhances migration of colon cancer cells related to activation of the K-Ras-Raf-Erk1/2 pathway. J Gastroenterol 2013; 48: [PMID: DOI: /s ] 23 Lauren P. The Two Histological Main Types Of Gastric Carcinoma: Diffuse And So-Called Intestinal-Type Carcinoma. An Attempt At A Histo-Clinical Classification. Acta Pathol Microbiol Scand 1965; 64: [PMID: ] 24 Berlth F, Bollschweiler E, Drebber U, Hoelscher AH, Moenig S. Pathohistological classification systems in gastric cancer: diagnostic relevance and prognostic value. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20. i ] 25 Plummer M, Franceschi S, Vignat J, Forman D, de Martel C. Global burden of gastric cancer attributable to Helicobacter pylori. Int J Cancer 2015; 136: [PMID: DOI: / ijc.28999] 26 Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat Rev Cancer 2004; 4: [PMID: DOI: /nrc1433] 27 Hu B, El Hajj N, Sittler S, Lammert N, Barnes R, Meloni-Ehrig A. Gastric cancer: Classification, histology and application of 5276 August 7, 2017 Volume 23 Issue 29

35 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies molecular pathology. J Gastrointest Oncol 2012; 3: [PMID: DOI: /j.issn ] 28 Jou E, Rajdev L. Current and emerging therapies in unresectable and recurrent gastric cancer. World J Gastroenterol 2016; 22: [PMID: DOI: /wjg.v22.i ] 29 Satolli MA, Buffoni L, Spadi R, Roato I. Gastric cancer: The times they are a-changin. World J Gastrointest Oncol 2015; 7: [PMID: DOI: /wjgo.v7.i11.303] 30 Jorge YC, Mataruco MM, Araújo LP, Rossi AF, de Oliveira JG, Valsechi MC, Caetano A, Miyazaki K, Fazzio CS, Thomé JA, Rahal P, Oliani SM, Silva AE. Expression of annexin-a1 and galectin-1 anti-inflammatory proteins and mrna in chronic gastritis and gastric cancer. Mediators Inflamm 2013; 2013: [PMID: DOI: /2013/152860] 31 Rossi AF, Duarte MC, Poltronieri AB, Valsechi MC, Jorge YC, de-santi Neto D, Rahal P, Oliani SM, Silva AE. Deregulation of annexin-a1 and galectin-1 expression in precancerous gastric lesions: intestinal metaplasia and gastric ulcer. Mediators Inflamm 2014; 2014: [PMID: DOI: /2014/478138] 32 Chen J, Tang D, Wang S, Li QG, Zhang JR, Li P, Lu Q, Niu G, Gao J, Ye NY, Wang DR. High expressions of galectin-1 and VEGF are associated with poor prognosis in gastric cancer patients. Tumour Biol 2014; 35: [PMID: DOI: /s ] 33 Zheng L, Xu C, Guan Z, Su X, Xu Z, Cao J, Teng L. Galectin-1 mediates TGF-β-induced transformation from normal fibroblasts into carcinoma-associated fibroblasts and promotes tumor progression in gastric cancer. Am J Transl Res 2016; 8: [PMID: ] 34 He XJ, Tao HQ, Hu ZM, Ma YY, Xu J, Wang HJ, Xia YJ, Li L, Fei BY, Li YQ, Chen JZ. Expression of galectin-1 in carcinomaassociated fibroblasts promotes gastric cancer cell invasion through upregulation of integrin β1. Cancer Sci 2014; 105: [PMID: DOI: /cas.12539] 35 Bektas S, Bahadir B, Ucan BH, Ozdamar SO. CD24 and galectin-1 expressions in gastric adenocarcinoma and clinicopathologic significance. Pathol Oncol Res 2010; 16: [PMID: DOI: /s ] 36 Chong Y, Tang D, Gao J, Jiang X, Xu C, Xiong Q, Huang Y, Wang J, Zhou H, Shi Y, Wang D. Galectin-1 induces invasion and the epithelial-mesenchymal transition in human gastric cancer cells via non-canonical activation of the hedgehog signaling pathway. Oncotarget 2016; 7: [PMID: DOI: /oncotarget.13201] 37 Chong Y, Tang D, Xiong Q, Jiang X, Xu C, Huang Y, Wang J, Zhou H, Shi Y, Wu X, Wang D. Galectin-1 from cancer-associated fibroblasts induces epithelial-mesenchymal transition through β1 integrinmediated upregulation of Gli1 in gastric cancer. J Exp Clin Cancer Res 2016; 35: 175 [PMID: DOI: /s ] 38 Yoshii M, Tanaka H, Ohira M, Muguruma K, Iwauchi T, Lee T, Sakurai K, Kubo N, Yashiro M, Sawada T, Hirakawa K. Expression of Forkhead box P3 in tumour cells causes immunoregulatory function of signet ring cell carcinoma of the stomach. Br J Cancer 2012; 106: [PMID: DOI: /bjc ] 39 Pernot S, Voron T, Perkins G, Lagorce-Pages C, Berger A, Taieb J. Signet-ring cell carcinoma of the stomach: Impact on prognosis and specific therapeutic challenge. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 40 Nieto MA. The ins and outs of the epithelial to mesenchymal transition in health and disease. Annu Rev Cell Dev Biol 2011; 27: [PMID: DOI: /annurevcellbio ] 41 Tang D, Gao J, Wang S, Ye N, Chong Y, Huang Y, Wang J, Li B, Yin W, Wang D. Cancer-associated fibroblasts promote angiogenesis in gastric cancer through galectin-1 expression. Tumour Biol 2016; 37: [PMID: DOI: /s ] 42 Estofolete CF, Zucoloto S, Oliani SM, Polli-Lopes AC, Gil CD. Myenteric denervation downregulates galectin-1 and -3 expression in gastric carcinogenesis. Dig Dis Sci 2011; 56: [PMID: DOI: /s ] 43 Polli-Lopes AC, Zucoloto S, de Queirós Cunha F, da Silva Figueiredo LA, Garcia SB. Myenteric denervation reduces the incidence of gastric tumors in rats. Cancer Lett 2003; 190: [PMID: ] 44 Lim JW, Kim H, Kim KH. Cell adhesion-related gene expression by Helicobacter pylori in gastric epithelial AGS cells. Int J Biochem Cell Biol 2003; 35: [PMID: ] 45 Chen YR, Juan HF, Huang HC, Huang HH, Lee YJ, Liao MY, Tseng CW, Lin LL, Chen JY, Wang MJ, Chen JH, Chen YJ. Quantitative proteomic and genomic profiling reveals metastasisrelated protein expression patterns in gastric cancer cells. J Proteome Res 2006; 5: [PMID: DOI: /pr060212g] 46 Croci DO, Cerliani JP, Dalotto-Moreno T, Méndez-Huergo SP, Mascanfroni ID, Dergan-Dylon S, Toscano MA, Caramelo JJ, García-Vallejo JJ, Ouyang J, Mesri EA, Junttila MR, Bais C, Shipp MA, Salatino M, Rabinovich GA. Glycosylation-dependent lectin-receptor interactions preserve angiogenesis in anti-vegf refractory tumors. Cell 2014; 156: [PMID: DOI: /j.cell ] 47 Tian H, Miyoshi E, Kawaguchi N, Shaker M, Ito Y, Taniguchi N, Tsujimoto M, Matsuura N. The implication of N-acetylglucosaminyltransferase V expression in gastric cancer. Pathobiology 2008; 75: [PMID: DOI: / ] 48 Granovsky M, Fata J, Pawling J, Muller WJ, Khokha R, Dennis JW. Suppression of tumor growth and metastasis in Mgat5- deficient mice. Nat Med 2000; 6: [PMID: DOI: /73163] 49 Taniguchi N, Korekane H. Branched N-glycans and their implications for cell adhesion, signaling and clinical applications for cancer biomarkers and in therapeutics. BMB Rep 2011; 44: [PMID: ] 50 Zhao Y, Nakagawa T, Itoh S, Inamori K, Isaji T, Kariya Y, Kondo A, Miyoshi E, Miyazaki K, Kawasaki N, Taniguchi N, Gu J. N-acetylglucosaminyltransferase III antagonizes the effect of N-acetylglucosaminyltransferase V on alpha3beta1 integrinmediated cell migration. J Biol Chem 2006; 281: [PMID: DOI: /jbc.M ] 51 Pinho SS, Figueiredo J, Cabral J, Carvalho S, Dourado J, Magalhães A, Gärtner F, Mendonfa AM, Isaji T, Gu J, Carneiro F, Seruca R, Taniguchi N, Reis CA. E-cadherin and adherensjunctions stability in gastric carcinoma: functional implications of glycosyltransferases involving N-glycan branching biosynthesis, N-acetylglucosaminyltransferases III and V. Biochim Biophys Acta 2013; 1830: [PMID: DOI: / j.bbagen ] 52 El-Serag HB. Hepatocellular carcinoma. N Engl J Med 2011; 365: [PMID: DOI: /NEJMra ] 53 Zhang DY, Friedman SL. Fibrosis-dependent mechanisms of hepatocarcinogenesis. Hepatology 2012; 56: [PMID: DOI: /hep.25670] 54 Hernandez-Gea V, Toffanin S, Friedman SL, Llovet JM. Role of the microenvironment in the pathogenesis and treatment of hepatocellular carcinoma. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] 55 Villanueva A, Hernandez-Gea V, Llovet JM. Medical therapies for hepatocellular carcinoma: a critical view of the evidence. Nat Rev Gastroenterol Hepatol 2013; 10: [PMID: DOI: /nrgastro ] 56 de Lope CR, Tremosini S, Forner A, Reig M, Bruix J. Management of HCC. J Hepatol 2012; 56: S75-S87 [PMID: DOI: /S (12) ] 57 Forner A, Llovet JM, Bruix J. Hepatocellular carcinoma. Lancet 2012; 379: [PMID: DOI: / S (11) ] 58 Ercolani G, Grazi GL, Ravaioli M, Del Gaudio M, Gardini A, Cescon M, Varotti G, Cetta F, Cavallari A. Liver resection for hepatocellular carcinoma on cirrhosis: univariate and multivariate analysis of risk factors for intrahepatic recurrence. Ann Surg 2003; 237: [PMID: DOI: /01.SLA F2] 5277 August 7, 2017 Volume 23 Issue 29

36 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies 59 Vivarelli M, Risaliti A. Liver transplantation for hepatocellular carcinoma on cirrhosis: strategies to avoid tumor recurrence. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 60 Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, de Oliveira AC, Santoro A, Raoul JL, Forner A, Schwartz M, Porta C, Zeuzem S, Bolondi L, Greten TF, Galle PR, Seitz JF, Borbath I, Häussinger D, Giannaris T, Shan M, Moscovici M, Voliotis D, Bruix J; SHARP Investigators Study Group. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 2008; 359: [PMID: DOI: /NEJMoa ] 61 Cheng AL, Kang YK, Chen Z, Tsao CJ, Qin S, Kim JS, Luo R, Feng J, Ye S, Yang TS, Xu J, Sun Y, Liang H, Liu J, Wang J, Tak WY, Pan H, Burock K, Zou J, Voliotis D, Guan Z. Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase III randomised, double-blind, placebo-controlled trial. Lancet Oncol 2009; 10: [PMID: DOI: /S (08) ] 62 Chung EJ, Sung YK, Farooq M, Kim Y, Im S, Tak WY, Hwang YJ, Kim YI, Han HS, Kim JC, Kim MK. Gene expression profile analysis in human hepatocellular carcinoma by cdna microarray. Mol Cells 2002; 14: [PMID: ] 63 Kondoh N, Hada A, Ryo A, Shuda M, Arai M, Matsubara O, Kimura F, Wakatsuki T, Yamamoto M. Activation of Galectin-1 gene in human hepatocellular carcinoma involves methylationsensitive complex formations at the transcriptional upstream and downstream elements. Int J Oncol 2003; 23: [PMID: ] 64 Spano D, Russo R, Di Maso V, Rosso N, Terracciano LM, Roncalli M, Tornillo L, Capasso M, Tiribelli C, Iolascon A. Galectin-1 and its involvement in hepatocellular carcinoma aggressiveness. Mol Med 2010; 16: [PMID: DOI: / molmed ] 65 Wu H, Chen P, Liao R, Li YW, Yi Y, Wang JX, Sun TW, Zhou J, Shi YH, Yang XR, Jin JJ, Cheng YF, Fan J, Qiu SJ. Overexpression of galectin-1 is associated with poor prognosis in human hepatocellular carcinoma following resection. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: /j x] 66 You Y, Tan JX, Dai HS, Chen HW, Xu XJ, Yang AG, Zhang YJ, Bai LH, Bie P. MiRNA-22 inhibits oncogene galectin-1 in hepatocellular carcinoma. Oncotarget 2016; 7: [PMID: DOI: /oncotarget.10981] 67 Zhang J, Yang Y, Yang T, Liu Y, Li A, Fu S, Wu M, Pan Z, Zhou W. microrna-22, downregulated in hepatocellular carcinoma and correlated with prognosis, suppresses cell proliferation and tumourigenicity. Br J Cancer 2010; 103: [PMID: DOI: /sj.bjc ] 68 Orentas RJ, Kohler ME, Johnson BD. Suppression of anticancer immunity by regulatory T cells: back to the future. Semin Cancer Biol 2006; 16: [PMID: DOI: / j.semcancer ] 69 Yeh CC, Hsu CH, Shao YY, Ho WC, Tsai MH, Feng WC, Chow LP. Integrated Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC) and Isobaric Tags for Relative and Absolute Quantitation (itraq) Quantitative Proteomic Analysis Identifies Galectin-1 as a Potential Biomarker for Predicting Sorafenib Resistance in Liver Cancer. Mol Cell Proteomics 2015; 14: [PMID: DOI: /mcp.M ] 70 Espelt MV, Croci DO, Bacigalupo ML, Carabias P, Manzi M, Elola MT, Muñoz MC, Dominici FP, Wolfenstein-Todel C, Rabinovich GA, Troncoso MF. Novel roles of galectin-1 in hepatocellular carcinoma cell adhesion, polarization, and in vivo tumor growth. Hepatology 2011; 53: [PMID: DOI: /hep.24294] 71 Su YC, Davuluri GV, Chen CH, Shiau DC, Chen CC, Chen CL, Lin YS, Chang CP. Galectin-1-Induced Autophagy Facilitates Cisplatin Resistance of Hepatocellular Carcinoma. PLoS One 2016; 11: e [PMID: DOI: /journal. pone ] 72 Potikha T, Stoyanov E, Pappo O, Frolov A, Mizrahi L, Olam D, Shnitzer-Perlman T, Weiss I, Barashi N, Peled A, Sass G, Tiegs G, Poirier F, Rabinovich GA, Galun E, Goldenberg D. Interstrain differences in chronic hepatitis and tumor development in a murine model of inflammation-mediated hepatocarcinogenesis. Hepatology 2013; 58: [PMID: DOI: / hep.26335] 73 Mauad TH, van Nieuwkerk CM, Dingemans KP, Smit JJ, Schinkel AH, Notenboom RG, van den Bergh Weerman MA, Verkruisen RP, Groen AK, Oude Elferink RP, van der Valk MA, Borst P, Offerhaus GJ. Mice with homozygous disruption of the mdr2 P-glycoprotein gene. A novel animal model for studies of nonsuppurative inflammatory cholangitis and hepatocarcinogenesis. Am J Pathol 1994; 145: [PMID: ] 74 Potikha T, Ella E, Cerliani JP, Mizrahi L, Pappo O, Rabinovich GA, Galun E, Goldenberg DS. Galectin-1 is essential for efficient liver regeneration following hepatectomy. Oncotarget 2016; 7: [PMID: DOI: /oncotarget.9194] 75 Bacigalupo ML, Manzi M, Espelt MV, Gentilini LD, Compagno D, Laderach DJ, Wolfenstein-Todel C, Rabinovich GA, Troncoso MF. Galectin-1 triggers epithelial-mesenchymal transition in human hepatocellular carcinoma cells. J Cell Physiol 2015; 230: [PMID: DOI: /jcp.24865] 76 Li S, Mo C, Peng Q, Kang X, Sun C, Jiang K, Huang L, Lu Y, Sui J, Qin X, Liu Y. Cell surface glycan alterations in epithelial mesenchymal transition process of Huh7 hepatocellular carcinoma cell. PLoS One 2013; 8: e71273 [PMID: DOI: /journal.pone ] 77 Guo R, Cheng L, Zhao Y, Zhang J, Liu C, Zhou H, Jia L. Glycogenes mediate the invasive properties and chemosensitivity of human hepatocarcinoma cells. Int J Biochem Cell Biol 2013; 45: [PMID: DOI: /j.biocel ] 78 Miyoshi E, Nishikawa A, Ihara Y, Gu J, Sugiyama T, Hayashi N, Fusamoto H, Kamada T, Taniguchi N. N-acetylglucosaminyltransferase III and V messenger RNA levels in LEC rats during hepatocarcinogenesis. Cancer Res 1993; 53: [PMID: ] 79 Liu H, Wu Q, Liu Y, Liu W, Zhang W, Pan D, Xu J. Prognostic significance of β1,6-n-acetylglucosaminyltransferase V expression in patients with hepatocellular carcinoma. Jpn J Clin Oncol 2015; 45: [PMID: DOI: /jjco/hyv080] 80 Yao M, Zhou DP, Jiang SM, Wang QH, Zhou XD, Tang ZY, Gu JX. Elevated activity of N-acetylglucosaminyltransferase V in human hepatocellular carcinoma. J Cancer Res Clin Oncol 1998; 124: [PMID: ] 81 Fischer C, Sanchez-Ruderisch H, Welzel M, Wiedenmann B, Sakai T, André S, Gabius HJ, Khachigian L, Detjen KM, Rosewicz S. Galectin-1 interacts with the {alpha}5{beta}1 fibronectin receptor to restrict carcinoma cell growth via induction of p21 and p27. J Biol Chem 2005; 280: [PMID: DOI: /jbc.M ] 82 Sanchez-Ruderisch H, Detjen KM, Welzel M, André S, Fischer C, Gabius HJ, Rosewicz S. Galectin-1 sensitizes carcinoma cells to anoikis via the fibronectin receptor α5β1-integrin. Cell Death Differ 2011; 18: [PMID: DOI: / cdd ] 83 Manzi M, Bacigalupo ML, Carabias P, Elola MT, Wolfenstein- Todel C, Rabinovich GA, Espelt MV, Troncoso MF. Galectin-1 Controls the Proliferation and Migration of Liver Sinusoidal Endothelial Cells and Their Interaction With Hepatocarcinoma Cells. J Cell Physiol 2016; 231: [PMID: DOI: /jcp.25244] 84 Kristensen DB, Kawada N, Imamura K, Miyamoto Y, Tateno C, Seki S, Kuroki T, Yoshizato K. Proteome analysis of rat hepatic stellate cells. Hepatology 2000; 32: [PMID: DOI: /jhep ] 85 Maeda N, Kawada N, Seki S, Arakawa T, Ikeda K, Iwao H, Okuyama H, Hirabayashi J, Kasai K, Yoshizato K. Stimulation of proliferation of rat hepatic stellate cells by galectin-1 and galectin-3 through different intracellular signaling pathways. J Biol Chem 2003; 278: [PMID: DOI: 5278 August 7, 2017 Volume 23 Issue 29

37 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies /jbc.M ] 86 Binefa G, Rodríguez-Moranta F, Teule A, Medina-Hayas M. Colorectal cancer: from prevention to personalized medicine. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] 87 Leufkens AM, van den Bosch MA, van Leeuwen MS, Siersema PD. Diagnostic accuracy of computed tomography for colon cancer staging: a systematic review. Scand J Gastroenterol 2011; 46: [PMID: DOI: / ] 88 Van Cutsem E, Oliveira J; ESMO Guidelines Working Group. Advanced colorectal cancer: ESMO clinical recommendations for diagnosis, treatment and follow-up. Ann Oncol 2009; 20 Suppl 4: [PMID: DOI: /annonc/mdp130] 89 Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet 2014; 383: [PMID: DOI: /S (13) ] 90 Fung KY, Nice E, Priebe I, Belobrajdic D, Phatak A, Purins L, Tabor B, Pompeia C, Lockett T, Adams TE, Burgess A, Cosgrove L. Colorectal cancer biomarkers: to be or not to be? Cautionary tales from a road well travelled. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i4.888] 91 Burt RW. Colon cancer screening. Gastroenterology 2000; 119: [PMID: ] 92 Fearon ER. Molecular genetics of colorectal cancer. Annu Rev Pathol 2011; 6: [PMID: DOI: / annurev-pathol ] 93 Lotan R, Matsushita Y, Ohannesian D, Carralero D, Ota DM, Cleary KR, Nicolson GL, Irimura T. Lactose-binding lectin expression in human colorectal carcinomas. Relation to tumor progression. Carbohydr Res 1991; 213: [PMID: ] 94 Irimura T, Matsushita Y, Sutton RC, Carralero D, Ohannesian DW, Cleary KR, Ota DM, Nicolson GL, Lotan R. Increased content of an endogenous lactose-binding lectin in human colorectal carcinoma progressed to metastatic stages. Cancer Res 1991; 51: [PMID: ] 95 Sanjuán X, Fernández PL, Castells A, Castronovo V, van den Brule F, Liu FT, Cardesa A, Campo E. Differential expression of galectin 3 and galectin 1 in colorectal cancer progression. Gastroenterology 1997; 113: [PMID: ] 96 Hittelet A, Legendre H, Nagy N, Bronckart Y, Pector JC, Salmon I, Yeaton P, Gabius HJ, Kiss R, Camby I. Upregulation of galectins-1 and -3 in human colon cancer and their role in regulating cell migration. Int J Cancer 2003; 103: [PMID: DOI: /ijc.10843] 97 Nagy N, Legendre H, Engels O, André S, Kaltner H, Wasano K, Zick Y, Pector JC, Decaestecker C, Gabius HJ, Salmon I, Kiss R. Refined prognostic evaluation in colon carcinoma using immunohistochemical galectin fingerprinting. Cancer 2003; 97: [PMID: DOI: /cncr.11268] 98 Zhao XY, Chen TT, Xia L, Guo M, Xu Y, Yue F, Jiang Y, Chen GQ, Zhao KW. Hypoxia inducible factor-1 mediates expression of galectin-1: the potential role in migration/invasion of colorectal cancer cells. Carcinogenesis 2010; 31: [PMID: DOI: /carcin/bgq116] 99 Gopalan V, Saremi N, Sullivan E, Kabir S, Lu CT, Salajegheh A, Leung M, Smith RA, Lam AK. The expression profiles of the galectin gene family in colorectal adenocarcinomas. Hum Pathol 2016; 53: [PMID: DOI: / j.humpath ] 100 Watanabe M, Takemasa I, Kawaguchi N, Miyake M, Nishimura N, Matsubara T, Matsuo E, Sekimoto M, Nagai K, Matsuura N, Monden M, Nishimura O. An application of the 2-nitrobenzenesulfenyl method to proteomic profiling of human colorectal carcinoma: A novel approach for biomarker discovery. Proteomics Clin Appl 2008; 2: [PMID: DOI: /prca ] 101 Watanabe M, Takemasa I, Kaneko N, Yokoyama Y, Matsuo E, Iwasa S, Mori M, Matsuura N, Monden M, Nishimura O. Clinical significance of circulating galectins as colorectal cancer markers. Oncol Rep 2011; 25: [PMID: DOI: / or ] 102 Watanabe T, Komuro Y, Kiyomatsu T, Kanazawa T, Kazama Y, Tanaka J, Tanaka T, Yamamoto Y, Shirane M, Muto T, Nagawa H. Prediction of sensitivity of rectal cancer cells in response to preoperative radiotherapy by DNA microarray analysis of gene expression profiles. Cancer Res 2006; 66: [PMID: DOI: / CAN ] 103 Wu KL, Chen HH, Pen CT, Yeh WL, Huang EY, Hsiao CC, Yang KD. Circulating Galectin-1 and 90K/Mac-2BP Correlated with the Tumor Stages of Patients with Colorectal Cancer. Biomed Res Int 2015; 2015: [PMID: DOI: /2015/306964] 104 Seelentag WK, Li WP, Schmitz SF, Metzger U, Aeberhard P, Heitz PU, Roth J. Prognostic value of beta1,6-branched oligosaccharides in human colorectal carcinoma. Cancer Res 1998; 58: [PMID: ] 105 Murata K, Miyoshi E, Kameyama M, Ishikawa O, Kabuto T, Sasaki Y, Hiratsuka M, Ohigashi H, Ishiguro S, Ito S, Honda H, Takemura F, Taniguchi N, Imaoka S. Expression of N-acetylglucosaminyltransferase V in colorectal cancer correlates with metastasis and poor prognosis. Clin Cancer Res 2000; 6: [PMID: ] 106 Ishida H, Togayachi A, Sakai T, Iwai T, Hiruma T, Sato T, Okubo R, Inaba N, Kudo T, Gotoh M, Shoda J, Tanaka N, Narimatsu H. A novel beta1,3-n-acetylglucosaminyltransferase (beta3gn-t8), which synthesizes poly-n-acetyllactosamine, is dramatically upregulated in colon cancer. FEBS Lett 2005; 579: [PMID: DOI: /j.febslet ] 107 Lahm H, André S, Hoeflich A, Fischer JR, Sordat B, Kaltner H, Wolf E, Gabius HJ. Comprehensive galectin fingerprinting in a panel of 61 human tumor cell lines by RT-PCR and its implications for diagnostic and therapeutic procedures. J Cancer Res Clin Oncol 2001; 127: [PMID: ] 108 Satelli A, Rao US. Galectin-1 is silenced by promoter hypermethylation and its re-expression induces apoptosis in human colorectal cancer cells. Cancer Lett 2011; 301: [PMID: DOI: /j.canlet ] 109 Satelli A, Rao PS, Gupta PK, Lockman PR, Srivenugopal KS, Rao US. Varied expression and localization of multiple galectins in different cancer cell lines. Oncol Rep 2008; 19: [PMID: ] 110 Liang L, Qu L, Ding Y. Protein and mrna characterization in human colorectal carcinoma cell lines with different metastatic potentials. Cancer Invest 2007; 25: [PMID: DOI: / ] 111 Lotan R, Lotan D, Carralero DM. Modulation of galactosidebinding lectins in tumor cells by differentiation-inducing agents. Cancer Lett 1989; 48: [PMID: ] 112 Ohannesian DW, Lotan D, Lotan R. Concomitant increases in galectin-1 and its glycoconjugate ligands (carcinoembryonic antigen, lamp-1, and lamp-2) in cultured human colon carcinoma cells by sodium butyrate. Cancer Res 1994; 54: [PMID: ] 113 Woynarowska B, Dimitroff CJ, Sharma M, Matta KL, Bernacki RJ. Inhibition of human HT-29 colon carcinoma cell adhesion by a 4-fluoro-glucosamine analogue. Glycoconj J 1996; 13: [PMID: ] 114 Horiguchi N, Arimoto K, Mizutani A, Endo-Ichikawa Y, Nakada H, Taketani S. Galectin-1 induces cell adhesion to the extracellular matrix and apoptosis of non-adherent human colon cancer Colo201 cells. J Biochem 2003; 134: [PMID: ] 115 Guo H, Nagy T, Pierce M. Post-translational glycoprotein modifications regulate colon cancer stem cells and colon adenoma progression in Apc(min/+) mice through altered Wnt receptor signaling. J Biol Chem 2014; 289: [PMID: DOI: /jbc.M ] 116 Ose R, Oharaa O, Nagase T. Galectin-1 and Galectin-3 Mediate Protocadherin-24-Dependent Membrane Localization of β-catenin in Colon Cancer Cell Line HCT116. Curr Chem Genomics 2012; 6: [PMID: DOI: / ] 5279 August 7, 2017 Volume 23 Issue 29

38 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies 117 Wang HM, Zhang GY. Indomethacin suppresses growth of colon cancer via inhibition of angiogenesis in vivo. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i3.340] 118 Wang YJ, Zhang GY, Xiao ZQ, Wang HM, Chen ZC. Preliminary proteomic analysis of indomethacin s effect on tumor transplanted with colorectal cancer cell in nude mice. J Biochem Mol Biol 2006; 39: [PMID: ] 119 Siegel RL, Miller KD, Jemal A. Cancer statistics, CA Cancer J Clin 2015; 65: 5-29 [PMID: DOI: /caac.21254] 120 Hruban RH, Adsay NV, Albores-Saavedra J, Compton C, Garrett ES, Goodman SN, Kern SE, Klimstra DS, Klöppel G, Longnecker DS, Lüttges J, Offerhaus GJ. Pancreatic intraepithelial neoplasia: a new nomenclature and classification system for pancreatic duct lesions. Am J Surg Pathol 2001; 25: [PMID: ] 121 Kamisawa T, Wood LD, Itoi T, Takaori K. Pancreatic cancer. Lancet 2016; 388: [PMID: DOI: / S (16) ] 122 Wilson JS, Pirola RC, Apte MV. Stars and stripes in pancreatic cancer: role of stellate cells and stroma in cancer progression. Front Physiol 2014; 5: 52 [PMID: DOI: /fphys ] 123 Zhu CP, Shi J, Chen YX, Xie WF, Lin Y. Gemcitabine in the chemoradiotherapy for locally advanced pancreatic cancer: a metaanalysis. Radiother Oncol 2011; 99: [PMID: DOI: /j.radonc ] 124 Iacobuzio-Donahue CA, Ashfaq R, Maitra A, Adsay NV, Shen- Ong GL, Berg K, Hollingsworth MA, Cameron JL, Yeo CJ, Kern SE, Goggins M, Hruban RH. Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive characterization and comparison of the transcription profiles obtained from three major technologies. Cancer Res 2003; 63: [PMID: ] 125 Pan S, Chen R, Reimel BA, Crispin DA, Mirzaei H, Cooke K, Coleman JF, Lane Z, Bronner MP, Goodlett DR, McIntosh MW, Traverso W, Aebersold R, Brentnall TA. Quantitative proteomics investigation of pancreatic intraepithelial neoplasia. Electrophoresis 2009; 30: [PMID: DOI: /elps ] 126 Shen J, Person MD, Zhu J, Abbruzzese JL, Li D. Protein expression profiles in pancreatic adenocarcinoma compared with normal pancreatic tissue and tissue affected by pancreatitis as detected by two-dimensional gel electrophoresis and mass spectrometry. Cancer Res 2004; 64: [PMID: DOI: / CAN ] 127 Grützmann R, Pilarsky C, Ammerpohl O, Lüttges J, Böhme A, Sipos B, Foerder M, Alldinger I, Jahnke B, Schackert HK, Kalthoff H, Kremer B, Klöppel G, Saeger HD. Gene expression profiling of microdissected pancreatic ductal carcinomas using high-density DNA microarrays. Neoplasia 2004; 6: [PMID: DOI: /neo.04295] 128 Chung JC, Oh MJ, Choi SH, Bae CD. Proteomic analysis to identify biomarker proteins in pancreatic ductal adenocarcinoma. ANZ J Surg 2008; 78: [PMID: DOI: / j x] 129 Iuga C, Seicean A, Iancu C, Buiga R, Sappa PK, Völker U, Hammer E. Proteomic identification of potential prognostic biomarkers in resectable pancreatic ductal adenocarcinoma. Proteomics 2014; 14: [PMID: DOI: / pmic ] 130 Tang D, Zhang J, Yuan Z, Gao J, Wang S, Ye N, Li P, Gao S, Miao Y, Wang D, Jiang K. Pancreatic satellite cells derived galectin-1 increase the progression and less survival of pancreatic ductal adenocarcinoma. PLoS One 2014; 9: e90476 [PMID: DOI: /journal.pone ] 131 Chen R, Pan S, Ottenhof NA, de Wilde RF, Wolfgang CL, Lane Z, Post J, Bronner MP, Willmann JK, Maitra A, Brentnall TA. Stromal galectin-1 expression is associated with long-term survival in resectable pancreatic ductal adenocarcinoma. Cancer Biol Ther 2012; 13: [PMID: DOI: /cbt.20842] 132 Tang D, Yuan Z, Xue X, Lu Z, Zhang Y, Wang H, Chen M, An Y, Wei J, Zhu Y, Miao Y, Jiang K. High expression of Galectin-1 in pancreatic stellate cells plays a role in the development and maintenance of an immunosuppressive microenvironment in pancreatic cancer. Int J Cancer 2012; 130: [PMID: DOI: /ijc.26290] 133 Berberat PO, Friess H, Wang L, Zhu Z, Bley T, Frigeri L, Zimmermann A, Büchler MW. Comparative analysis of galectins in primary tumors and tumor metastasis in human pancreatic cancer. J Histochem Cytochem 2001; 49: [PMID: ] 134 Tang D, Gao J, Wang S, Yuan Z, Ye N, Chong Y, Xu C, Jiang X, Li B, Yin W, Miao Y, Wang D, Jiang K. Apoptosis and anergy of T cell induced by pancreatic stellate cells-derived galectin-1 in pancreatic cancer. Tumour Biol 2015; 36: [PMID: DOI: /s ] 135 Wang L, Friess H, Zhu Z, Frigeri L, Zimmermann A, Korc M, Berberat PO, Büchler MW. Galectin-1 and galectin-3 in chronic pancreatitis. Lab Invest 2000; 80: [PMID: ] 136 Sandgren EP, Quaife CJ, Paulovich AG, Palmiter RD, Brinster RL. Pancreatic tumor pathogenesis reflects the causative genetic lesion. Proc Natl Acad Sci USA 1991; 88: [PMID: ] 137 Grippo PJ, Sandgren EP. Acinar-to-ductal metaplasia accompanies c-myc-induced exocrine pancreatic cancer progression in transgenic rodents. Int J Cancer 2012; 131: [PMID: DOI: /ijc.27322] 138 Martínez-Bosch N, Fernández-Barrena MG, Moreno M, Ortiz- Zapater E, Munné-Collado J, Iglesias M, André S, Gabius HJ, Hwang RF, Poirier F, Navas C, Guerra C, Fernández-Zapico ME, Navarro P. Galectin-1 drives pancreatic carcinogenesis through stroma remodeling and Hedgehog signaling activation. Cancer Res 2014; 74: [PMID: DOI: / CAN ] 139 Roda O, Ortiz-Zapater E, Martínez-Bosch N, Gutiérrez-Gallego R, Vila-Perelló M, Ampurdanés C, Gabius HJ, André S, Andreu D, Real FX, Navarro P. Galectin-1 is a novel functional receptor for tissue plasminogen activator in pancreatic cancer. Gastroenterology 2009; 136: , e1-e5 [PMID: DOI: / j.gastro ] 140 Rosenberger I, Strauss A, Dobiasch S, Weis C, Szanyi S, Gil-Iceta L, Alonso E, González Esparza M, Gómez-Vallejo V, Szczupak B, Plaza-García S, Mirzaei S, Israel LL, Bianchessi S, Scanziani E, Lellouche JP, Knoll P, Werner J, Felix K, Grenacher L, Reese T, Kreuter J, Jiménez-González M. Targeted diagnostic magnetic nanoparticles for medical imaging of pancreatic cancer. J Control Release 2015; 214: [PMID: DOI: / j.jconrel ] 141 Roda O, Chiva C, Espuña G, Gabius HJ, Real FX, Navarro P, Andreu D. A proteomic approach to the identification of new tpa receptors in pancreatic cancer cells. Proteomics 2006; 6: S36-S41 [PMID: DOI: /pmic ] 142 André S, Sanchez-Ruderisch H, Nakagawa H, Buchholz M, Kopitz J, Forberich P, Kemmner W, Böck C, Deguchi K, Detjen KM, Wiedenmann B, von Knebel Doeberitz M, Gress TM, Nishimura S, Rosewicz S, Gabius HJ. Tumor suppressor p16ink4a--modulator of glycomic profile and galectin-1 expression to increase susceptibility to carbohydrate-dependent induction of anoikis in pancreatic carcinoma cells. FEBS J 2007; 274: [PMID: DOI: /j x] 143 Sanchez-Ruderisch H, Fischer C, Detjen KM, Welzel M, Wimmel A, Manning JC, André S, Gabius HJ. Tumor suppressor p16 INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model. FEBS J 2010; 277: [PMID: DOI: /j x] 144 Amano M, Eriksson H, Manning JC, Detjen KM, André S, Nishimura S, Lehtiö J, Gabius HJ. Tumour suppressor p16(ink4a) - anoikis-favouring decrease in N/O-glycan/cell surface sialylation by down-regulation of enzymes in sialic acid biosynthesis in tandem in a pancreatic carcinoma model. FEBS J 2012; 279: [PMID: DOI: /febs.12001] 145 Muniyan S, Haridas D, Chugh S, Rachagani S, Lakshmanan I, Gupta S, Seshacharyulu P, Smith LM, Ponnusamy MP, Batra SK. MUC16 contributes to the metastasis of pancreatic ductal adenocarcinoma through focal adhesion mediated signaling 5280 August 7, 2017 Volume 23 Issue 29

39 Bacigalupo ML et al. Galectin-1 in gastrointestinal malignancies mechanism. Genes Cancer 2016; 7: [PMID: DOI: /genesandcancer.104] 146 Xue X, Lu Z, Tang D, Yao J, An Y, Wu J, Li Q, Gao W, Xu Z, Qian Z, Dai C, Wei J, Miao Y, Jiang K. Galectin-1 secreted by activated stellate cells in pancreatic ductal adenocarcinoma stroma promotes proliferation and invasion of pancreatic cancer cells: an in vitro study on the microenvironment of pancreatic ductal adenocarcinoma. Pancreas 2011; 40: [PMID: DOI: / MPA.0b013e e] 147 Chen R, Dawson DW, Pan S, Ottenhof NA, de Wilde RF, Wolfgang CL, May DH, Crispin DA, Lai LA, Lay AR, Waghray M, Wang S, McIntosh MW, Simeone DM, Maitra A, Brentnall TA. Proteins associated with pancreatic cancer survival in patients with resectable pancreatic ductal adenocarcinoma. Lab Invest 2015; 95: [PMID: DOI: /labinvest ] 148 Masamune A, Satoh M, Hirabayashi J, Kasai K, Satoh K, Shimosegawa T. Galectin-1 induces chemokine production and proliferation in pancreatic stellate cells. Am J Physiol Gastrointest Liver Physiol 2006; 290: G729-G736 [PMID: DOI: /ajpgi ] 149 Fitzner B, Walzel H, Sparmann G, Emmrich J, Liebe S, Jaster R. Galectin-1 is an inductor of pancreatic stellate cell activation. Cell Signal 2005; 17: [PMID: DOI: / j.cellsig ] P- Reviewer: Bener Sadik R, Gazouli M, Sperti C S- Editor: Ma YJ L- Editor: A E- Editor: Li D 5281 August 7, 2017 Volume 23 Issue 29

40 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) REVIEW From diagnosis to treatment of hepatocellular carcinoma: An epidemic problem for both developed and developing world Dimitrios Dimitroulis, Christos Damaskos, Serena Valsami, Spyridon Davakis, Nikolaos Garmpis, Eleftherios Spartalis, Antonios Athanasiou, Demetrios Moris, Stratigoula Sakellariou, Stylianos Kykalos, Gerasimos Tsourouflis, Anna Garmpi, Ioanna Delladetsima, Konstantinos Kontzoglou, Gregory Kouraklis Dimitrios Dimitroulis, Christos Damaskos, Nikolaos Garmpis, Stylianos Kykalos, Gerasimos Tsourouflis, Konstantinos Kontzoglou, Gregory Kouraklis, Second Department of Propedeutic Surgery, Laiko General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece Serena Valsami, Blood Transfusion Department, Aretaieion Hospital, Medical School, National and Kapodistrian Athens University, Athens, Greece Spyridon Davakis, First Department of Surgery, Laiko General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece Eleftherios Spartalis, N.S. Christeas Laboratory of Experimental Surgery and Surgical Research, Medical School, National and Kapodistrian University of Athens, Athens, Greece Antonios Athanasiou, Department of Surgery, Mercy University Hospital, Grenville Pl, T12 WE28 Cork, Ireland Demetrios Moris, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195, United States Stratigoula Sakellariou, Ioanna Delladetsima, First Department of Pathology, Medical School, National and Kapodistrian University of Athens, Athens, Greece Anna Garmpi, Internal Medicine Department, Laiko General Hospital, University of Athens Medical School, Athens, Greece Author contributions: Dimitroulis D and Damaskos C contributed equally to this work; Dimitroulis D, Damaskos C, Valsami S and Davakis S designed the research and wrote the paper; Dimitroulis D, Damaskos C, Garmpis N, Kykalos S, Delladetsima I, Kontzoglou K and Kouraklis G reviewed the paper; Spartalis E, Athanasiou A, Moris D, Sakellariou S, Tsourouflis G and Garmpi A collected the data. Conflict-of-interest statement: No potential conflicts of interest. No financial support. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Dimitrios Dimitroulis, MD, MSc, PhD, Assistant Professor of Surgery, Second Department of Propedeutic Surgery, Laiko General Hospital, National and Kapodistrian University of Athens, Medical School, 17 Agiou Thoma Street, Athens, Greece. dimitroulisdimitrios@yahoo.com Telephone: Fax: Received: March 15, 2017 Peer-review started: March 17, 2017 First decision: April 7, 2017 Revised: May 3, 2017 Accepted: June 9, 2017 Article in press: June 12, 2017 Published online: August 7, 2017 Abstract Hepatocellular carcinoma (HCC) is the most frequent primary liver malignancy and the third cause of cancer-related death in the Western Countries. The well-established causes of HCC are chronic liver 5282 August 7, 2017 Volume 23 Issue 29

41 Dimitroulis D et al. Current evidence for HCC infections such as hepatitis B virus or chronic hepatitis C virus, nonalcoholic fatty liver disease, consumption of aflatoxins and tobacco smocking. Clinical presentation varies widely; patients can be asymptomatic while symptomatology extends from right upper abdominal quadrant paint and weight loss to obstructive jaundice and lethargy. Imaging is the first key and one of the most important aspects at all stages of diagnosis, therapy and follow-up of patients with HCC. The Barcelona Clinic Liver Cancer Staging System remains the most widely classification system used for HCC management guidelines. Up until now, HCC remains a challenge to early diagnose, and treat effectively; treating management is focused on hepatic resection, orthotopic liver transplantation, ablative therapies, chemoembolization and systemic therapies with cytotocix drugs, and targeted agents. This review article describes the current evidence on epidemiology, symptomatology, diagnosis and treatment of hepatocellular carcinoma. Key words: Hepatocellular; Cancer; Epidemiology; Treatment; Diagnosis; Staging; Transplantation The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Hepatocellular carcinoma (HCC) is the most frequent primary liver malignancy. It consists an epidemic problem for both developed and developing world. HCC remains a challenge to early diagnose, and treat effectively. This review article focuses on the current evidence on epidemiology, symptomatology, diagnosis and treatment of hepatocellular carcinoma. This review will be highly educational as it describes all the current data for HCC. Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, Athanasiou A, Moris D, Sakellariou S, Kykalos S, Tsourouflis G, Garmpi A, Delladetsima I, Kontzoglou K, Kouraklis G. From diagnosis to treatment of hepatocellular carcinoma: An epidemic problem for both developed and developing world. World J Gastroenterol 2017; 23(29): Available from: URL: com/ /full/v23/i29/5282.htm DOI: org/ /wjg.v23.i INTRODUCTION Hepatocellular carcinoma (HCC) is the most frequent primary liver malignancy and the third cause of cancer-related death in the Western Countries. The causes of HCC are chronic liver infections, nonalcoholic fatty liver disease, consumption of aflatoxins and tobacco smocking. Clinical presentation varies; patients can be asymptomatic while symptomatology extends from abdominal paint and weight loss to jaundice and lethargy. Imaging is the first key and one of the most important aspects at all stages of diagnosis, therapy and follow-up of patients with HCC. HCC remains a challenge to early diagnose, and treat effectively; treating management is focused on hepatic resection, orthotopic liver transplantation, ablative therapies, chemoembolization and systemic therapies with cytotocix drugs, and targeted agents. This review article focuses on the current evidence on epidemiology, symptomatology, diagnosis and treatment of hepatocellular carcinoma. LITERATURE SEARCH An extensive literature search was conducted using the MEDLINE database. The key word used was Hepatocellular carcinoma. A total of 82 papers were included for review. EPIDEMIOLOGY HCC is the most frequent primary liver malignancy and one of the most common malignancies worldwide. HCC is considered as the sixth most common cancer type and as the third cause of cancer-related death in the developed countries [1] ; more than a million people are dying yearly due to HCC in the Western countries. It has been found that in countries with higher rates of chronic hepatitis B virus (HBV) or chronic hepatitis C virus (HCV) [2], well established causes of HCC, the incidence of the disease varies from 15 per comparing to 3 per in the Western countries. Over the past 30 years a higher incidence of HCC has been noticed in the United States [3]. Τhat must be attributed to the increased incidence of HCV infection as well as to the new immigration patterns across the world. HCC seems to have strong sex preponderance; it is two to eight times more common in males comparing to females in low-and high-incidence areas. The higher incidence of HCC in males is related to higher rates of associated risk factors. In general, the incidence of HCC increases with age, but a tendency to develop HCC earlier in high-incidence areas has been noted. In addition, it has been reported the familial aggregation of HCC. RISK FACTORS Most of the HCC cases develop in the presence of advanced chronic liver disease related to viral hepatitis. In particular HBV and HCV infections are considered as major HCC risk factors worldwide. Moreover, heavy alcohol consumption and liver cirrhosis are a well-known pattern of increased risk for chronic liver disease and HCC development (higher hepatic DNA synthesis in cirrhosis). However, current studies provide strong evidence for increasing numbers of HCC in nonalcoholic fatty liver disease (NAFLD). NAFLD represents the hepatic manifestation of metabolic 5283 August 7, 2017 Volume 23 Issue 29

42 Dimitroulis D et al. Current evidence for HCC < 1 cm Liver mass > 1 cm may initially appear with a paraneoplastic syndrome; the most common paraneoplastic syndromes associated with HCC are hypercholesterolemia, hypercalcemia, hypoglycemia and erythrocytosis [8]. No change Surveillance Ultrasonography twice a year Changing size and characteristic Investigate with other imaging studies syndrome which is based on obesity and insulin resistance [4]. Consumption of aflatoxins; frequent contaminants of a number of staple foods, pose serious public health hazards including the causation of hepatocellular carcinoma by aflatoxin B [5]. Tobacco smokers had been found to have a higher risk to nonsmokers population, as an independent factor, of developing HCC [6]. CLINICAL PRESENTATION - PHYSICAL EXAMINATION Contrast-enhanced computed tomography/dm magnetic resonance imaging High arterial-phase contrast uptake and rapid wash out (late phase) The patients presenting with HCC are usually males with an average age of 50 years. In countries with high HBV prevalence, HCC often appears about 2 decades earlier and is attributed to HBV transmission perinatally or in early childhood. HCC may progress silently in patients with sufficient liver function and escape early diagnosis due to vague complaints and non-specific symptoms. This is why in developing countries with limited surveillance resources HCC diagnosis is usually delayed. On the other hand, clinical symptoms are accentuated in cases with impaired liver function. In advanced stages, symptoms and clinical findings include vague right upper quadrant abdominal pain, hepatomegaly, obstructive jaundice, hemobilia, and fever of unknown origin. Non-specific symptoms of advanced malignant disease such as anorexia, nausea, lethargy and weight loss often co-exist. Patients with unrecognized cirrhosis or known compensated cirrhosis may also present with liver decompensation. Complications include hepatic vein occlusion evolving to Budd-Chiari syndrome [7] and more often portal vein invasion and thrombosis while a severe complication is HCC rupture causing acute abdomen and intraperitoneal bleeding. HCC patients Yes Hepatocellular carcinoma No Biopsy/other imaging study Figure 1 Imaging studies used in diagnosis, treatment planning, management and follow-up of hepatocellular carcinoma. DIAGNOSIS The diagnosis of HCC is mostly based on imaging studies and laboratory tests as well. The imaging studies used in diagnosis, treatment planning, management and follow-up of HCC are ultrasonography (US), computed tomography (CT) scanning and magnetic resonance imaging (MRI) [9] (Figure 1). In refer to laboratory tests, alpha-fetoprotein (AFP) is the most frequent used serological marker. However, sensitivity ranges from 25% for tumors smaller than 3 cm to 50% for lesions larger than 3 cm in diameter [10]. Other serum biomarkers and a new generation of IgM immunocomplexes did not succeed in providing diagnostic accuracy. However, simultaneous detection of these markers in various combinations could improve sensitivity. Although current management guidelines for HCC do not require biopsy to prove the diagnosis [11], lesions greater than 2 cm on MRI or computed tomograph angiography (CTA) scans, with AFP either elevated more than 400 ng/ml or rising within sequential measurements do not require histologic confirmation according to the guidelines of the European Association for the Study of the Liver (EASL). In patients without chronic liver disease, liver biopsy is strongly recommended for the final diagnosis and proper treatment plan. American Association for the Study of Liver Disease (AASLD) proposed guidelines on the management of HCC in 2005 [12]. According to AASLD guidelines, liver nodules detected on abdominal US surveillance which measure less than 1 cm should be re-examined every twice a year. The AASLD as well as the EASL suggest abdominal ultrasonography as the preferred study for surveillance of patients at high risk of HCC twice a year [13]. If no radiological change of the lesion has occurred over a period of up to 2 years, routine surveillance can be continued. Every suspicious lesion in high risk patients that has suggestive US findings for HCC should be further investigated with additional imaging studies. That includes 4-phase multidetector CT scan or dynamic contrast enhanced MRI. If the lesion has the typical characteristics of HCC, it should be treated as HCC. If a nodule is greater 2 cm at the initial diagnosis and it is compatible with HCC after one dynamic imaging study, biopsy is not necessary for the diagnosis of HCC. On the other hand, if the vascular profile of the liver tumor on imaging studies of a non-cirrhotic patient is not consistent with HCC, a second imaging study or biopsy of the lesion should be performed to rule out HCC. If the biopsy of a liver nodule is 5284 August 7, 2017 Volume 23 Issue 29

43 Dimitroulis D et al. Current evidence for HCC A B C D Figure 2 Multiphasic computed tomography in a large hepatocellular carcinoma located in the right liver lobe. A: Unenhanced image; B: Lesion s enhancement in the late hepatic arterial phase; C: Lesion s washout in the portal venous phase; D: Delayed phase image. The lesion has capsule appearance most shown in the portal venous and delayed phase. negative for HCC, patients should be further surveilled via abdominal US every 3-6 mo until the nodule presents enlarged in size or with altered imaging characteristics. According to the guidelines of the Asia- Pacific Association for the Study of the Liver 2010 [14], every nodular lesion with atypical vascular features should undergo further imaging investigation such as endoscopic ultrasonography (EUS) [14]. Most commonly, contrast enhanced CT scans and MRI scans are performed to expose, differentiate and examine a liver mass. HCC has often a unique imaging pattern [15]. On contrast-enhanced CT and MRI studies, high arterial-phase contrast uptake and rapid washout during in late phase are displayed, although these characteristics are not present in early stages or in not well-differentiated HCC (Figure 2). Furthermore, Triphasic CTA can identify more nodules, but in patients with nodular cirrhosis, contrast enhanced MRI should be preferred. Lesions between 1 and 2 cm in cirrhotic patients should be further examined with triphasic CTA and MRI in order to rule out HCC [16]. Angiography and contrast-enhanced ultrasound (CEUS) have complementary role in the investigation of a possible HCC lesion. The diagnosis of HCC is made using the same imaging criteria of arterial phase hypervascularity, but portal or delayed phase washout is observed in only 50% of cases [17]. Moreover, the depiction interval is short and comprehensive scanning of the entire liver is not possible. The CEUS sensitivity is further restricted to less than 50% in the investigation of small tumors [18]. Angiography for the diagnosis of HCC has been replaced mostly by crosssectional imaging. Normal vasculature is typically displaced by a characteristic hypervascular large mass, with bizarre neovascularity and arteriovenous shunting. An enlarged hepatic artery may also be present [19]. Pozitron Emiting Tomography scan is not accurate for early diagnosis, but 18 F-fluorodeoxyglucose (FDG) uptake can significantly help investigating liver lesions. PET using FDG can detect extrahepatic metastases not revealed in CT or MRI scans [20]. Diffusion-weighted imaging (DWI) contributes to the molecular water composition and to the degree of tumor viability at the cellular level. DWI is particularly useful as an initial screening tool for liver study as nearly 70%-95% of HCCs can appear hyperintense [21]. Although DWI is high sensitive in detecting liver nodules, it cannot accurately distinguish between HCC and dysplastic nodules or other malignant and benign liver lesions. Contrast-enhanced MRI outperforms DWI in that field, consisting currently the method of choice for the characterization of malignant liver lesions in cirrhotic liver [22]. STAGING The prognosis of HCC is related to tumor stage; staging in HCC should define outcome prediction and the optimum treatment management, liver function, portal pressure and clinical performance status of the 5285 August 7, 2017 Volume 23 Issue 29

44 Dimitroulis D et al. Current evidence for HCC Table 1 Barcelona Clinic Liver Cancer staging classification Tumor status Stage PST Tumor stage Okuda Stage Liver function studies Stage A: early HCC A1 0 Single Ⅰ No portal hypertension A2 0 Single Ⅰ Portal hypertension and normal bilirubin A3 0 Single Ⅰ Portal hypertension and abnormal bilirubin A4 0 3 tumors < 3 cm Ⅰ-Ⅱ Child-Pugh A-B Stage B: idermediate HCC 0 Large multinodular Ⅰ-Ⅱ Child-Pugh A-B Stage C: advanced HCC Vascular invasion or Ⅰ-Ⅱ Child-Pugh A-B extrahepatic spread Stage D: end-stage HCC Any Ⅲ Child-Pugh C 1 Stage C, at least one criteria: PST1-2 or vascular invasion/extrahepatic spread; 2 Stage D, at least one criteria: PST3-4 or Okuda Stage Ⅲ/Child-Pugh C. PST: Performance status; Stage A and B, all criteria should be fulfilled. Table 2 Child-Turcotte-Pugh score Measurements Score Encephalopathy None Mild Moderate Ascites None Slight Moderate Serum Bilirubin (mg/dl) > 3 Serum Albumin (mg/dl) > < 2.8 PT (seconds prolonged) < > 6 Stage A: 5-6 points; Stage B: 7-9 points; Stage C: points. patient. However, prognosis for the patients with HCC is not only associated with the stage of the disease, but also depends on the underlying liver function as well as the performance status of each patient [23]. The current staging system for HCC, it is proposed by the Barcelona Clinic Liver Cancer (BCLC), and is recommended both for prognostic prediction and treatment allocation [24,25]. It is a staging system that also assigns treatment based on tumor stage, liver function, performance status, and treatment intent (Table 1). The Child-Turcotte-Pugh (CTP) score is a simple and widely used grading system for liver function [26] (Table 2). On the other hand, there are many drawbacks using CTP system in liver function appraisal, including interlaboratory variations, day-to-day fluctuations in the key parameters and the subjective nature of the clinical grading of chronic liver disease [27]. The most important disadvantage of CTP score is the presence of subjective parameters. Therefore, in the recent years the CTP score is gradually substituted by other scoring systems accessing the underlying liver function more accurately. The Okuda classification was first applied in HCC patients more than two decades ago. It indicates parameters about the tumor stage (more or less than 50% of the liver parenchyma involved), as well as liver functional status, such as albumin, ascites and bilirubin. Okuda classification has been useful to identify the end-stage patients (Okuda stage III) [28]. Table 3 Model for end-stage liver disease, United Network for Organ Sharing modification MELD Score = 9.57 ln (Serum Creatinine in mg/dl) ln (Serum Bilirubin in mg/dl) ln (INR) MELD: Model for end-stage liver disease. The model for end-stage liver disease (MELD) score assess the severity of chronic liver disease and was initially developed to predict three month mortality following transjugular intrahepatic portosystemic shunt placement [29]. It is a logarithmic score that is comprised of serum creatinine, total serum bilirubin and International Normalized Ratio. It also included a variable based on the underlying etiology of the hepatic disease. However, the etiology of the underlying liver disease turned out to be relatively unimportant; therefore it was removed from the score calculation [30] (Table 3). MELD was adopted by the United Network for Organ Sharing in 2002 for prioritization of patients awaiting liver transplantation. However, the MELD score has been strongly criticized as it fails to classify the patients with advanced liver disease correctly [31]. Several groups have offered refinements to the MELD score calculation, including other parameters [32]. ΤΝΜ system is based on histopathology of a tumor, while it examines the local expansion of the disease on local nodules as well as the adjacent organs. TNM is applicable in predicting survival for these patients who have undergone surgical excision of an HCC. The criteria of TNM system are developed jointly by the American Joint Committee on Cancer and the International Union for Cancer Control. Current edition of TNM for HCC is the seventh, which took effect in 2010 [33] (Table 4). PATHOLOGY Macroscopic appearance of HCC depends on tumor size and the presence or absence of cirrhosis in the 5286 August 7, 2017 Volume 23 Issue 29

45 Dimitroulis D et al. Current evidence for HCC Table 4 American Joint Committee on Cancer TNM Staging for Liver Tumors (7 th edition, 2010) Primary tumor (T) Tx T0 T1 Primary tumor cannot be assessed No evidence of primary tumor Solitary tumor without vascular invasion T2 Solitary tumor with vascular invasion or multiple tumors, none more than 5 cm T3a Multiple tumors more than 5 cm T3b Single tumor or multiple tumors of any size involving a major branch of the portal vein or the hepatic vein T4 Tumors with direct invasion of adjacent organs other than the gallbladder or with perforation of visceral peritoneum Regional lymph nodes (N) Nx Regional lymph nodes cannot be assessed N0 No regional node metastasis N1 Regional lymph node metastasis Distal Metastases (M) M0 No distant metastasis M1 Distant metastasis Anatomic stage/prognostic groups Stage Ⅰ T1 N0 M0 Stage Ⅱ T2 N0 M0 Stage ⅢA T3a N0 M0 Stage ⅢB T3b N0 M0 Stage ⅢC T4 N0 M0 Stage IVA Any T N1 M0 Stage IVB Any T Any N M1 Histologic grade (G) G1 Well differentiated G2 Moderately differentiated G3 Poorly differentiated G4 Undifferentiated Fibrosis core (F) The fibrosis score as defined by Ishak recommended because of its prognostic value in overall survival. This scoring system uses a 0-6 scale F0 Fibrosis score 0-4 (none to moderate fibrosis) F1 Fibrosis score 5-6 (severe fibrosis or cirrhosis) sinusoids are lost [34,37]. GRADING The most widespread grading system is the WHO 4 tier system, classifying tumors into well differentiated (Figure 3A and B), moderate differentiated, poorly differentiated and undifferentiated. The Edmonson - Steiner system (1954) also divides HCC in 4 grades based on an assessment of cellular atypia and nuclear - cytoplasm ratio. Tumor grade has proven to be of weak prognostic significance regarding clinical course and survival [38] in contrast to tumor size which constitutes a major prognostic factor, with a very good prognosis for small sized HCC [39]. Along these lines, the International Consensus Group for Hepatocellular Carcinoma adopted in 2009 the division of small HCC into two clinico-pathological groups, termed early HCC and progressed HCC [35]. They represent tumors at different stages of development, which differ in morphology, prognosis and treatment. Early HCC is a small tumor (less than 2 cm), with poorly defined margins and well differentiated histology that has been characterized by some investigators as carcinoma in situ or microinvasive carcinoma [39,40]. Angiographic findings are often not diagnostic because the main blood supply is through the portal vein. Major histologic features constitute preserved portal tracts, pseudoglandular pattern, diffuse fatty change and varying numbers of unpaired arteries (Figures 3A and 2B). The most helpful feature in differentiating early HCC from highgrade dysplastic nodule is portal tract or fibrous septa infiltration. background liver [34]. Small HCC (less than 2 cm) can be vaguely nodular (early HCC) or distinctly nodular (progressed HCC) [35]. The majority of larger HCC show a nodular pattern, either unifocal or multifocal. In livers with cirrhosis a fibrous pseudocapsule is often formed while in noncirrhotic livers HCC tend to be unencapsulated [34]. Occasionally, HCC protrude outside the liver resulting in a pedunculated tumor. The massive HCC type represents a sizable tumor with relatively unclear boundaries that may occupy the entire liver lobe. The diffuse type is a rare growth pattern comprising of multiple scattered tiny nodules distributed throughout the liver mimicking cirrhosis [36]. On histological grounds, HCC mimics the hepatic parenchyma in structural and cytological features. Well and moderately differentiated HCCs show a trabecular (plate-like) growth pattern with sinusoidal capillarization expressed by CD34 positive endothelial cells. Rarefaction of reticular fibers is another microscopic characteristic while bile canaliculi are also formed and can be depicted by polyclonal carcinoembryonic antigen and CD10 expression. Poorly differentiated HCC shows a compact architecture and DIFFERENTIAL DIAGNOSIS The histological diagnosis of HCC may be difficult due to morphological similarities between (1) welldifferentiated HCC and benign hepatocellular lesions such as regenerative nodules, dysplastic nodules, hepatocellular adenoma and focal nodular hyperplasia; and (2) between poorly differentiated HCC and other primary liver (e.g., cholangiocarcinoma) or metastatic cancers. Immunohistochemical markers that can facilitate diagnosis include HepPar1, albumin, fibrinogen, a1-antitrypsin, alfa-fetoprotein and glypican-3 (GPC3). Among them, GPC3 appears to be the more suitable marker in poorly differentiated tumors [41,42]. Overexpression of desgamma-carboxyprothrombin, GPC3, heat-shock protein (HSP70) and glutamine synthetase favor malignancy in the differential diagnosis of hepatocellular nodules. The detection of at least two of the above markers enhances the diagnostic reliability. A group of expert liver pathologists recently proposed the term well-differentiated hepatocellular neoplasm of uncertain malignant potential for a small subset of well-differentiated hepatocellular adenoma August 7, 2017 Volume 23 Issue 29

46 Dimitroulis D et al. Current evidence for HCC A B C D Figure 3 Well differentiated, (grade 1) hepatocellular carcinoma and early hepatocellular carcinoma with diffuse fatty change. A: White arrows indicate the interface between HCC (left) and background liver (right); B: HCC cells show high nuclear/cytoplasmic ratio and minimal nuclear atypia. A: H/E 100, B: H/E 200; C and D: Early HCC with diffuse fatty change. Black arrowhead depicts a preserved portal tract. Gomori stain shows rarefaction of reticulin network. C: H/E 100, D: Gomori stain 100. HCC: Hepatocellular carcinoma. Table 5 Current treatment options for hepatocellular carcinoma Surgical Resection Resection + ablation Orthotopic liver transplantation Ablative Thermal ablation (radiofrequency ablation, microwave ablation) Percutaneous alcohol (ethanol) injection Transarterial Embolization Chemoembolization Radiotherapy Transarterial and ablative (combined) Systemic chemotherapy + radioembolization like lesions with atypical clinical, histologic or genetic features which raise the necessity for close followup [43]. HCC HISTOLOGICAL SUBTYPES Besides conventional HCC there are rare histological types, which, except fibrolamellar HCC and HCC with stem cell features, are not associated with specific clinical characteristics or pathogenetic peculiarities. Fibrolamellar carcinoma constitutes a special type of HCC occurring in children and young adults that has a better prognosis than HCC when arising in cirrhotic liver but similar to HCC in non-cirrhotic liver. FLC grow with pushing borders and tumor cells are arranged in sheets and trabeculae, separated by collagen fibers which are often hyalinized and provide a unique lamellar appearance. FLC cells are sizeable with eosinophilic granular cytoplasm and often contain pale bodies, hyaline bodies and copper [34]. HCC with stem cell features has been established on the ground of accumulating evidence indicating that a subset of adult HCC with worse survival rates exhibits, at least focally, a progenitor cell phenotype. These tumors retain stem cell markers and may also express a hepatobiliary immunophenotype (Figure 4). Acknowledging this fact, WHO has included in the Classification of Tumors of the Digestive System (2010) the Combined Hepatocellular-Cholangiocarcinoma category, encompassing primary liver carcinoma subtypes with stem cell features. In a recent review, Brunt et al [44] pointed out the need for the establishment of a more complete terminology including the different subtypes based on their differentiation status. TREATMENT Treating HCC has always been a challenge, regarding efficiency of interventional medicine, coherence of the practitioner physicians about the treating options and first and foremost the survival of the treated patients. When feasible, complete HCC resection is the treatment of choice [45]. Otherwise, there is a variety of treatment options based on HCC stage, the patients performance status and physical abilities, the available resources, and the level of practitioner expertise (Table 5). Most recommendations for staging-guided treatment are based on the findings of retrospective studies [46]. Resection of the HCC lesion should be the primary 5288 August 7, 2017 Volume 23 Issue 29

47 Dimitroulis D et al. Current evidence for HCC A B C Figure 4 Combined hepatocellular-cholangiocarcinoma with stem cell features, intermediate cell subtype. Tumor expresses both hepatocellular (HepPar1) and biliary (CK19) immunohistochemical markers. A: H/E 100; B: HepPar1 100; C: CK A B C Figure 5 Intra-operative situs [prior (A) and post (B) right hepatectomy] and surgical specimen (C) of a large hepatocellular carcinoma located in the right liver lobe. treatment option in patients with single HCC with well-compensated Child A cirrhosis [12]. It has been proven that 5-year survival excides 50% and 5-year recurrence rate is about 70% in the group of patients that had undergone previously a surgical HCC resection [47]. Major hepatectomy can be safely performed nowadays due to better understanding of the liver anatomy [48], advances in surgical instruments and implication of newer surgical approaches (Figure 5). The most commonly used techniques for liver resection are the anterior approach to avoid liver mobilization and rupture of large liver tumors [49], the Pringle maneuver [50], the hanging maneuver [51] as well as the careful adjustment of central venus pressure for reduction of blood loss peri-operatively [52]. Site and size of the lesion, vascular invasion as well as multifocal disease should be estimated pre-operatively. Anatomic resection should be intended in every case if not contraindicated. It is well known that future liver remnant (FLR)/ total liver volume (TLV) ratio should be more than 20%-25% in patients with normal liver functions (no cirrhosis) and more than 50% in patients with a Child- Pugh score A cirrhosis, who s PLTs are more than /mm 3. The FLR/TLV ratio is being calculated via imaging studies pre-operatively. If FLR/TLV ratio is below recommended values, pre-operative portal vein embolization (PVE) should be considered in order to have a feasible liver remnant post-operatively, capable to actualize the metabolic needs of the patient [53]. It has been proven that PVE can increase the FLR size. In PVE, the ipsilateral portal vein which supplies the liver lobe harboring the tumor, thus inducing hypertrophy of the hepatic liver remnant [54]. PVE can be offered to cirrhotic patients, although liver regeneration and hypertrophy of the FLR is questionable in the presence of cirrhosis. In this group of patients the combination of PVE and trans-arterial chemoembolisation (TACE) represents a feasible treatment option [55]. The resectability of HCC often depends on the volume of the FLR. Stage hepatectomy is proposed for HCC with bilobar liver involvement. According to this procedure, two or more hepatectomies are performed at different time points in order to allow increase of FLR. This technique ensures adequate liver function as well as R0 resection. As prerequisites, the preserved portion of the liver should be sufficient and cancer free and adequate vascular inflow and outflow should be retained [56]. A newer technique, combines two stage hepatectomy with portal vein occlusion. Associating Liver Partition and Portal Vein Ligation in Staged Hepatectomy (ALPPS) is one of the main surgical innovations in hepatic surgery nowadays [57]. ALPPS aims to speed up hypertrophy of the liver remnant by right portal vein ligation and 5289 August 7, 2017 Volume 23 Issue 29

48 Dimitroulis D et al. Current evidence for HCC Table 6 Treatment schedule proposed for hepatocellular carcinoma cirrhotic patients according to the Barcelona Clinic Liver Cancer classification system Stage Treatment intention First/second choice Stage A: early HCC A1 Radical Surgical resection A2 Surgical resection ð OLT/ percutaneous treatment A3 OLT/percutaneous treatment (Ablation) A4 OLT/percutaneous treatment (Ablation) Stage B: intermediate HCC Stage C: advanced HCC Stage D: end-stage HCC Palliative 1 Palliative 1 Symptomatic Trasanterial embolization (associated or not to percutaneous treatment) Chemoembolization (TACE) New agents (Sorafenib) Supporting treatment 1 In the setting of phase II investigations or randomized control trials. HCC: Hepatocellular carcinoma; BCLC: Barcelona Clinic Liver Cancer. in-situ splitting of the intended transection surface down to the inferior vena cava. The second stage of the procedure is executed several days later with an adequate volume of FLR for a safe and feasible hepatectomy. Patients with solitary tumor who have adequate liver function, no major vascular invasion or intrahepatic metastases and adequate FLR should be considered eligible for surgery as a potentially curative option. In patients with advanced liver disease (multi-focal disease, inadequate liver function, major vascular invasion, a solitary tumor with multiple intrahepatic metastases, metastases on adjacent organs or missing enough healthy hepatic parenchyma to survive) the benefit of resection is vague and it should be weighed against the risk of liver failure and post-operative systemic complications [58]. It has to be taken into consideration that in these patients other treatment options might result in better long-term outcomes and similar rates of survival. Liver transplantation (LT) is the ideal treatment for HCC, especially in the presence of underlying liver disease, because it eliminates the tumor and cure underlying cirrhotic liver that serves as a risk of HCC development. However, the major limitation of LT is organ shortage resulting in high dropout rate (12%-25% per year) [59]. There are studies that have proven that Milan Criteria is the most significant prognostic factor of patients with HCC undergoing LT [60]. In patients with tumor burden beyond the Milan Criteria, other treatments can be applied to downstage the tumor to meet acceptable criteria for LT. TACE or radiofrequency ablation (RFA) are the common modalities used for downstaging [61]. Few patients (less than 20%) are amenable to resection and transplantation due to difficulties related to size, location and number of tumors, vascular and extrahepatic involvement and functional hepatic reserve due to cirrhosis. The ultimate treatment choice for the remaining 80% is interventional therapies [62]. BCLC staging system should be used in patients with HCC and underlying cirrhosis. The system identifies those patients with early HCC who may benefit from resection or RFA (stage 0 and A), those at intermediate or advanced stage who may benefit from palliative treatments and those with a very poor life expectancy (Table 6). Patients with early HCC who are not eligible for surgical resection or liver transplantation should undergo Local Ablative Therapy [63]. The procedure can be performed using or thermal ablation: RFA, microwave ablation (MWA), Laser-induced interstitial thermotherapy or either chemical: percutaneous alcohol injection (PEI). Under imaging guidance (US or CT) PEI is injected directly to the lesion. PEI is consisted of 95% ethanol, which causes local tumor necrosis. PEI is recommended for small lesions (10%-15% of liver lesions) [64], in cases where RFA is not feasible to apply due to technical reasons. Similar therapeutic results and rates of residual foci of untreated disease as well as equivalent complication rates have been showed for MWA and RFA use in liver lesions [65]. However, RFA offers the same results as WMA in fewer sessions [66], while MWA outweighs PEI on the local control of moderately or poorly differentiated small lesions. Furthermore, patients with a single tumor smaller than 4.0 cm and Child-Pugh class A cirrhosis have a higher probability of long-term survival after WMA rather than after RFA or PEI [67]. Transarterial chemoembolization (TACE), is a palliative treatment for inoperable HCC patients with large or multinodular lesions limited to the liver and with an adequate liver function [68]. Various treatment protocols have been applied using different chemotherapeutic agents [69]. The perfect TACE scheme should be that who would allow the maximum and also sustained concentration of the agent within the tumor, while keeping the systemic exposure as low as possible. Furthermore, a major issue is the lowest possible vessel obstruction, in order to reduce hepatic ischemia. Radioembolization with yttrium-90 microspheres, is a palliative treatment for patients with Child-Pugh class A cirrhosis and intermediate-stage HCC. It has also been used for the bridging to liver transplantation and as a downstage method for non-operable tumors. Arterial radioembolisation have shown improve in 2-year survival rate after administration, comparing with conservative treatment [70]. Three-dimensional conformal radiotherapy (RT) has shown good results at doses between 40Gy and 60Gy for patients with advance HCC. Median response rate is 45% and median survival 10 to 15 mo. Furthermore 1-year survival excides 70%; 5-year survival rate is between 9%and 25%. RT combined with TACE in various dose schemes have given advantages 5290 August 7, 2017 Volume 23 Issue 29

49 Dimitroulis D et al. Current evidence for HCC as salvage therapy. RT is an option in patients with advance liver disease that cannot be respected, in patients which are not suitable for liver transplantation, and those inoperable due to performance status or comorbidities [71]. SYSTEMIC THERAPY HCC is more often diagnosed in late stages and on the background of chronic liver disease. This fact minimizes the possibilities for curative strategies, while palliative procedures prevail as therapeutic options, aiming to downstage or to alleviate a locally advanced disease. The therapeutic options in advanced HCC are limited due to resistance of the carcinoma to chemotherapy. Systemic therapy with doxorubicin or cisplatin yields low objective response rates while drug-combinations may offer a better disease control without succeeding in improving survival rate. In addition, due to chronic liver disease and to underline liver dysfunction, HCC patients have limited tolerance to full doses of polychemotherapy. It has been proven that low response and no survival benefits ensure from cytotoxic chemotherapy [72]. Doxorubicin has been considered as one of the most active cytotoxic agents. Its use in HCC has reached 10% to 20% response rates as single agent chemotherapy. Clinical trials have demonstrated that Doxorubicin prolongs survival in advanced HCC compared to Nolatrexed (a thymidylate synthase inhibitor) [73]. Other cytotoxic agents, such as Gemcitabine, have shown fairly limited clinical benefit, despite their highly promising effect in in vitro studies [74]. Sorafenib is an oral multikinase inhibitor, which acts against platelet-derived growth factor receptor beta, vascular endothelial growth factor receptor as well as c-raf and b-raf. It was the first agent to achieve a statistically significant improvement of overall survival in Child-Pugh class A patients with advanced HCC [75]. In addition, administration of Sorafenib in patients with Child-Pugh class B has also given promising results [76]. Overall survival in patients with Child-Pugh A was encouraging after receiving combination therapy with Sorafenib plus Doxorubicin versus Doxorubicin alone [77]. RESPONSE ASSESSMENT AND FOLLOW- UP Monitoring a patient treated for hepatocellular carcinoma is an important part of the clinical management; accurate assessment of tumor response is essential for favorable outcomes. Follow-up of patients who had been treated with surgical resection or RFA ablation should consist of the clinical evaluation of liver function and the tumor response to the particular therapy, by CT or MRI studies every 3 mo the first 2 years and lance every 6 mo later on by US, enhanced CT and MRI scans [78]. Patients with recurrence on follow-up imaging studies may still be candidates for curative therapies. Patients with HCC and end-stage cirrhosis being treated with TACE or systemic chemotherapy should be examined for possible liver dysfunction as well as for tumor progression by CT or MRI every 2 mo [12]. The evaluation of HCC response to administered therapy is based on Response Evaluation Criteria in Solid Tumors (RECIST) [79]. However, with the increasing clinical use of antineoplastic cytostatic agents and locoregional interventional therapies in hepatocellular carcinoma (HCC), conventional morphologic methods have strong limitations in response assessment. Current RECIST criteria were designed for the evaluation of cytotoxic agents [80]. Modified RECIST (mrecist) criteria are mainly based on the measurement of the viable tumor component [81]. Additional criteria include evaluation of vascular invasion, lymph node involvement, effusions and new lesions [82]. Response assessment should be based on CT or MRI scans. Serum tumor markers may be helpful, but should not be used as the only determinant for treatment decision. CONCLUSION Summarizing and in order to emphasize to new data regarding the treatment of HCC following topics should be highlighted. Only a small proportion of patients with HCC (less than 20%) is amenable to resection or transplantation. ALPPS is nowadays one of the main innovations in hepatic surgery [57]. Regarding LT, treatments such as TACE or RFA can be applied to downstage tumors that initially do not meet the Milan Criteria [61]. Furthermore, a conventional treatment option that gains field in treatment of inoperable HCC is the RT [71]. In terms of chemotherapy, the administration of Sorafenib has given promising results in patients with Child-Pugh class B [76], while combination therapy with Sorafenib plus Doxorubicin seems to improve overall survival in patients with Child-Pugh A. Despite the advances in diagnostic and invasive medicine, hepatocellular carcinoma remains the most fatal malignant liver cancer worldwide. At the present time, treatment has focused to early diagnosis and hepatic resection or transplantation. Combination therapies have been used to downstage the tumor and make it operable, to improve underlying liver status and prolong the survival period. Therefore, future studies on HCC management are tremendously important in order to offer better treatment outcome and prolong survival for HCC patients. REFERENCES 1 Ferlay J. International Agency for Research on Cancer. GLOBOCAN 2000: cancer incidence, mortality, and prevalence 5291 August 7, 2017 Volume 23 Issue 29

50 Dimitroulis D et al. Current evidence for HCC worldwide. Lyon: IARC Press Hemming AW, Berumen J, Mekeel K. Hepatitis B and Hepatocellular Carcinoma. Clin Liver Dis 2016; 20: [PMID: DOI: /j.cld ] 3 El-Serag HB. Epidemiology of hepatocellular carcinoma in USA. Hepatol Res 2007; 37 Suppl 2: S88-S94 [PMID: DOI: /j X x] 4 Seyda Seydel G, Kucukoglu O, Altinbasv A, Demir OO, Yilmaz S, Akkiz H, Otan E, Sowa JP, Canbay A. Economic growth leads to increase of obesity and associated hepatocellular carcinoma in developing countries. Ann Hepatol 2016; 15: [PMID: DOI: / ] 5 Kew MC. Aflatoxins as a cause of hepatocellular carcinoma. J Gastrointestin Liver Dis 2013; 22: [PMID: ] 6 Siegel AB, Conner K, Wang S, Jacobson JS, Hershman DL, Hidalgo R, Verna EC, Halazun K, Brubaker W, Zaretsky J, Moniodis A, Delgado-Cruzata L, Dove L, Emond J, Kato T, Brown RS Jr, Neugut AI. Smoking and hepatocellular carcinoma mortality. Exp Ther Med 2012; 3: [PMID: DOI: /etm ] 7 Valla DC. The diagnosis and management of the Budd-Chiari syndrome: consensus and controversies. Hepatology 2003; 38: [PMID: DOI: /jhep ] 8 Luo JC, Hwang SJ, Wu JC, Li CP, Hsiao LT, Lai CR, Chiang JH, Lui WY, Chang FY, Lee SD. Paraneoplastic syndromes in patients with hepatocellular carcinoma in Taiwan. Cancer 1999; 86: [PMID: ] 9 Ghanaati H, Alavian SM, Jafarian A, Ebrahimi Daryani N, Nassiri-Toosi M, Jalali AH, Shakiba M. Imaging and Imaging- Guided Interventions in the Diagnosis and Management of Hepatocellular Carcinoma (HCC)-Review of Evidence. Iran J Radiol 2012; 9: [PMID: DOI: / iranjradiol.8242] 10 Stefaniuk P, Cianciara J, Wiercinska-Drapalo A. Present and future possibilities for early diagnosis of hepatocellular carcinoma. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg.v16.i4.418] 11 Bialecki ES, Ezenekwe AM, Brunt EM, Collins BT, Ponder TB, Bieneman BK, Di Bisceglie AM. Comparison of liver biopsy and noninvasive methods for diagnosis of hepatocellular carcinoma. Clin Gastroenterol Hepatol 2006; 4: [PMID: DOI: /S (05) ] 12 Bruix J, Sherman M; American Association for the Study of Liver Diseases. Management of hepatocellular carcinoma: an update. Hepatology 2011; 53: [PMID: DOI: / hep.24199] 13 Blum HE. Hepatocellular carcinoma: HCC. Hepat Mon 2011; 11: [PMID: ] 14 Omata M, Lesmana LA, Tateishi R, Chen PJ, Lin SM, Yoshida H, Kudo M, Lee JM, Choi BI, Poon RT, Shiina S, Cheng AL, Jia JD, Obi S, Han KH, Jafri W, Chow P, Lim SG, Chawla YK, Budihusodo U, Gani RA, Lesmana CR, Putranto TA, Liaw YF, Sarin SK. Asian Pacific Association for the Study of the Liver consensus recommendations on hepatocellular carcinoma. Hepatol Int 2010; 4: [PMID: DOI: / s ] 15 Yu SC, Yeung DT, So NM. Imaging features of hepatocellular carcinoma. Clin Radiol 2004; 59: [PMID: ] 16 Hennedige T, Venkatesh SK. Imaging of hepatocellular carcinoma: diagnosis, staging and treatment monitoring. Cancer Imaging 2013; 12: [PMID: DOI: / ] 17 Jang HJ, Kim TK, Burns PN, Wilson SR. Enhancement patterns of hepatocellular carcinoma at contrast-enhanced US: comparison with histologic differentiation. Radiology 2007; 244: [PMID: DOI: /radiol ] 18 Lencioni R, Piscaglia F, Bolondi L. Contrast-enhanced ultrasound in the diagnosis of hepatocellular carcinoma. J Hepatol 2008; 48: [PMID: DOI: /j.jhep ] 19 El-Serag HB, Marrero JA, Rudolph L, Reddy KR. Diagnosis and treatment of hepatocellular carcinoma. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 20 Ho CL, Chen S, Yeung DW, Cheng TK. Dual-tracer PET/CT imaging in evaluation of metastatic hepatocellular carcinoma. J Nucl Med 2007; 48: [PMID: DOI: / jnumed ] 21 Piana G, Trinquart L, Meskine N, Barrau V, Beers BV, Vilgrain V. New MR imaging criteria with a diffusion-weighted sequence for the diagnosis of hepatocellular carcinoma in chronic liver diseases. J Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 22 Park MS, Kim S, Patel J, Hajdu CH, Do RK, Mannelli L, Babb JS, Taouli B. Hepatocellular carcinoma: detection with diffusionweighted versus contrast-enhanced magnetic resonance imaging in pretransplant patients. Hepatology 2012; 56: [PMID: DOI: /hep.25681] 23 Llovet JM, Burroughs A, Bruix J. Hepatocellular carcinoma. Lancet 2003; 362: [PMID: DOI: / S (03) ] 24 Bruix J, Sherman M, Llovet JM, Beaugrand M, Lencioni R, Burroughs AK, Christensen E, Pagliaro L, Colombo M, Rodés J; EASL Panel of Experts on HCC. Clinical management of hepatocellular carcinoma. Conclusions of the Barcelona-2000 EASL conference. European Association for the Study of the Liver. J Hepatol 2001; 35: [PMID: ] 25 Llovet JM, Brú C, Bruix J. Prognosis of hepatocellular carcinoma: the BCLC staging classification. Semin Liver Dis 1999; 19: [PMID: DOI: /s ] 26 Subramaniam S, Kelley RK, Venook AP. A review of hepatocellular carcinoma (HCC) staging systems. Chin Clin Oncol 2013; 2: 33 [PMID: DOI: /j.issn ] 27 Botta F, Giannini E, Romagnoli P, Fasoli A, Malfatti F, Chiarbonello B, Testa E, Risso D, Colla G, Testa R. MELD scoring system is useful for predicting prognosis in patients with liver cirrhosis and is correlated with residual liver function: a European study. Gut 2003; 52: [PMID: ] 28 Okuda K, Ohtsuki T, Obata H, Tomimatsu M, Okazaki N, Hasegawa H, Nakajima Y, Ohnishi K. Natural history of hepatocellular carcinoma and prognosis in relation to treatment. Study of 850 patients. Cancer 1985; 56: [PMID: DOI: /s ] 29 Biggins SW, Kim WR, Terrault NA, Saab S, Balan V, Schiano T, Benson J, Therneau T, Kremers W, Wiesner R, Kamath P, Klintmalm G. Evidence-based incorporation of serum sodium concentration into MELD. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 30 Kamath PS, Kim WR; Advanced Liver Disease Study Group. The model for end-stage liver disease (MELD). Hepatology 2007; 45: [PMID: DOI: /hep.21563] 31 Al Sibae MR, Cappell MS. Accuracy of MELD scores in predicting mortality in decompensated cirrhosis from variceal bleeding, hepatorenal syndrome, alcoholic hepatitis, or acute liver failure as well as mortality after non-transplant surgery or TIPS. Dig Dis Sci 2011; 56: [PMID: DOI: / s ] 32 Malinchoc M, Kamath PS, Gordon FD, Peine CJ, Rank J, ter Borg PC. A model to predict poor survival in patients undergoing transjugular intrahepatic portosystemic shunts. Hepatology 2000; 31: [PMID: DOI: /he ] 33 Edge SB, Compton CC. The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol 2010; 17: [PMID: DOI: /s ] 34 Bosman FT, Carneiro F, Hruban RH, Theise ND. WHO Classification of Tumours of the Digestive System. 4th ed. Lyon: IARC Press, International Consensus Group for Hepatocellular Neoplasia. The Pathologic diagnosis of early hepatocellular carcinoma: a report of the international consensus group for hepatocellular neoplasia. Hepatology 2009; 49: [PMID: DOI: 5292 August 7, 2017 Volume 23 Issue 29

51 Dimitroulis D et al. Current evidence for HCC /hep.22709] 36 Yuki K, Hirohashi S, Sakamoto M, Kanai T, Shimosato Y. Growth and spread of hepatocellular carcinoma. A review of 240 consecutive autopsy cases. Cancer 1990; 66: [PMID: ] 37 Goodman ZD, Terraciano LM, Wee A. Tumors and tumorlike lesions of the liver. In: Hubscher SG, Burt AD, Portmann BC, Ferrell LD. MacSween s Pathology of the Liver. 6th ed. Philadelphia, PA: Elsevier; 2012: Chuong JJ, Livstone EM, Barwick KW. The histopathologic and clinical indicators of prognosis in hepatoma. J Clin Gastroenterol 1982; 4: [PMID: ] 39 Paradis V. Histopathology of hepatocellular carcinoma. Recent Results Cancer Res 2013; 190: [PMID: DOI: / _2] 40 Sakamoto M. Pathology of early hepatocellular carcinoma. Hepatol Res 2007; 37 Suppl 2: S135-S138 [PMID: DOI: /j X x] 41 Shafizadeh N, Ferrell LD, Kakar S. Utility and limitations of glypican-3 expression for the diagnosis of hepatocellular carcinoma at both ends of the differentiation spectrum. Mod Pathol 2008; 21: [PMID: DOI: /modpathol ] 42 Wang XY, Degos F, Dubois S, Tessiore S, Allegretta M, Guttmann RD, Jothy S, Belghiti J, Bedossa P, Paradis V. Glypican-3 expression in hepatocellular tumors: diagnostic value for preneoplastic lesions and hepatocellular carcinomas. Hum Pathol 2006; 37: [PMID: DOI: /j.humpath ] 43 Bedossa P, Burt AD, Brunt EM, Callea F, Clouston AD, Dienes HP, Goodman ZD, Gouw AS, Hubscher SG, Roberts EA, Roskams T, Terracciano L, Tiniakos DG, Torbenson MS, Wanless IR. Well-differentiated hepatocellular neoplasm of uncertain malignant potential: proposal for a new diagnostic category. Hum Pathol 2014; 45: [PMID: DOI: / j.humpath ] 44 Brunt EM, Paradis V, Sempoux C, Theise ND. Biphenotypic (hepatobiliary) primary liver carcinomas: the work in progress. Hepat Oncol 2015; 2: [DOI /hep.15.8] 45 Bruix J, Sherman M; Practice Guidelines Committee, American Association for the Study of Liver Diseases. Management of hepatocellular carcinoma. Hepatology 2005; 42: [PMID: DOI: /hep.20933] 46 Kuo KL, Stenehjem D, Albright F, Ray S, Brixner D. Treatment Patterns and Outcomes in Patients With Hepatocellular Carcinoma Stratified by Stage-Guided Treatment Categories. J Natl Compr Canc Netw 2015; 13: [PMID: ] 47 Lee WC, Lee CF, Cheng CH, Wu TJ, Chou HS, Wu TH, Soong RS, Chan KM, Yu MC, Chen MF. Outcomes of liver resection for hepatocellular carcinoma in liver transplantation era. Eur J Surg Oncol 2015; 41: [PMID: DOI: / j.ejso ] 48 Couinaud C. Liver anatomy: portal (and suprahepatic) or biliary segmentation. Dig Surg 1999; 16: [PMID: ] 49 Fan ST, Liu CL. Anterior approach for major right hepatic resection. J Hepatobiliary Pancreat Surg 2005; 12: [PMID: DOI: /s ] 50 Man K, Fan ST, Ng IO, Lo CM, Liu CL, Wong J. Prospective evaluation of Pringle maneuver in hepatectomy for liver tumors by a randomized study. Ann Surg 1997; 226: ; discussion [PMID: ] 51 Belghiti J, Guevara OA, Noun R, Saldinger PF, Kianmanesh R. Liver hanging maneuver: a safe approach to right hepatectomy without liver mobilization. J Am Coll Surg 2001; 193: [PMID: ] 52 Melendez JA, Arslan V, Fischer ME, Wuest D, Jarnagin WR, Fong Y, Blumgart LH. Perioperative outcomes of major hepatic resections under low central venous pressure anesthesia: blood loss, blood transfusion, and the risk of postoperative renal dysfunction. J Am Coll Surg 1998; 187: [PMID: ] 53 Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T. Measurement of liver volume and hepatic functional reserve as a guide to decisionmaking in resectional surgery for hepatic tumors. Hepatology 1997; 26: [PMID: DOI: /jhep v26.pm ] 54 Abulkhir A, Limongelli P, Healey AJ, Damrah O, Tait P, Jackson J, Habib N, Jiao LR. Preoperative portal vein embolization for major liver resection: a meta-analysis. Ann Surg 2008; 247: [PMID: DOI: /SLA.0b013e31815f6e5b] 55 Ogata S, Belghiti J, Farges O, Varma D, Sibert A, Vilgrain V. Sequential arterial and portal vein embolizations before right hepatectomy in patients with cirrhosis and hepatocellular carcinoma. Br J Surg 2006; 93: [PMID: DOI: /bjs.5341] 56 Charnsangavej C, Clary B, Fong Y, Grothey A, Pawlik TM, Choti MA. Selection of patients for resection of hepatic colorectal metastases: expert consensus statement. Ann Surg Oncol 2006; 13: [PMID: DOI: /s y] 57 de Santibañes E, Clavien PA. Playing Play-Doh to prevent postoperative liver failure: the ALPPS approach. Ann Surg 2012; 255: [PMID: DOI: /SLA.0b013e d] 58 Intaraprasong P, Siramolpiwat S, Vilaichone RK. Advances in Management of Hepatocellular Carcinoma. Asian Pac J Cancer Prev 2016; 17: [PMID: ] 59 Yao FY, Bass NM, Nikolai B, Davern TJ, Kerlan R, Wu V, Ascher NL, Roberts JP. Liver transplantation for hepatocellular carcinoma: analysis of survival according to the intention-to-treat principle and dropout from the waiting list. Liver Transpl 2002; 8: [PMID: DOI: /jlts ] 60 Mazzaferro V, Bhoori S, Sposito C, Bongini M, Langer M, Miceli R, Mariani L. Milan criteria in liver transplantation for hepatocellular carcinoma: an evidence-based analysis of 15 years of experience. Liver Transpl 2011; 17 Suppl 2: S44-S57 [PMID: DOI: /lt.22365] 61 Bhoori S, Mazzaferro V. Current challenges in liver transplantation for hepatocellular carcinoma. Best Pract Res Clin Gastroenterol 2014; 28: [PMID: DOI: /j.bpg ] 62 Poulou LS, Botsa E, Thanou I, Ziakas PD, Thanos L. Percutaneous microwave ablation vs radiofrequency ablation in the treatment of hepatocellular carcinoma. World J Hepatol 2015; 7: [PMID: DOI: /wjh.v7.i8.1054] 63 Livraghi T, Meloni F. Treatment of hepatocellular carcinoma by percutaneous interventional methods. Hepatogastroenterology 2002; 49: [PMID: ] 64 Livraghi T, Bolondi L, Lazzaroni S, Marin G, Morabito A, Rapaccini GL, Salmi A, Torzilli G. Percutaneous ethanol injection in the treatment of hepatocellular carcinoma in cirrhosis. A study on 207 patients. Cancer 1992; 69: [PMID: ] 65 Ohmoto K, Yoshioka N, Tomiyama Y, Shibata N, Kawase T, Yoshida K, Kuboki M, Yamamoto S. Comparison of therapeutic effects between radiofrequency ablation and percutaneous microwave coagulation therapy for small hepatocellular carcinomas. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 66 Livraghi T, Meloni F, Di Stasi M, Rolle E, Solbiati L, Tinelli C, Rossi S. Sustained complete response and complications rates after radiofrequency ablation of very early hepatocellular carcinoma in cirrhosis: Is resection still the treatment of choice? Hepatology 2008; 47: [PMID: DOI: /hep.21933] 67 European Association For The Study Of The Liver.; European Organisation For Research And Treatment Of Cancer. EASL- EORTC clinical practice guidelines: management of hepatocellular carcinoma. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 68 Facciorusso A, Di Maso M, Muscatiello N. Microwave ablation versus radiofrequency ablation for the treatment of hepatocellular carcinoma: A systematic review and meta-analysis. Int J Hyperthermia 2016; 32: [PMID: DOI: / ] 69 Lencioni R, de Baere T, Burrel M, Caridi JG, Lammer J, Malagari K, Martin RC, O Grady E, Real MI, Vogl TJ, Watkinson A, 5293 August 7, 2017 Volume 23 Issue 29

52 Dimitroulis D et al. Current evidence for HCC Geschwind JF. Transcatheter treatment of hepatocellular carcinoma with Doxorubicin-loaded DC Bead (DEBDOX): technical recommendations. Cardiovasc Intervent Radiol 2012; 35: [PMID: DOI: /s ] 70 Kuei A, Saab S, Cho SK, Kee ST, Lee EW. Effects of Yttrium-90 selective internal radiation therapy on non-conventional liver tumors. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 71 Tsai CL, Hsu FM, Cheng JC. How to Improve Therapeutic Ratio in Radiotherapy of HCC. Liver Cancer 2016; 5: [PMID: DOI: / ] 72 Kim DW, Talati C, Kim R. Hepatocellular carcinoma (HCC): beyond sorafenib-chemotherapy. J Gastrointest Oncol 2017; 8: [DOI: /jgo ] 73 Chlebowski RT, Brzechwa-Adjukiewicz A, Cowden A, Block JB, Tong M, Chan KK. Doxorubicin (75 mg/m2) for hepatocellular carcinoma: clinical and pharmacokinetic results. Cancer Treat Rep 1984; 68: [PMID: ] 74 Matsumoto K, Nagahara T, Okano J, Murawaki Y. The growth inhibition of hepatocellular and cholangiocellular carcinoma cells by gemcitabine and the roles of extracellular signal-regulated and checkpoint kinases. Oncol Rep 2008; 20: [PMID: ] 75 Abou-Alfa GK, Schwartz L, Ricci S, Amadori D, Santoro A, Figer A, De Greve J, Douillard JY, Lathia C, Schwartz B, Taylor I, Moscovici M, Saltz LB. Phase II study of sorafenib in patients with advanced hepatocellular carcinoma. J Clin Oncol 2006; 24: [PMID: DOI: /JCO ] 76 Abou-Alfa GK, Amadori D, Santoro A, Figer A, De Greve J, Lathia C, Voliotis D, Anderson S, Moscovici M, Ricci S. Is sorafenib (S) safe and effective in patients (pts) with hepatocellular carcinoma (HCC) and Child-Pugh B (CPB) cirrhosis? J Clin Oncol 2008; 26: 4518 [DOI: /jco _suppl.4518] 77 Abou-Alfa GK, Johnson P, Knox J, Davidenko I, Lacava J, Leung T, Mori A, Le Berre M, Voliotis D, Saltz L. Final results from a phase II (PhII), randomized, double-blind study of sorafenib plus doxorubicin (S D) versus placebo plus doxorubicin (P D) in patients (pts) with advanced hepatocellular carcinoma (AHCC). Presented at the Gastrointestinal Cancers Symposium; Orlando, Florida; Minami Y, Kudo M. Therapeutic response assessment of transcatheter arterial chemoembolization for hepatocellular carcinoma: ultrasonography, CT and MR imaging. Oncology 2013; 84 Suppl 1: [PMID: DOI: / ] 79 Therasse P, Arbuck SG, Eisenhauer EA, Wanders J, Kaplan RS, Rubinstein L, Verweij J, Van Glabbeke M, van Oosterom AT, Christian MC, Gwyther SG. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 2000; 92: [PMID: DOI: / jnci/ ] 80 Nishino M, Jackman DM, Hatabu H, Yeap BY, Cioffredi LA, Yap JT, Jänne PA, Johnson BE, Van den Abbeele AD. New Response Evaluation Criteria in Solid Tumors (RECIST) guidelines for advanced non-small cell lung cancer: comparison with original RECIST and impact on assessment of tumor response to targeted therapy. AJR Am J Roentgenol 2010; 195: W221-W228 [PMID: DOI: /AJR ] 81 Lencioni R, Llovet JM. Modified RECIST (mrecist) assessment for hepatocellular carcinoma. Semin Liver Dis 2010; 30: [PMID: DOI: /s ] 82 Llovet JM, Di Bisceglie AM, Bruix J, Kramer BS, Lencioni R, Zhu AX, Sherman M, Schwartz M, Lotze M, Talwalkar J, Gores GJ; Panel of Experts in HCC-Design Clinical Trials. Design and endpoints of clinical trials in hepatocellular carcinoma. J Natl Cancer Inst 2008; 100: [PMID: DOI: / jnci/djn134] P- Reviewer: Tomizawa M, Wong GLH S- Editor: Qi Y L- Editor: A E- Editor: Li D 5294 August 7, 2017 Volume 23 Issue 29

53 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Basic Study ORIGINAL ARTICLE Partial external biliary diversion in bile salt export pump deficiency: Association between outcome and mutation Philipp Ellinger, Jan Stindt, Carola Dröge, Katharina Sattler, Claudia Stross, Stefanie Kluge, Diran Herebian, Sander HJ Smits, Martin Burdelski, Sebastian Schulz-Jürgensen, Antje Ballauff, Jan Schulte am Esch, Ertan Mayatepek, Dieter Häussinger, Ralf Kubitz, Lutz Schmitt Philipp Ellinger, Jan Stindt, Sander HJ Smits, Lutz Schmitt, Institute of Biochemistry, Heinrich-Heine-University Düsseldorf, Düsseldorf, Germany Jan Stindt, Carola Dröge, Katharina Sattler, Claudia Stross, Stefanie Kluge, Dieter Häussinger, Ralf Kubitz, Medical Faculty, Department of Gastroenterology, Hepatology and Infectious Diseases, Heinrich-Heine-University Düsseldorf, Düsseldorf, Germany Diran Herebian, Ertan Mayatepek, Department of General Pediatrics, Neonatology and Pediatric Cardiology, Medical Faculty, Heinrich-Heine-University Düsseldorf, Düsseldorf, Germany Martin Burdelski, Sebastian Schulz-Jürgensen, Department of Paediatrics, University Hospital Schleswig Holstein, Kiel, Germany Antje Ballauff, Department of Paediatrics, Helios Clinic, Krefeld, Germany Jan Schulte am Esch, Department of General Surgery, Heinrich-Heine-University, Düsseldorf, Germany Author contributions: Ellinger P and Stindt J contributed equally to this work; Ellinger P, Stindt J, Dröge C, Sattler K, Stross C and Kluge S performed the experiments; Herebian D and Mayatepek E carried out bile salt analysis; Burdelski M, Schulz-Jürgensen S, Ballauff A, Kubitz R and Häussinger D treated the patients; Schulte am Esch J collected human bile samples; Ellinger P, Stindt J, Kubitz R and Schmitt L designed experiments; Smits SHJ, Kubitz R and Schmitt L wrote the paper; all authors contributed to the final manuscript. Supported by the German Research Foundation through the Clinical Research Group KFO217 Hepatobiliary transport and liver diseases ; and the Collaborative Research Centre 974 Communication and Systemic Relevance in Liver Damage and Regeneration. Institutional review board statement: The study was reviewed and approved by the Institutional Review board, the Ethikkommission an der Medizinischen Fakultät der Heinrich- Heine-Universität Düsseldorf (Study number 2875). Conflict-of-interest statement: The authors declare no conflict of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Dr. Lutz Schmitt, Professor, Institute of Biochemistry, Heinrich-Heine-University Düsseldorf, Universitätsstr. 1, Düsseldorf, Germany. lutz.schmitt@hhu.de Telephone: Received: January 1, 2017 Peer-review started: January 5, 2017 First decision: January 19, 2017 Revised: May 10, 2017 Accepted: June 9, 2017 Article in press: June 12, 2017 Published online: August 7, 2017 Abstract AIM To investigate the relation of two different mutations to the outcome of partial external biliary diversion (PEBD) 5295 August 7, 2017 Volume 23 Issue 29

54 Ellinger P et al. Outcome of PEBD in PFIC-2 in severe bile salt export pump (BSEP) deficiency. METHODS Mutations in the gene encoding BSEP leading to severe BSEP deficiency in two unrelated patients were identified by genomic sequencing. Native liver biopsies and transiently transfected human embryonic kidney (HEK) 293 cells expressing either wild-type or mutated BSEP were subjected to immunofluorescence analysis to assess BSEP transporter localization. Bile acid profiles of patient and control bile samples were generated by ultra-performance liquid chromatographytandem mass spectrometry. Wild-type and mutant BSEP transport of [ 3 H]-labeled taurocholate (TC) and taurochenodeoxycholate (TCDC) was assessed by vesicular transport assays. RESULTS A girl (at 2 mo) presented with pruritus, jaundice and elevated serum bile salts (BS). PEBD stabilized liver function and prevented liver transplantation. She was heterozygous for the BSEP deletion p.t919del and the nonsense mutation p.r1235x. At the age of 17 years relative amounts of conjugated BS in her bile were normal, while total BS were less than 3% as compared to controls. An unrelated boy (age 1.5 years) presenting with severe pruritus and elevated serum BS was heterozygous for the same nonsense and another missense mutation, p.g1032r. PEBD failed to alleviate pruritus, eventually necessitating liver transplantation. BS concentration in bile was about 5% of controls. BS were mainly unconjugated with an unusual low amount of chenodeoxycholate derivatives (< 5%). The patients native liver biopsies showed canalicular BSEP expression. Both BSEP p.t919del and p.g1032r were localized in the plasma membrane in HEK293 cells. In vitro transport assays showed drastic reduction of transport by both mutations. Using purified recombinant BSEP as quantifiable reference, per-molecule transport rates for TC and TCDC were determined to be 3 and 2 BS molecules per wild-type BSEP transporter per minute, respectively. CONCLUSION In summary, our findings suggest that residual function of BSEP as well as substrate specificity influence the therapeutic effectiveness of PEBD in progressive familial intrahepatic cholestasis type 2 (PFIC-2). Key words: Familial intrahepatic cholestasis type 2; Partial external biliary diversion; Bile salt export pump; ATP binding cassette transporter; Intrahepatic cholestasis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: PFIC-2, a severe form of BSEP deficiency, is caused by mutations of the bile salt export pump (BSEP), an ATP binding cassette transporter exclusively expressed in hepatocytes. In this study we determine the functional impact of two distinct BSEP mutations on transporter localization and function in two unrelated PFIC-2 patients showing a drastically different response to partial external biliary diversion (PEBD). Our data demonstrate that residual bile salt transport by BSEP is likely required for a beneficial outcome of PEBD. Ellinger P, Stindt J, Dröge C, Sattler K, Stross C, Kluge S, Herebian D, Smits SHJ, Burdelski M, Schulz-Jürgensen S, Ballauff A, Schulte am Esch J, Mayatepek E, Häussinger D, Kubitz R, Schmitt L. Partial external biliary diversion in bile salt export pump deficiency: Association between outcome and mutation. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5295.htm DOI: i INTRODUCTION Chronic cholestasis is a major cause of severe liver disease in young children. Apart from biliary atresia, four types of progressive familial intrahepatic cholestasis (PFIC) are currently diagnosed. While PFIC-4 is caused by leaky bile canalicular tight junctions due to mutations in the TJP2 gene [1], PFIC-1 to -3 are caused by inherited defects in transporter proteins residing in the canalicular membrane of hepatocytes. Mutations in the ATP8B1 gene encoding a phosphatidylserine flippase (FIC1) cause PFIC-1 [2,3]. PFIC-2 is linked to mutations in ABCB11 encoding the bile salt export pump (BSEP) [4]. BSEP is an ATP binding cassette transporter and transports conjugated bile salts (BS), with highest transport capacity for tauro-/glycochenodeoxycholic acid (TCDC/GCDC) and taurocholic acid (TC) [5]. Defects in canalicular BSEP functionality cause severe liver disease by compromising BS excretion into bile, while intracellular and serum BS concentrations rise to toxic levels. Milder forms of BSEP disease have been denoted as benign recurrent intrahepatic cholestasis (BRIC). BRIC is characterised by self-limiting cholestatic episodes with pruritus. BRIC-associated mutations are in general less severe as compared to PFIC-related mutations, which more often affect transmembrane helices [6] and which include nonsense and frame-shift mutations [7]. PFIC-3 is caused by mutations of the multidrug resistance protein 3 (MDR3) encoded by the ABCB4 gene [8-10]. MDR3 transports phosphatidylcholine-type lipids from the inner to the outer canalicular membrane leaflet, from where they are likely extracted by BS to form mixed micelles with cholesterol [11]. The flip of phosphatidylserine from the outer to the inner leaflet by the ATP8B1 gene product compensates this membrane destabilization [12]. In PFIC-1 and PFIC-2 γ-glutamyltransferase (GT) levels are normal, which are attributed to low concentrations of free toxic 5296 August 7, 2017 Volume 23 Issue 29

55 Ellinger P et al. Outcome of PEBD in PFIC-2 BS in bile of these patients [13], whereas PFIC-3 is characterized by elevated serum γgt. Many PFIC patients receive ursodeoxycholic acid (UDCA) as a first-line treatment. UDCA stimulates BSEP expression, inhibits BS synthesis and stimulates BS clearance via urine [14]. When symptoms do not improve sufficiently, partial external biliary diversion (PEBD) may be considered as a surgical intervention to reduce the toxic bile salt pool in PFIC-1 and -2 [15]. The continuous removal of bile may alleviate the otherwise intractable pruritus associated with PFIC, improving quality of life as well as prolonging transplant-free survival [15]. While many PFIC-1 and -2 patients improve upon PEBD, some fail to benefit from the procedure. The reasons for the different therapeutic responses are not well understood. We investigated the functional properties of two BSEP missense mutations causing PFIC-2 in two unrelated children that responded fundamentally different to UDCA and PEBD treatment. MATERIALS AND METHODS Bile sample collection and analysis The study was performed according to the guidelines of the declaration of Helsinki and informed written consent was obtained from patients or their parents. Bile samples from both patients were collected by external drainage. Bile samples from six noncholestatic patients were collected intraoperatively. These patients were operated for oncological reasons and bile was collected from the common bile duct before routine gallbladder removal. Six bile samples from the common bile ducts were collected from patients with obstructive cholestasis (2 PSC, 2 choledocholithiasis, 1 benign and 1 malignant bile duct obstruction) during endoscopic retrograde cholangiography (ERC). Solid phase extraction of bile acids and analysis of BS profiles by liquid chromatography-tandem mass spectrometry (LC-MS/MS) was performed as described previously [6]. Sequencing of ABCB11 (BSEP, NM_ ), ATP8B1 (FIC1, AF038007) and ABCB4 (MDR3, NM_ ) was performed using genomic DNA extracted from EDTA blood and standard sequencing as described recently [16,17]. Exons containing the start codon were defined as the exon one and the adenine of the start codon was counted as one. Immunofluorescence staining of liver biopsies and transfected HEK293 cells was performed as described [17,18]. Liver biopsies were stained using the K24 antiserum for BSEP [19], P3Ⅱ-26 for MDR3 and a mix of antibodies M2I-4 and M2Ⅲ-6 for MRP2 (Enzo Life Sciences). Methanol-fixed HEK293 cells were stained using the BSEP antibody F-6 (Santa Cruz Biotechnology) and the Na + /K + -ATPase antibody M7- PB-E9 (Sigma Aldrich). Appropriate fluorophorelabelled secondary antibodies were used. Cloning of BSEP and mutagenesis for expression in HEK293 cells For expression of human BSEP, a tag-less version of plasmid peyfp-n1-orileu-bsep [6] was generated resulting in a BSEP reading frame without any artificial tags or cloning artifacts as determined by gene sequencing. Deletion of the EYFP-tag and introduction of the p.t919del and p.g1032r mutations were performed using the DREAM method [20]. For immunofluorescence studies, HEK293 cells seeded onto coverslips were transfected at sub-confluence with 2 μg of plasmids using polyethyleneimine (MW 25 kda; Sigma Aldrich). For isolation of plasma membrane vesicles, cells were transfected at a confluence of 30%-40% with 30 μg of each plasmid per 15-cm diameter cell culture dish and cultured for 48 h. Isolation of human embryonic kidney 293 plasma membrane vesicles Transfected cells were collected, re-suspended in ice-cold hypotonic buffer (10 mmol/l Tris-HCl ph 8.0, 10 mmol/l KCl, 5 mmol/l EDTA) containing protease inhibitor cocktail (Roche) and incubated for 30 min at 4 on a rotator. All subsequent steps were carried out at 4. Cells were disrupted with ten strokes using a tight-fitting Potter-Elvehjem homogenizer. Cellular debris was spun down for 10 min at 400 g and the supernatant was further centrifuged at 1000 g for 10 min. The resulting supernatant was centrifuged at g in a Ti70 rotor (Beckman). The membrane pellet was re-suspended in 50 mmol/l Hepes-Tris, ph 7.4, 100 mmol/l KNO3, 50 mmol/l sucrose, snapfrozen in liquid nitrogen and stored at -80 until further use. Quantification of BSEP in plasma membrane vesicles Human BSEP was expressed in Pichia pastoris and purified as described in Ellinger et al [21]. Protein concentrations were determined using the Coomassie Plus Assay (Thermo Scientific). A specified amount of purified BSEP was loaded onto a 7% SDS-PAGE gel together with 20 μg of each plasma membrane vesicle preparation. Samples were incubated in 3% SDS for 30 min at 37, supplemented with 1/4 volume of 5 reducing Laemmli sample buffer and further incubated for 10 min at 65. SDS-PAGE and Western blotting was performed as described [21]. BSEP was detected by the F-6 antibody and a goat anti-mouse- HRP secondary antibody (Jackson ImmunoResearch), using the Western lightning plus ECL Kit (Perkin Elmer). Images were acquired using the Chemigenius 2 detection system (Syngene) according to the manufacturer s guidelines. The time of exposition was adjusted to prevent signal saturation. Signals were subsequently quantified with the GeneTools analysis software (V.3.06; Syngene) by comparing bands corresponding to known amounts of purified BSEP with bands in the lanes containing vesicle preparations. Vesicular transport studies were essentially 5297 August 7, 2017 Volume 23 Issue 29

56 Ellinger P et al. Outcome of PEBD in PFIC-2 performed as described in Herédi-Szabó et al [22]. Reactions were set up to contain equal BSEP amounts in a final reaction volume of 70 μl and included either 2 μmol/l [ 3 H]-TC or [ 3 H]-TCDC. Transport was started by addition of ATP or transport buffer as background control. Reactions were incubated at 37 for 5 min or 30 min and stopped with ice-cold washing buffer followed by rapid filtration through 0.22 μm mixed cellulose membrane filters (type GSTF; Millipore). Filters were air-dried and suspended in Ultima Gold TM scintillation liquid in polypropylene vials (Perkin Elmer) for liquid scintillation counting. BSEP-dependent transport was calculated by subtracting the amount of radioactivity in BSEP-containing vesicles obtained in the presence of ATP/Mg 2+ from that obtained in the absence of ATP. RESULTS Two unrelated PFIC-2 patients with different responses to UDCA treatment and PEBD A two-months-old girl presented with non-obstructive cholestasis und severe pruritus. γgt levels were normal, while serum BS were strongly elevated (150 μmol/l). A liver biopsy at the age of 1 year showed no signs of inflammation but some fibrotic thickening of the portal tracts together with intraand intercellular cholestasis. Therefore PFIC was suspected and at the age of five PEBD was initiated to avert further cholestatic liver damage. Serum BS decreased and symptoms completely resolved. At the age of 17 years, a moderate deterioration of liver function was observed. Fibroscan was 14.1 kpa reflecting fibrosis [23] or cholestasis [24]. A liver biopsy (for immunostaining), a DNA sample and diverted bile were taken and analysed. Because a low-γgt PFIC was suspected, sequencing of ATP8B1 (FIC1) and ABCB11 (BSEP) was performed. While ATP8B1 only showed two heterozygous intronic variants, sequencing of ABCB11 revealed a heterozygous nonsense mutation (c.3703c>t; p.r1235x) and a heterozygous triplet deletion (c.2756_2758delcca), causing loss of a single threonine at amino acid position 919 (p.t919del). Genetic analysis of the healthy parents indicated paternal inheritance of the nonsense mutation and maternal inheritance of the deletion. The patient continued to be symptom-free under PEBD without the need for liver transplantation in the continuous presence of UDCA treatment. An unrelated boy of 18 mo presented with nonobstructive cholestasis and severe pruritus and total serum BS were increased (371 μmol/l). PFIC was suspected, however, UDCA treatment did not alleviate pruritus. PEBD was performed at two years and seven months of age, which led to a drop of serum bile salts from 412 μmol/l (the day before PEBD) to 207 μmol/l (5 d post-op), 70 μmol/l (7 mo after PEBD) and 93 μmol/l (1 year after PEBD). Symptoms only improved transiently. A biopsy taken during the PEBD showed no signs of fibrosis. Sequencing of ATP8B1 (FIC1) showed the common heterozygous variant p.r952q and the common homozygous variant p.n168n was found in the ABCB4 gene. ABCB11 sequencing, however, uncovered the same heterozygous nonsense mutation (c.3703c>t; p.r1235x) as found in the first patient along with a heterozygous missense mutation (c.3094g>c) leading to an amino acid change from glycine to arginine at position 1032 (p.g1032r). Genetic testing of both healthy parents showed paternal inheritance of the nonsense and maternal inheritance of the missense mutation. At the age of four, this patient had to be transplanted due to his intractable pruritus despite PEBD. Histology of the explant confirmed absence of cirrhosis. Bile salt analysis of serum and bile confirm defects in bile salt transport Total BS concentration in bile of the female patient (p.t919del) was 1531 μmol/l (including 931 μmol/l of UDCA derivatives), which is only 2.5% of total biliary BS in non-cholestatic patients (Table 1 and Figure 1). As in controls and in patients with obstructive cholestasis, we found almost no unconjugated BS in her bile. Notably, the ratio between taurine- and glycineconjugated bile acids in the patient s bile was very similar to the ratio in controls (Figure 1A). Likewise, the fraction of CDCA derivatives was comparable to that in controls. The fraction of cholic acid (CA) derivatives was higher in the patient than in controls. This can be attributed to partial disruption of the enterohepatic circulation by PEBD. In healthy individuals, CA and its derivatives are dehydroxylated in the intestine by bacteria to deoxycholic acid (DCA), which is reabsorbed. Indeed, the combined relative amount of DCA and CA derivatives in controls is of the same magnitude as that of CA in the patient. Total serum BS concentration was 150 μmol/l (normal: < 8 μmol/l) including UDCA-derivatives, while relative amounts of single BS species were similar to values in controls. As in bile, DCA and derivatives were absent in the patient s serum. Taken together, the findings suggest a severe reduction markedly reduced canalicular BSEP function in the presence of the p.t919del mutation despite UDCA treatment, which is known to stabilize BSEP and enhance its expression [14]. Bile of the male patient (p.g1032r) showed a total BS amount of 3451 μmol/l (about 5% of controls; Table 1 and Figure 1). Surprisingly, 68% of these were unconjugated bile acids (Figure 1B). Furthermore, there were no conjugates of CDCA and only a minor proportion was unconjugated CDCA. CA and its conjugates amounted to more than 95% of bile acids in the patient s bile. The absence of CDCA and its conjugates was not caused by defects in conjugation, because tauro- as well as glyco-cdca was present in elevated amounts with a normal ratio of CDCA derivatives in the serum of the patient (Table 1). While the absolute amount of CA derivatives was 22% of 5298 August 7, 2017 Volume 23 Issue 29

57 Ellinger P et al. Outcome of PEBD in PFIC-2 Table 1 Concentrations of bile acids in serum and bile Serum T919del G1032R Controls (n = 33) T919del G1032R Controls (n = 6) Cholestasis (n = 6) CA 0.15 ± ± 9 88 ± 72 Tauro-CA ± ± ± 405 Glyco-CA ± ± ± 662 CDCA 0.13 ± ± 48 Tauro-CDCA ± ± ± 396 Glyco-CDCA ± ± ± 811 DCA 0.25 ± ± 19 Tauro-DCA 0.11 ± ± ± 328 Glyco-DCA 0.24 ± ± ± 674 UDCA ± Tauro-UDCA ± ± 591 Glyco-UDCA ± ± ± 1877 total ± ± ± 4447 % CDCAderivatives ± ± 8 44 ± 5 bile/serum (μmol/l/μmol/l) ca Bile Bile salt derivatives in bile of the female patient (p.t919del) and the male patient (p.g1032r), in six non-cholestatic patients and in six patients with obstructive cholestasis of different causes. Serum control values are from 33 non-cholestatic patients. Values are given in μmol/l. CA: Cholic acid; UDCA: Ursodeoxycholic acid. A B Type of conjugation of BA-derivatives (%) Distribution of BA-derivatives (%) 100% 100% 80% 80% 60% 60% 40% 40% 20% 20% 0% unconj. Taurine Glycine 0% CA CDCA DCA Figure 1 Bile acid derivatives in bile samples of the two patients. Concentrations of different bile acid derivatives were measured in bile samples of two patients possessing the bile salt export pump (BSEP)-T919del and BSEP-G1032R mutation, respectively, as well as in six non-cholestatic and in six cholestatic control samples (Table 1). A: Relative amounts of unconjugated, taurine- or glycine-conjugated bile acids are shown. In the background of the BSEP-G1032R mutation a very high amount ( > 60%) of unconjugated bile salts is found; B: Relative amounts of cholic, chenodeoxycholic and deoxycholic acid (CA, CDCA, DCA) including their corresponding conjugates are shown. In the background of the BSEP-G1032R less than 5% of bile acids are chenodeoxycholic acid and its conjugates (UDCA and conjugates were omitted from these plots). CA: Cholic acid; DCA: Deoxycholic acid; CDCA: Chenodeoxycholic acid. controls, the total amount of CDCA and its derivatives was only 0.4% of controls. These data strongly suggest that the p.g1032r mutation also reduces canalicular BSEP function. The observed shift from CDCA to CA derivatives may be caused by an altered substrate specificity of BSEP, when the mutation p.g1032r is present. The predominance of unconjugated BS may be due to bacterial contamination of the biliary tract after PEBD and subsequent de-conjugation by bacterial enzymes, although the patient had no signs of bacterial cholangitis. BSEP-T919del and BSEP-G1032R are correctly localized in vivo and and in vitro Immunofluorescent staining showed normal canalicular expression of MDR3 and MRP2 (bilirubin transporter) in liver biopsies of both patients (Figure 2A). Since BSEP-R1235X lacks the C-terminal 87 amino acid residues containing essential motifs of the second nucleotide binding domain (Walker B, D-and H-loop), this premature stop results in a truncated, non-functional transporter. Using the K24 antiserum raised against the C-terminus of BSEP [19], only the full-length variants carrying the missense mutation or deletion alleles are detected. Both BSEP-T919del and BSEP-G1032R showed normal, canalicular localization. To further confirm this, both mutations were introduced into a mammalian BSEP expression plasmid and transiently transfected into HEK293 cells. Both BSEP-T919del and BSEP-G1032R showed a regular plasma membrane localization comparable to wild-type BSEP (Figure 2B). Bile salt transport by BSEP-T919del and BSEP-G1032R is impaired in vitro Plasma membrane vesicles containing wild-type BSEP, BSEP-T919del or BSEP-G1032R were prepared 5299 August 7, 2017 Volume 23 Issue 29

58 Ellinger P et al. Outcome of PEBD in PFIC-2 A Ⅰ T919del B WT T919del G1032R BSEP MRP2 Merge BSEP BSEP BSEP Ⅱ T919del MRP2 MDR3 Merge Na/K-ATPase Na/K-ATPase Na/K-ATPase Ⅲ G1032R Merge Merge Merge BSEP MDR3 Merge Ⅳ G1032R MRP2 BSEP Merge Figure 2 Immunofluorescence studies. A: Liver biopsy from the female patient possessing the BSEP-T919del mutation. (Ⅰ) Immunoreactivity of BSEP (K24-antibody) was apparently normal as compared to the bilirubin transporter multidrug resistance- associated protein 2 (MRP2; M2I-4- and M2III-6-antibodies). (Ⅱ) Immunoreactivity of MDR3 (P3Ⅱ-26-antibody) showed a typical canalicular pattern similar to MRP2 (EAG5-antibody). Liver biopsy from the male patient (p.g1032r mutation) shows an almost regular BSEP expression (K24-antibody) and MDR3 (Ⅲ) and MRP2 (Ⅳ); B: Wild-type BSEP is largely expressed at the cell membrane of human embryonic kidney (HEK293) cells. Likewise, both BSEP mutants, with deletion of threonine at position 919 (p.t919del) and with arginine instead of glycine at amino acid position 1032 (p.g1032r), are localized at the plasma membrane (Bars = 5 μm). BSEP: Bile salt export pump. from transiently transfected HEK293 cells. In order to determine a transport rate per BSEP rather than per total protein, we purified recombinant human BSEP from the yeast Pichia pastoris as described in detail in Ellinger et al [21]. Protein purity, as isolated by a two-step purification procedure, was more than 90% (Figure 3A, left panel). Using purified BSEP as quantitative standard, we quantified BSEP amounts in vesicle preparations by immunoblotting (Figure 3A, right panel for an example). Vesicular transport assays (Figure 3B) using equal amounts of each BSEP variant showed a strong reduction of TC and TCDC transport by BSEP-T919del and an even more pronounced reduction in transport for BSEP-G1032R. Notably, the amount of transported TC and TCDC increased from 5 min to 30 min for BSEP-T919del. In contrast, no increase of TC or TCDC accumulation over time was observed for BSEP-G1032R within experimental error. DISCUSSION Both patients reported here suffered from severe cholestasis due to deficient canalicular transport of BS. It has been shown in earlier studies that absence of BSEP from the canalicular membrane is a diagnostic feature of PFIC-2/BSEP-disease [18,25,26], which is found in up to 72% of affected patients [25]. Reduced or absent canalicular BSEP expression can for example be caused by splicing defects [7,27,28], premature stop codons or by impaired targeting to the canalicular membrane [5,16]. In our patients canalicular BSEP expression was well detectable in liver biopsies and targeting was apparently normal as shown by transient expression of mutated BSEP in HEK293 cells (Figure 2). Instead, the transporter function itself is compromised. While BSEP-T919del showed a residual transport of both BS species (22% and 34% transport of TC and TCDC as compared to wild-type BSEP), the p.g1032r mutation essentially abolished transport of the conjugated bile salts TC and TCDC in vitro. Taking into account that the decrease of the bile-to-serum ratio for BS is less pronounced in the presence of BSEP- G1032R than of BSEP-T919del, it must be assumed that decreased transport capacity of BSEP-G1032R is at least partially compensated by a higher expression level. Nevertheless, the outcome after PEBD-treatment is worse in the boy carrying the p.g1032r mutation, which is otherwise a well-established therapy in severe BSEP-disease [29,30]. Interestingly, determination of BS species in the bile samples of the two patients showed a marked shift in the composition of single bile salts in the boy s sample. Notably, there are less than 5% of 5300 August 7, 2017 Volume 23 Issue 29

59 Ellinger P et al. Outcome of PEBD in PFIC-2 A B TC 5 min 30 min TCDC min 30 min kda Purified BSEP kda 250 Purified BSEP Ctrl WT T919del G1032R Pmol/mg BSEP Pmol/mg BSEP BSEP WT BSEP T919 BSEP G1032R BSEP WT BSEP T919 BSEP G1032R BSEP WT BSEP T919 BSEP G1032R BSEP WT BSEP T919 BSEP G1032R C 90 G1032 T919 G1032 T919 Figure 3 In vitro transport assay of wild-type bile salt export pump, BSEP-T919del and BSEP-G1032R. A: Left, Coomassie brilliant blue (CBB) stained SDS- PAGE gel of purified Bile Salt Export Pump (BSEP) expressed in Pichia pastoris. 9 μg protein was loaded on the lane. Right, Western blot of purified BSEP and membrane preparations of BSEP-T919del, BSEP-G1032R, BSEP wild-type (WT) and empty control (Ctrl) ng of purified BSEP or 15 μl of the membrane preparations were subjected to SDS-PAGE. After detection with the monoclonal antibody, the gel was analyzed densitometrically to calculate the amount of wild-type or mutant BSEP or in the membrane preparations (relative densitometric values below panel); B: [ 3 H]-taurocholate (TC) and [ 3 H]-taurochenodeoxycholate (TCDC) transport by wild-type BSEP, BSEP-T919del, and BSEP-G1032R after 5 (black bars) and 30min (white bars). Experimental details are provided in Materials and Methods. The amount of translocated TC (left) or TCDC (right) per mg of BSEP was determined based on the quantification of wild-type BSEP, BSEP-T919del and BSEP-G1032R in the membrane vesicle preparations. All measurements represent the average with standard deviation of triplicate measurements; C: The homology model of BSEP was generated based on the outward-facing crystal structure of the multidrug transporter Sav18662 from S. aureus (pdb entry: 2HYD). The putative localisation of T919 at the outer surface of the transporter molecule and of G1032 close to the potential translocation pore of BSEP is highlighted by red spheres. Pmol/mg BSEP. BSEP: Bile salt export pump. conjugated bile salts and CA outbalances CDCA. The latter finding is in contrast with the known substrate specificity of human BSEP [5], indicating a significant shift in specificity of the mutated transporter. The presence of unconjugated BS may theoretically be due to de-conjugation within the biliary tract, although clinically there was no evidence of cholangitis or bacterial contamination of bile ducts and gallbladder. The lack of CDCA and its conjugates is not due to a defect in BS synthesis, since CDCA species were found in the serum in a normal distribution. Bile analysis of the BSEP-G1032R affected patient revealed that more unconjugated than conjugated cholate is transported into bile. Considering that the intracellular amount of unconjugated cholate in general is much lower than that of taurine- or glycine-conjugated cholate, it must be assumed that unconjugated cholate is transported much better than conjugated cholate by BSEP-G1032R. This may explain why in our transport assay TC and TCDC transport was almost absent, although the bile-to-serum ratio of all bile acids was approximately 50. Unfortunately, [ 3 H]-labelled unconjugated cholate was not available for use in our assay to test our hypothesis. Using purified BSEP as a quantitative reference, the amount of wild-type BSEP and both mutations could be determined (Figure 3B). Thus it was possible to obtain a per-molecule transport rate for human BSEP. Assuming that all BSEP molecules within the membrane vesicles are in an uptake-competent orientation (NBD facing the exterior) and generally transport-active, the number of BS molecules transported per BSEP unit per minute is 3 for TCDC and 2 for TC, respectively, under the conditions of the assay (5 min duration). These two values clearly represent the lowest possible estimate for TC and TCDC transport. Calibration of 5301 August 7, 2017 Volume 23 Issue 29

60 Ellinger P et al. Outcome of PEBD in PFIC-2 the Western blot signal likely results in values, which are too high since our BSEP preparation displayed homogeneity of approximately 90%. Additionally, not all BSEP-containing vesicles adopt the insideout orientation (i.e., NBDs facing the exterior) during preparation. Under the experimental conditions, BS transport appears to be rather slow. However, it should be noted that the plasma membrane environment of HEK293 cells is not identical to the apical membrane of hepatocytes, lacking its unique membrane asymmetry and structure and that one cannot ensure that the linear rate of transport is still maintained. Nevertheless, this is, to the best of our knowledge, the first time that a per-transporter translocation rate of TC and TCDC has been established for human BSEP. To obtain molecular insights into a structure-function relation of these two mutations, we employed a homology model of BSEP (Figure 3C), which is based on the outward-facing crystal structure of Sav18662 [31]. Based on this model, T919 is located at the membraneexposed side of the transporter, while G1032 lines up the putative translocation pore of BSEP. A deletion of threonine at position 919 would result in a shift within the corresponding helix, which obviously interferes with the function of BSEP. Replacement of a small glycine residue at position 1032 against a bulky and charged arginine residue within the pore of the transporter might either sterically block substrate translocation or prevent the switch from inwardto outward-facing conformation, because the large side chain would reduce the flexibility of this region. This conformational switch is absolutely required for transport. In addition, the critical localization of this amino acid might well explain a shift in transporter specificity. In PFIC-2 patients who do not respond to PEBD sufficiently, low residual transporter activity as well as disruption of transporter specificity should be considered by determining BS profiles in serum and bile. Taking the limitations of individual observations into account, the results suggest that both mutations reported here differently interfere with the function of BSEP, which provides a rational explanation for the individual course of cholestatic liver disease of the two patients. ACKNOWLEDGMENTS The authors would like to acknowledge expert technical assistance by Paulina Philippski and Nathalie Walter. COMMENTS Background Genetic defects of the bile salt export pump (BSEP), the major transporter for bile salts at the apical membrane of hepatocytes, may result in severe liver disease, termed progressive familial intrahepatic cholestasis type 2 (PFIC-2). Biliary diversion is a therapeutic option for the treatment of PFIC-2. However, only some patients benefit from this surgical intervention. The reason for variable treatment response is not well understood. Research frontiers The molecular understanding of pathophysiological consequences of single mutations or clusters of mutations of BSEP is presently evolving. Innovations and breakthroughs The study provides detailed analysis of two BSEP mutations, which have opposite effects on patient s outcome in terms of treatment response. Most importantly, the results strongly indicate that a single amino acid substitution of BSEP (G1032R) may severely alter its substrate specificity. Applications The findings of their study imply that in BSEP-associated liver diseases evaluation of bile salt profiles (blood and bile) should be considered in addition to genetic analysis. This will improve the choice for the best treatment and will advance the prognostic assessment. Terminology Partial external biliary diversion (PEBD) is a surgical procedure for drainage of bile to the outside of the body. Bile is drained from bile ducts via the gallbladder and a short interposed segment from the small intestine to the surface of the abdomen. Peer-review The authors reported two patients with different mutations of the bile salt export pump which affect its residual function and substrate specificity. This is a wellwritten paper. The article is innovative. The article suggests that residual function of BSEP as well as substrate specificity influence the therapeutic effectiveness of PEBD in PFIC-2. REFERENCES 1 Sambrotta M, Strautnieks S, Papouli E, Rushton P, Clark BE, Parry DA, Logan CV, Newbury LJ, Kamath BM, Ling S, Grammatikopoulos T, Wagner BE, Magee JC, Sokol RJ, Mieli- Vergani G; University of Washington Center for Mendelian Genomics, Smith JD, Johnson CA, McClean P, Simpson MA, Knisely AS, Bull LN, Thompson RJ. Mutations in TJP2 cause progressive cholestatic liver disease. Nat Genet 2014; 46: [PMID: DOI: /ng.2918] 2 Bull LN, van Eijk MJ, Pawlikowska L, DeYoung JA, Juijn JA, Liao M, Klomp LW, Lomri N, Berger R, Scharschmidt BF, Knisely AS, Houwen RH, Freimer NB. A gene encoding a P-type ATPase mutated in two forms of hereditary cholestasis. Nat Genet 1998; 18: [PMID: DOI: /ng ] 3 Paulusma CC, Oude Elferink RP. Diseases of intramembranous lipid transport. FEBS Lett 2006; 580: [PMID: DOI: /j.febslet ] 4 Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, Dahan K, Childs S, Ling V, Tanner MS, Kagalwalla AF, Németh A, Pawlowska J, Baker A, Mieli-Vergani G, Freimer NB, Gardiner RM, Thompson RJ. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998; 20: [PMID: DOI: /3034] 5 Hayashi H, Takada T, Suzuki H, Onuki R, Hofmann AF, Sugiyama Y. Transport by vesicles of glycine- and taurine-conjugated bile salts and taurolithocholate 3-sulfate: a comparison of human BSEP with rat Bsep. Biochim Biophys Acta 2005; 1738: [PMID: DOI: /j.bbalip ] 6 Stindt J, Ellinger P, Weissenberger K, Dröge C, Herebian D, Mayatepek E, Homey B, Braun S, Schulte am Esch J, Horacek M, Canbay A, Schmitt L, Häussinger D, Kubitz R. A novel mutation within a transmembrane helix of the bile salt export pump (BSEP, ABCB11) with delayed development of cirrhosis. Liver Int 2013; 33: [PMID: DOI: /liv.12217] 7 Kubitz R, Dröge C, Stindt J, Weissenberger K, Häussinger D. The bile salt export pump (BSEP) in health and disease. Clin Res 5302 August 7, 2017 Volume 23 Issue 29

61 Ellinger P et al. Outcome of PEBD in PFIC-2 Hepatol Gastroenterol 2012; 36: [PMID: DOI: /j.clinre ] 8 Deleuze JF, Jacquemin E, Dubuisson C, Cresteil D, Dumont M, Erlinger S, Bernard O, Hadchouel M. Defect of multidrugresistance 3 gene expression in a subtype of progressive familial intrahepatic cholestasis. Hepatology 1996; 23: [PMID: DOI: /hep ] 9 Ruetz S, Gros P. Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 1994; 77: [PMID: ] 10 van Helvoort A, Smith AJ, Sprong H, Fritzsche I, Schinkel AH, Borst P, van Meer G. MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycoprotein specifically translocates phosphatidylcholine. Cell 1996; 87: [PMID: ] 11 Small DM. Role of ABC transporters in secretion of cholesterol from liver into bile. Proc Natl Acad Sci USA 2003; 100: 4-6 [PMID: DOI: /pnas ] 12 Groen A, Romero MR, Kunne C, Hoosdally SJ, Dixon PH, Wooding C, Williamson C, Seppen J, Van den Oever K, Mok KS, Paulusma CC, Linton KJ, Oude Elferink RP. Complementary functions of the flippase ATP8B1 and the floppase ABCB4 in maintaining canalicular membrane integrity. Gastroenterology 2011; 141: e1-4 [PMID: DOI: /j.gastro ] 13 Jacquemin E. Role of multidrug resistance 3 deficiency in pediatric and adult liver disease: one gene for three diseases. Semin Liver Dis 2001; 21: [PMID: DOI: /s ] 14 Marschall HU, Wagner M, Zollner G, Fickert P, Diczfalusy U, Gumhold J, Silbert D, Fuchsbichler A, Benthin L, Grundström R, Gustafsson U, Sahlin S, Einarsson C, Trauner M. Complementary stimulation of hepatobiliary transport and detoxification systems by rifampicin and ursodeoxycholic acid in humans. Gastroenterology 2005; 129: [PMID: DOI: /j.gastro ] 15 Whitington PF, Whitington GL. Partial external diversion of bile for the treatment of intractable pruritus associated with intrahepatic cholestasis. Gastroenterology 1988; 95: [PMID: ] 16 Keitel V, Burdelski M, Vojnisek Z, Schmitt L, Häussinger D, Kubitz R. De novo bile salt transporter antibodies as a possible cause of recurrent graft failure after liver transplantation: a novel mechanism of cholestasis. Hepatology 2009; 50: [PMID: DOI: /hep.23083] 17 Kubitz R, Keitel V, Scheuring S, Köhrer K, Häussinger D. Benign recurrent intrahepatic cholestasis associated with mutations of the bile salt export pump. J Clin Gastroenterol 2006; 40: [PMID: ] 18 Keitel V, Burdelski M, Warskulat U, Kühlkamp T, Keppler D, Häussinger D, Kubitz R. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology 2005; 41: [PMID: DOI: /hep.20682] 19 Noé J, Stieger B, Meier PJ. Functional expression of the canalicular bile salt export pump of human liver. Gastroenterology 2002; 123: [PMID: ] 20 Stindt J, Ellinger P, Stross C, Keitel V, Häussinger D, Smits SH, Kubitz R, Schmitt L. Heterologous overexpression and mutagenesis of the human bile salt export pump (ABCB11) using DREAM (Directed REcombination-Assisted Mutagenesis). PLoS One 2011; 6: e20562 [PMID: DOI: /journal. pone ] 21 Ellinger P, Kluth M, Stindt J, Smits SH, Schmitt L. Detergent screening and purification of the human liver ABC transporters BSEP (ABCB11) and MDR3 (ABCB4) expressed in the yeast Pichia pastoris. PLoS One 2013; 8: e60620 [PMID: DOI: /journal.pone ] 22 Herédi-Szabó K, Kis E, Krajcsi P. The vesicular transport assay: validated in vitro methods to study drug-mediated inhibition of canalicular efflux transporters ABCB11/BSEP and ABCC2/ MRP2 Curr Protoc Toxicol 2012; Chapter 23: Unit 23.4 [PMID: DOI: / tx2304s54] 23 Göbel T, Schadewaldt-Tümmers J, Greiner L, Poremba C, Häussinger D, Erhardt A. Transient elastography improves detection of liver cirrhosis compared to routine screening tests. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i3.953] 24 Millonig G, Reimann FM, Friedrich S, Fonouni H, Mehrabi A, Büchler MW, Seitz HK, Mueller S. Extrahepatic cholestasis increases liver stiffness (FibroScan) irrespective of fibrosis. Hepatology 2008; 48: [PMID: DOI: / hep.22577] 25 Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerová D, Rayner A, Dutton L, Meier Y, Antoniou A, Stieger B, Arnell H, Ozçay F, Al-Hussaini HF, Bassas AF, Verkade HJ, Fischler B, Németh A, Kotalová R, Shneider BL, Cielecka-Kuszyk J, McClean P, Whitington PF, Sokal E, Jirsa M, Wali SH, Jankowska I, Pawłowska J, Mieli-Vergani G, Knisely AS, Bull LN, Thompson RJ. Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 26 Thompson R, Strautnieks S. BSEP: function and role in progressive familial intrahepatic cholestasis. Semin Liver Dis 2001; 21: [PMID: DOI: /s ] 27 Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ. Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing. Hepatology 2009; 49: [PMID: DOI: /hep.22683] 28 Dröge C, Schaal H, Engelmann G, Wenning D, Häussinger D, Kubitz R. Exon-skipping and mrna decay in human liver tissue: molecular consequences of pathogenic bile salt export pump mutations. Sci Rep 2016; 6: [PMID: DOI: /srep24827] 29 Wang KS, Tiao G, Bass LM, Hertel PM, Mogul D, Kerkar N, Clifton M, Azen C, Bull L, Rosenthal P, Stewart D, Superina R, Arnon R, Bozic M, Brandt ML, Dillon PA, Fecteau A, Iyer K, Kamath B, Karpen S, Karrer F, Loomes KM, Mack C, Mattei P, Miethke A, Soltys K, Turmelle YP, West K, Zagory J, Goodhue C, Shneider BL; Childhood Liver Disease Research Network (ChiLDReN). Analysis of surgical interruption of the enterohepatic circulation as a treatment for pediatric cholestasis. Hepatology 2017; 65: [PMID: DOI: /hep.29019] 30 Czubkowski P, Jankowska I, Pawlowska J. Successful pregnancy after ileal exclusion in progressive familial intrahepatic cholestasis type 2. Ann Hepatol 2015; 14: [PMID: ] 31 Dawson RJ, Locher KP. Structure of a bacterial multidrug ABC transporter. Nature 2006; 443: [PMID: DOI: /nature05155] P- Reviewer: Garcia-Olmo D, Koksal AS, Mansilla-Vivar R, Sira AM, Sun JH, S- Editor: Qi Y L- Editor: A E- Editor: Li D 5303 August 7, 2017 Volume 23 Issue 29

62 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Basic Study ORIGINAL ARTICLE Celecoxib-induced gastrointestinal, liver and brain lesions in rats, counteraction by BPC 157 or L-arginine, aggravation by L-NAME Domagoj Drmic, Danijela Kolenc, Spomenko Ilic, Lara Bauk, Marko Sever, Anita Zenko Sever, Kresimir Luetic, Jelena Suran, Sven Seiwerth, Predrag Sikiric Domagoj Drmic, Danijela Kolenc, Spomenko Ilic, Lara Bauk, Marko Sever, Anita Zenko Sever, Kresimir Luetic, Jelena Suran, Sven Seiwerth, Predrag Sikiric, Departments of Pharmacology and Pathology, Medical Faculty University of Zagreb, Salata, Zagreb, Croatia Domagoj Drmic, Danijela Kolenc, Spomenko Ilic, Lara Bauk, Marko Sever, Anita Zenko Sever, Kresimir Luetic, Jelena Suran, Sven Seiwerth, Predrag Sikiric, Faculty of Medicine, J.J. Strossmayer University of Osijek, Osijek, Croatia Author contributions: Drmic D, Kolenc D, Ilic S, Suran J, Seiwerth S and Sikiric P designed the research; Drmic D, Kolenc D, Ilic S, Bauk L, Sever M, Zenko Sever A, Seiwerth S and Sikiric P performed the research; Seiwerth S and Sikiric P contributed reagents and analytic tools. Drmic D, Kolenc D, Ilic S, Bauk L, Sever M, Zenko Sever A, Luetic K, Suran J, Seiwerth S and Sikiric P analyzed the data; Drmic D, Kolenc D, Seiwerth S and Sikiric P wrote the paper. Institutional review board statement: The study was reviewed and approved by the Department of Veterinary, Ministry of Agriculture, Croatia, No. UP/I /07-01/210. Conflict-of-interest statement: The authors state that they have no conflicts of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Predrag Sikiric, MD, PhD, Professor, Departments of Pharmacology and Pathology, Medical Faculty University of Zagreb, Salata 11, POB 916, Zagreb, Croatia. sikiric@mef.hr Telephone: Fax: Received: February 15, 2017 Peer-review started: February 19, 2017 First decision: April 5, 2017 Revised: May 3, 2017 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, 2017 Abstract AIM To counteract/reveal celecoxib-induced toxicity and NO system involvement. METHODS Celecoxib (1 g/kg b.w. ip) was combined with therapy with stable gastric pentadecapeptide BPC 157 (known to inhibit these lesions, 10 µg/kg, 10 ng/kg, or 1 ng/kg ip) and L-arginine (100 mg/kg ip), as well as NOS blockade [N(G)-nitro-L-arginine methyl ester (L-NAME)] (5 mg/kg ip) given alone and/or combined immediately after celecoxib. Gastrointestinal, liver, and brain lesions and liver enzyme serum values in rats were assessed at 24 h and 48 h thereafter. RESULTS This high-dose celecoxib administration, as a result of NO system dysfunction, led to gastric, liver, and brain lesions and increased liver enzyme serum values. The L-NAME-induced aggravation of the lesions was notable 5304 August 7, 2017 Volume 23 Issue 29

63 Drmic D et al. Celecoxib, BPC 157 and the NO system for gastric lesions, while in liver and brain lesions the beneficial effect of L-arginine was blunted. L-arginine counteracted gastric, liver and brain lesions. These findings support the NO system mechanism(s), both NO system agonization (L-arginine) and NO system antagonization (L-NAME), that on the whole are behind all of these COX phenomena. An even more complete antagonization was identified with BPC 157 (at both 24 h and 48 h). A beneficial effect was evident on all the increasingly negative effects of celecoxib and L-NAME application and in all the BPC 157 groups (L-arginine + BPC 157; L-NAME + BPC 157; L-NAME + L-arginine + BPC 157). Thus, these findings demonstrated that BPC 157 may equally counteract both COX-2 inhibition (counteracting the noxious effects of celecoxib on all lesions) and additional NOS blockade (equally counteracting the noxious effects of celecoxib + L-NAME). CONCLUSION BPC 157 and L-arginine alleviate gastrointestinal, liver and brain lesions, redressing NSAIDs post-surgery application and NO system involvement. Key words: BPC 157; celecoxib; L-arginine; N(G)-nitro- L-arginine methyl ester; rats The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In rats treated with the COX-2 inhibitor celecoxib, BPC 157 (given intraperitoneally) counteracted lesion development in the stomach, liver and brain. BPC 157 treatment alongside with N(G)-nitro- L-arginine methyl ester (L-NAME) also attenuated any effect of L-NAME that would otherwise have intensified the deleterious regular course. Consistently, with exacerbation (induced by L-NAME administration) and amelioration (due to L-arginine) of gastric, liver and brain lesions, L-arginine amelioration prevailed (i.e., the gastric, liver and brain lesions were attenuated) when given together with L-NAME (L-NAME + L-arginine), an effect further reversed toward a marked beneficial effect by the addition of BPC 157 (L-NAME + L-arginine + BPC 157). Drmic D, Kolenc D, Ilic S, Bauk L, Sever M, Zenko Sever A, Luetic K, Suran J, Seiwerth S, Sikiric P. Celecoxib-induced gastrointestinal, liver and brain lesions in rats, counteraction by BPC 157 or L-arginine, aggravation by L-NAME. World J Gastroenterol 2017; 23(29): Available from: URL: DOI: INTRODUCTION We suggest that celecoxib, a specific COX-2 blocker, causes gastrointestinal, liver and brain lesions in rats when given in high doses, as has already been shown with non-selective nonsteroidal antiinflammatory drugs (NSAIDs) [1]. These results should also be related to the hitherto undetermined interaction with NO system dysfunction as well presenting the role of the NO system in gastrointestinal lesions [2,3], liver damage and hepatic encephalopathy [4]. These findings would correspond to hitherto reported lesions after the use of non-selective NSAIDs [5-8]. To clarify and combat the side effects of celecoxib, we focused on the stable gastric pentadecapeptide BPC 157, which is known to counteract lesions induced by non-selective NSAIDs [5-8] and to interact with the NO system in different models and species [9]. We also explored mechanisms behind the protection induced by the NO synthetase (NOS) substrate L-arginine and the aggravation induced by the NOS blocker N(G)- nitro-l-arginine methyl ester (L-NAME). It was previously shown that celecoxib improved gastric lesions [10], induced the regression of preneoplastic lesions in the liver [11] and counteracted brain lesions and convulsions [12-14]. However, research into celecoxib-induced damage showed gastric [15-21] or intestinal lesions [22,23] and aggravation of kainic acid-convulsions [24]. Finally, both celecoxib and indomethacin prevented the gastroprotective effects induced by a nitric oxide donor or an inducer of nitric oxide synthesis [25]. These findings reveal more gastrointestinal lesions, more liver toxicity, and more toxicity to the brain as known risks for nonselective NSAIDs [5-8], which are also associated with adverse drug reactions in humans [26,27]. Therefore, these results would define the possible liver and brain lesions in the post-application period during a course of celecoxib-induced damage. In this scenario, the combined application of both of the NO agents L-NAME and L-arginine, i.e., the application of NOS blockade and an NOS substrate, testing the dual significance of NO, would clarify eventual therapeutic attempts and resolve possible controversies. For example, L-NAME was shown to attenuate indomethacin-induced microvascular injuries and leakage while L-arginine worked in conjunction with indomethacin [28]. A likely beneficial effect for the stable gastric pentadecapeptide BPC 157 on potential celecoxibinduced toxicity might be related to NO system dysfunction, which follows from consistent evidence [1,9]. BPC 157 (as an anti-ulcer peptide that is native and stable in human gastric juice) has been designated to be a novel mediator of cytoprotection [29] that has been implemented in inflammatory bowel disease and is in trial now to treat multiple sclerosis [30]. Recent reviews [1,9] cover that BPC 157 counteracts COX-1/COX- 2-induced gastric, intestinal, liver and brain lesions [5-8], aspirin-prolonged bleeding and thrombocytopenia [31] and might prevent and rescue adjuvant arthritis [32]. BPC 157 also interacts with the effects of both L-arginine and L-NAME-induced aggravation in different models and species. Thus, we examined these possible therapies and the mechanisms behind them [9]. Consequently, we focused on the disturbances at 5305 August 7, 2017 Volume 23 Issue 29

64 Drmic D et al. Celecoxib, BPC 157 and the NO system 24 h and 48 h after celecoxib application, including identifying any gastrointestinal, liver and brain lesions as well as identifying any possible noxious stimuli that could further aggravate the existing conditions, e.g., the NOS blocker L-NAME, which was given alone and combined with celecoxib administration. We also focused on possible therapies, including the stable gastric pentadecapeptide BPC 157 and the NOS substrate L-arginine. Furthermore, we should emphasize that the previous high-dose regimens used to demonstrate the toxicity of all non-selective NSAIDs [5-8] were compared with µg-ng regimens of BPC 157 as a potential antidote to counteract these effects [1] and to examine the safety profile of celecoxib. Thus, we consistently used this selective NSAID at very high doses that consequently markedly exceeded the maximal dose used in patients [10]. Likewise, in rats treated with celecoxib, both BPC 157 regimens, µg and ng, were also validated against the NO-related agents L-NAME and L-arginine, which were given either alone and/or in combination. MATERIALS AND METHODS Animals Male albino Wistar (200 g) rats were used in all the experiments (at least 10 rats per experimental group and interval). Experiments were approved by the local ethics committee and assessed by observers unaware of the given treatment. Drugs The medications used, without carrier or peptidase inhibitor, included pentadecapeptide BPC 157 (a partial sequence of the human gastric juice protein BPC that is freely soluble in water at ph 7.0 and in saline). It was prepared as a peptide with 99% (HPLC) purity (1-des- Gly peptide was the main impurity, manufactured by Diagen, Ljubljana, Slovenia, GEPPPGKPADDAGLV, M.W. 1419). Celecoxib, L-NAME, and L-arginine (Sigma, United States) were prepared as previously described [1,9]. Protocol Celecoxib (1 g/kg) was given intraperitoneally, and then immediately, as medications, we intraperitoneally administered the stable gastric pentadecapeptide BPC 157 (10 μg/kg, 10 ng/kg, 1 ng/kg), L-NAME (5 mg/kg) and L-arginine (100 mg/kg), while controls simultaneously received an equal volume of saline (5 ml/kg) intraperitoneally. Gastrointestinal assay Gastric lesions: Injury severity was assessed immediately after sacrifice. The sum of the longest lesion s diameters was assessed as described previously [5,7,8], and gastric tissues were processed for routine microscopy analysis as described previously [5,7,8]. Liver assays - bilirubin and enzyme activity: To determine the serum values of aspartate transaminase (AST), alanine transaminase (ALT) (IU/L) and total bilirubin (μmol/l), blood samples were obtained immediately after sacrifice and were centrifuged for 15 min at 3000 rpm. All tests were measured using an Olympus AU2700 analyzer with original test reagents (Olympus Diagnostica, Lismeehan, Ireland) [5-8]. Liver lesions: Liver tissue was immediately placed in 10% neutral buffered formalin for 24 h and subsequently embedded in paraffin. Hematoxylin-eosinstained sections were analyzed on three high-power fields. The number of nuclei and area of cytoplasm as well as their diameter were measured using the ISSA program (Vamstec, Zagreb, Croatia), and the number of binucleated cells was also counted. Microvesicular steatosis was scored from 1-3: 1, less than 20% of hepatocytes showing microvesicular steatosis; 2, 20%-60% of hepatocytes showing microvesicular steatosis; and 3, over 60% of hepatocytes showing microvesicular steatosis. Parenchymal necrosis, eosinophilic cytoplasm, pyknotic nuclei and conspicuous nucleoli were scored semiquantitatively as follows: 0, showing no changes; 1, minimum; 2, moderate; and 3, maximum changes [5-8]. Brain assay Brain lesions: Brains were fixed in 10% formalin for two days. Upon fixation, the brain was grossly inspected and cut into consecutive coronal sections. Brain slabs were dehydrated in graded ethanol and embedded in paraffin. Paraffin blocks were cut into 5-μm slices. Paraffin slices were deparaffinated in xylene, rehydrated in graded ethanol and stained with hematoxylin and eosin. The intensity and distribution of brain lesions (balloonized or red neurons), brain edema and cyanosis were described and evaluated semiquantitatively on two scales as follows where 0 generally indicated no changes: 0-3, edema (1, weakly diffuse and/or perifocal; 2, moderate; and 3, strong and generalized); 0-4, balloonized or red neurons (1, 5%; 2, 5%-30%; 3, 30%-50%; and 4, > 50%) [5-8]. Statistical analyses Statistical analyses of the quantified data were performed by analysis of variance (ANOVA). Post hoc comparisons were appraised using the conservative Bonferroni/Dunn test. Data are presented as the mean ± SD. Non-parametric statistical analyses were performed for categorical data using the Kruskal- Wallis and post hoc Mann-Whitney U test. Values are expressed as min/med/max. Values of P < 0.05 were considered statistically significant. RESULTS Gastric lesions Celecoxib induced severe gastric lesions (histologically, they appeared as mucosal defects ranging from one 5306 August 7, 2017 Volume 23 Issue 29

65 Drmic D et al. Celecoxib, BPC 157 and the NO system Table 1 Gastric lesions assessment after celecoxib, BPC 157, L-NAME, L-arginine Medication (/kg intraperitoneally) immediately after celecoxib 1 g/kg intraperitoneally Sum of longest lesions diameters (means ± SD, mm) assessed rafter celecoxib and mediation application 24 h 48 h Control, saline 5 ml 10 ± 2 17 ± 3.5 BPC μg 0 ± 0 a 7.5 ± 2.8 a BPC ng 2 ± 0.8 a 4 ± 1.2 a BPC ng 2.2 ± 0.6 a 4.3 ± 1 a L-NAME 5 mg 13 ± 2 30 ± 5 a L-arginine 100 mg 7 ± ± 1 a L-NAME 5 mg + L-arginine 100 mg 8 ± 2 10 ± 3 a L-NAME 5 mg + BPC μg 2 ± 1 a 4 ± 2 a L-NAME 5 mg + BPC ng 3.2 ± 0.8 a 5 ± 0.6 a L-arginine 100 mg + BPC μg 1 ± 0.5 a 2.5 ± 0.8 a L-arginine 100 mg + BPC ng 2.3 ± 0.4 a 4.5 ± 0.6 a L-NAME 5 mg + L-arginine 100 mg + BPC μg 1 ± 0.5 a 2.5 ± 0.6 a L-NAME 5 mg + L-arginine 100 mg + BPC ng 2.5 ± 0.4 a 4.7 ± 0.7 a a P < 0.05 vs control. BPC 157 L-arginine Control L-NAME Figure 1 Gross presentation of celecoxib-induced gastric lesions at 48 h. half of the mucosal thickness to full-blown ulcers; the defect bed was debris-covered, partially by erythrocytes, and it was surrounded by an edematous lamina propria with polymorphonuclear infiltration) showed a gradual increase from 24 h to 48 h after administration, while the liver and brain lesions showed sustained levels (Table 1, Figure 1). Only when these lesions became stronger, at the 48 h mark after celecoxib, were they aggravated by L-NAME and attenuated by L-arginine. When combined, the beneficial effect of L-arginine completely overrode the damaging effect of L-NAME. BPC 157 presented a stronger beneficial effect. Illustratively, given immediately after celecoxib, BPC 157 (in either of the regimens) completely alleviated the lesions induced by celecoxib, both at 24 h and 48 h. Likewise, when given together with other agents, BPC 157 consistently demonstrated the same beneficial effect. Liver lesions Celecoxib induced marked steatosis, congestion and necrosis at 24 h and at 48 h, along with increased enzyme serum values. The lesions were markedly attenuated by L-arginine at 24 h and at 48 h. Its beneficial effect was preserved at 24 h but decreased to control values at 48 h when combined with L-NAME, though L-NAME by itself could not affect celecoxib- liver lesions. A stronger beneficial effect occurred with BPC 157. BPC 157 alone completely alleviated celecoxib-induced liver lesions, both at 24 h and 48 h. In combination with the other agents, BPC 157 consistently demonstrated the same beneficial effect (Table 2, Figure 2). Brain lesions Brain edema was commonly absent, though celecoxibtreated rats presented with damaged (balloonized) red neurons without any inflammation that were markedly expressed particularly in the cerebral cortex and in the Purkinje cells (Table 3, Figure 3). At 48 h, these lesions were attenuated by L-arginine, but when combined with L-NAME, the beneficial effect of L-arginine was decreased to the control values. Treatment with L-NAME by itself, however, did not affect the extent of the celecoxib-brain lesions. Again, BPC 157 presented a stronger beneficial effect; alone, it completely alleviated celecoxib-induced brain lesions, both at 24 h and 48 h. Likewise, given together with other agents, BPC 157 consistently demonstrated the same beneficial effect. DISCUSSION This study argues that the celecoxib-induced stomach, liver and brain lesions resulting from extended COX August 7, 2017 Volume 23 Issue 29

66 Drmic D et al. Celecoxib, BPC 157 and the NO system Table 2 Liver lesions assessment after celecoxib, BPC 157, L-NAME, L-arginine Medication (/kg intraperitoneally) immediately after celecoxib 1 g/kg intraperitoneally Time after celecoxib Liver lesions assessment Microscopic assessment, Score (0-3), Min/Med/Max Serum enzymes values (IU/L), means ± SD steatosis congestion necrosis ALT AST Control, saline 5 ml 24 h 2/2/3 2/2/3 2/2/3 352 ± ± 8 48 h 2/3/3 2/2/3 2/2/3 356 ± ± 9 BPC μg 24 h 1/1/1 a 1/1/2 a 1/1/1 a 138 ± 14 a 41 ± 11 a 48 h 1/1/1 a 1/1/2 a 1/1/1 a 63 ± 12 a 35 ± 12 a BPC ng 24 h 1/1/1 a 1/1/2 a 1/1/1 a 154 ± 13 a 45 ± 8 a 48 h 1/1/2 a 1/1/2 a 1/1/1 a 72 ± 19 a 40 ± 7 a BPC ng 24 h 1/1/1 a 1/1/2 a 1/1/1 a 170 ± 15 a 48 ± 10 a 48 h 1/1/2 a 1/1/2 a 1/1/1 a 80 ± 15 a 43 ± 8 a L-NAME 5 mg 24 h 2/3/3 2/2/3 2/2/3 375 ± ± h 3/3/3 2/3/3 2/2/3 400 ± ± 10 L-arginine 100 mg 24 h 1/2/2 a 1/2/2 a 1/2/2 a 315 ± 14 a 68 ± 14 a 48 h 1/2/2 a 1/2/2 a 1/2/2 a 300 ± 21 a 65 ± 10 a L-NAME 5 mg + L-arginine 100 mg 24 h 1/2/2 a 1/2/2 a 1/2/2 a 293 ± 17 a 68 ± 9 a 48 h 2/2/2 2/2/3 2/2/2 270 ± 15 a 73 ± 11 a L-NAME 5 mg + BPC μg 24 h 1/1/1 a 1/2/2 a 1/1/1 a 170 ± 15 a 69 ± 9 a 48 h 1/1/2 a 1/2/2 a 1/1/1 a 150 ± 12 a 55 ± 13 a L-NAME 5 mg + BPC ng 24 h 1/1/1 a 1/2/2 a 1/1/1 a 210 ± 16 a 70 ± 7 a 48 h 1/1/2 a 1/2/2 a 1/1/1 a 182 ± 14 a 60 ± 8 a L-arginine 100 mg + BPC μg 24 h 1/1/1 a 1/1/1 a 1/1/1 a 165 ± 25 a 55 ± 8 a 48 h 1/1/2 a 1/1/1 a 1/1/1 a 160 ± 18 a 45 ± 8 a L-arginine 100 mg + BPC ng 24 h 1/1/1 a 1/1/2 a 1/1/1 a 190 ± 11 a 63 ± 10 a L-NAME 5 mg + L-arginine 100 mg + BPC μg L-NAME 5 mg + L-arginine 100 mg + BPC ng 48 h 1/1/2 a 1/1/2 a 1/1/1 a 170 ± 13 a 55 ± 9 a 24 h 1/1/2 a 1/1/2 a 1/1/1 a 167 ± 11 a 57 ± 10 a 48 h 1/1/2 a 1/1/2 a 1/1/1 a 176 ± 14 a 57 ± 8 a 24 h 1/1/2 a 1/1/2 a 1/1/1 a 202 ± 9 a 62 ± 7 a 48 h 1/1/2 a 1/1/2 a 1/1/1 a 190 ± 12 a 65 ± 8 a a P < 0.05 vs control. A B Figure 2 Presentation of celecoxib-induced liver lesions at 48 h. Controls presented with pronounced microvesicullar and macrovesicullar steatosis, dilated sinusoids, and piecemeal necrosis (A); BPC 157 rats presenting with minimal microvesicullar steatosis and no necrosis (B). HE 40. inhibition are a function of NO system dysfunction, which is particularly worsened after a high-dose application. Considering the advanced safety profile of celecoxib [10], lower celecoxib regimens such as 200 mg/kg and 500 mg/kg given intraperitoneally were without notable effect on gastric, liver or brain lesions (thus, these results are not specifically shown). These lesions could be all influenced by the NOS substrate L-arginine and in particular by the stable pentadecapeptide BPC 157, which is an agent known to counteract non-selective NSAID-induced ulcerogenesis as well as the liver and brain lesions that interact with the NO system [1,9]. The additional support comes from the similar therapy effects obtained with the correspondingly high dose range of BPC 157 therapy, which was similar to the dosing used in other studies as well [33,34]. This study argues that the celecoxib-induced stomach, liver and brain lesions presenting after COX-2 inhibition demonstrate a particular NO system dysfunction. These effects could be all influenced by the NOS substrate L-arginine, particularly by the stable pentadecapeptide BPC 157, which is an agent known to counteract nonselective NSAID-induced ulcerogenesis as well as liver and brain lesions and particularly interacts with the NO system [1,9] August 7, 2017 Volume 23 Issue 29

67 Drmic D et al. Celecoxib, BPC 157 and the NO system Table 3 Brain lesions assessment after celecoxib, BPC 157, L-NAME, L-arginine Medication (/kg intraperitoneally) immediately after celecoxib 1 g/kg intraperitoneally Time after celecoxib Brain lesions assessment Microscopic assessment, Score (0-4), Microscopic assessment, Score (0-3), Min/Med/Max Min/Med/Max Purkinje cells (red neurons) Cerebral cortex (red neurons) Edema Control, saline 5 ml 24 h 2/2/2 2/2/2 0/0/0 48 h 2/2/3 2/2/3 0/0/0 BPC μg 24 h 0/0/0 a 0/1/1 a 0/0/0 48 h 0/1/1 a 0/1/1 a 0/0/0 BPC ng 24 h 0/1/1 a 0/1/1 a 0/0/0 48 h 0/1/1 a 1/1/1 a 0/0/0 BPC ng 24 h 0/1/1 a 0/1/1 a 0/0/0 48 h 0/1/1 a 0/1/1 a 0/0/0 L-NAME 5 mg 24 h 2/2/3 2/2/3 0/0/0 48 h 2/3/3 2/3/3 0/0/0 L-arginine 100 mg 24 h 1/2/2 1/2/2 0/0/0 48 h 1/2/2 a 1/2/2 a 0/0/0 L-NAME 5 mg + L-arginine 100 mg 24 h 2/2/2 2/2/2 0/0/0 48 h 2/2/2 2/2/2 0/0/0 L-NAME 5 mg + BPC μg 24 h 1/1/1 a 1/1/2 a 0/0/0 48 h 1/1/2 a 1/1/2 a 0/0/0 L-NAME 5 mg + BPC ng 24 h 1/1/1 a 1/1/2 a 0/0/0 48 h 1/1/2 a 1/1/2 a 0/0/0 L-arginine 100 mg+ BPC μg 24 h 0/1/1 a 0/1/1 a 0/0/0 48 h 1/1/2 a 0/1/1 a 0/0/0 L-arginine 100 mg + BPC ng 24 h 0/1/1 a 0/1/1 a 0/0/0 48 h 1/1/2 a 1/1/1 a 0/0/0 L-NAME 5 mg + L-arginine 100 mg + BPC μg L-NAME 5 mg + L-arginine 100 mg + BPC ng 24 h 1/1/2 a 1/1/1 a 0/0/0 48 h 1/1/2 a 1/1/1 a 0/0/0 24 h 1/1/2 a 1/1/1 a 0/0/0 48 h 1/1/2 a 1/2/1 a 0/0/0 a P < 0.05 vs control. A B Figure 3 Presentation of celecoxib-induced cerebral cortex lesions at 48 h. Control celecoxib rats presented more damaged (balloonized) red neurons without any inflammation markedly expressed in particular in the cerebral cortex (A), unlike BPC celecoxib rats (B). HE 40. In support of this argument, the evidence for nonselective NSAIDs [5-8] shows that they cause more gastrointestinal lesions, more liver toxicity, and more toxicity in the brain due to the known COX-1/COX-2 relationship [5-8]. On the other hand, after celecoxib treatment, the deleterious course that characterizes COX-2 inhibition should be more complex. This course includes initial stomach lesions and further progressing lesions that deteriorate over time as well as extensive liver and brain lesions that are already sustainably present at the early 24 h period. Further, these lesions are reciprocally potentiated by L-NAME and opposed by L-arginine in a particular way. In so doing and in substantiating the particularities for the initial lesions in the stomach at 24 h, it is likely that celecoxib provides COX-2 inhibition; at that time, in the stomach, there is no effect of L-arginine or L-NAME. However, the liver and brain lesions likely appear due to COX-2 inhibition and NOS dysfunction, the latter of which is counteracted by L-arginine. Next, in addition to this opposing effect of L-arginine, NOS blockade specifically contributes NOS dysfunction to COX-2 inhibition as verified over the h period August 7, 2017 Volume 23 Issue 29

68 Drmic D et al. Celecoxib, BPC 157 and the NO system It is only in competition with the progressive stomach lesions that the beneficial effect of L-arginine occurs. Similarly, L-NAME aggravation occurs in stomach lesions, while the liver and brain lesions cannot not be worsened further. Therefore, maximal NOS dysfunction with COX-2 inhibition is present in the brain more than in the liver. Namely, unlike stomach lesions (where L-arginine nullifies L-NAME aggravation) and liver lesions, in brain lesions, L-arginine could not work to counteract an L-NAME-induced NOS blockade. Thus, there is threefold confirmation of the NO relationship: L-NAME (NOS blockade) in stomach lesions; L-arginine (NOS substrate) counteracts stomach, liver, brain lesions; and L-arginine and L-NAME could specifically affect each other s response in the stomach, liver and brain. Finally, for all these lesions in the stomach, liver and brain, celecoxib- and/or L-NAME-induced lesions were completely inhibited by BPC 157 administration. As mentioned, BPC 157, due to its counteraction of NSAIDinduced lesions [1] and interaction with NO agents [1,9], is assumed to be more prone to counteracting both COX-1/COX-2 and NOS inhibition than L-arginine as an NOS substrate. In addition, this result is also true for COX-2/NOS inhibition. Further, BPC 157 induces NO release from the gastric mucosa supernatant, similarly to L-arginine [35], but it also functions under conditions where L-arginine does not work [36]. This mechanism assumes a persistent, beneficial effect versus increasing dysfunction of the nitrergic pathway (for instance, heavier loss of endothelium cells from the vascular wall could lead to less NO production ability [37] ), making COX-2/NOS inhibition worse as the tissue integrity is damaged further. Likely as a result of this relationship, the same effectiveness is observed in all increasingly damaged circumstances following celecoxib and L-NAME application. This process specifically involves all BPC 157 groups when administered with celecoxib alone and/or with NO agents (L-arginine + BPC 157; L-NAME + BPC 157; L-NAME + L-arginine + BPC 157) in the stomach, liver and brain. BPC 157 may thereby equally counteract both COX-2 inhibition (counteracting the noxious effects of celecoxib on all lesions) and additional NOS blockade (equally counteracting the noxious effects of celecoxib + L-NAME) [1,9]. This outcome occurs equally with either µg- or ng dosing regimens. In addition, BPC 157 affects enos gene function as well [38] as that of other genes [38-42]. In the latter cases, in the healing process, BPC-157 regulates the phosphorylation level of extracellular signal-regulated kinases 1 and 2 (ERK1/2) as well as their downstream targets, including c-fos, c-jun, and egr-1, key molecules involved in cell growth, migration, and angiogenesis [38-42]. In conclusion, the therapy and syndrome in rats treated with celecoxib described herein (the gastrointestinal tract, liver and brain lesions presented rapidly in rats) overlaps with the definitive follow-up of previous non-selective NSAID studies [1,5-8]. With respect to the administration of pentadecapeptide BPC 157, these results extend and generalize the observed acute and long-term therapeutic effects [5-8]. Then, over longer periods, there is greater deterioration from celecoxib, the COX-2-inhibitor, and the NO synthetase (NOS)-blocker L-NAME when combined, along with prominent rescue by the stable pentadecapeptide BPC 157 and less prominent attenuation with the NOS substrate L-arginine. These findings should likely reveal an aggravating parallelism between COX-2 and NOS inhibition [43], including the role of the NO system in gastrointestinal [2,3] and liver damage and hepatic encephalopathy [4] as well as celecoxib syndrome in particular NO system pathways. Conclusively, L-arginine, but more so BPC 157, may provide a particular therapy that may alleviate likely gastrointestinal, liver and brain lesions and redress NSAIDs post-surgery application and NO system involvement. However, the particular point remains that a single large overdose challenge differs considerably from the lower regular patient regimens throughout a markedly more prolonged treatment duration. COMMENTS Background Non-selective nonsteroidal antiinflammatory drugs (NSAIDs) induce gastrointestinal, liver and brain toxicity in rats, while celecoxib, a COX-2 inhibitor, is considered less toxic. Research frontiers This study argues that the celecoxib-induced stomach, liver and brain lesions resulting from extended COX-2 inhibition are a function of NO system dysfunction, which is particularly worsened after a high-dose application. These lesions could be all influenced by the NO synthetase (NOS) substrate L-arginine and in particular by the stable pentadecapeptide BPC 157, which is an agent known to counteract non-selective NSAID-induced ulcerogenesis as well as the liver and brain lesions that interact with the NO system. The additional support comes from the similar therapy effects obtained with the correspondingly high dose range of BPC 157 therapy, which was similar to the dosing used in other studies as well. Innovations and breakthroughs With respect to the administration of pentadecapeptide BPC 157, these results extend and generalize the observed acute and long-term therapeutic effects. Then, over longer periods, there is greater deterioration from celecoxib, the COX-2-inhibitor, and the NOS-blocker L-NAME when combined, along with prominent rescue by the stable pentadecapeptide BPC 157 and less prominent attenuation with the NOS substrate L-arginine. These findings should likely reveal an aggravating parallelism between COX-2 and NOS inhibition, including the role of the NO system in gastrointestinal and liver damage and hepatic encephalopathy as well as celecoxib syndrome in particular NO system pathways. Applications Conclusively, L-arginine, but more so BPC 157, may provide a particular therapy that may alleviate likely gastrointestinal, liver and brain lesions and redress NSAIDs post-surgery application and NO system involvement. Peer-review The manuscript is well written and reports a potentially interesting data August 7, 2017 Volume 23 Issue 29

69 Drmic D et al. Celecoxib, BPC 157 and the NO system REFERENCES 1 Sikiric P, Seiwerth S, Rucman R, Turkovic B, Rokotov DS, Brcic L, Sever M, Klicek R, Radic B, Drmic D, Ilic S, Kolenc D, Aralica G, Safic H, Suran J, Rak D, Dzidic S, Vrcic H, Sebecic B. Toxicity by NSAIDs. Counteraction by stable gastric pentadecapeptide BPC 157. Curr Pharm Des 2013; 19: [PMID: DOI: / ] 2 Whittle BJ. Nitric oxide-modulating agents for gastrointestinal disorders. Expert Opin Investig Drugs 2005; 14: [PMID: DOI: / ] 3 Evans SM, Whittle BJ. Interactive roles of superoxide and inducible nitric oxide synthase in rat intestinal injury provoked by non-steroidal anti-inflammatory drugs. Eur J Pharmacol 2001; 429: [PMID: DOI: /S (01) ] 4 Huang HC, Wang SS, Lee FY, Chan CY, Chang FY, Lin HC, Chu CJ, Chen YC, Lee SD. Simvastatin for rats with thioacetamideinduced liver failure and encephalopathy. J Gastroenterol Hepatol 2008; 23: e236-e242 [PMID: DOI: / j x] 5 Ilic S, Drmic D, Franjic S, Kolenc D, Coric M, Brcic L, Klicek R, Radic B, Sever M, Djuzel V, Filipovic M, Djakovic Z, Stambolija V, Blagaic AB, Zoricic I, Gjurasin M, Stupnisek M, Romic Z, Zarkovic K, Dzidic S, Seiwerth S, Sikiric P. Pentadecapeptide BPC 157 and its effects on a NSAID toxicity model: diclofenac-induced gastrointestinal, liver, and encephalopathy lesions. Life Sci 2011; 88: [PMID: DOI: /j.lfs ] 6 Ilic S, Drmic D, Zarkovic K, Kolenc D, Coric M, Brcic L, Klicek R, Radic B, Sever M, Djuzel V, Ivica M, Boban Blagaic A, Zoricic Z, Anic T, Zoricic I, Djidic S, Romic Z, Seiwerth S, Sikiric P. High hepatotoxic dose of paracetamol produces generalized convulsions and brain damage in rats. A counteraction with the stable gastric pentadecapeptide BPC 157 (PL 14736). J Physiol Pharmacol 2010; 61: [PMID: ] 7 Ilic S, Drmic D, Zarkovic K, Kolenc D, Brcic L, Radic B, Djuzel V, Blagaic AB, Romic Z, Dzidic S, Kalogjera L, Seiwerth S, Sikiric P. Ibuprofen hepatic encephalopathy, hepatomegaly, gastric lesion and gastric pentadecapeptide BPC 157 in rats. Eur J Pharmacol 2011; 667: [PMID: DOI: / j.ejphar ] 8 Lojo N, Rasic Z, Zenko Sever A, Kolenc D, Vukusic D, Drmic D, Zoricic I, Sever M, Seiwerth S, Sikiric P. Effects of Diclofenac, L-NAME, L-Arginine, and Pentadecapeptide BPC 157 on Gastrointestinal, Liver, and Brain Lesions, Failed Anastomosis, and Intestinal Adaptation Deterioration in 24 Hour-Short-Bowel Rats. PLoS One 2016; 11: e [PMID: DOI: / journal.pone ] 9 Sikiric P, Seiwerth S, Rucman R, Turkovic B, Rokotov DS, Brcic L, Sever M, Klicek R, Radic B, Drmic D, Ilic S, Kolenc D, Aralica G, Stupnisek M, Suran J, Barisic I, Dzidic S, Vrcic H, Sebecic B. Stable gastric pentadecapeptide BPC 157-NO-system relation. Curr Pharm Des 2014; 20: [PMID: DOI: / ] 10 Tsuji S, Miyoshi H, Tomita T, Nakase T, Hamada M, Oomae T, Tsumoto C, Hirata Y, Iguchi M, Edogawa S, Kawai H, Yoshikawa H. Celecoxib, a cyclooxygenase-2 inhibitor, improved upper gastrointestinal lesions in rheumatoid arthritis patients as assessed by endoscopic evaluation. Mod Rheumatol 2012; 22: [PMID: DOI: /s ] 11 Arellanes-Robledo J, Márquez-Rosado L, Pérez-Carreón JI, Fattel-Fazenda S, Aguirre-García J, Villa-Treviño S. Celecoxib induces regression of putative preneoplastic lesions in rat liver. Anticancer Res 2006; 26: [PMID: ] 12 Gupta A, Dhir A, Kumar A, Kulkarni SK. Protective effect of cyclooxygenase (COX)-inhibitors against drug-induced catatonia and MPTP-induced striatal lesions in rats. Pharmacol Biochem Behav 2009; 94: [PMID: DOI: /j.pbb ] 13 Abd El-Aal SA, El-Sawalhi MM, Seif-El-Nasr M, Kenawy SA. Effect of celecoxib and L-NAME on global ischemia-reperfusion injury in the rat hippocampus. Drug Chem Toxicol 2013; 36: [PMID: DOI: / ] 14 Zandieh A, Maleki F, Hajimirzabeigi A, Zandieh B, Khalilzadeh O, Dehpour AR. Anticonvulsant effect of celecoxib on pentylenetetrazole-induced convulsion: Modulation by NO pathway. Acta Neurobiol Exp (Wars) 2010; 70: [PMID: ] 15 Berenguer B, Alarcón De La Lastra C, Motilva V, La Casa C, Herrerias JM, Pozo D, Calero MJ. Effects of celecoxib on acidchallenged gastric mucosa of rats: comparison with metamizol and piroxicam. Dig Dis Sci 2004; 49: [PMID: ] 16 Yamakawa N, Suzuki K, Yamashita Y, Katsu T, Hanaya K, Shoji M, Sugai T, Mizushima T. Structure-activity relationship of celecoxib and rofecoxib for the membrane permeabilizing activity. Bioorg Med Chem 2014; 22: [PMID: DOI: / j.bmc ] 17 Ishihara T, Tanaka K, Tashiro S, Yoshida K, Mizushima T. Protective effect of rebamipide against celecoxib-induced gastric mucosal cell apoptosis. Biochem Pharmacol 2010; 79: [PMID: DOI: /j.bcp ] 18 Ma J, Yuan G, Chen MH. [Non-steroidal anti-inflammatory drug induced gastropathy and preventive effects of teprenone on the gastropathy in rats]. Zhonghua Yi Xue Za Zhi 2006; 86: [PMID: DOI: /j:issn: ] 19 Pajdo R, Brzozowski T, Szlachcic A, Konturek PC, Ptak-Belowska A, Drozdowicz D, Targosz A, Konturek SJ, Pawlik WW. Lipoxins, the novel mediators of gastroprotection and gastric adaptation to ulcerogenic action of aspirin. Curr Pharm Des 2011; 17: [PMID: DOI: / ] 20 Toller IM, Hitzler I, Sayi A, Mueller A. Prostaglandin E2 prevents Helicobacter-induced gastric preneoplasia and facilitates persistent infection in a mouse model. Gastroenterology 2010; 138: , 1467.e e4 [PMID: DOI: / j.gastro ] 21 Junqueira-Júnior J, Junqueira AF, Medeiros JV, Barbosa SH, Nogueira AC, Mota JM, Santana AP, Brito GA, Ribeiro RA, Lima- Júnior RC, Souza MH. Role of capsaicin-sensitive primary afferent neurons and non-protein sulphydryl groups on gastroprotective effect of amifostine against ethanol-induced gastric damage in rats. Dig Dis Sci 2011; 56: [PMID: DOI: / s ] 22 Sendur P, Ceranowicz P, Sendur R, Cieszkowski J, Warzecha Z, Dembiński A. [Involvement of endogenous tachykinins in the development of jejunal mucosa injury induced by on-steroidal anti-inflammatory drugs]. Przegl Lek 2013; 70: [PMID: ] 23 Zwolinska-Wcislo M, Krzysiek-Maczka G, Ptak-Belowska A, Karczewska E, Pajdo R, Sliwowski Z, Urbanczyk K, Drozdowicz D, Konturek SJ, Pawlik WW, Brzozowski T. Antibiotic treatment with ampicillin accelerates the healing of colonic damage impaired by aspirin and coxib in the experimental colitis. Importance of intestinal bacteria, colonic microcirculation and proinflammatory cytokines. J Physiol Pharmacol 2011; 62: [PMID: ] 24 Baik EJ, Kim EJ, Lee SH, Moon C. Cyclooxygenase-2 selective inhibitors aggravate kainic acid induced seizure and neuronal cell death in the hippocampus. Brain Res 1999; 843: [PMID: ] 25 Coppelli G, Guaita E, Spaggiari S, Coruzzi G. Gastric effects of the selective cyclooxygenase-2 inhibitor, celecoxib, in the rat. Dig Liver Dis 2004; 36: [PMID: DOI: /j.dld ] 26 Auriel E, Regev K, Korczyn AD. Nonsteroidal anti-inflammatory drugs exposure and the central nervous system. Handb Clin Neurol 2014; 119: [PMID: DOI: /B ] 27 Bessone F. Non-steroidal anti-inflammatory drugs: What is the actual risk of liver damage? World J Gastroenterol 2010; 16: [PMID: DOI: /wjg.v16.i ] 28 Whittle BJ, László F, Evans SM, Moncada S. Induction of nitric oxide synthase and microvascular injury in the rat jejunum 5311 August 7, 2017 Volume 23 Issue 29

70 Drmic D et al. Celecoxib, BPC 157 and the NO system provoked by indomethacin. Br J Pharmacol 1995; 116: [PMID: ] 29 Sikiric P, Seiwerth S, Brcic L, Sever M, Klicek R, Radic B, Drmic D, Ilic S, Kolenc D. Revised Robert s cytoprotection and adaptive cytoprotection and stable gastric pentadecapeptide BPC 157. Possible significance and implications for novel mediator. Curr Pharm Des 2010; 16: [PMID: DOI: / ] 30 Klicek R, Kolenc D, Suran J, Drmic D, Brcic L, Aralica G, Sever M, Holjevac J, Radic B, Turudic T, Kokot A, Patrlj L, Rucman R, Seiwerth S, Sikiric P. Stable gastric pentadecapeptide BPC 157 heals cysteamine-colitis and colon-colon-anastomosis and counteracts cuprizone brain injuries and motor disability. J Physiol Pharmacol 2013; 64: [PMID: ] 31 Stupnisek M, Franjic S, Drmic D, Hrelec M, Kolenc D, Radic B, Bojic D, Vcev A, Seiwerth S, Sikiric P. Pentadecapeptide BPC 157 reduces bleeding time and thrombocytopenia after amputation in rats treated with heparin, warfarin or aspirin. Thromb Res 2012; 129: [PMID: DOI: /j.thromres ] 32 Sikiric P, Seiwerth S, Grabarevic Z, Rucman R, Petek M, Jagic V, Turkovic B, Rotkvic I, Mise S, Zoricic I, Konjevoda P, Perovic D, Simicevic V, Separovic J, Hanzevacki M, Ljubanovic D, Artukovic B, Bratulic M, Tisljar M, Rekic B, Gjurasin M, Miklic P, Buljat G. Pentadecapeptide BPC 157 positively affects both non-steroidal anti-inflammatory agent-induced gastrointestinal lesions and adjuvant arthritis in rats. J Physiol Paris 1997; 91: [PMID: DOI: /S (97) ] 33 Jelovac N, Sikiric P, Rucman R, Petek M, Marovic A, Perovic D, Seiwerth S, Mise S, Turkovic B, Dodig G, Miklic P, Buljat G, Prkacin I. Pentadecapeptide BPC 157 attenuates disturbances induced by neuroleptics: the effect on catalepsy and gastric ulcers in mice and rats. Eur J Pharmacol 1999; 379: [PMID: ] 34 Duplancic B, Stambolija V, Holjevac J, Zemba M, Balenovic I, Drmic D, Suran J, Radic B, Filipovic M, Blagaic AB, Brcic L, Kolenc D, Grabarevic Z, Seiwerth S, Sikiric P. Pentadecapeptide BPC 157 and anaphylactoid reaction in rats and mice after intravenous dextran and white egg administration. Eur J Pharmacol 2014; 727: [PMID: DOI: /j.ejphar ] 35 Sikirić P, Seiwerth S, Grabarević Z, Rucman R, Petek M, Jagić V, Turković B, Rotkvić I, Mise S, Zoricić I, Konjevoda P, Perović D, Jurina L, Separović J, Hanzevacki M, Artuković B, Bratulić M, Tisljar M, Gjurasin M, Miklić P, Stancić-Rokotov D, Slobodnjak Z, Jelovac N, Marović A. The influence of a novel pentadecapeptide, BPC 157, on N(G)-nitro-L-arginine methylester and L-arginine effects on stomach mucosa integrity and blood pressure. Eur J Pharmacol 1997; 332: [PMID: DOI: / S (97) ] 36 Turkovic B, Sikiric P, Seiwerth S, Mise S, Anic T, Petek M, Rucman R. Stable gastric pentadecapeptide BPC 157 studied for inflammatory bowel disease (PLD116, PL14736, Pliva) induces nitric oxide synthesis. Gastroenterology 2004; 126: A287-A Berra-Romani R, Avelino-Cruz JE, Raqeeb A, Della Corte A, Cinelli M, Montagnani S, Guerra G, Moccia F, Tanzi F. Ca² + -dependent nitric oxide release in the injured endothelium of excised rat aorta: a promising mechanism applying in vascular prosthetic devices in aging patients. BMC Surg 2013; 13 Suppl 2: S40 [PMID: DOI: / S2-S40] 38 Cesarec V, Becejac T, Misic M, Djakovic Z, Olujic D, Drmic D, Brcic L, Rokotov DS, Seiwerth S, Sikiric P. Pentadecapeptide BPC 157 and the esophagocutaneous fistula healing therapy. Eur J Pharmacol 2013; 701: [PMID: DOI: / j.ejphar ] 39 Chang CH, Tsai WC, Lin MS, Hsu YH, Pang JH. The promoting effect of pentadecapeptide BPC 157 on tendon healing involves tendon outgrowth, cell survival, and cell migration. J Appl Physiol (1985) 2011; 110: [PMID: DOI: / japplphysiol ] 40 Chang CH, Tsai WC, Hsu YH, Pang JH. Pentadecapeptide BPC 157 enhances the growth hormone receptor expression in tendon fibroblasts. Molecules 2014; 19: [PMID: DOI: /molecules ] 41 Huang T, Zhang K, Sun L, Xue X, Zhang C, Shu Z, Mu N, Gu J, Zhang W, Wang Y, Zhang Y, Zhang W. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro. Drug Des Devel Ther 2015; 9: [PMID: DOI: /DDDT.S82030] 42 Tkalcević VI, Cuzić S, Brajsa K, Mildner B, Bokulić A, Situm K, Perović D, Glojnarić I, Parnham MJ. Enhancement by PL of granulation and collagen organization in healing wounds and the potential role of egr-1 expression. Eur J Pharmacol 2007; 570: [PMID: DOI: /j.ejphar ] 43 Tetsuka T, Daphna-Iken D, Miller BW, Guan Z, Baier LD, Morrison AR. Nitric oxide amplifies interleukin 1-induced cyclooxygenase-2 expression in rat mesangial cells. J Clin Invest 1996; 97: [PMID: DOI: /JCI118641] P- Reviewer: Swierczynski JT S- Editor: Gong ZM L- Editor: A E- Editor: Li D 5312 August 7, 2017 Volume 23 Issue 29

71 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Basic Study ORIGINAL ARTICLE Hwangryunhaedok-tang induces the depolarization of pacemaker potentials through 5-HT3 and 5-HT4 receptors in cultured murine small intestine interstitial cells of Cajal Hyun Jung Kim, Guem San Lee, Hyungwoo Kim, Byung Joo Kim Hyun Jung Kim, Byung Joo Kim, Division of Longevity and Biofunctional Medicine, Healthy Aging Korean Medical Research Center, School of Korean Medicine, Pusan National University, Yangsan 50612, South Korea Guem San Lee, Wonkwang University College of Korean Medicine, Iksan 54538, South Korea Hyungwoo Kim, Division of Pharmacology, School of Korean Medicine, Pusan National University, Yangsan 50612, South Korea Byung Joo Kim, Division of Longevity and Biofunctional Medicine, School of Korean Medicine, Pusan National University, Gyeongsangnamdo 50612, South Korea Author contributions: Kim HJ and Kim BJ designed the research; Kim HJ, Lee GS and Kim H performed the experiments; Kim HJ and Kim BJ analyzed the data; and Kim HJ and Kim BJ wrote the paper. Supported by the National Research Foundation of Korea Grant funded by the Korea Government (MSIP), No. 2014R1A5A Institutional animal care and use committee statement: the animal care and experiments in accordance with the guidelines issued by the Institutional Animal Care and Use Committee at Pusan National University (Busan, Republic of Korea; Approval No. PNU ). Conflict-of-interest statement: The authors have no disclosures to report. Data sharing statement: No additional are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Byung Joo Kim, PhD, Associate Professor, Division of Longevity and Biofunctional Medicine, School of Korean Medicine, Pusan National University, Beomeori, Mulgeumeup, Yangsan, Gyeongsangnamdo 50612, South Korea. vision@pusan.ac.kr Telephone: Fax: Received: March 2, 2017 Peer-review started: March 4, 2017 First decision: April 6, 2017 Revised: April 18, 2017 Accepted: June 9, 2017 Article in press: June 12, 2017 Published online: August 7, 2017 Abstract AIM To investigate the effects of a water extract of Hwangryunhaedok-tang (HHTE) on the pacemaker potentials of mouse interstitial cells of Cajal (ICCs). METHODS We dissociated ICCs from small intestines and cultured. ICCs were immunologically identified using an antic-kit antibody. We used the whole-cell patch-clamp configuration to record the pacemaker potentials generated by cultured ICCs under the current clamp mode (I = 0). All experiments were performed at RESULTS HHTE dose-dependently depolarized ICC pacemaker potentials. Pretreatment with a 5-HT3 receptor anta August 7, 2017 Volume 23 Issue 29

72 Kim HJ et al. Hwangryunhaedok-tang and ICCs gonist (Y25130) or a 5-HT4 receptor antagonist (RS39604) blocked HHTE-induced pacemaker potential depolarizations, whereas pretreatment with a 5-HT7 receptor antagonist (SB269970) did not. Intracellular GDPβS inhibited HHTE-induced pacemaker potential depolarization and pretreatment with a Ca 2+ -free solution or thapsigargin abolished the pacemaker potentials. In the presence of a Ca 2+ -free solution or thapsigargin, HHTE did not depolarize ICC pacemaker potentials. In addition, HHTE-induced pacemaker potential depolarization was unaffected by a PKC inhibitor (calphostin C) or a Rho kinase inhibitor (Y27632). Of the four ingredients of HHT, Coptidis Rhizoma and Gardeniae Fructus more effectively inhibited pacemaker potential depolarization. CONCLUSION These results suggest that HHTE dose-dependently depolarizes ICC pacemaker potentials through 5-HT3 and 5-HT4 receptors via external and internal Ca 2+ regulation and via G protein-, PKC- and Rho kinase-independent pathways. Key words: Hwangryunhaedok-tang; Interstitial cells of Cajal; Pacemaker potentials; Gastrointestinal tract; Motility The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Hwangryunhaedok-tang, a traditional herbal medicine, has been used to treat gastrointestinal diseases. Our data suggest that HHT can depolarize the pacemaker potentials of cultured interstitial cells of Cajal from mouse small intestine and may be a novel prokinetic agent. Kim HJ, Lee GS, Kim H, Kim BJ. Hwangryunhaedok-tang induces the depolarization of pacemaker potentials through 5-HT3 and 5-HT4 receptors in cultured murine small intestine interstitial cells of Cajal. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5313.htm DOI: i INTRODUCTION Herbal medicines are becoming increasingly popular in modern societies and substantial research has been conducted to establish their pharmacological properties according to scientific principles [1]. Since ancient times, people have used herbal medicines to treat and prevent disease. Due to their natural origins, herbal medicines have mild activities and few side effects; for this reason, many people are becoming increasingly interested in traditional herbal medicines [2-5]. Hwangryunhaedok-tang (HHT; Huang-Lian-Jie- Tang in Chinese or Oren-gedoku-to in Japanese) is a preparation that consists of Rhizoma Coptidis, Radix Scutellariae, Cortex Phellodendri and Fructus Gardenia [6]. HHT has been used to treat various symptoms, including inflammatory diseases [7,8], cardiovascular diseases [9], diabetes mellitus [10], liver diseases [11,12], brain injury [13,14] and obesity [15]. HHT is also used to prevent or ameliorate gastrointestinal (GI) diseases [16-19]. HHT has been shown to have a preventive effect on the development of water immersion restraint (WIR) stress-induced acute gastric lesions in rats [16] and it suppresses the symptoms of inflammatory bowel disease by reducing levels of interleukin-8 (IL-8), leukotriene B4 (LTB4) and prostaglandin E2 (PGE2) [17]. In addition, HHT has been shown to prevent lethal indomethacin (IND)-induced enteropathy by decreasing adenosine deaminase (ADA) and, thus, increasing the adenosine levels in female BALB/c mice [18]. Interstitial cells of Cajal (ICCs) contribute to normal GI function, such as by generating electrical slow waves and mediating neuromuscular signaling [19-21]. Damage to ICCs or reductions in ICC numbers have been described in many GI motility disorders [22-24] ; therefore, it is very important to understand the mechanisms of ICC pacemaker activity. However, no scientific evidence of a relationship between HHT and ICCs has been presented until now. In the present study, we investigated the effects of water extracts of HHT and its components on the pacemaker potentials of cultured ICCs from murine small intestine. MATERIALS AND METHODS Preparation of HHT extract HHT was purchased from I-WORLD Pharmaceuticals (Incheon, South Korea). HHT (3.67 g) consists of Coptidis Rhizoma (0.67 g), Scutellariae Radix (1.00 g), Phellodendri Cortex (1.00 g) and Gardeniae Fructus (1.00 g). The materials were authenticated by Prof. Hyungwoo Kim (Division of Pharmacology, Pusan National University, School of Korean Medicine, Yangsan, Korea). HHT extract (HHTE) was prepared by boiling HHT in water for three hours. The standard adult dose of HHTE is g (crude material) per day. More information about HHTE can be found at the I-WORLD Pharmaceuticals Homepage ( koreasme.com). HHTE was dissolved in distilled water at a concentration of 0.5 g (crude drug)/ml and stored in a refrigerator until required. Reagents Geniposide, berberine chloride, baicalin and wogonin were purchased from Wako (Japan). High-performance liquid chromatography (HPLC)-grade water and methanol were obtained from JT Baker Inc. (Phillipsburg, NJ, United States). Trifluoroacetic acid was purchased from Sigma-Aldrich (St. Louis, MO, United States). Preparation of standard solutions Each standard compound (geniposide, berberine chloride, 5314 August 7, 2017 Volume 23 Issue 29

73 Kim HJ et al. Hwangryunhaedok-tang and ICCs A B C D Control HHTE 10 mg/ml HHTE 30 mg/ml HHTE 50 mg/ml -35 mv -59 mv -33 mv -59 mv -34 mv -57 mv -34 mv -59 mv E F G Degree of depolarization (mv) Amplitude (mv) Frequency (cycles/min) e e CTRL HHTE mg/ml e e CTRL HHTE mg/ml e e CTRL HHTE mg/ml Figure 1 Effects of water extract of Hwangryunhaedok-tang on the pacemaker potentials of cultured interstitial cells of Cajal from murine small intestine. A-D: HHTE (0-50 mg/ml) induced pacemaker potential depolarizations and decreased amplitudes in a concentration-dependent manner. Responses to HHTE are summarized (E-G). Bars indicate the means ± SEMs. e P < 0.001: significantly different from the control. CTRL: Control; HHTE: Water extract of Hwangryunhaedoktang. baicaline and wogonin) was accurately weighed and dissolved in methanol at a concentration of 1000 g/ml and the solution was 10-fold diluted before injection. Chromatographic conditions An Agilent 1200 (Agilent Technologies, Santa Clara, CA, United States) equipped with a quaternary pump, autosampler, column oven and diode-array detector was used. Acquired data were processed using Chemstation software (Ver. B ). Chromatographic separation was performed on an XDB C18 column (4.6 mm 150 mm, 5 μm; Agilent, United States) at 35. The mobile phase consisted of water with 0.1% trifluoroacetic acid (A) and methanol (B). The following program was used: 30% (B) for 1 min, 30%-80% (B) over 1 min-13 min and 80% (B) for 1 min, which was followed by a re-equilibration to 30% (B). The flow rate was set at 0.8 ml/min and the injection volume was 10 μl. The detection wavelengths were 240 nm for geniposide, 260 nm for berberine chloride and 275 nm for baicalin and wogonin. Identification of standard compounds in HHTE Standard compounds were detected in the chromatogram of HHTE at the following retention times: 5.2 min for geniposide, 9.1 min for berberine chloride, 10.1 min for baicalin and 14.7 min for wogonin (Figure 1). Ethics We conducted the animal care and experiments in accordance with the guidelines issued by the Institutional Animal Care and Use Committee (IACUC) at Pusan National University (Busan, Republic of Korea; Approval no. PNU ) and those issued by the National Institute of Health Guide for the Care and Use of Laboratory Animals. Preparation of ICC and ICC clusters ICR mice (Samtako Bio Korea Co., Ltd., Osan, South Korea; 3-7 day-old; weighing 1.9 g-2.2 g) of either sex were used and kept under controlled conditions (20 ± 3, RH 49% ± 6% and light on 7 a.m.-7 p.m.). The small intestines were removed and opened; then, the luminal contents were cleaned using Krebs- Ringer bicarbonate solution and the obtained tissues were pinned to the bases of Sylgard dishes. Mucosae were removed and small tissue strips of intestine muscle were equilibrated for 25 min in Ca 2+ -free Hank s solution with the following solutions (in mmol/l): KCl 5.36, NaCl 125, NaOH 0.34, Na2HCO3 0.44, glucose 10, sucrose 2.9 and HEPES 11 (ph 7.4). Cells were then dispersed in an enzyme solution [1.3 mg/ml collagenase (Worthington Biochemical, Lakewood, NJ, United States), 2.1 mg/ml bovine serum albumin (Sigma-Aldrich, St. Louis, MO, United States), August 7, 2017 Volume 23 Issue 29

74 Kim HJ et al. Hwangryunhaedok-tang and ICCs mg/ml trypsin inhibitor (Sigma-Aldrich, St. Louis, MO, United States) and 0.50 mg/ml ATP (Sigma-Aldrich, St. Louis, MO, United States)]. Cells were then cultured at 37 in a 95% O2-5% CO2 incubator in smooth muscle growth medium (SMGM) (Clonetics, San Diego, CA, United States) supplemented with 2% antibiotics/ antimycotics (Gibco, Grand Island, NY, United States) and 5 ng/ml of murine stem cell factor (SCF) (Sigma- Aldrich, St. Louis, MO, United States). All experiments were performed on ICC cells that were cultured for < 12 h. ICCs were identified immunologically using an anti-c-kit antibody (phycoerythrin (PE)-conjugated rat anti-mouse c-kit monoclonal antibody) (ebioscience, San Diego, CA, United States) at a dilution of 1:50 for 20 min [25]. Because ICCs differed morphologically from other cell types in culture, they were identified by phase contrast microscopy after incubation with anti c-kit antibody. Patch-clamp experiments The cells were transferred onto a solution chamber on the stage of an inverted microscope (IX70, Olympus, Japan). The whole-cell patch-clamp technique was used to record the membrane potentials (current clamp) of cultured ICCs as described previously [21,22] and an Axopatch 200B amplifier (Axon Instruments, Foster City, CA, United States) was used to amplify membrane potentials. The bath solution [Normal Tyrode (NT)] contained 135 mmol/l NaCl, 5 mmol/l KCl, 2 mmol/l CaCl2, 1 mmol/l MgCl2, 10 mmol/l glucose and 10 mmol/l HEPES, with a ph adjusted to 7.4 using NaOH. The internal solution contained 145 mmol/l Cs-glutamate, 8 mmol/l NaCl, 10 mmol/l BAPTA and 10 mmol/l HEPES-CsOH, with a ph adjusted to 7.2 with CsOH. All experiments were performed at Drugs Y25130, RS39604 and SB were purchased from Tocris Bioscience (Bristol, United Kingdom) and all other drugs were obtained from Sigma-Aldrich (St. Louis, MO, United States). For stock solutions, all drugs were dissolved in distilled water or dimethylsulfoxide (DMSO) and stored at -20. The final concentration of DMSO in the bath solution was always < 0.1%. Furthermore, the addition of these chemicals did not alter the bath solution ph. Statistical analysis The results are expressed as the means ± SEMs. N values refer to the numbers of cells used in the experiments. For multiple comparison analysis, we used one-way ANOVA with Bonferroni s post hoc comparison. For statistical analyses, we used Prism 6.0 (GraphPad Software Inc., La Jolla, CA, United States) and Origin version 8.0 (OriginLab Corporation, Northampton, MA, United States). P values < 0.05 were considered statistically significant. RESULTS Functional components of HHTE The presence of geniposide, berberine chloride, baicalin and wogonin in HHTE was established by HPLC and their levels were quantified using calibration curves obtained with purchased standards [26]. Validation of the method confirmed its reliability and stability. The contents of the four marker components of HHTE by HPLC were 2.684% ± 0.014% in geniposide, 0.993% ± 0.006% in berberine chloride, 5.081% ± 0.027% in baicalin and 0.040% ± 0.003% in wogonin. Effects of HHTE on the pacemaker potentials of ICCs Using the whole-cell patch clamp technique, we investigated the characteristics of cell clusters. Cell clusters formed network-like structures after culture for < 12 h and were viable as demonstrated by the generation of spontaneous rhythmic contractions. ICCs were immunologically identified using an antic-kit antibody [25]. All experiments were performed at Under the current clamp mode (I = 0), ICCs generated pacemaker potentials (Figure 1A) with a mean resting membrane potential of ± 1.5 mv and a mean amplitude of 24.9 ± 1.1 mv. Initially, we examined the effects of HHTE on the pacemaker potentials of ICCs. HHTE (10-50 mg/ml) was found to depolarize pacemaker potentials and decrease their amplitudes in a concentration-dependent manner (Figure 1B-D). In the presence of HHTE, the mean degrees of depolarization were 0.1 ± 0.1 mv at 10 mg/ ml, 11.1 ± 0.9 mv at 20 mg/ml and 19.6 ± 1.1 mv at 30 mg/ml (Figure 1E, n = 17), the mean amplitudes were 24.8 ± 1.0 mv at 10 mg/ml, 12.1 ± 0.3 mv at 20 mg/ml and 1.7 ± 0.6 mv at 30 mg/ml (Figure 1F, n = 17) and the mean frequencies were 17.5 ± 1.0 cycles/min at 10 mg/ml, 4.5 ± 1.3 cycles/min at 20 mg/ml and 1.8 ± 0.9 cycles/min at 30 mg/ ml (Figure 1G, n = 17). The summarized values showing the effects of HHTE on pacemaker potentials are provided in Figure 1E, 1F and 1G. These results show HHTE dose-dependently depolarizes the ICC pacemaker potentials. HHTE mechanisms of action on ICCs To identify the connection between HHTE and its receptors in cultured ICCs, we studied the correlation of 5-HT receptors because these receptors are involved in GI tract motility, which is strongly associated with prokinetic activity [27]. In previous studies, 5-HT has been shown to interact with seven 5-HT receptor subtypes in the GI tract and only murine small intestine ICCs express three of these receptors (5-HT3, 4 and 7) [28,29]. To confirm the 5-HT receptor subtypes involved in the effects of HHTE, we used the various 5-HT receptor antagonists and then treated samples with HHTE. A 5-HT3 receptor antagonist (Y25130), a 5-HT4 receptor antagonist (RS39604), or a 5-HT August 7, 2017 Volume 23 Issue 29

75 Kim HJ et al. Hwangryunhaedok-tang and ICCs A -34 mv D 25 B Y μmol/l HHTE 50 mg/ml -58 mv -33 mv Degree of depolarization (mv) e e C RS μmol/l SB μmol/l HHTE 50 mg/ml -59 mv -34 mv -59 mv E Frequency (cycles/min) CTRL Y25130 RS39604 SB HHTE 50 mg/ml 0 CTRL Y25130 RS39604 SB a HHTE 50 mg/ml HHTE 50 mg/ml Figure 2 Effects of 5-HT receptor antagonists on water extract of Hwangryunhaedok-tang-induced pacemaker potential depolarizations in the cultured interstitial cells of Cajal of murine small intestine. A: Y25130 (a 5-HT3 receptor antagonist) inhibited HHTE-induced responses. B: A 5-HT4 receptor antagonist, RS39604, blocked HHTE-induced responses. C: A 5-HT7 receptor antagonist, SB269970, did not block HHTE-induced responses. D and E responses to 5-HT receptor antagonists are summarized. Bars indicate the means ± SEMs. a P < 0.05 and e P < 0.001: Significantly different from nontreated controls. CTRL: Control; HHTE: Water extract of Hwangryunhaedok-tang. A (GDP-β-S 1 mmol/l) HHTE 50 mg/ml -36 mv -59 mv induced pacemaker potential depolarization in the presence of SB was 19.4 ± 1.8 mv (n = 5; Figure 2C-E). These results indicate that HHTE affects ICCs in the murine small intestine through the 5-HT3 and 5-HT4 receptors. B Degree of depolarization (mv) CTRL (GDP-β-S 1 mmol/l) HHTE 50 mg/ml e receptor antagonist (SB269970) was used to pretreat the samples at 10 μmol/l for 5 min; then, HHTE was added. In the case of pretreatment with Y25130, HHTE-induced pacemaker potential depolarization was blocked (Figure 2A) and HHTE-induced pacemaker potential depolarization in the presence of Y25130 was 0.8 ± 0.5 mv (n = 5; Figure 2D and E). RS39604 also blocked HHTE-induced pacemaker potential depolarization. HHTE-induced pacemaker potential depolarization in the presence of RS39604 was 0.5 ± 0.6 mv (n = 5; Figure 2B, D and E). However, pretreatment with SB did not block the HHTEinduced pacemaker potential depolarization. HHTE CTRL (GDP-β-S 1 mmol/l) HHTE 50 mg/ml Figure 3 Effects of GDP-β-S on water extract of Hwangryunhaedok-tanginduced pacemaker potential depolarizations in cultured interstitial cells of Cajal. A: When GDP-β-S (1 mmol/l) was applied in the pipette, HHTE did not depolarize the pacemaker potential. B and C: HHTE-induced responses are summarized. Bars indicate the means ± SEMs. e P < 0.001: Significantly different from nontreated controls. CTRL: Control; HHTE: Water extract of Hwangryunhaedok-tang. C Frequency (cycles/min) Connection of G protein in HHTE-induced pacemaker potential depolarization in ICCs To determine whether G proteins are involved in HHTE-induced pacemaker potential depolarization, we used GDP-β-S (a non-hydrolysable guanosine 5 diphosphate analogue), which inhibits G-protein activation [30,31]. HHTE (50 mg/ml) induced pacemaker potential depolarization in ICCs (Figure 1D); however, when GDP-β-S (1 mmol/l) was applied in the pipette solution, HHTE (50 mg/ml) only caused slight pacemaker potential depolarization (5.2 ± 0.3 mv, n = 5; Figure 3A and B). These results indicate that G protein is involved in HHTE-induced ICC pacemaker potential depolarization. Effects of external and internal Ca 2+ on HHTE-induced pacemaker potential depolarization in ICCs Regulation of external and internal Ca 2+ has an important role in mediating GI smooth muscle contraction and the generation of pacemaker potentials in ICCs [32]. To identify the roles of Ca 2+, HHTE was applied in external Ca 2+ -free conditions or in the presence of an inhibitor of Ca 2+ -ATPase in the endoplasmic reticulum (thapsigargin). In the external Ca 2+ -free conditions, pacemaker potentials were abolished; under this condition, HHTE did not induce pacemaker potential depolarization (n = 6; Figure 4A and C). In addition, pretreatment with thapsigargin abolished pacemaker potentials and under this condition, HHTE also did not induce pacemaker potential depolarization (n = 5317 August 7, 2017 Volume 23 Issue 29

76 Kim HJ et al. Hwangryunhaedok-tang and ICCs A -33 mv C Degree of depolarization (mv) CTRL e Ca 2+ free B Ca 2+ free HHTE 50 mg/ml -58 mv D Degree of depolarization (mv) HHTE 50 mg/ml e CTRL Thapsigargin E 20 HHTE 50 mg/ml Thapsigargin 5 μmol/l HHTE 50 mg/ml -35 mv -58 mv Frequency (cycles/min) e e CTRL Ca 2+ free Thapsigargin HHTE 50 mg/ml Figure 4 Effects of external and internal Ca 2+ on water extract of Hwangryunhaedok-tang-induced pacemaker potential depolarization in cultured interstitial cells of Cajal from murine small intestine. A: In external Ca2 + -free conditions, the pacemaker potentials were abolished and HHTE had no effect. B: Thapsigargin abolished the pacemaker potentials and HHTE had no effects; C-E: HHTE-induced pacemaker potential depolarizations are summarized. Bars represent the means ± SEMs. e P < 0.001: Significantly different from untreated controls. CTRL: Control; HHTE: Water extract of Hwangryunhaedok-tang. A B C Degree of depolarization (mv) Calphostin C 10 μmol/l HHTE 50 mg/ml Y μmol/l HHTE 50 mg/ml 0 CTRL Calphostin Y27631 HHTE 50 mg/ml Frequency (cycles/min) -32 mv -59 mv -35 mv -58 mv 5; Figure 4B and D). These results show that HHTEinduced pacemaker potential depolarization depends CTRL Calphostin Y27631 HHTE 50 mg/ml Figure 5 Effects of protein kinase C inhibitor and Rho kinase inhibitor on water extract of Hwangryunhaedok-tang-induced pacemaker potential depolarizations in cultured interstitial cells of Cajal from murine small intestine. Both (A) calphostin C (a PKC inhibitor) and (B) Y27631 (a Rho kinase inhibitor) had no effects on the pacemaker potentials; under these conditions, HHTE induced pacemaker potential depolarizations. C and D responses to HHTE in the presence of calphostin C or Y27631 are summarized. Bars represent the means ± SEMs. e P < 0.001: significantly different from the nontreated control. CTRL: Control; HHTE: Water extract of Hwangryunhaedoktang; PKC: Protein kinase C. D e e on internal and external Ca 2+. Pathways mediating HHTE-induced pacemaker potential depolarization in ICCs To determine whether HHTE-induced pacemaker potential depolarization is associated with protein kinase C (PKC) or Rho kinase, we pretreated ICCs with a PKC inhibitor (calphostin C, 10 μmol/l, Figure 5A) or a Rho kinase inhibitor (Y27631, 1 μmol/l, Figure 5B) for 5 min. HHTE-induced pacemaker potential depolarizations were not inhibited by calphostin C or Y27632 (Figure 5C). We confirmed that treatment with these inhibitors alone did not affect pacemaker potential depolarization. These results suggest that HHTE-induced pacemaker potential depolarization is not mediated by PKC or Rho kinase in the cultured ICCs of murine small intestine. Effects of Coptidis Rhizoma, Scutellariae Radix, Phellodendri Cortex and Gardeniae Fructus extracts in ICCs We investigated the effects of the four components of HHT, Coptidis Rhizoma, Scutellariae Radix, Phellodendri Cortex and Gardeniae Fructus [6], in cultured ICCs from murine small intestine. All four components depolarized the pacemaker potentials and decreased the amplitudes of the pacemaker potentials (Figures 6 and 7) in a concentration-dependent manner. At a concentration of 30 μg/ml, Coptidis Rhizoma had a mean degree of depolarization of 13.1 ± 2.2 mv (Figure 6A, n = 7), Scutellariae Radix had a mean 5318 August 7, 2017 Volume 23 Issue 29

77 Kim HJ et al. Hwangryunhaedok-tang and ICCs A -33 mv B e C Coptidis Rhizoma 30μg/mL -35 mv -57 mv Degree of depolarization (mv) e CTRL Coptidis Rhizoma (μg/ml) E Frequency (cycles/min) Scutellariae Radix 30 μg/ml -58 mv D Degree of depolarization (mv) e e b CTRL Scutellariae Radix (μg/ml) 0 CTRL CR SR 30 μg/ml Figure 6 Effects of Coptidis Rhizoma and Scutellariae Radix on pacemaker potentials in cultured interstitial cells of Cajal from murine small intestine. A: Pacemaking activities of ICCs exposed to Coptidis Rhizoma (30 μg/ml) in current-clamp mode (I = 0); B: Coptidis Rhizoma (10-50 μg/ml) concentration-dependently induced pacemaker potential depolarization. Responses to Coptidis Rhizoma are summarized; C: Pacemaking activities of ICCs exposed to Scutellariae Radix (30 μg/ml) in the current-clamp mode (I = 0); D: Scutellariae Radix ( μg/ml) concentration-dependently induced pacemaker potential depolarization. Responses to Scutellariae Radix are summarized; E: Frequency changes to Coptidis Rhizoma and Scutellariae Radix are summarized. Bars represent the means ± SEMs. b P < 0.01 and e P < 0.001: Significantly different from the control. CTRL: Control; CR: Coptidis Rhizoma; SR: Scutellariae Radix; ICCs: Interstitial cells of Cajal. degree of depolarization of 0.6 ± 0.4 mv (Figure 6C, n = 7), Phellodendri Cortex had a mean degree of depolarization of 0.7 ± 0.6 mv (Figure 7A, n = 6) and Gardeniae Fructus had a mean degree of depolarization of 9.7 ± 1.5 mv (Figure 7C, n = 7). The summarized values and bar graph showing the effects of these components on pacemaker potentials are provided in Figures 6B, 6D, 6E, 7B, 7D and 7E. These results suggest that Coptidis Rhizoma and Gardeniae Fructus are the main components responsible for HHTE-induced pacemaker potential depolarizations in the cultured ICCs of murine small intestine. DISCUSSION ICCs are located within and around smooth muscle layers of the GI tract and they control GI motility by acting as pacemaker cells [20-22,33,34]. The pacemaker functions of these cells result from the electrical slow waves generated and propagated in smooth muscles [20,35]. Additionally, ICCs are connected to both nerve and smooth muscle cells and they are involved in mechanosensation and neurotransmission [32,34,36]. Many GI motility disorders, such as achalasia and inflammatory bowel disease, have been associated with ICC dysfunctions [37]. Therefore, understanding the mechanisms of ICC and pacemaker activity is very important. In the present study, we show that HHTE depolarized ICC pacemaker potentials through 5-HT3 and 5-HT4 receptors via external and internal Ca 2+ regulation and via G protein-, PKC- and Rho kinaseindependent pathways. Additionally, we tested the effects of HHTE on GI motility in mice in vivo and found that HHTE increased the GI motility in mice [26]. HHT has long been used as an herbal medicine to treat GI disorders in Asia [16-18]. Ohta et al [16] suggested that oral HHT prevents stress-induced acute gastric lesions in rats. Additionally, Zhou and Mineshita [17] reported that HHT showed anti-inflammatory and anti-ulcerative effects on trinitrobenzene-sulfonic acid (TNB)-induced colitis in rats. In that study, HHT was found to inhibit myeloperoxidase activity and to significantly decrease the IL-8, PGE2 and LTB4 levels. Therefore, the authors suggested that HHT may be useful for treating inflammatory bowel disease. In addition, Watanabe-Fukuda et al [18] observed that HHT prevented lethal indomethacin (IND)-induced enteropathy by downregulating adenosine deaminase (ADA) and thus upregulating adenosine (an antiinflammatory nucleoside) levels. Furthermore, these authors reported that berberine, which is a major ingredient of HHT, suppressed ADA expression and reduced the incidence of lethality. In the present study, we found that 5-HT3 or 5-HT August 7, 2017 Volume 23 Issue 29

78 Kim HJ et al. Hwangryunhaedok-tang and ICCs A -34 mv B 30 C Phellodendri Cortex 30 μg/ml -59 mv -35 mv Degree of depolarization (mv) e Gardeniae Fructus 30 μg/ml -58 mv 0 CTRL Phellodendri Cortex (μg/ml) D 30 e E 20 Degree of depolarization (mv) e e e Frequency (cycles/min) a 0 CTRL CTRL PC GF Gardeniae Fructus (μg/ml) 30 μg/ml Figure 7 Effects of Phellodendri Cortex and Gardeniae Fructus on pacemaker potentials in cultured interstitial cells of Cajal from murine small intestine. A: Pacemaking activities of ICCs exposed to Phellodendri Cortex (30 μg/ml) in the current-clamp mode (I = 0); B: Phellodendri Cortex ( μg/ml) concentrationdependently induced pacemaker potential depolarization. Responses to Phellodendri Cortex are summarized; C: Pacemaking activities of ICCs exposed to Gardeniae Fructus (30 μg/ml) in the current-clamp mode (I = 0); D: Gardeniae Fructus ( μg/ml) concentration-dependently induced pacemaker potential depolarizations. Responses to Gardeniae Fructus are summarized; E: Frequency changes to Phellodendri Cortex and Gardeniae Fructus are summarized. Bars represent the means ± SEMs. a P < 0.05 and e P < 0.001: Significantly different from the control. CTRL: Control; PC: Phellodendri Cortex. GF: Gardeniae Fructus. receptors, via external and internal Ca 2+ regulation and via G protein, were involved in HHTE-induced responses in ICCs. Of the seven 5-HT receptor subtypes, the 5-HT3 and 5-HT4 receptors are the most highly expressed and best understood 5-HT receptor subtypes in the GI tract [38,39]. 5-HT3 receptors are ligand-gated cation channels that can initiate peristalsis and secretion in the GI tract [38]. Additionally, 5-HT4 receptors are G-protein-coupled metabotropic receptors and their activation regulates GI motility [39]. Furthermore, these receptors are coupled to G proteins, which have Ca 2+ / calmodulin-dependent activation [40,41]. Additionally, in the present study, HHT-induced pacemaker potential depolarizations via 5-HT3 and 5-HT4 receptors were not inhibited by the Rho kinase inhibitor, Y27632, or the PKC inhibitor, calphostin (Figure 5). These results suggest that HHT-induced pacemaker potential depolarizations are independent of PKC and Rho kinase activation. 5-HT has played a major role in gut function regulation [42]. Among 5-HT receptors, 5-HT3 and 5-HT4 receptors have been the most widely investigated for gut motility [27]. 5-HT3 receptors are mainly targeted to treat diarrhea and abdominal pain [27,43,44] and 5-HT4 receptors are targeted to treat constipation [44,45]. Although each agonist and antagonist has been used effectively, pharmacological agents of 5-HT receptors have problems in their clinical use because of deleterious side effects. In the present study, HHTE affects ICC pacemaker potentials through 5-HT3 and 5-HT4 receptors; therefore, HHTE may be used to treat diarrhea, abdominal pain and constipation, among other symptoms. Of note, future studies will have to be designed to determine the side effects of HHT. The 5-HT3 receptor channels are the only ionotropic receptors within the 5-HT receptor family [46-48]. 5-HT3 receptors are involved in many pathophysiological processes, such as GI motility disorders and the development of nausea and vomiting [48-50]. Therefore, 5-HT3 receptors play an important role in GI motility functions. In this paper, we found that HHTE may activate 5-HT3 and 5-HT4 receptors; among them, 5-HT4 receptors may have the main role in regulating the ICC, whereas 5-HT3 receptors may have a supportive role. Additionally, when GDP-β-S (1 mmol/l) was applied in the pipette solution, we found that HHTE caused slight pacemaker potential depolarization (Figure 3), which might be due to the 5-HT3 receptor signaling pathway. GI disorders are observed in Western and Eastern countries [51]. Because GI disorders are not lethal, the medications used to treat these disorders have a higher safety threshold than those for medications 5320 August 7, 2017 Volume 23 Issue 29

79 Kim HJ et al. Hwangryunhaedok-tang and ICCs used to treat non-gi diseases. However, recent studies have highlighted the substantial health impacts of GI disorders [52]. Furthermore, several GI treatments have significant adverse effects, which has led to the withdrawal of cisapride and tegaserod from the market [53,54]. Of note, herbal products are often used to treat GI disorders like irritable bowel syndrome [55,56] and herbal medications have a desirable role in the treatment of GI disorders. HHT consists of Coptidis Rhizoma, Scutellariae Radix, Phellodendri Cortex and Gardeniae Fructus [6]. We investigated the effects of these four constituents on the pacemaker potentials of ICCs to identify the components that are primarily responsible for the effect of HHT on ICC pacemaker potentials. All four components depolarized pacemaker potentials and decreased the amplitudes of pacemaker potentials in a concentration-dependent manner (Figures 6 and 7). However, Coptidis Rhizoma and Gardeniae Fructus were observed to have greater depolarizing effects. We will perform future experiments to determine the detailed effects of the HHT active elements (Coptidis Rhizoma and Gardeniae Fructus) and identified compounds (geniposide, berberine chloride, baicalin and wogonin) on ICC pacemaking potential. ICCs are pacemaker cells that appear to play important roles in the determination and regulation of GI motility [19,20]. HHTE depolarized the pacemaker potentials of ICCs in a G protein- and Ca 2+ -dependent manner. Based on the findings described in this study, we propose the following model of the effects of HHTE in ICCs. HHTE binds 5-HT3 and 5-HT4 receptors and HHTE-induced pacemaker potential depolarizations are G protein- and Ca 2+ -dependent in ICCs. An increase in intracellular Ca 2+ induces membrane depolarizations on ICCs [57,58]. In addition, these pacemaker potential depolarizations might be regulated by transient receptor potential melastatin 7 (TRPM7) and Ca 2+ - activated Cl - (ANO1) channels [20,59]. In the present study, HHTE was found to regulate ICC pacemaker potential depolarization in a G proteinand Ca 2+ -dependent manner. Accordingly, HHT may play an excitatory role in GI motility regulation. Additionally, because GI motility regulations are highly integrated behaviors between smooth muscle cells, ICCs and enteric nervous systems, further studies are needed to investigate the effects of HHT on other cells in vitro and in vivo. In summary, our findings suggest that HHT can depolarize the pacemaker potentials of cultured ICCs from mouse small intestine. Future research should attempt to identify the components responsible for the effects of HHT and to determine their mechanisms of action in vitro and in vivo. COMMENTS Background Interstitial cells of Cajal (ICCs) are the pacemaker cells that generate slow waves in the gastrointestinal (GI) tract. Hwangryunhaedok-tang (HHT) (consisting of Coptidis Rhizoma, Scutellariae Radix, Phellodendri Cortex and Gardeniae Fructus) is a traditional herbal medicine used to treat GI disorders. However, despite the considerable use of HHT in traditional herbal medicine to treat GI dysfunction, little is known of the effects of a water extract of HHT (HHTE) on the pacemaker potentials of mouse small intestinal ICCs. Research frontiers The prokinetic effects of HHTE are mediated by the induction of pacemaker potentials in ICCs. Innovations and breakthroughs HHTE dose-dependently depolarizes ICC pacemaker potentials through the 5-HT3 and 5-HT4 receptors via external and internal Ca 2+ regulation as well as via G protein-, PKC- and Rho kinase-independent pathways. Applications HHT may be a new target for pharmacological treatment of GI motility disorders. Peer-review The authors investigated the effects of HHT (a traditional herbal medicine) on the pacemaker potentials of mouse ICCs, the results of study suggest that HHT dose-dependently depolarizes ICC pacemaker potentials through 5-HT3 and 5-HT4 receptors via external and internal Ca 2+ regulation and via G protein- and MLCK-dependent pathways. These data are somewhat interesting. REFERENCES 1 Zhang J, Wider B, Shang H, Li X, Ernst E. Quality of herbal medicines: challenges and solutions. Complement Ther Med 2012; 20: [PMID: DOI: /j.ctim ] 2 Normile D. Asian medicine. The new face of traditional Chinese medicine. Science 2003; 299: [PMID: DOI: /science ] 3 Xue T, Roy R. Studying traditional Chinese medicine. Science 2003; 300: [PMID: DOI: /science ] 4 Jiang WY. Therapeutic wisdom in traditional Chinese medicine: a perspective from modern science. Trends Pharmacol Sci 2005; 26: [PMID: DOI: /j.tips ] 5 Liu S, Yi LZ, Liang YZ. Traditional Chinese medicine and separation science. J Sep Sci 2008; 31: [PMID: DOI: /jssc ] 6 Lu T, Song J, Huang F, Deng Y, Xie L, Wang G, Liu X. Comparative pharmacokinetics of baicalin after oral administration of pure baicalin, Radix scutellariae extract and Huang-Lian-Jie-Du-Tang to rats. J Ethnopharmacol 2007; 110: [PMID: DOI: /j.jep ] 7 Lu J, Wang JS, Kong LY. Anti-inflammatory effects of Huang-Lian- Jie-Du decoction, its two fractions and four typical compounds. J Ethnopharmacol 2011; 134: [PMID: DOI: /j.jep ] 8 Yue R, Zhao L, Hu Y, Jiang P, Wang S, Xiang L, Liu W, Zhang W, Liu R. Rapid-resolution liquid chromatography TOF-MS for urine metabolomic analysis of collagen-induced arthritis in rats and its applications. J Ethnopharmacol 2013; 145: [PMID: DOI: /j.jep ] 9 Seo CS, Kim OS, Kim JH, Shin HK. Simultaneous quantification and antiatherosclerosis effect of the traditional Korean medicine, Hwangryunhaedok-tang. BMC Complement Altern Med 2015; 15: 108 [PMID: DOI: /s ] 10 Yu YL, Lu SS, Yu S, Liu YC, Wang P, Xie L, Wang GJ, Liu XD. Huang-lian-jie-du-decoction modulates glucagon-like peptide-1 secretion in diabetic rats. J Ethnopharmacol 2009; 124: [PMID: DOI: /j.jep ] 11 Ohta Y, Kongo-Nishimura M, Hayashi T, Kishikawa T. Effect of Oren-gedoku-to (Huanglian-Jie-Du-Tang) extract on disruption of hepatic antioxidant defense systems in rats treated with 5321 August 7, 2017 Volume 23 Issue 29

80 Kim HJ et al. Hwangryunhaedok-tang and ICCs D-galactosamine. J Ethnopharmacol 2004; 94: [PMID: DOI: /j.jep ] 12 Hsu YL, Kuo PL, Tzeng TF, Sung SC, Yen MH, Lin LT, Lin CC. Huang-lian-jie-du-tang, a traditional Chinese medicine prescription, induces cell-cycle arrest and apoptosis in human liver cancer cells in vitro and in vivo. J Gastroenterol Hepatol 2008; 23: e290-e299 [PMID: DOI: /j x] 13 Hwang YS, Shin CY, Huh Y, Ryu JH. Hwangryun-Hae-Doktang (Huanglian-Jie-Du-Tang) extract and its constituents reduce ischemia-reperfusion brain injury and neutrophil infiltration in rats. Life Sci 2002; 71: [PMID: ] 14 Zhang Q, Ye YL, Yan YX, Zhang WP, Chu LS, Wei EQ, Yu YP. [Protective effects of Huanglian-Jiedu-Tang on chronic brain injury after focal cerebral ischemia in mice]. Zhejiang Da Xue Xue Bao Yi Xue Ban 2009; 38: [PMID: ] 15 Yamakawa J, Ishigaki Y, Takano F, Takahashi T, Yoshida J, Moriya J, Takata T, Tatsuno T, Sasaki K, Ohta T, Takegami T, Yoshizaki F. The Kampo medicines Orengedokuto, Bofutsushosan and Boiogito have different activities to regulate gene expressions in differentiated rat white adipocytes: comprehensive analysis of genetic profiles. Biol Pharm Bull 2008; 31: [PMID: ] 16 Ohta Y, Kobayashi T, Nishida K, Sasaki E, Ishiguro I. Preventive effect of Oren-gedoku-to (Huanglian-Jie-Du-Tang) extract on the development of stress-induced acute gastric mucosal lesions in rats. J Ethnopharmacol 1999; 67: [PMID: ] 17 Zhou H, Mineshita S. The effect of Oren-gedoku-to on experimental colitis in rats. J Pharm Pharmacol 1999; 51: [PMID: ] 18 Watanabe-Fukuda Y, Yamamoto M, Miura N, Fukutake M, Ishige A, Yamaguchi R, Nagasaki M, Saito A, Imoto S, Miyano S, Takeda J, Watanabe K. Orengedokuto and berberine improve indomethacin-induced small intestinal injury via adenosine. J Gastroenterol 2009; 44: [PMID: DOI: / s ] 19 Huizinga JD, Thuneberg L, Klüppel M, Malysz J, Mikkelsen HB, Bernstein A. W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity. Nature 1995; 373: [PMID: DOI: /373347a0] 20 Kim BJ, Lim HH, Yang DK, Jun JY, Chang IY, Park CS, So I, Stanfield PR, Kim KW. Melastatin-type transient receptor potential channel 7 is required for intestinal pacemaking activity. Gastroenterology 2005; 129: [PMID: DOI: /j.gastro ] 21 Kim HJ, Wie J, So I, Jung MH, Ha KT, Kim BJ. Menthol Modulates Pacemaker Potentials through TRPA1 Channels in Cultured Interstitial Cells of Cajal from Murine Small Intestine. Cell Physiol Biochem 2016; 38: [PMID: DOI: / ] 22 He CL, Burgart L, Wang L, Pemberton J, Young-Fadok T, Szurszewski J, Farrugia G. Decreased interstitial cell of cajal volume in patients with slow-transit constipation. Gastroenterology 2000; 118: [PMID: ] 23 He CL, Soffer EE, Ferris CD, Walsh RM, Szurszewski JH, Farrugia G. Loss of interstitial cells of cajal and inhibitory innervation in insulin-dependent diabetes. Gastroenterology 2001; 121: [PMID: ] 24 Zárate N, Mearin F, Wang XY, Hewlett B, Huizinga JD, Malagelada JR. Severe idiopathic gastroparesis due to neuronal and interstitial cells of Cajal degeneration: pathological findings and management. Gut 2003; 52: [PMID: ] 25 Gim H, Nam JH, Lee S, Shim JH, Kim HJ, Ha KT, Kim BJ. Quercetin Inhibits Pacemaker Potentials via Nitric Oxide/cGMP- Dependent Activation and TRPM7/ANO1 Channels in Cultured Interstitial Cells of Cajal from Mouse Small Intestine. Cell Physiol Biochem 2015; 35: [PMID: DOI: / ] 26 Kim H, Kim I, Lee MC, Kim HJ, Lee GS, Kim H, Kim BJ. Effects of Hwangryunhaedok-tang on gastrointestinal motility function in mice. World J Gastroenterol 2017; 23: [PMID: DOI: /wjg.v23.i ] 27 Gershon MD, Tack J. The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 28 Liu HN, Ohya S, Nishizawa Y, Sawamura K, Iino S, Syed MM, Goto K, Imaizumi Y, Nakayama S. Serotonin augments gut pacemaker activity via 5-HT3 receptors. PLoS One 2011; 6: e24928 [PMID: DOI: /journal.pone ] 29 Shahi PK, Choi S, Zuo DC, Yeum CH, Yoon PJ, Lee J, Kim YD, Park CG, Kim MY, Shin HR, Oh HJ, Jun JY. 5-hydroxytryptamine generates tonic inward currents on pacemaker activity of interstitial cells of cajal from mouse small intestine. Korean J Physiol Pharmacol 2011; 15: [PMID: DOI: / kjpp ] 30 Komori S, Kawai M, Takewaki T, Ohashi H. GTP-binding protein involvement in membrane currents evoked by carbachol and histamine in guinea-pig ileal muscle. J Physiol 1992; 450: [PMID: ] 31 Ogata R, Inoue Y, Nakano H, Ito Y, Kitamura K. Oestradiolinduced relaxation of rabbit basilar artery by inhibition of voltagedependent Ca channels through GTP-binding protein. Br J Pharmacol 1996; 117: [PMID: ] 32 Lee JH, Kim SY, Kwon YK, Kim BJ, So I. Characteristics of the cholecystokinin-induced depolarization of pacemaking activity in cultured interstitial cells of Cajal from murine small intestine. Cell Physiol Biochem 2013; 31: [PMID: DOI: / ] 33 Torihashi S, Horisawa M, Watanabe Y. c-kit immunoreactive interstitial cells in the human gastrointestinal tract. J Auton Nerv Syst 1999; 75: [PMID: ] 34 Rumessen JJ, Vanderwinden JM. Interstitial cells in the musculature of the gastrointestinal tract: Cajal and beyond. Int Rev Cytol 2003; 229: [PMID: ] 35 Sanders KM, Koh SD, Ro S, Ward SM. Regulation of gastrointestinal motility--insights from smooth muscle biology. Nat Rev Gastroenterol Hepatol 2012; 9: [PMID: DOI: /nrgastro ] 36 Sanders KM, Ward SM. Kit mutants and gastrointestinal physiology. J Physiol 2007; 578: [PMID: DOI: / jphysiol ] 37 Vanderwinden JM, Rumessen JJ. Interstitial cells of Cajal in human gut and gastrointestinal disease. Microsc Res Tech 1999; 47: [PMID: DOI: /(SICI) ( )47:5<344::AID-JEMT6>3.0.CO;2-1] 38 Taniyama K, Makimoto N, Furuichi A, Sakurai-Yamashita Y, Nagase Y, Kaibara M, Kanematsu T. Functions of peripheral 5-hydroxytryptamine receptors, especially 5-hydroxytryptamine4 receptor, in gastrointestinal motility. J Gastroenterol 2000; 35: [PMID: ] 39 Wouters MM, Farrugia G, Schemann M. 5-HT receptors on interstitial cells of Cajal, smooth muscle and enteric nerves. Neurogastroenterol Motil 2007; 19 Suppl 2: 5-12 [PMID: DOI: /j x] 40 Murthy KS, Makhlouf GM. Opioid mu, delta, and kappa receptorinduced activation of phospholipase C-beta 3 and inhibition of adenylyl cyclase is mediated by Gi2 and G(o) in smooth muscle. Mol Pharmacol 1996; 50: [PMID: ] 41 Murthy KS, Zhou H, Grider JR, Brautigan DL, Eto M, Makhlouf GM. Differential signalling by muscarinic receptors in smooth muscle: m2-mediated inactivation of myosin light chain kinase via Gi3, Cdc42/Rac1 and p21-activated kinase 1 pathway, and m3- mediated MLC20 (20 kda regulatory light chain of myosin II) phosphorylation via Rho-associated kinase/myosin phosphatase targeting subunit 1 and protein kinase C/CPI-17 pathway. Biochem J 2003; 374: [PMID: DOI: /BJ ] 42 Kendig DM, Grider JR. Serotonin and colonic motility. Neurogastroenterol Motil 2015; 27: [PMID: DOI: /nmo.12617] 43 Vanuytsel T, Tack JF, Boeckxstaens GE. Treatment of abdominal 5322 August 7, 2017 Volume 23 Issue 29

81 Kim HJ et al. Hwangryunhaedok-tang and ICCs pain in irritable bowel syndrome. J Gastroenterol 2014; 49: [PMID: DOI: /s ] 44 Spiller R. Recent advances in understanding the role of serotonin in gastrointestinal motility in functional bowel disorders: alterations in 5-HT signalling and metabolism in human disease. Neurogastroenterol Motil 2007; 19 Suppl 2: [PMID: DOI: /j x] 45 Hoffman JM, Tyler K, MacEachern SJ, Balemba OB, Johnson AC, Brooks EM, Zhao H, Swain GM, Moses PL, Galligan JJ, Sharkey KA, Greenwood-Van Meerveld B, Mawe GM. Activation of colonic mucosal 5-HT(4) receptors accelerates propulsive motility and inhibits visceral hypersensitivity. Gastroenterology 2012; 142: e4 [PMID: DOI: /j.gastro ] 46 Derkach V, Surprenant A, North RA. 5-HT3 receptors are membrane ion channels. Nature 1989; 339: [PMID: DOI: /339706a0] 47 Hannon J, Hoyer D. Molecular biology of 5-HT receptors. Behav Brain Res 2008; 195: [PMID: DOI: / j.bbr ] 48 Herbrechter R, Ziemba PM, Hoffmann KM, Hatt H, Werner M, Gisselmann G. Identification of Glycyrrhiza as the rikkunshito constituent with the highest antagonistic potential on heterologously expressed 5-HT3A receptors due to the action of flavonoids. Front Pharmacol 2015; 6: 130 [PMID: DOI: / fphar ] 49 Gershon MD. Review article: serotonin receptors and transporters -- roles in normal and abnormal gastrointestinal motility. Aliment Pharmacol Ther 2004; 20 Suppl 7: 3-14 [PMID: DOI: /j x] 50 Costedio MM, Hyman N, Mawe GM. Serotonin and its role in colonic function and in gastrointestinal disorders. Dis Colon Rectum 2007; 50: [PMID: DOI: / s ] 51 Chang L. Review article: epidemiology and quality of life in functional gastrointestinal disorders. Aliment Pharmacol Ther 2004; 20 Suppl 7: [PMID: DOI: / j x] 52 Talley NJ. Functional gastrointestinal disorders as a public health problem. Neurogastroenterol Motil 2008; 20 Suppl 1: [PMID: DOI: /j x] 53 Glessner MR, Heller DA. Changes in related drug class utilization after market withdrawal of cisapride. Am J Manag Care 2002; 8: [PMID: ] 54 Pasricha PJ. Desperately seeking serotonin... A commentary on the withdrawal of tegaserod and the state of drug development for functional and motility disorders. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 55 Rawsthorne P, Shanahan F, Cronin NC, Anton PA, Löfberg R, Bohman L, Bernstein CN. An international survey of the use and attitudes regarding alternative medicine by patients with inflammatory bowel disease. Am J Gastroenterol 1999; 94: [PMID: DOI: /j x] 56 Seeff LB, Lindsay KL, Bacon BR, Kresina TF, Hoofnagle JH. Complementary and alternative medicine in chronic liver disease. Hepatology 2001; 34: [PMID: DOI: / jhep ] 57 Park KJ, Hennig GW, Lee HT, Spencer NJ, Ward SM, Smith TK, Sanders KM. Spatial and temporal mapping of pacemaker activity in interstitial cells of Cajal in mouse ileum in situ. Am J Physiol Cell Physiol 2006; 290: C1411-C1427 [PMID: DOI: /ajpcell ] 58 Lee HT, Hennig GW, Park KJ, Bayguinov PO, Ward SM, Sanders KM, Smith TK. Heterogeneities in ICC Ca 2+ activity within canine large intestine. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 59 Zhu MH, Kim TW, Ro S, Yan W, Ward SM, Koh SD, Sanders KM. A Ca(2+)-activated Cl(-) conductance in interstitial cells of Cajal linked to slow wave currents and pacemaker activity. J Physiol 2009; 587: [PMID: DOI: / jphysiol ] P- Reviewer: Baker S, Liu S, Xu WX S- Editor: Gong ZM L- Editor: A E- Editor: Li D 5323 August 7, 2017 Volume 23 Issue 29

82 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) ORIGINAL ARTICLE Basic Study MicroRNA exhibit altered expression in the inflamed colonic mucosa of ulcerative colitis patients Swati Valmiki, Vineet Ahuja, Jaishree Paul Swati Valmiki, Jaishree Paul, School of Life Sciences, Jawaharlal Nehru University, New Delhi , India Vineet Ahuja, Department of Gastroenterology, All India Institute of Medical Sciences, New Delhi , India Author contributions: Valmiki S and Paul J designed the study, analyzed the data and wrote the manuscript; Valmiki S performed the experiments; Ahuja V provided the samples with clinical history. Supported by Department of Biotechnology, Ministry of Science and Technology, New Delhi, Government of India vide BT/PR8348/MED/30/1023/2013 to Paul J; PURSE grant from the Department of Science and Technology, New Delhi India vide 6(54) SLS/JP/DST PURSE/ Institutional review board statement: The study has been ethically approved from the Institute Ethics Committee, All India Institute of Medical Sciences (Ref. No. T-290/ , RT-7/ ) and Institutional Ethics Review Board, JNU (IERB Ref. No.2016/Student/93). Conflict-of-interest statement: The authors declare no conflict of interest in the present study. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Dr. Jaishree Paul, School of Life Sciences, Jawaharlal Nehru University, New Delhi , India. jaishree@mail.jnu.ac.in Telephone: Fax: Received: February 7, 2017 Peer-review started: February 8, 2017 First decision: March 30, 2017 Revised: May 22, 2017 Accepted: June 1, 2017 Article in press: June 1, 2017 Published online: August 7, 2017 Abstract AIM To investigate the mirna expression in colonic mucosal biopsies from endoscopically inflamed and non inflamed regions of ulcerative colitis (UC) patients. METHODS Colonic mucosal pinch biopsies were analyzed from the inflamed and non inflamed regions of same UC patient. Total RNA was isolated and differential mirna profiling was done using microarray platform. Quantitative Real Time PCR was performed in colonic biopsies from inflamed (n = 8) and non-inflamed (n = 8) regions of UC and controls (n = 8) to validate the differential expression of mirna. Potential targets of dysregulated mirna were identified by using in silico prediction tools and probable role of these mirna in inflammatory pathways were predicted. RESULTS The mirna profile of inflamed colonic mucosa differs significantly from the non-inflamed. Real time PCR analysis showed that some of the mirna were differentially expressed in the inflamed mucosa as compared to non inflamed mucosa and controls (mir- 125b, mir-223, mir-138, and mir-155), while (mir- 200a) did not show any significant changes. In contrast to microarray, where mir-378d showed downregulation in the inflamed mucosa, qrt-pcr showed a significant upregulation in the inflamed mucosa as compared 5324 August 7, 2017 Volume 23 Issue 29

83 Valmiki S et al. Spatial expression of mirna in UC patients to the non inflamed. The in silico prediction analysis revealed that the genes targeted by these mirnas play role in the major signaling pathways like MAPK pathway, NF-κB signaling pathway, cell adhesion molecules which are all assciated with UC. CONCLUSION The present study reports disease specific alteration in the expression of mir-125b, mir-155, mir-223 and mir-138 in UC patients and also predict their biological significance. Key words: Ulcerative colitis; Colon mucosa; MicroRNA; Microarray; qrt-pcr; In silico analysis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In order to get an insight into the pathogenesis of ulcerative colitis (UC), we explored spatial expression of microrna in the inflamed and non-inflamed region of mucosal tissue of patients. Profiling of differentially expressed mirna was generated by microarray from three paired samples. Few significantly dysregulated microrna were validated using qrt-pcr. The present study reports disease specific alteration in the expression of mir-125b, mir-155, mir-223 and mir-138 in UC patients and also analyzed their biological significance using in silico tools. MiR-223 exhibited elevated expression independent of disease activity therefore, could be a potential candidate as biomarker for UC. Valmiki S, Ahuja V, Paul J. MicroRNA exhibit altered expression in the inflamed colonic mucosa of ulcerative colitis patients. World J Gastroenterol 2017; 23(29): Available from: URL: DOI: INTRODUCTION Inflammatory bowel disease (IBD) is a gastrointestinal disorder which is chronic and relapsing in nature and exists in two clinical forms ulcerative colitis (UC) and Crohn s disease (CD) [1]. Over the past decade, the incidence and prevalence of IBD are continuously increasing worldwide [2]. The etiology of IBD is not defined yet, but several reports in the past have hypothesized that there is complex interplay of microbial, environmental and genetic factors which predisposes an individual to develop the disease [3]. Various systematic approaches like candidate gene identification or genome wide association studies have been made to identify the genes that get dysregulated and affect the downstream signaling pathways and subsequent gene expression during disease condition. Molecular changes in the expression of several genes have been found to be assciated with IBD pathogenesis [4], and some of these genes play important roles in the major inflammatory pathways. MicroRNA are a class of small sized (about nucleotides in length), non coding, single stranded, endogenous mrna which modulates the expression of their target mrna by binding to them in their 3 UTR by either carrying out their degradation or inhibiting the translation prcess [5-8]. However, target sites for mirna have also been reported in the 5 UTR of many genes [9]. Around 2000 mature mirna have been reported so far and they are known to modulate the expression of about one third of human genes [10]. Recent evidences suggest that mirnas play key role in modulating the expression of target genes involved in the pathogenesis of various diseases. According to a recent estimate almost 60% of genes in a cell are regulated by mirnas [11]. In the past few years mirnas have emerged as the new epigenetic regulators in IBD [12,13] also differential expression of mirnas have been assciated with several autoimmune diseases and cancer including IBD [14]. These studies have revealed differential profiling of mirnas in mucosal tissues of UC and CD patients thus indicating their importance as potential biomarkers [15]. Our aim in this study had been to profile the mirnas exhibiting differential expression in inflamed and noninflamed region of the colon tissue in UC patients. Further we attempted to assess using bioinformatics tools, the functional significance of selected mirnas involved in the regulation of target genes. Therefore, studying these mirnas could provide better ways for disease diagnosis and therapeutics by establishing potential biomarkers. MATERIALS AND METHODS Patients and tissue samples The study included 8 UC patients and 8 non IBD controls. Colonic pinch biopsies were collected from the endoscopically inflamed as well as non inflamed regions of UC patients from the Department of Gastroenterology, All India Institute of Medical Sciences, New Delhi, India. The disease activities of the samples were measured on the basis of SCCAI score. Demographic features of study subjects are enlisted in Table 1. For obtaining inflamed mucosal samples, pinch biopsies were withdrawn from the colonic regions which showed clear symptoms of UC such as loss of vascular pattern, erythema, spontaneous bleeding or ulceration while in case of non inflamed mucosal samples, biopsies were collected from colonic regions of same UC patients with no disease activity. In case of control subjects biopsies were collected from rectosigmoid area. All the controls were age and sex matched with patients. Controls included were individual attending the clinic for routine colonoscopy and were without any inflammatory disorder of intestine and without any 5325 August 7, 2017 Volume 23 Issue 29

84 Valmiki S et al. Spatial expression of mirna in UC patients Table 1 Demographic features of study subject n (%) Characteristics UC patients Non IBD control No. of patients (total) 8 8 Sex (M/F) 3/5 2/6 Age (mean ± SD, range, yr) ± (25-62) ± (24-60) Disease duration (mean ± SD, 6.35 ± 6.52 (1.5-21) NA Range, yr) Disease extent Proctitis 3 (37.5) Left sided colitis 5 (62.5) Medication Mesalamine 5 (62.5) 0 Azathioprine 3 (37.5) 0 Steroids 0 0 UC: Ulcerative colitis; IBD: Inflammatory bowel disease. IBD symptoms. Mucosal biopsy samples were collected in RNA later solution. Diagnosis of UC was confirmed through endoscopic and histological examination by following ECCO guidelines [16]. Ethical approval The study has been ethically approved from the Institute Ethics Committee, All India Institute of Medical Sciences (Ref. No. T-290/ , RT-7/ ) and Institutional Ethics Review Board, JNU (IERB Ref. No.2016/Student/93). Informed consent was taken from all the subjects included in study. RNA isolation and quality check Total RNA was extracted from the mucosal biopsies using mirvana mirna isolation kit (Ambion INC, TX, United States) according to manufacturer s protcol and quantified by NanoDrop 2000 Spectrophotometer (Thermo Scientific, Waltham, United States). The 260/280 values were above 1.9. Quality check for RNA was assayed by Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, United States). mirna microarray profiling The array included three pairs of inflamed and non inflamed samples from UC patients. Samples were submitted to Affymetrix for mirna profiling using GeneChip mirna 4.0 Array which is designed to interrogate all mature mirna sequences in mirbase Release 20. The differentially expressed mirna were statistically assessed by one way ANOVA paired method. P value of 0.05 was considered significant and fold change of 1.5 was taken as cut off for upregulation and -1.5 for downregulation of mirna in a given sample. Reverse transcription and quantitative real time PCR Reverse transcription for each mirna (800 ng) was carried out using gene specific looped primers [17], using revert aid cdna synthesis kit (Fermentas St. Leon Rot, Germany). Sequence of primers used for Table 2 List of primers used for reverse transcription and qrt-pcr Name Primer Sequence (5-3 ) Reverse Universal GTGCAGGGTCCGAGGT Primer hsa-mir-125b-5p RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGTCACAAGT Forward TCCCTGAGACCCTAACTTG hsa-mir-223-3p RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGTGGGGTAT Forward TGTCAGTTTGTCAAATACCC hsa-mir-155-5p RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGACCCCTAT Forward TTAATGCTAATCGTGATAGG hsa-mir-138-5p RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGCGGCCTGA Forward AGCTGGTGTTGTGAATCAG hsa-mir-200a-3p RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGACATCGTT Forward TAACACTGTCTGGTAACGAT hsa-mir-378d RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGTTTCTGTC Forward ACTGGACTTGGAGTCAGAAA Sno RNA U6 RT GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGAAAATATG Forward CAAATTCGTGAAGCGTTCCA RT primers were used to sythesize mirna specific cdna. For real time PCR mirna specific forward primer and reverse universal primers were used. reverse transcription and qrt-pcr are enlisted in Table 2. Differential expression of six selected mirnas identified by microarray was performed using BioRad CFX96 Real Time System with C1000 Touch Thermal cylcer. (BioRad, Hercules, CA, United States) by SYBR Green method, and the cycles were as follows: initial denaturation - 94 for 2 min, denaturation - 94 for 30 s, annealing - 60 for 1 min for 40 cycles. The relative expression differences of mirnas were normalized to internal reference U6 snorna and analyzed using 2 -ΔΔct method. The statistical analysis was done using unpaired, two way student s t-test and a p value < 0.05 were considered significant. Target prediction for differentially expressed mirnas Target prediction for differentially expressed mirnas was carried out by mirwalk database ( ma.uniheidelberg.de/apps/zmf/mirwalk/). This database simultaneously searches several other databases [18]. Additionally, TargetScan, mirbd, RNA22, DIANA, Pictar were also selected for target prediction and genes picked at least by three tools were selected for our list of potential targets. Further, involvement of these mirnas in different biological pathways was investigated using mirpath v.3: DIANA TOOLS. RESULTS MiRNA microarray profiling of inflamed colonic mucosa of UC patients To investigate the disease specific changes in the mirna 5326 August 7, 2017 Volume 23 Issue 29

85 Valmiki S et al. Spatial expression of mirna in UC patients profiling, mucosal biopsy tissues from endoscopically inflamed and non inflamed region of UC patients were submitted for microarray analysis. Microarray analysis revealed that mirnas are differentially expressed in the inflamed colonic region of UC patients as compared to the non inflamed ones Supplementary Figure 1. We had selected three matched pairs for mirna microarray profiling, out of which two pairs (Sample NI1, I1 and NI6, I6) exhibited dysregulated expression of several mirnas in the inflamed mucosa which indicates the disease specific behavior of mirnas. In the third matched pair (NI5, I5) the changes in mirna expression were not comparable probably due to the mild disease activity in the patient. Some of the mirnas were upregulated with a fold change more than 10 such as mir-138, mir-708-5p, mir-212-3p, mir-4521, mir-17,-3p, mir-223,-3p, mir-21. The top 44 differentially expressed mirnas have been enlisted in Table 3 with their respective fold changes. MiR-138 and mir-223 were upregulated more than 10 folds in the inflamed tissues and they have also been reported to be dysregulated in UC. mir-125b and mir-155 were upregulated with a fold change of 2.56 and 2.33 respectively in our study. Additionally, mir-200a and mir-378d were downregulated with a fold change of and respectively. We selected these six mirnas as candidate mirnas for further analysis because these mirnas were reported to be dysregulated during autoimmune diseases and in various cancers. Some of these mirnas were reported to be differentially regulated during UC but whether these mirnas show any spatial expression within the endoscopically inflamed and non inflamed regions was not known. Also the gene targeted by these mirnas play role in major inflammatory pathways. Validation of differentially expressed mirna by qrt- PCR The differential expression of six candidate mirnas (mir-155, mir-138, mir-125b, mir-223, mir-378d and mir-200a) was validated by performing qrt- PCR in matched pair samples from UC patients (n = 8) and non IBD controls (n = 8). The expression of mir-155, mir-138, mir-125b and mir-223 was found to be significantly upregulated in inflamed colonic mucosa of UC patients as compared to non inflamed mucosa and controls Figure 1. We found that mir-223 was significantly upregulated in the inflamed vs non inflamed tissues (p < 0.05) and in inflamed vs control (p < 0.001). Its expression was also significantly higher in the non inflamed vs controls (p < 0.01) as well. Similarly, mir-125b, was significantly higher in inflamed vs non inflamed (p < 0.01) as seen in microarray and inflamed vs controls (p < 0.001). In accordance with microarray, mir-138 exhibited increased expression in inflamed vs non inflamed and also in inflamed vs controls (p < 0.05) and mir-155 was also upregulated in inflamed vs non inflamed (p < 0.05) as well as in inflamed vs control (p < 0.01). In contrast to microarray results, the expression of mir-200a did not change significantly in the inflamed samples when compared with non inflamed and controls Figure 2. But interestingly, the expression of mir-200a in non inflamed mucosa was significantly lower in the non inflamed vs controls. As seen in microarray mirna-378d was downregulated in the inflamed mucosa of UC patients but in qrt-pcr, it showed a significant upregulation in the inflamed mucosa as compared to the non inflamed (p < 0.01) and controls (p < 0.05). Interestingly, mir-378d showed less expression in the non inflamed mucosa as compared to the control. The qrt-pcr results were further reanalyzed individually for each matched pair and it showed that although inter sample variation was there in each case, the expression of mir-155, mir-138, mir-223, mir- 125b was upregulated in most of the inflamed samples as compared to the non inflamed ones Figure 3 and these changes were found to be statistically significant. In contrast to microarray, mir-378d showed significant upregulation in the inflamed samples as compared to the non inflamed although inter sample variation was seen in this case also. In case of mir-200a, the inter sample variation was quite high, although the changes in expression were not significant it showed upregulation in the expression in four pairs whereas downregulation in the rest four pairs Figure 2. Therefore, we could not draw a conclusive trend for this mirna. Prediction of potential targets by in silico prediction tool mirnas (mir-155, mir-138, mir-125b andmir-223) showing significant changes in qrt-pcr analysis were examined for their biological relevance by studying their respective potential gene targets and the signaling pathways involved. In silico target prediction analysis revealed several putative targets which play important role in major signaling pathways. Target prediction analysis indicated biological relevance of these dysregulated mirnas as the genes targeted by these mirnas are involved in the major inflammatory pathways such as NF-κB signaling pathways and MAPK pathway. Potential targets of all four mirnas have been enlisted in Table 4. Potential targets of mir-125b included TNF receptor assciated factor 6 (TRAF6), TNF alpha induced protein 3 (TNFAIP3), IL6R of NF-κB signaling pathway and Signal transducer and activator of transcription (STAT3), JUN, AKT1, IRF6 and IRAK1 of TLR signaling. In addition to this, mir-125b also targets SMAD4 and camp responsive element binding protein1 (CREB1), SIRT5, DICER1, acetylcholine esterase (ACHE), CDK16, CCR2 and MUC1.Putative targets of mir-155 includes signaling molecules of NF-κB signaling such as TGF beta activated kinase 2 (TAB2), CARD6, RelA and TRAF3, suppressor of cytokine signaling (SCS1), KRAS, PAK2, BDNF of MAPK 5327 August 7, 2017 Volume 23 Issue 29

86 Valmiki S et al. Spatial expression of mirna in UC patients Table 3 List of top 44 differentially expressed mirnas in the inflamed colonic mucosal biopsies of ulcerative colitis patients determined by microarray MicroRNA F.C 1 Expression MicroRNA F.C Expression hsa-mir-138-5p Upregulated hsa-mir-148a-5p 2.42 Upregulated hsa-mir-708-5p 34.7 Upregulated hsa-mir-155-5p 2.33 Upregulated hsa-mir-212-3p Upregulated hsa-mir-21-5p 1.81 Upregulated hsa-mir Upregulated hsa-mir-196b-3p 1.50 Upregulated hsa-mir Upregulated hsa-mir-552-3p Downregulated hsa-mir Upregulated hsa-mir-196b-5p Downregulated hsa-mir-17-3p Upregulated hsa-mir-378d-5p Downregulated hsa-mir-424-3p Upregulated hsa-mir-141-3p Downregulated hsa-mir-874-3p Upregulated hsa-mir-10b-5p Downregulated hsa-mir-25-5p Upregulated hsa-mir-215-5p Downregulated hsa-mir-223-3p Upregulated hsa-mir-192-5p Downregulated hsa-mir p Upregulated hsa-mir-194-3p Downregulated hsa-mir-148b-3p Upregulated hsa-mir-422a Downregulated hsa-mir-501-5p Upregulated hsa-mir-200a-3p Downregulated hsa-mir Upregulated hsa-mir-378a-3p Downregulated hsa-mir-224-3p Upregulated hsa-mir p Downregulated hsa-mir-21-3p 8.46 Upregulated hsa-mir-147b Downregulated hsa-mir-146b-5p 6.83 Upregulated hsa-mir-200b-3p -1.7 Downregulated hsa-mir-149-5p 6.24 Upregulated hsa-mir Downregulated hsa-mir-31-5p 4.04 Upregulated hsa-mir p Downregulated hsa-mir-491-5p 3.92 Upregulated hsa-mir Downregulated hsa-mir-125b-5p 2.56 Upregulated hsa-mir-299-5p Downregulated 1 F.C denoted the fold change in the expression of respective mirna in the inflamed biopsies compared to the non inflamed biopsy. A P < B P < Relative mrna expression P < 0.05 P < 0.01 C NI INF Relative mrna expression P < 0.01 NS C NI INF C Relative mrna expression P < 0.05 P < 0.05 NS C NI INF D Relative mrna expression P < 0.01 P < 0.05 NS C NI INF Figure 1 Differential expression of mirnas investigated by performing real time PCR. A: mir-223; B: mir-125b; C: mir-138; D: mir-155. C denotes Control, NI denotes non-inflamed and INF denotes inflamed. NS: Not significant. signaling, CTLA4, IL6R, nuclear factor of activated T cells 5 (NFAT5), IL17RB, Myd88, IKBKE, CTLA4, CLCN3 and APC. Similarly, mir-138 targets genes such as CXCL8, RELA of NF-κB signaling pathway and other genes like CASP3, HDAC4, SIRT1, MAST4, SMAD4, MyD88 and CDK6. mir-223 targets STAT1, RELA and TAB3 of NFκB signaling. The putative targets of mir-378d include TRAF3, SCS2 and MAPK1. Putative target genes of mir-200a involved in inflammatory pathways were 5328 August 7, 2017 Volume 23 Issue 29

87 Valmiki S et al. Spatial expression of mirna in UC patients A P < 0.05 B NI INF 10 P < P < 0.01 Relative mrna expression 5 NS Relative mrna expression C NI INF C Relative mrna expression P < 0.01 NS NS D Relative mrna expression NI INF NS NS 0.0 C NI INF Figure 2 Real time analysis for mir-378d and mir-200a. A: mir-378d; B: mir-378d matched individual samples; C: mir-200a; D: mir-200a matched individual samples. C: Control; NI: Non inflamed; INF: Inflamed; NS: Not significant. Table 4 List of potential targets and the pathway involved MicroRNA Target gene Pathway involved hsa-mir-155-5p TAB2, CFLAR, CARD11, NF-κB signaling. ReLA, TRAF3 hsa-mir-155-5p CARD6, ERBB2IP, MAPK10 Nod like receptor signaling hsa-mir-155-5p S S1, KRAS, PAK2, RAP1B, MAPK signaling RFLA, TAOK1, CACNB4, BDNF hsa-mir-155-5p FOS, S S1, IKBKE, TRAF3, TLR signaling MAPK10, TAB2 has-mir-155 TAB2, CXCL12, TNFAIP3, SIRT1 and TGFB2. DISCUSSION NFAT5, GSK3B, INPP5D, VAV3, PIK3CA B cell receptor signaling hsa-mir-138-5p CSNK2A2, RELA NF-κB signaling hsa-mir-138-5p CXCL8, MAP2K7 TLR signaling hsa-mir-138-5p CLDN19, CD274, ITGAL Cell Adhesion Molecules. hsa-mir-125b-5p MAPK14, JUN.AKT1, IRAK1, TLR signaling TRAF6, IRF5 hsa-mir-125b TNFAIP3, CSNK2A1, IRAK1 NF-κB signaling hsa-mir-223-3p STAT1, RELA TLR signaling hsa-mir-223-3p TAB3, ERC1, PARP1, RELA NF-κB signaling hsa-mir-378d MAPK1 MAPK signaling hsa-mir-378d TRAF3 NF-κB signaling hsa-mir-200a TAB2, TNFAIP3 NF-κB signaling In the past few years, mirnas have been reported to be dysregulated during UC, there are several studies which claimed that mirna profile in the blood and tissue of UC patients differs from that of control individuals [19,20]. MiRNA were also reported to play critical role in mediating cross talk between CD, UC and CRC [21]. Our microarray analysis included three matched pairs from the endoscopically inflamed and non inflamed regions of UC patients. One of the pair didn t show much changes in the mirna transcriptome of inflamed region when compared with the non inflamed one (NI5 and I5), which is more certainly due to the mild activity of disease in the patient. Other two pairs showed significant changes in the mirna profile in the inflamed regions as compared to the non inflamed ones. We found that mir-223 and mir-138 were upregulated with a fold change of more than 10 folds in the inflamed mucosa and these mirnas are also reported earlier to be dysregulated during UC [22-24] however the spatial expression of these mirnas in the endoscopically inflamed and non inflamed regions are reported here for the first time. mir-125b and mir-155 mediates cross talk between UC and CRC [21] as reported earlier and also modulates the expression of genes playing role in inflammatory pathways [25]. mir-200a is earlier reported to get downregulated in UC [22]. Keeping the role of these mirnas in mind we selected these six as our candidate mirnas for further analysis, so that we can elucidate the disease specific behavior of these mirna and correlate their expression with disease activity. qrt-pcr analysis revealed that mir-223 was upregulated in inflamed tissues of UC patients, also 5329 August 7, 2017 Volume 23 Issue 29

88 Valmiki S et al. Spatial expression of mirna in UC patients A Relative mrna expression NI INF P < 0.01 Down B Relative mrna expression NI INF P < 0.01 Down C Relative mrna expression NI INF P < 0.01 Down D Relative mrna expression NI INF P < 0.05 Down Figure 3 Differentially expressed mirnas in the matched colonic biopsies of each ulcerative colitis patient determined by qrt-pcr analysis. A: mir- 223; B: mir-125-b; C: mir-138; D: mir-155. NI denotes non-inflamed and INF denotes inflamed. NS: Not significant. this was the only mirna in our study, which showed significantly higher expression in both the inflamed as well as non inflamed tissues of UC patients as compared to controls. Therefore, this mirna could be established as a potential biomarker to differentiate between UC and controls as its expression does not depend upon disease activity. Moreover, previous studies have shown mir-223 plays a role in gastric cancer and also known to target the tumor suppressor gene EPB41L3 [26,27]. Wang et al [28] showed that mir-223 targets claudin-8 (CLDN8) which is a tight junction protein and maintains the intestinal barrier. mir-223 targets CLDN8 thereby mediating cross talk between IL23 pathway during IBD. In accordance with the microarray studies, mir-155 expression was also significantly higher in the inflamed vs non inflamed as well as inflamed vs controls. Its upregulation is also reported in breast cancer where it acts as an OncomiR by targeting suppressor of cytokine signaling 1 (SCS1) [29,30]. In addition to this Kong et al [31] claimed that mir-155 modulated the expression of tumor suppressor gene von Hippel-Lindau (VHL) and promotes tumor invasion, proliferation, angiogenesis and recruitment of proinflamatory cells in breast cancer. Expression of mir-125b was also found significantly higher in the inflamed mucosa as compared to non inflamed and controls. Since mirnas (mir125b and mir-155) are responsible for mediating cross talk between UC and CRC [21], therefore, studying these mirnas in detail could provide new insights in disease diagnosis and therapeutics. In the present study, mir-138 was also highly expressed in the inflamed mucosa of UC patient. Elevated level of mir-138 expression reported here has not been shown earlier from mucosal tissue of UC patients but only from peripheral blood samples [32]. Some of the previous reports suggest tumor suppressive role of mir-138 in nasopharyngeal cancers by targeting oncogene CCDN1 and controlling tumor proliferation [33] and also downregulation of mir-138 was reported by Liu et al [34] in head and neck squamous cell carcinomas where it played role in promoting apoptosis and suppressing tumor invasion. Role of this microrna, regulating the target gene of inflammatory pathway during UC is yet to be validated. In contrast with the microarray results, qrt-pcr analysis did not show significant changes in expression of mir-200a in the inflamed mucosa vs non inflamed mucosa of UC patients. Interestingly, mir-378d showed a significant upregulation in the inflamed mucosa as compared to the non inflamed and controls in paired samples, while our microarray data a reverse trend in the inflamed mucosa. We also investigated the expression of mir-200a and mir-378d in UC (n = 30) vs controls (n = 20) by qrt-pcr, where we again observed significant downregulation in mir-200a and significant upregulation in mir-378d (data not shown). The next approach in our study was to find out the putative targets of candidate mirnas using in silico target prediction tools. The potential targets of our candidate mirnas included signaling molecules of inflammatory pathways such as MAPK signaling, NF-κB signaling and cytokine signaling pathways, which are 5330 August 7, 2017 Volume 23 Issue 29

89 Valmiki S et al. Spatial expression of mirna in UC patients known to be directly assciated with pathogenesis of IBD [35]. In conclusion, our study elucidated the spatial relationship of mir-125b, mir-155, mir-138 and mir-223 in the endoscopically involved and non involved pockets of UC patients. mir-223 showed differential expression independent of disease activity therefore, could be a potential target as biomarker for UC. ACKNOWLEDGMENTS The authors acknowledge the subjects who participated in the study. Valmiki S acknowledges the fellowship received from University Grants Commission, New Delhi India. The authors are grateful to Mr. Raju Ranjha for helping us with troubleshoots during experiments. COMMENTS Background MicroRNA (mirnas) are endogenous, single stranded, short length (18-22 nucleotides), non coding RNA which modulates the expression of their target mrna by binding to them in the 3 UTR and causing RNA degradation or translational repression. The differential expression of mirna has been reported in different diseases including psoriasis, multiple sclerosis, and inflammatory bowel disease. Research frontiers Expression profile of different mirna was investigated in the colonic mucosal samples of endoscopically inflamed and non inflamed regions of the same ulcerative colitis (UC) patient to get an insight in to the status of these mirna in the inflamed and non inflamed pockets of UC patients. Microarray and qrt-pcr showed a spatial distribution in expression of mir-125b, mir-223, mir-155 and mir-138 in the inflamed colonic samples. Putative targets of these mirnas included the genes involved in the major inflammatory pathways such as NF-κB pathway and MAPK signaling which showed that these mirna might be one of the contributing factors in disease pathogenesis. Innovations and breakthroughs In order to get an insight into the pathogenesis of UC, the authors explored spatial distribution in expression of microrna in the inflamed and non-inflamed region of mucosal tissue of patients. Profiling of differentially expressed mirna was generated by microarray from three paired samples. Few significantly dysregulated mirna were validated using qrt-pcr. The present study reports disease specific alteration in the expression of mir-125b, mir-155, mir-223 and mir-138 in UC patients and also analyzed their biological significance using in silico tools. mir-223 exhibited elevated expression independent of disease activity therefore, could be a potential candidate as biomarker for UC. Applications mir-223 altered expression during UC, irrespective of inflammation, therefore it could be developed as a biomarker for UC. Expression of this mirna in colonic biopsy of UC patient could indicate toward disease status. Terminology SCCAI (Simple Clinical Colitis Activity Index) score is a symptoms based diagnostic tool and questionnaire to estimate the Ulcerative colitis disease severity. It takes into account parameters such as general well-being, bowel frequency, urgency, abdominal pain, rectal bleeding and extra intestinal features. Peer-review The authors reported mirna exhibit altered expression in the inflamed colonic mucosa of UC patients. The article is informative and well-presented. REFERENCES 1 Bouma G, Strober W. The immunological and genetic basis of inflammatory bowel disease. Nat Rev Immunol 2003; 3: [PMID: DOI: /nri1132] 2 Hisamatsu T, Kanai T, Mikami Y, Yoneno K, Matsuoka K, Hibi T. Immune aspects of the pathogenesis of inflammatory bowel disease. Pharmacol Ther 2013; 137: [PMID: DOI: /j.pharmthera ] 3 Chen WX, Ren LH, Shi RH. Implication of mirna for inflammatory bowel disease treatmernt: Systemic review. World J Gastrointest Pathophysiol 2014; 5: [PMID: DOI: /wjgp. v5.i2.63] 4 Xavier RJ, Podolsky DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature 2007; 448: [PMID: DOI: /nature06005] 5 Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian micrornas predominantly act to decrease target mrna levels. Nature 2010; 466: [PMID: DOI: / nature09267] 6 Baek D, Villén J, Shin C, Camargo FD, Gygi SP, Bartel DP. The impact of micrornas on protein output. Nature 2008; 455: [PMID: DOI: /nature07242] 7 Esteller M. Non-coding RNAs in human disease. Nat Rev Genet 2011; 12: [PMID: DOI: /nrg3074] 8 Selbach M, Schwanhäusser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N. Widespread changes in protein synthesis induced by micrornas. Nature 2008; 455: [PMID: DOI: /nature07228] 9 Lytle JR, Yario TA, Steitz JA. Target mrnas are repressed as efficiently by microrna-binding sites in the 5 UTR as in the 3 UTR. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 10 Kozomara A, Griffiths-Jones S. mirbase: integrating microrna annotation and deep-sequencing data. Nucleic Acids Res 2011; 39: D152-D157 [PMID: DOI: /nar/gkq1027] 11 Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mrnas are conserved targets of micrornas. Genome Res 2009; 19: [PMID: DOI: /gr ] 12 Loddo I, Romano C. Inflammatory Bowel Disease: Genetics, Epigenetics, and Pathogenesis. Front Immunol 2015; 6: 551 [PMID: DOI: /fimmu ] 13 Scarpa M, Stylianou E. Epigenetics: Concepts and relevance to IBD pathogenesis. Inflamm Bowel Dis 2012; 18: [PMID: DOI: /ibd.22934] 14 Ranjha R, Paul J. Micro-RNAs in inflammatory diseases and as a link between inflammation and cancer. Inflamm Res 2013; 62: [PMID: DOI: /s ] 15 Fasseu M, Tréton X, Guichard C, Pedruzzi E, Cazals-Hatem D, Richard C, Aparicio T, Daniel F, Soulé JC, Moreau R, Bouhnik Y, Laburthe M, Groyer A, Ogier-Denis E. Identification of restricted subsets of mature microrna abnormally expressed in inactive colonic mucosa of patients with inflammatory bowel disease. PLoS One 2010; 5: [PMID: DOI: /journal. pone ] 16 Dignass A, Eliakim R, Magro F, Maaser C, Chowers Y, Geboes K, Mantzaris G, Reinisch W, Colombel JF, Vermeire S, Travis S, Lindsay JO, Van Assche G. Second European evidence-based consensus on the diagnosis and management of ulcerative colitis part 1: definitions and diagnosis. J Crohns Colitis 2012; 6: [PMID: DOI: /j.crohns ] 17 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ. Real-time quantification of micrornas by stem-loop RT-PCR. Nucleic Acids Res 2005; 33: e179 [PMID: DOI: /nar/gni178] 18 Dweep H, Sticht C, Pandey P, Gretz N. mirwalk--database: prediction of possible mirna binding sites by walking the genes of three genomes. J Biomed Inform 2011; 44: [PMID: DOI: /j.jbi ] 19 Dalal SR, Kwon JH. The Role of MicroRNA in Inflammatory 5331 August 7, 2017 Volume 23 Issue 29

90 Valmiki S et al. Spatial expression of mirna in UC patients Bowel Disease. Gastroenterol Hepatol (N Y) 2010; 6: [PMID: ] 20 Schaefer JS, Attumi T, Opekun AR, Abraham B, Hou J, Shelby H, Graham DY, Streckfus C, Klein JR. MicroRNA signatures differentiate Crohn s disease from ulcerative colitis. BMC Immunol 2015; 16: 5 [PMID: DOI: /s ] 21 Bai J, Li Y, Shao T, Zhao Z, Wang Y, Wu A, Chen H, Li S, Jiang C, Xu J, Li X. Integrating analysis reveals microrna-mediated pathway crosstalk among Crohn s disease, ulcerative colitis and colorectal cancer. Mol Biosyst 2014; 10: [PMID: DOI: /c4mb00169a] 22 Van der Goten J, Vanhove W, Lemaire K, Van Lommel L, Machiels K, Wollants WJ, De Preter V, De Hertogh G, Ferrante M, Van Assche G, Rutgeerts P, Schuit F, Vermeire S, Arijs I. Integrated mirna and mrna expression profiling in inflamed colon of patients with ulcerative colitis. PLoS One 2014; 9: e [PMID: DOI: /journal.pone ] 23 Wang H, Zhang S, Yu Q, Yang G, Guo J, Li M, Zeng Z, He Y, Chen B, Chen M. Circulating MicroRNA223 is a New Biomarker for Inflammatory Bowel Disease. Medicine (Baltimore) 2016; 95: e2703 [PMID: DOI: /MD ] 24 Xu XM, Zhang HJ. mirnas as new molecular insights into inflammatory bowel disease: Crucial regulators in autoimmunity and inflammation. World J Gastroenterol 2016; 22: [PMID: DOI: /wjg.v22.i7.2206] 25 Kim SW, Ramasamy K, Bouamar H, Lin AP, Jiang D, Aguiar RC. MicroRNAs mir-125a and mir-125b constitutively activate the NF-κB pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci USA 2012; 109: [PMID: DOI: / pnas ] 26 Li BS, Zhao YL, Guo G, Li W, Zhu ED, Luo X, Mao XH, Zou QM, Yu PW, Zuo QF, Li N, Tang B, Liu KY, Xiao B. Plasma micrornas, mir-223, mir-21 and mir-218, as novel potential biomarkers for gastric cancer detection. PLoS One 2012; 7: e41629 [PMID: DOI: /journal.pone ] 27 Li X, Zhang Y, Zhang H, Liu X, Gong T, Li M, Sun L, Ji G, Shi Y, Han Z, Han S, Nie Y, Chen X, Zhao Q, Ding J, Wu K, Daiming F. mirna-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3. Mol Cancer Res 2011; 9: [PMID: DOI: / MCR ] 28 Wang H, Chao K, Ng SC, Bai AH, Yu Q, Yu J, Li M, Cui Y, Chen M, Hu JF, Zhang S. Pro-inflammatory mir-223 mediates the cross-talk between the IL23 pathway and the intestinal barrier in inflammatory bowel disease. Genome Biol 2016; 17: 58 [PMID: DOI: /s ] 29 Mattiske S, Suetani RJ, Neilsen PM, Callen DF. The oncogenic role of mir-155 in breast cancer. Cancer Epidemiol Biomarkers Prev 2012; 21: [PMID: DOI: / EPI ] 30 Jiang S, Zhang HW, Lu MH, He XH, Li Y, Gu H, Liu MF, Wang ED. MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res 2010; 70: [PMID: DOI: / CAN ] 31 Kong W, He L, Richards EJ, Challa S, Xu CX, Permuth-Wey J, Lancaster JM, Coppola D, Sellers TA, Djeu JY, Cheng JQ. Upregulation of mirna-155 promotes tumour angiogenesis by targeting VHL and is associated with poor prognosis and triplenegative breast cancer. Oncogene 2014; 33: [PMID: DOI: /onc ] 32 Fisher K, Lin J. MicroRNA in inflammatory bowel disease: Translational research and clinical implication. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 33 Liu X, Lv XB, Wang XP, Sang Y, Xu S, Hu K, Wu M, Liang Y, Liu P, Tang J, Lu WH, Feng QS, Chen LZ, Qian CN, Bei JX, Kang T, Zeng YX. MiR-138 suppressed nasopharyngeal carcinoma growth and tumorigenesis by targeting the CCND1 oncogene. Cell Cycle 2012; 11: [PMID: DOI: /cc.20898] 34 Liu X, Jiang L, Wang A, Yu J, Shi F, Zhou X. MicroRNA-138 suppresses invasion and promotes apoptosis in head and neck squamous cell carcinoma cell lines. Cancer Lett 2009; 286: [PMID: DOI: /j.canlet ] 35 Khor B, Gardet A, Xavier RJ. Genetics and pathogenesis of inflammatory bowel disease. Nature 2011; 474: [PMID: DOI: /nature10209] P- Reviewer: Chiba T, Lakatos PL S- Editor: Ma YJ L- Editor: A E- Editor: Li D 5332 August 7, 2017 Volume 23 Issue 29

91 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Basic Study ORIGINAL ARTICLE Salvianolic acid B protects hepatocytes from H2O2 injury by stabilizing the lysosomal membrane Xiao-Feng Yan, Pei Zhao, Dong-Yan Ma, Yi-Lu Jiang, Jiao-Jiao Luo, Liu Liu, Xiao-Ling Wang Xiao-Feng Yan, Pei Zhao, Xiao-Ling Wang, Department of Biology, School of Basic Medical Science, Shanghai University of Traditional Chinese Medicine, Shanghai , China Dong-Yan Ma, Women and Infant Hospital of Zhengzhou, Zhengzhou , Henan Province, China Yi-Lu Jiang, Jiao-Jiao Luo, Liu Liu, Shanghai University of Traditional Chinese Medicine, Shanghai , China Author contributions: Wang XL and Yan XF designed the research; Yan XF, Zhao P, Ma DY, Jiang YL, Luo JJ and Liu L performed the research; Yan XF, Zhao P and Ma DY analyzed the data; Wang XL wrote the paper. Supported by National Natural Science Funds of China, No ; and the Budget Research Project of Shanghai Education Commission, No. 2014YSN03 and No. 2014YSN22. Institutional review board statement: This study was reviewed and approved by the Shanghai University of Traditional Chinese Medicine Institutional Review Board (No ). Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the Shanghai University of Traditional Chinese Medicine [License number: SCXK (Shanghai) ]. Conflict-of-interest statement: The authors declare that there are no conflicts of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Dr. Xiao-Ling Wang, Department of Biology, School of Basic Medical Science, Shanghai University of Traditional Chinese Medicine, 1200 Cailun Road, Pudong, Shanghai , China. wangxiaoling1033@shutcm.edu.cn Telephone: Received: January 17, 2017 Peer-review started: January 19, 2017 First decision: February 23, 2017 Revised: March 27, 2017 Accepted: May 9, 2017 Article in press: May 9, 2017 Published online: August 7, 2017 Abstract AIM To investigate the capability of salvianolic acid B (Sal B) to protect hepatocytes from hydrogen peroxide (H2O2)/carbon tetrachloride (CCl4)-induced lysosomal membrane permeabilization. METHODS Cell Counting Kit-8 assay was used to measure cell viability. Apoptosis and death were assayed through flow cytometry. BrdU incorporation was used to detect cell proliferation. Serum alanine aminotransferase activity and liver malondialdehyde (MDA) content were measured. Liver histopathological changes were evaluated using hematoxylin-eosin staining. Lysosomal membrane permeability was detected with LysoTracker Green-labeled probes and acridine orange staining. The levels of protein carbonyl content (PCC), cathepsins (Cat)B/D, and lysosome-associated membrane protein 1 (LAMP1) were evaluated through western blotting. Cytosol CatB activity analysis was performed with chemiluminescence detection. The mrna level of 5333 August 7, 2017 Volume 23 Issue 29

92 Yan XF et al. Salvianolic acid B protects hepatocytes LAMP1 was evaluated through quantitative real-time polymerase chain reaction. RESULTS Results indicated that H2O2 induced cell injury/death. Sal B attenuated H2O2-induced cell apoptosis and death, restored the inhibition of proliferation, decreased the amount of PCC, and stabilized the lysosome membrane by increasing the LAMP1 protein level and antagonizing CatB/D leakage into the cytosol. CCl4 also triggered hepatocyte death. Furthermore, Sal B effectively rescued hepatocytes by increasing LAMP1 expression and by reducing lysosomal enzyme translocation to the cytosol. CONCLUSION Sal B protected mouse embryonic hepatocytes from H2O2/CCl4-induced injury/death by stabilizing the lysosomal membrane. Key words: Lysosomal membrane permeabilization; Injury; Salvianolic acid B; Hepatocyte The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Lysosomal membrane permeabilization leads to the release of luminal contents, such as proteases and protons, into the cytosol, resulting in cell death. Salvianolic acid B (Sal B), a water-soluble compound extracted from Salvia miltiorrhiza, exerts a cell protective effect by anti-oxidation. In the present study, we elucidate that Sal B protects hepatocytes from H2O2/CCl4 -induced injury/death by stabilizing the lysosomal membrane. Yan XF, Zhao P, Ma DY, Jiang YL, Luo JJ, Liu L, Wang XL. Salvianolic acid B protects hepatocytes from H2O2 injury by stabilizing the lysosomal membrane. World J Gastroenterol 2017; 23(29): Available from: URL: wjgnet.com/ /full/v23/i29/5333.htm DOI: org/ /wjg.v23.i allows the release of luminal contents, such as proteases, into the cytosol and results in lysosomal alkalization and cell death. The oxidative stress caused by the imbalance between reactive oxygen species (ROS) production and clearance is associated with numerous pathological consequences, including necrosis, autophagy, and apoptosis [4]. Hydrogen peroxide (H2O2) is a key mediator underlying cellular oxidative stress and is involved in various pathological processes [5,6]. In carbon tetrachloride (CCl4)- induced liver injury, oxidative stress is one of the main mechanisms [7]. Hepatocytes make up a systemic hub, integrating the entire body s metabolic demand and detoxification processes, all of which are redox-regulated [8]. An increase in oxidative stress sensitizes hepatocytes to subsequent necrosis and/or apoptosis and ultimately results in a massive loss of mature hepatocytes with subsequent inflammation, fibrosis, cirrhosis, and even hepatocellular carcinoma [9]. However, how hepatocyte death is caused by oxidative stress-induced LMP remains unclear. Salvianolic acid B (Sal B), a water-soluble compound extracted from the herb of Salvia miltiorrhiza, has been widely used in many Asian countries for the treatment of cardiovascular disorders and cerebrovascular diseases for thousands of years [10]. Sal B exerts significant free radical scavenging effects [11]. Several recent reports have indicated that Sal B produces hepatoprotective effects in chronic alcoholic liver disease [12], nonalcoholic fatty liver disease [13], and non-alcoholic steatohepatitis [14]. Furthermore, Sal B can effectively inhibit hepatocyte apoptosis by regulating death receptor and mitochondrial pathways [15]. However, whether the anti-oxidation effects of Sal B are related to LMP in hepatocytes still requires elucidation. In the present study, H2O2/CCl4-induced injury/ death in the BNL CL.2 hepatocyte cell line was used to determine if LMP leads to the leakage of lysosomal contents into the cytosol and triggers cell death in hepatocytes and if Sal B protects cells from death. INTRODUCTION Lysosomes are cytoplasmic membrane-enclosed organelles that contain various hydrolytic enzymes; they complete the degradation process of cellular components and macromolecules [1]. The function of lysosomes is critically dependent on soluble lysosomal hydrolases, including cathepsin (Cat) B and CatD [2], as well as membrane integrity due to highly glycosylated lysosomal membrane proteins, including lysosomeassociated membrane proteins (LAMPs) [3]. Lysosomes are potentially harmful to cells when damage occurs on the lysosomal membrane under pathological conditions. This occurrence is called lysosomal membrane permeabilization (LMP), which MATERIALS AND METHODS Cell culture The BNL CL.2 mouse embryonic hepatocyte cell line was purchased from the Cell Bank of Shanghai Institutes for Biological Sciences and routinely grown in Dulbecco s modified Eagle s medium supplemented with 10% fetal bovine serum, 100 U/mL of penicillin, and 100 μg/ml of streptomycin in a humidified atmosphere containing 5% CO2 at 37. The culture media were changed once every 2 d. Cell viability assay Cell viability was assessed with the Cell Counting Kit-8 (CCK8) assay (Dojindo, Kumamoto, Japan). Four thousand cells were seeded onto 96-well plates and 5334 August 7, 2017 Volume 23 Issue 29

93 Yan XF et al. Salvianolic acid B protects hepatocytes incubated for 24 h at 37 in 5% CO2. After incubation with different concentrations of Sal B, 10 µl of the CCK8 reagent was added to each well and incubated for 2 h at 37. The absorbance at 450 nm was measured with a microplate reader (Bio-Tek, Hercules, CA, United States). The mean absorbance values from four wells after each treatment were used to represent the cell viability index. The experiments were repeated at least thrice. Cell viability (%) was obtained as follows: (treated group absorbance - blank group absorbance)/ (control group absorbance - blank group absorbance) 100%. BrdU labelling and immunofluorescence After growing 4000 cells on a 96-well plate treated with 10 µmol/l of Sal B for 24 h and with 500 µmol/l of H2O2 for another 2 h, the medium was changed to a final concentration of 10 µmol/l of 5-bromo-2- deoxyuridine (BrdU; Sigma, St. Louis, MO, United States) for 24 h at 37. After fixing with cold 4% paraformaldehyde for 15 min at room temperature and washing with phosphate-buffered saline (PBS), the cells were incubated with 0.2% TritonX-100 for 20 min to permeabilize the membranes and blocked with 10% horse serum in PBS. A primary antibody (CST, Boston, MA, United States) was added at 1:100 dilution to the blocking solution and incubated at 4 overnight. After incubating, a secondary antibody (AlexaTM-594 donkey anti-mouse; Jackson ImmunoResearch, West Grove, PA, United States) was added at 1:100 dilution to the blocking solution for 1 h at room temperature. The cells were labelled with 5 μg/ml of Hoechst (CST) for 1 h at 37. BrdU-positive proliferating cells were expressed as a percentage of the control level. Annexin V-FITC/propidium iodide (PI) staining with fluorescence-activated cell sorter (FACS) Cells treated with 10 µmol/l of Sal B for 12 h or 24 h followed by 2 h with 500 µmol/l of H2O2 were harvested through trypsinization. After washing with cold PBS three times, the cells were resuspended in 100 μl of binding buffer at a density of cells per ml. Then, 5 μl of Annexin V-FITC (BD Pharmingen, Santiago, CA, United States) and 5 μl of PI (BD Pharmingen) were added to each sample and incubated in the dark for 15 min. Fluorescence was detected immediately after staining by using a flow cytometer (Ex = 488 nm; Em = 530 nm). The results were presented as the percentage of cells that were viable (Ann-V - /PI - ), early apoptotic (Ann-V + /PI - ), late apoptotic (Ann-V + /PI + ), or nonviable (Ann-V - /PI + ). Western blotting At the end of the designated treatments, 20 μg of cellular protein was separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, United States) blocked with 5% non-fat milk for 2 h. The membranes were probed with the designated primary and secondary antibodies, developed using enhanced chemiluminescence (Thermo Scientific, Waltham, MA, United States), and visualized using an FCM gel imaging device (Protein Simple, San Francisco, CA, United States). Protein carbonyl content The protein carbonyl content (PCC) was assayed with an Oxyblot kit (Millipore). Briefly, 5 µl of cell lysates, including 20 µg of protein mixed with 5 µl of 12% SDS, were supplemented with 10 µl of 2,4-dinitrophenylhydrazine in 2 N HCl for 15 min at room temperature to derive carbonyl groups from the protein side chains. Then, the lysates were separated via 12% SDS-PAGE. Western blotting was performed using the 2,4-dinitrophenylhydrazine antibody (1:50). Given the presence of multiple bands, the average value of all the bands within each lane was used to provide an overall measure of PCC. LysoTracker green or acridine orange staining A total of cells were seeded on a 60 mm confocal plate. After the designated treatments, the cells were incubated with 75 nmol/l of LysoTracker Green (Invitrogen, Waltham, MA, United States) or 5 mg/ml of acridine orange (AO) (Sigma) for 30 min at 37. Fluorescence was examined with a confocal microscope, with the excitation wavelength set at 488 nm. Two separate emission bands ( nm and nm) for AO staining and one for LysoTracker staining ( nm) were obtained, used simultaneously, and photographed. Cytosolic/particulate separation Cytosolic/particulate separation was based on the protocol described in the Cytosol/Particulate Rapid Separation Kit (BioVision, Milpitas, CA, United States). Briefly, cells were harvested in 15 ml tubes and centrifuged at 600 g for 5 min. The pellets were resuspended in 40 µl of cell suspension buffer and mixed with 40 µl of cytosol releasing buffer, including 1 mmol/l of PMSF. The cell suspension was carefully layered on 500 µl of an oil layer with 40 µl of a particulate layer at the bottom on ice for 30 s. After centrifugation at 1400 g for 1 min, the cytosol was separated from the membrane particles by the oil layer and transferred to new tubes. The protein concentration was used with a BCA total protein assay kit (Biomiga, San Diego, CA, United States). Real-time polymerase chain reaction (RT-PCR) analysis Total RNA was isolated from cells ( ) by using the TRIzol reagent (Invitrogen). Equal amounts of RNA were reverse transcribed into cdna. The cdna was amplified through RT-PCR, and the housekeeping gene 18S rrna was used as an internal standard to quantify the levels of the target mrna. The cycling 5335 August 7, 2017 Volume 23 Issue 29

94 Yan XF et al. Salvianolic acid B protects hepatocytes conditions were as follows: hold: 95 for 10 s; cycling: 95 for 5 s, 60 for 30 s, 40 cycles; and melt for The nucleotide sequences for the primers used were as follows: 18S rrna: Forward: 5 -GTAACCCGTTGAACCCCATT-3 and Reverse: 5 -CCATCCAATCGGTAGTAGCG-3 ; LAMP1: Forward: 5 -GATACAGTGGGGTTTGTGGG-3 and Reverse: 5 -CTGTCGAGTGGCAACTTCAG-3. CatB activity A total of 20 μl of cytoplasmic protein was added to 20 μl of CatB reaction buffer (100 mmol/l of sodium acetate, 200 mmol/l of NaCl, 4 mmol/l of EDTA, 10 mmol/l of DTT, and 10 mmol/l of Z-RR-AMC) at 37 for 30 min. The fluorescence released was measured at 37 for 10 min using a cytofluorimeter plate reader with excitation and emission wavelengths of 355 and 450 nm, respectively. The fluorescence increment value within 10 min was regarded as the relative value of enzyme activity in 20 µl of cytosol protein. Protein concentration was assayed by BCA, and CatB activity in each sample was corrected according to the protein concentration. Animal experiments All procedures involving animals were reviewed and approved by the Local Ethics Committee for Animal Research Studies at Shanghai University of Traditional Chinese Medicine (IACUC protocol number: ). The mice were maintained in a specific pathogenfree facility under controlled laboratory conditions (23, 12 h light/12 h dark cycle, 50% humidity, and ad libitum access to food and water) for 2 wk prior to experimentation, and were treated humanely. Intragastric gavage was performed on conscious animals by using straight gavage needles that were appropriate for the animal size (20 g of body weight: 22 gauge, 1 inch length, 1.25 mm ball diameter). In total, 24 male BALB/c mice were initially and randomly divided into four groups: control group (n = 6), CCl4-treated group (n = 6), Sal B/CCl4-treated group (n = 6), and N-acetylcysteine (NAC)/CCl4-treated group (n = 6). Before CCl4 injection, the mice in the control and CCl4 groups were injected intragastrically with 0.9% NaCl. The mice in the Sal B/ CCl4-treated and NAC/ CCl4-treated groups were intragastrically administered with Sal B and NAC at a dosage of 10 mg/kg body weight and 100 mg/kg body weight, respectively, for 3 d. The mice in the CCl4-treated, Sal B/CCl4-treated, and NAC/CCl4-treated groups were given intraperitoneal injections of 5% CCl4 (10 μl/g weight), and the mice in the control group were intraperitoneally injected with olive oil (10 μl/weight). All mice were sacrificed on day 7 of the experiment. The livers were excised, and samples were obtained for the following investigation. Hematoxylin and eosin staining The fresh liver tissue samples were fixed in 10% formalin and embedded in paraffin. Then, the samples were cut into 4 μm thick sections and stained with hematoxylin and eosin (H and E) staining solution. The stained sections were subject to visualization of histopathological changes under a light microscope. Liver function and malondialdehyde Serum alanine aminotransferase (ALT) activity was assayed according to the recommendations of the Institute of Biological Products Nanjing Jiancheng (Nanjing, China). The malondialdehyde (MDA) in the tissues was determined according to the manufacturer s instructions (Cayman, Ann Arbor, MI, United States). Statistical analysis All data are presented as mean ± SD. Statistical analysis was performed using Student s t-test and one-way analysis of variance. Statistical significance was set to P < At least three independent experiments were performed for each condition. RESULTS Sal B attenuates H2O2-induced apoptosis/death and restores the inhibition of proliferation Cells were exposed to Sal B at concentrations of 0, 1, 10, 100, 200 and 400 µmol/l for 24 h to assess the safety of Sal B. The results revealed that Sal B concentrations from 1 μmol/l to 400 μmol/l were not cytotoxic to cells (Figure 1A). The inhibition rate of 500 µmol/l of H2O2 in cell viability was approximately 50%. However, Sal B effectively revised H2O2-inhibited cell viability at different concentrations, ranging from 5 µmol/l to 40 µmol/l (Figure 1B). As shown in Figure 1C, in the untreated control, only 3.98% of the cells were late apoptotic cells and 0.45% were dead cells. By contrast, in the H2O2- treated group, 19.38% of the cells were late apoptotic cells and 3.72% were dead cells. This result indicates an approximately 5-fold increase in the number of late apoptotic or dead cells in the H2O2-treated group compared with the untreated control group. After 12 h of treatment with 10 µmol/l of Sal B and 500 µmol/l of H2O2, 6.82% of the cells were late apoptotic cells and 0.92% were dead cells. At the 24 h time point, 5.94% of the cells were late apoptotic cells and 0.75% were dead cells in the Sal B treatment group. These results demonstrate that Sal B protected hepatocytes from H2O2-induced apoptosis and death. Instead of thymidine, BrdU was incorporated into the nuclear DNA during the S-phase of the cell cycle to evaluate cell proliferation [16]. As shown in Figure 2, after exposure to H2O2, the number of BrdUpositive cells significantly decreased to 50.1% of the control. However, pretreatment with 10 µmol/l of Sal B significantly increased the number of BrdU-positive cells to 68.6% of the control. Sal B exerts an anti-oxidative effect Proteins are the major target of ROS because amino 5336 August 7, 2017 Volume 23 Issue 29

95 Yan XF et al. Salvianolic acid B protects hepatocytes A 120 B Cell viability (%) Cell viability (%) a d d d d Con H2O Concentration of Sal B (μmol/l) Concentration of Sal B (μmol/l) C 10 4 Con 0.45% 3.98% 10 4 H2O2 3.72% 19.38% 10 4 Sal B (12 h) 0.92% 6.82% 10 4 Sal B (24 h) 0.75% 5.94% Propldium iodide % Propldium iodide % Propldium iodide % Propldium iodide % Annexin V Annexin V Annexin V Annexin V Figure 1 Effect of Sal B on apoptosis and death. A: The viability of hepatocytes treated with different concentrations of Sal B for 24 h; B: The viability of hepatocytes treated with different concentrations of Sal B for 22 h following induction by H2O2 for 2 h; C: The Annexin V/PI assay with FACS. All data are presented as mean ± SD. Statistical analysis was performed using Student s t-test ( a P < 0.05 vs Con; d P < 0.01 vs H2O2). acids are susceptible to oxidation. Carbonylation is the most common oxidative alteration of proteins. The results in Figure 3 demonstrate that the amount of PCC in cells increased by nearly 2-fold after H2O2 treatment. However, with or without H2O2, Sal B reduced the content of PCC in the cells. Evidently, Sal B diminished the oxidative stress of cells. Sal B protects the lysosome membrane LAMP1 is highly expressed in lysosomes, and its primary localization is at the endosome-lysosomal membrane [17]. The results of this study revealed that LAMP1 mrna and protein levels significantly decreased with H2O2 treatment. By contrast, for cells pretreated with Sal B or NAC, either the LAMP1 mrna level or the protein level increased (Figure 4A-C). LysoTracker green, a lysosomal marker that is selectively retained in the partially acidic lysosome and reflects lysosomal membrane permeability [18], was used to evaluate the integrity of the lysosome membrane. The intensity of green fluorescence decreased with H2O2 treatment. However, the fluorescence intensity increased with Sal B pretreatment. NAC was used as a positive antioxidant and showed a similar result as Sal B (Figure 4D and E). Sal B antagonizes H2O2-induced LMP and CatB/D leakage To further investigate whether catalytic enzymes in the lysosome leaked into the cytosol and caused the inhibition of cell viability, the content and activity of CatB and CatD in the cytosol and entire cells were assessed. The contents of CatB and CatD in the cytosol increased significantly after exposure to H2O2 compared with that in the control (Figure 5A and C). By contrast, the content detected in the entire cells remained unchanged (Figure 5B and D). Sal B and NAC suppressed cytoplasmic CatB and CatD contents (Figure 5A-D). The CatB activity in the cytosol obviously increased with H2O2 treatment. However, either Sal B or NAC suppressed cytoplasmic CatB activity (Figure 5E). AO is a cell-permeable fluorescent dye with a concentration-dependent fluorescence emission that ranges from red (when the concentration is high in the lysozyme) to green (when the concentration is low in the cytosol). AO is positively charged at a low ph, which consequently hinders the ability of AO molecules to cross the vesicular membrane and escape into the surrounding cytoplasm. In the case of LMP, AO is released from the lysosomes into the cytosol, where it emits an enhanced green fluorescence that can be monitored by fluorescence microscopy [18]. After the delivery of H2O2 to the cells, a significant reduction in red fluorescence was observed, suggesting that H2O2 induced LMP at the cellular level (Figure 6A and C). By contrast, Sal B and NAC were associated with an increase in red fluorescence and concomitant suppression of green fluorescence compared with the situation in the H2O2-treated cells (Figure 6A-C) August 7, 2017 Volume 23 Issue 29

96 Yan XF et al. Salvianolic acid B protects hepatocytes A BrdU Hoechst Merge B 120 Con H2O2 50 μm 50 μm 50 μm BrdU positive cells (%) Con c a H2O2 H2O2 + Sal B 50 μm 50 μm 50 μm Sal B 50 μm 50 μm 50 μm Figure 2 Effect of Sal B on cell proliferation. A: BrdU incorporation assay, with 4000 cells seeded in a 96-well plate being treated with 10 μmol/l of Sal B for 24 h and with 500 μmol/l H2O2 for an additional 2 h. A final concentration of 10 μmol/l BrdU was supplemented in the medium for 24 h (scale bar = 50 μmol/l); B: Quantification of BrdU incorporation assay. All data are presented as mean ± SD. Statistical analysis was performed using Student s t-test ( a P < 0.05 vs Con; c P < 0.05 vs H2O2). A B 2.5 PCC Protein carbonyl content (fold change) a b d H2O Sal B β-actin 0.0 Con Sal B H2O2 H2O2 + Sal B Figure 3 Effect of Sal B on protein carbonyl content. A: The expressions of protein carbonyl content in hepatocytes detected by western blot; B: Quantitative analysis of optical densities of protein carbonyl content and normalized to the expression of β-actin ( a P < 0.05, b P < 0.01 vs Con; d P < 0.01 vs H2O2). Sal B attenuates lysosomal damage after CCl4-induced acute liver injury Hematoxylin-eosin staining revealed a normal hepatic architecture within the clear hepatic lobule and the absence of dead hepatocytes in the control group of mice. By contrast, a large area of dead hepatocytes was observed in the central vein area of the CCl4- treated mice. Compared with the CCl4-treated group, the CCl4 group treated with Sal B or NAC exhibited improvements in CCl4-associated pathological changes (Figure 7A). ALT has been used as an index of liver injury in clinics and in vivo studies [19]. The mice in the CCl4-treated group exhibited signs of liver injury. The ALT activity in these mice was significantly higher than that in the control group (P < 0.01), although Sal B or NAC interventions reduced the activity of ALT (P < 0.01) (Figure 7B). MDA level has been widely used as a marker of lipid peroxidation in cells and body fluids in clinical and experimental studies [20]. The MDA concentration in the CCl4-treated group was significantly higher than that in the control group (P < 0.01). Pretreatment with Sal B or NAC reduced the MDA levels (P < 0.01) (Figure 7C). LAMP1 is used as a lysosomal marker and contributes to the protection of the lysosomal membrane and its proteins from hostile constituents, such as hydrogen ions and proteases [21]. LAMP1 protein levels decreased significantly after CCl4 treatment (P < 0.01), 5338 August 7, 2017 Volume 23 Issue 29

97 Yan XF et al. Salvianolic acid B protects hepatocytes A B C H2O Sal B NAC LAMP1 β-actin LAMP1 protein content (fold change) Con b H2O2 d H2O2 + Sal B d H2O2 + NAC LAMP1 mrna relative level Con d d b H2O2 H2O2 + Sal B H2O2 + NAC D Con Sal B H2O2 10 μm 10 μm NAC E Lysotracker (% of control) (Green fluorescence) Con a b H2O2 H2O2 + Sal B a H2O2 + NAC 10 μm 10 μm Figure 4 Effect of Sal B on lysosomal membrane permeability. A: The expressions of LAMP1 in hepatocytes detected by western blot; B: Quantitative analysis of optical densities of LAMP1 and normalized to the expression of β-actin; C: Levels of LAMP1 mrna were measured in cells by qrt-pcr; D: LysoTracker green staining; E: Quantification of the LysoTracker green staining ( b P < 0.01 vs Con; a P < 0.05, d P < 0.01 vs H2O2). and Sal B or NAC pretreatment increased the protein levels (P < 0.01) (Figure 8A and D). To further confirm if CCl4 induces liver injury triggered by lysosomal disintegration, the leakage of lysosomal enzymes into the cytosolic fractions was investigated. Surprisingly, the contents of CatB and CatD in the cytosol increased significantly after CCl4 treatment (P < 0.01), and Sal B or NAC pretreatment decreased the protein levels (P < 0.01) (Figure 8B and E). By contrast, the content detected in the entire cells remained unchanged (Figure 8C and F). DISCUSSION Hepatocytes, which are in charge of the detoxification of exogenous xenobiotics, drugs, viral infections and chronic alcoholism, have the largest amount of cells in the liver. Regardless of etiology (e.g., toxic chemicals, drugs and virus), hepatocyte injury/death is involved in all pathological stages of hepatitis, fibrosis, cirrhosis, and even liver cancer [22]. Therefore, hepatocytes act as a common therapeutic target in various liver diseases. Sal B is a major water-soluble polyphenolic antioxidant in Radix Salviae Miltiorrhizae and has been extensively used in clinics in China [23-25]. Sal B possesses efficient radical scavengers and antioxidants [14,26,27]. Previous reports have shown that Sal B exerts therapeutic effects in treating liver fibrosis [28,29]. In this study, the effect of Sal B on H2O2-induced hepatocytes was investigated in vitro. CCl4 is a potent hepatotoxicant that is commonly used to generate liver injury in animal models [30]. In hepatocytes, CCl4 is metabolized by cytochrome P450 to produce highly reactive free radicals [31]. Therefore, oxidative stress is one of the main mechanisms of CCl4-induced liver injury [7]. The present results suggest that the levels of lipid peroxidation in livers and serum ALT activity in hepatocytes after cell injury/death increased after CCl4 treatment. The results of hepatic histological staining in CCl4-treated mice also showed large areas of dead hepatocytes. LAMP1 is a highly glycosylated protein located in the lysosomal membrane; it controls the integrity of the lysosomal membrane [21]. In this study, LAMP1 detected in the livers was low, and CatB and CatD levels in the cytoplasm increased but were unchanged in whole tissues after CCl4 treatment. However, after Sal B treatment, the structure of the liver tissues returned to normal. Meanwhile, serum ALT decreased, the levels of lipid peroxidation diminished, and the levels of LAMP1 were enhanced in the livers. Thus, the hepatotoxicant effect of CCl4 is attributed to its induction 5339 August 7, 2017 Volume 23 Issue 29

98 Yan XF et al. Salvianolic acid B protects hepatocytes A Cytosol B Whole CatB CatB CatD CatD β-actin β-actin H2O Sal B NAC H2O Sal B NAC C D E Cytosol CatB/D protein content (fold change) b CatB d d b CatD d d Whole CatB/D protein content (fold change) CatB Con H2O2 H2O2 + Sal B H2O2 + NAC CatD Cytosol CatB activity (fold change) Con b d d H2O2 H2O2 + Sal B H2O2 + NAC Figure 5 Effect of Sal B on the leakage of CatB/D into the cytosol. A and B: CatB/D levels in the cytosol/whole lysate were measured by western blot; C and D: Quantitative analysis of optical densities of CatB/D in the cytosol/whole lysate and normalized to the expression of β-actin; E: CatB activity analysis was performed with chemiluminescence detection. ( b P < 0.01 vs Con; d P < 0.01 vs H2O2). A Con H2O2 B Acridine (fold of control) (red fluorescence) a b d 10 μm 10 μm 0.0 Con H2O2 H2O2 + Sal B H2O2 + NAC Sal B NAC C Acridine (fold of control) (green fluorescence) b c c 10 μm 10 μm 0.0 Con H2O2 H2O2 + Sal B H2O2 + NAC Figure 6 Effect of Sal B on lysosomal PH. A: AO staining; B: Quantification of the AO staining ( a P < 0.05, b P < 0.01 vs Con; c P < 0.05, d P < 0.01 vs H2O2). of oxidative stress followed by lysosomal membrane permeabilization, which mediates hepatocyte injury/ death. Sal B protected the livers by interfering with lysosome membrane permeabilization. Consistent with the in vivo results, H2O2-induced cytotoxicity is a common method used for measuring 5340 August 7, 2017 Volume 23 Issue 29

99 Yan XF et al. Salvianolic acid B protects hepatocytes A Con CCl4 Sal B NAC B Serum ALT (IU/L) b d d C MDA concentration (μmol/l) b d d 0 Con CCl4 Sal B NAC 0 Con CCl4 Sal B NAC Figure 7 Effect of Sal B on CCl4-induced liver injury. A: Hematoxylin-eosin staining is shown (scale bar =100 μm). Con:control group (n = 6), CCl4: CCl4 injection group (n = 6), Sal B: CCl4 injection and Sal B administration group (n = 6), NAC: CCl4 injection and NAC administration group (n = 6); B: Serum ALT activity in mice; C: MDA content of liver tissues in mice. Statistical analysis was performed using Student s t-test ( b P < 0.01 vs Con; d P < 0.01 vs CCl4). ALT: Alanine aminotransferase; MDA: Malondialdehyde. A B Cytosol C Whole CatB CatB LAMP1 β-actin CatD β-actin CatD β-actin CCl Sal B NAC CCl Sal B NAC CCl Sal B NAC D E F Con Con LAMP1 protein content (fold change) b Con CCl4 SalB NAC d d Cytosol CatB/D protein content (fold change) b d CatB d CCl4 CCl4 + Sal B CCl4 + NAC b d CatD d Whole CatB/D protein content (fold change) CatB CCl4 CCl4 + Sal B CCl4 + NAC CatD Figure 8 Effect of Sal B on LAMP1 and leakage of CatB to the cytosol. A: Expressions of LAMP1 in liver detected by western blot; B, C: CatB/D levels in the cytosol/whole lysate were measured by western blot; D: Quantitative analysis of optical densities of LAMP1 and normalized to the expression of β-actin. E, F: Quantitative analysis of optical densities of CatB/D in the cytosol/whole lysate and normalized to the expression of β-actin. All data are presented as mean ± SD. Statistical analysis was performed using Student s t-test ( b P < 0.01 vs Con; d P < 0.01 vs CCl4). potential antioxidants. In the in vitro study, treatments with 500 µmol/l of H2O2 for 2 h induced a decrease in cell viability, and the rate of inhibition was approximately 50%. This concentration was used for the subsequent experiments. After oxidative damage, cell viability was inhibited, and cell proliferation diminished. Sal B 5341 August 7, 2017 Volume 23 Issue 29

100 Yan XF et al. Salvianolic acid B protects hepatocytes decreased the number of apoptotic and necrotic cells and restored cell proliferation. In cultured cells, a large amount of H2O2 diffuses into the lysosome and results in LMP [32-34], which is attributed to the reduced H2O2-induced expression of LAMP1 [35]. Upon LMP, hydrolytic enzymes [36,37] and protons [38,39] in the lysosomes are released into the cytoplasm, resulting in acidification and triggering lysosome-induced cell death [40] Hepatocyte death is accompanied by an increase in LMP in acute liver injury [41]. According to the cell type and dosages of the inducing factors, lysosomal apoptosis or necrosis occurs [42]. Cathepsins, including CatB and CatD, exhibit catalytic activity for a few hours even under near-neutral ph conditions [43]. CatB leakage from the lysosomes is also associated with apoptosis [44,45]. The current study found that the levels of CatB and CatD in the cytoplasm increased considerably after exposure to H2O2 for 2 h. The activity of CatB in cytoplasm increased and reached nearly 2.5-fold. Meanwhile, the results of LysoTracker and AO staining confirmed that LMP occurred during H2O2 treatment. After Sal B treatment, the levels of CatB/D and CatB enzyme activity in cytoplasm decreased, and the fluorescence intensity of LysoTracker and AO in the lysosome was enhanced. Thus, leakage of lysosome contents was improved, lysosome membrane integrity was protected, and cell injury/death was inhibited. NAC is a sulfhydryl donor antioxidant that contributes to the regeneration of glutathione [46] and commonly used as a positive antioxidant control. (-)-epigallocatechin-3-gallate (EGCG) promotes the production of intracellular ROS upstream of LMP and cell death, and NAC protects against EGCG-mediated LMP by decreasing the level of ROS [47]. Bxpc3 cell death is also involved in LMP and oxidative stress, which is protected against by NAC [21]. In the present study, the content of CatB/D and CatB enzyme activity in the cytosol after NAC treatment showed a significant decrease compared with that in the H2O2 treatment group. The fluorescence intensity of LysoTracker Green and the LAMP1 level in the cells treated with NAC increased. These results show that NAC protected hepatocytes from H2O2-induced apoptosis and death by inhibiting LMP. The effects of NAC were similar to those of the antioxidant Sal B. In sum, Sal B protected the integrity of the lysosomal membrane by up-regulating the expression of LAMP1, which reduced CatB/D leakage into the cytosol and protected hepatocytes from death. COMMENTS Background Highly glycosylated lysosome-associated membrane proteins (LAMPs), especially LAMP1, on the inner surface of the lysosomal membrane serve as a barrier to soluble hydrolases and keep the integrity of membrane. The loss of membrane integrity leads to lysosomal membrane permeabilization (LMP), allowing release of the luminal contents into the cytosol, resulting in cellular injury/death. Oxidative stress causes LMP in hepatocytes, leading to cellular injury/death. Salvianolic acid B (Sal B) performs anti-inflammatory and antioxidant functions and elicits protective effects on hepatocytes. Research frontiers Lysosomes filled with more than 50 soluble acid hydrolases are the cellular recycling center and play an important role in cells. Upon LMP, the leakage of enzymes from lysosomes into cytosol causes cellular injury/death. Hepatocytes are the most frequent cells in the liver and the target of oxidative stress, and the resulting injury/death is involved in all liver diseases. Herein, hepatocytes served as a target of therapy. Innovations and breakthroughs Upon H2O2 attacking, the expression of LAMP1 was significantly decreased and destroyed the integrity of the lysosome membrane in hepatocytes and contributed to cellular injury/death. Sal B elicits protective effects on hepatocytes by scavenging reactive oxygen species and enhancing LAMP1 expression. Applications Sal B can protect lysosome membrane integrity by diminishing oxidative stress and can elicit a protective effect on hepatocytes. This study provided a theoretical basis for the clinical application of Sal B to treat liver diseases. Terminology LMP is the leakage of lysosome contents due to the destruction of lysosome membrane integrity and causes cell injury/death. Sal B is a major water-soluble polyphenolic antioxidant in Radix Salviae Miltiorrhizae and also elicits protective effects on hepatocytes. Peer-review The paper is very interesting. Moreover, whereas the authors target the effect of Sal B on the protection of the integrity of the lysosomal membrane by upregulating the expression of LAMP1, via reduction of cathepsin B/D leakage into the cytosol, and protects hepatocytes from apoptosis. REFERENCES 1 Saftig P, Klumperman J. Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol 2009; 10: [PMID: DOI: /nrm2745] 2 Turk V, Stoka V, Vasiljeva O, Renko M, Sun T, Turk B, Turk D. Cysteine cathepsins: from structure, function and regulation to new frontiers. Biochim Biophys Acta 2012; 1824: [PMID: DOI: /j.bbapap ] 3 Howe CL, Granger BL, Hull M, Green SA, Gabel CA, Helenius A, Mellman I. Derived protein sequence, oligosaccharides, and membrane insertion of the 120-kDa lysosomal membrane glycoprotein (lgp120): identification of a highly conserved family of lysosomal membrane glycoproteins. Proc Natl Acad Sci USA 1988; 85: [PMID: ] 4 Handy DE, Loscalzo J. Redox regulation of mitochondrial function. Antioxid Redox Signal 2012; 16: [PMID: DOI: /ars ] 5 Celi P, Gabai G. Oxidant/Antioxidant Balance in Animal Nutrition and Health: The Role of Protein Oxidation. Front Vet Sci 2015; 2: 48 [PMID: DOI: /fvets ] 6 Poljsak B, Šuput D, Milisav I. Achieving the balance between ROS and antioxidants: when to use the synthetic antioxidants. Oxid Med Cell Longev 2013; 2013: [PMID: DOI: /2013/956792] 7 Basu S. Carbon tetrachloride-induced lipid peroxidation: eicosanoid formation and their regulation by antioxidant nutrients. Toxicology 2003; 189: [PMID: DOI: / S X(03) ] 8 Mello T, Zanieri F, Ceni E, Galli A. Oxidative Stress in the Healthy and Wounded Hepatocyte: A Cellular Organelles Perspective. Oxid 5342 August 7, 2017 Volume 23 Issue 29

101 Yan XF et al. Salvianolic acid B protects hepatocytes Med Cell Longev 2016; 2016: [PMID: DOI: /2016/ ] 9 Mishra A, Younossi ZM. Epidemiology and Natural History of Non-alcoholic Fatty Liver Disease. J Clin Exp Hepatol 2012; 2: [PMID: DOI: /S (12) ] 10 Wang J, Xiong X, Feng B. Cardiovascular effects of salvianolic Acid B. Evid Based Complement Alternat Med 2013; 2013: [PMID: DOI: /2013/247948] 11 Tsai MK, Lin YL, Huang YT. Effects of salvianolic acids on oxidative stress and hepatic fibrosis in rats. Toxicol Appl Pharmacol 2010; 242: [PMID: DOI: / j.taap ] 12 Zhang N, Hu Y, Ding C, Zeng W, Shan W, Fan H, Zhao Y, Shi X, Gao L, Xu T, Wang R, Gao D, Yao J. Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats. Toxicol Lett 2017; 267: 1-10 [PMID: DOI: /j.toxlet ] 13 Zeng W, Shan W, Gao L, Gao D, Hu Y, Wang G, Zhang N, Li Z, Tian X, Xu W, Peng J, Ma X, Yao J. Inhibition of HMGB1 release via salvianolic acid B-mediated SIRT1 up-regulation protects rats against non-alcoholic fatty liver disease. Sci Rep 2015; 5: [PMID: DOI: /srep16013] 14 Wang YC, Kong WZ, Jin QM, Chen J, Dong L. Effects of salvianolic acid B on liver mitochondria of rats with nonalcoholic steatohepatitis. World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 15 Yan X, Zhou T, Tao Y, Wang Q, Liu P, Liu C. Salvianolic acid B attenuates hepatocyte apoptosis by regulating mediators in death receptor and mitochondrial pathways. Exp Biol Med (Maywood) 2010; 235: [PMID: DOI: / ebm ] 16 Duque A, Rakic P. Different effects of bromodeoxyuridine and [3H]thymidine incorporation into DNA on cell proliferation, position, and fate. J Neurosci 2011; 31: [PMID: DOI: /JNEUROSCI ] 17 Madan R, Rastogi R, Parashuraman S, Mukhopadhyay A. Salmonella acquires lysosome-associated membrane protein 1 (LAMP1) on phagosomes from Golgi via SipC protein-mediated recruitment of host Syntaxin6. J Biol Chem 2012; 287: [PMID: DOI: /jbc.M ] 18 Pierzyńska-Mach A, Janowski PA, Dobrucki JW. Evaluation of acridine orange, LysoTracker Red, and quinacrine as fluorescent probes for long-term tracking of acidic vesicles. Cytometry A 2014; 85: [PMID: DOI: /cyto.a.22495] 19 Li W, Qu XN, Han Y, Zheng SW, Wang J, Wang YP. Ameliorative effects of 5-hydroxymethyl-2-furfural (5-HMF) from Schisandra chinensis on alcoholic liver oxidative injury in mice. Int J Mol Sci 2015; 16: [PMID: DOI: /ijms ] 20 Zeng T, Guo FF, Zhang CL, Zhao S, Dou DD, Gao XC, Xie KQ. The anti-fatty liver effects of garlic oil on acute ethanol-exposed mice. Chem Biol Interact 2008; 176: [PMID: DOI: /j.cbi ] 21 Hornick JR, Vangveravong S, Spitzer D, Abate C, Berardi F, Goedegebuure P, Mach RH, Hawkins WG. Lysosomal membrane permeabilization is an early event in Sigma-2 receptor ligand mediated cell death in pancreatic cancer. J Exp Clin Cancer Res 2012; 31: 41 [PMID: DOI: / ] 22 Cao L, Quan XB, Zeng WJ, Yang XO, Wang MJ. Mechanism of Hepatocyte Apoptosis. J Cell Death 2016; 9: [PMID: DOI: /JCD.S39824] 23 Lee HJ, Cho JY, Moon JH. Comparison of the inhibitory effect against copper ion-induced oxidation in rat plasma after oral administration of salvianolic acid B and its decocted solutions. J Med Food 2013; 16: [PMID: DOI: / jmf ] 24 Zhao CQ, Zhou Y, Ping J, Xu LM. Traditional Chinese medicine for treatment of liver diseases: progress, challenges and opportunities. J Integr Med 2014; 12: [PMID: DOI: /S (14)60039-X] 25 Wang X, Wang N, Cheung F, Lao L, Li C, Feng Y. Chinese medicines for prevention and treatment of human hepatocellular carcinoma: current progress on pharmacological actions and mechanisms. J Integr Med 2015; 13: [PMID: DOI: /S (15) ] 26 Shu T, Pang M, Rong L, Liu C, Wang J, Zhou W, Wang X, Liu B. Protective Effects and Mechanisms of Salvianolic Acid B Against H2O2-Induced Injury in Induced Pluripotent Stem Cell-Derived Neural Stem Cells. Neurochem Res 2015; 40: [PMID: DOI: /s ] 27 Liu Y, Hu Y, E Q, Zuo J, Yang L, Liu W. Salvianolic acid B inhibits mitochondrial dysfunction by up-regulating mortalin. Sci Rep 2017; 7: [PMID: DOI: /srep43097] 28 Yu F, Lu Z, Chen B, Wu X, Dong P, Zheng J. Salvianolic acid B-induced microrna-152 inhibits liver fibrosis by attenuating DNMT1-mediated Patched1 methylation. J Cellular Molecular Med 2015; 19: [PMID: DOI: / jcmm.12655] 29 Yu F, Lu Z, Huang K, Wang X, Xu Z, Chen B, Dong P, Zheng J. MicroRNA-17-5p-activated Wnt/β-catenin pathway contributes to the progression of liver fibrosis. Oncotarget 2016; 7: [PMID: DOI: /oncotarget.6447] 30 Teng H, Chen M, Zou A, Jiang H, Han J, Sun L, Feng C, Liu J. Hepatoprotective effects of licochalcone B on carbon tetrachlorideinduced liver toxicity in mice. Iran J Basic Med Sci 2016; 19: [PMID: ] 31 Dong D, Yin L, Qi Y, Xu L, Peng J. Protective Effect of the Total Saponins from Rosa laevigata Michx Fruit against Carbon Tetrachloride-Induced Liver Fibrosis in Rats. Nutrients 2015; 7: [PMID: DOI: /nu ] 32 Ullio C, Casas J, Brunk UT, Sala G, Fabriàs G, Ghidoni R, Bonelli G, Baccino FM, Autelli R. Sphingosine mediates TNFα-induced lysosomal membrane permeabilization and ensuing programmed cell death in hepatoma cells. J Lipid Res 2012; 53: [PMID: DOI: /jlr.M022384] 33 Malekova L, Tomaskova J, Novakova M, Stefanik P, Kopacek J, Lakatos B, Pastorekova S, Krizanova O, Breier A, Ondrias K. Inhibitory effect of DIDS, NPPB, and phloretin on intracellular chloride channels. Pflugers Arch 2007; 455: [PMID: DOI: /s ] 34 Lee SJ, Cho KS, Koh JY. Oxidative injury triggers autophagy in astrocytes: the role of endogenous zinc. Glia 2009; 57: [PMID: DOI: /glia.20854] 35 Lee SJ, Park MH, Kim HJ, Koh JY. Metallothionein-3 regulates lysosomal function in cultured astrocytes under both normal and oxidative conditions. Glia 2010; 58: [PMID: DOI: /glia.20998] 36 Owa C, Messina ME, Halaby R. Triptolide induces lysosomalmediated programmed cell death in MCF-7 breast cancer cells. Int J Womens Health 2013; 5: [PMID: DOI: /IJWH.S44074] 37 Marques C, Oliveira CS, Alves S, Chaves SR, Coutinho OP, Côrte-Real M, Preto A. Acetate-induced apoptosis in colorectal carcinoma cells involves lysosomal membrane permeabilization and cathepsin D release. Cell Death Dis 2013; 4: e507 [PMID: DOI: /cddis ] 38 Deng D, Jiang N, Hao SJ, Sun H, Zhang GJ. Loss of membrane cholesterol influences lysosomal permeability to potassium ions and protons. Biochim Biophys Acta 2009; 1788: [PMID: DOI: /j.bbamem ] 39 Nilsson C, Roberg K, Grafström RC, Ollinger K. Intrinsic differences in cisplatin sensitivity of head and neck cancer cell lines: Correlation to lysosomal ph. Head Neck 2010; 32: [PMID: DOI: /hed.21317] 40 Brandstetter C, Mohr LK, Latz E, Holz FG, Krohne TU. Light induces NLRP3 inflammasome activation in retinal pigment epithelial cells via lipofuscin-mediated photooxidative damage. J Mol Med (Berl) 2015; 93: [PMID: DOI: /s ] 41 Chang CP, Yang MC, Lei HY. Concanavalin A/IFN-gamma 5343 August 7, 2017 Volume 23 Issue 29

102 Yan XF et al. Salvianolic acid B protects hepatocytes triggers autophagy-related necrotic hepatocyte death through IRGM1-mediated lysosomal membrane disruption. PLoS One 2011; 6: e28323 [PMID: DOI: /journal. pone ] 42 Repnik U, Hafner Česen M, Turk B. Lysosomal membrane permeabilization in cell death: concepts and challenges. Mitochondrion 2014; 19 Pt A: [PMID: DOI: /j.mito ] 43 Appelqvist H, Wäster P, Kågedal K, Öllinger K. The lysosome: from waste bag to potential therapeutic target. J Mol Cell Biol 2013; 5: [PMID: DOI: /jmcb/mjt022] 44 Oberle C, Huai J, Reinheckel T, Tacke M, Rassner M, Ekert PG, Buellesbach J, Borner C. Lysosomal membrane permeabilization and cathepsin release is a Bax/Bak-dependent, amplifying event of apoptosis in fibroblasts and monocytes. Cell Death Differ 2010; 17: [PMID: DOI: /cdd ] 45 Colletti GA, Miedel MT, Quinn J, Andharia N, Weisz OA, Kiselyov K. Loss of lysosomal ion channel transient receptor potential channel mucolipin-1 (TRPML1) leads to cathepsin B-dependent apoptosis. J Biol Chem 2012; 287: [PMID: DOI: /jbc.M ] 46 Samuni Y, Goldstein S, Dean OM, Berk M. The chemistry and biological activities of N-acetylcysteine. Biochim Biophys Acta 2013; 1830: [PMID: DOI: / j.bbagen ] 47 Zhang Y, Yang ND, Zhou F, Shen T, Duan T, Zhou J, Shi Y, Zhu XQ, Shen HM. (-)-Epigallocatechin-3-gallate induces nonapoptotic cell death in human cancer cells via ROS-mediated lysosomal membrane permeabilization. PLoS One 2012; 7: e46749 [PMID: DOI: /journal.pone ] P- Reviewer: Cubero FJ, Ling C, Yu TF S- Editor: Qi Y L- Editor: Filipodia E- Editor: Li D 5344 August 7, 2017 Volume 23 Issue 29

103 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Basic Study PBX1 attributes as a determinant of connexin 32 downregulation in Helicobacter pylori -related gastric carcinogenesis ORIGINAL ARTICLE Xiao-Ming Liu, Can-Xia Xu, Lin-Fang Zhang, Li-Hua Huang, Ting-Zi Hu, Rong Li, Xiu-Juan Xia, Lin-Yong Xu, Ling Luo, Xiao-Xia Jiang, Ming Li Xiao-Ming Liu, Can-Xia Xu, Lin-Fang Zhang, Ting-Zi Hu, Rong Li, Xiu-Juan Xia, Ling Luo, Xiao-Xia Jiang, Ming Li, Department of Gastroenterology, the Third Xiangya Hospital of Central South University, Changsha , Hunan Province, China Li-Hua Huang, Center for Medical Experiments, the Third Xiangya Hospital of Central South University, Changsha , Hunan Province, China Lin-Yong Xu, Department of Medical Statistics, Xiangya School of Public Health, Central South University, Changsha , Hunan Province, China Author contributions: Liu XM and Xu CX contributed to the conception and design of the study, as well as the acquisition, analysis and interpretation of data; Zhang LF, Hu TZ, Li R, Xia XJ, Luo L, Jiang XX and Li M performed the research; Huang LH contributed new reagents and analytic tools; Zhang LF and Xu LY analyzed the data; and Liu XM wrote the paper. Supported by the New Xiangya Talent project of the Third Xiangya Hospital of Central South University, No Institutional review board statement: This study was reviewed and approved by the Ethics Committee of the Third Xiangya Hospital of Central South University. Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the Third Xiangya Hospital of Central South University (A branch of the Ethics Committee of the Third Xiangya Hospital of Central South University, protocol number: 2017-S001). Conflict-of-interest statement: The authors declare no conflicts of interest related to this manuscript. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Can-Xia Xu, MD, Professor of Gastroenterology, Department of Gastroenterology, the Third Xiangya Hospital of Central South University, No. 138 Tongzipo Street, Changsha , Hunan Province, China. xucanxia2000@163.com Telephone: Fax: Received: January 26, 2017 Peer-review started: February 2, 2017 First decision: March 17, 2017 Revised: April 25, 2017 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, 2017 Abstract AIM To clarify the mechanisms of connexin 32 (Cx32) downregulation by potential transcriptional factors (TFs) in Helicobacter pylori (H. pylori )-associated gastric carcinogenesis. METHODS Approximately 25 specimens at each developmental stage of gastric carcinogenesis [non-atrophic gastritis, 5345 August 7, 2017 Volume 23 Issue 29

104 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC chronic atrophic gastritis, intestinal metaplasia, dysplasia and gastric carcinoma (GC)] with H. pylori infection [H. pylori (+)] and 25 normal gastric mucosa (NGM) without H. pylori infection [H. pylori (-)] were collected. After transcriptional factor array analysis, the Cx32 and PBX1 expression levels of H. pylori -infected tissues from the developmental stages of GC and NGM with no H. pylori infection were measured by real-time polymerase chain reaction (RT-PCR) and Western blot analysis. Regarding H. pylori -infected animal models, the Cx32 and PBX1 mrna expression levels and correlation between the gastric mucosa from 10 Mongolian gerbils with long-term H. pylori colonization and 10 controls were analyzed. PBX1 and Cx32 mrna and protein levels were further studied under the H. pylori-infected condition as well as PBX1 overexpression and knockdown conditions in vitro. RESULTS Incremental PBX1 was first detected by TF microarray in H. pylori -related gastric carcinogenesis. The identical trend of PBX1 and Cx32 expression was confirmed in the developmental stages of H. pylori -related clinical specimens. The negative correlation of PBX1 and Cx32 was confirmed in H. pylori -infected Mongolian gerbils. Furthermore, decreased PBX1 expression was detected in the normal gastric epithelial cell line GES-1 with H. pylori infection. Enforced overexpression or RNAi-mediated knockdown of PBX1 contributed to the diminished or restored Cx32 expression in GES-1 and the gastric carcinoma cell line BGC823, respectively. Finally, dual-luciferase reporter assay in HEK293T cells showed that Cx32 promoter activity decreased by 30% after PBX1 vector co-transfection, indicating PBX1 as a transcriptional downregulator of Cx32 by directly binding to its promoters. CONCLUSION PBX1 is one of the determinants in the Cx32 promoter targeting site, preventing further damage of gap junction protein in H. pylori -associated gastric carcinogenesis. Key words: Helicobacter pylori; inflammation-carcinoma chain; Connexin 32; PBX1; carcinogenesis The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In this paper, we first report on the increasing tendency of transcriptional factor PBX1 in response to Helicobacter pylori (H. pylori ) infection. This is significant because H. pylori is the predominant factor of gastric carcinoma, and the enhanced PBX1 expression in epithelial cells was first revealed as a marker of H. pylori -associated gastric carcinogenesis. Moreover, PBX1 transcriptionally downregulates the expression of connexin 32, which is vital to epithelial cell-cell communication, indicating an anti-cancer target that prevents the accumulation of PBX1 in the presence of H. pylori infection. Liu XM, Xu CX, Zhang LF, Huang LH, Hu TZ, Li R, Xia XJ, Xu LY, Luo L, Jiang XX, Li M. PBX1 attributes as a determinant of connexin 32 downregulation in Helicobacter pylori-related gastric carcinogenesis. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5345.htm DOI: i INTRODUCTION The development of gastric cancer is generally conceptualized as a gradual altering process subsequent to genetic susceptibility, carcinogens, and Helicobacter pylori (H. pylori) infection. H. pylori causes chronic gastritis and gastric ulcer, and its chronic infection greatly accelerates the process towards gastric carcinoma [1]. It has been widely suggested that inflammation with H. pylori infection triggers gastric carcinogenesis through an inflammation-carcinoma chain [nonatrophic gastritis (NAG) chronic atrophic gastritis (CAG) intestinal metaplasia (IM) dysplasia (DYS) gastric carcinoma (GC)] [2]. CAG and IM are dynamic inflammatory processes that might be prone to severe histopathologic changes over time if left unchecked. Intercellular communication mediated by gap junctions is known as an indispensable mechanism for maintaining tissue homeostasis. This type of communication, composed of protein subunits known as connexins (Cxs), is the only means by which small substances (< 1 kda) flux between adjacent cells [3]. Connexins are expressed in specific and overlapping patterns, whose inhibition or dis-integrity has been virtually found in cancer cells and in cells clearly expressing oncogenes [4]. The gap junction protein connexin 32 (Cx32, an estimated molecular mass of 32 kda), encoded by the gap junction protein β1 gene, is expressed abundantly in mammalian gastric epithelium and defines cell-specific patterns of gap junctional intracellular communication (GJIC). Cx32 in mature mucosa appears to form a critical path of biological functions by directly potentiating the cells to cooperate electrically or metabolically. The heteromeric gap junction channels such as Cx26/Cx30 might be similar to Cx32 gap junction channels. Despite the similar function of Cx proteins found in specific tissues such as the liver and cochlea [5,6], to date, no evidence has shown that other Cx proteins could compensate for the loss of gastric epithelial Cx32. The expression levels of Cx32 were found to be significantly lower in human adenocarcinomas than in the normal stomach, agreeing with our previous finding that gastric carcinoma cells do not contain detectable Cx32 protein [7]. The altering localization of Cx32 expression from cytomembrane to the cytoplasm was found in gastric cancer cells compared with normal gastric epithelium [8]. The loss of Cx32 expression and membrane localization in human gastric cancer was further found to be related to the degree of tumor cell differentiation with unrestricted 5346 August 7, 2017 Volume 23 Issue 29

105 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC growth control [9]. Although reduced or abolished Cx32 is the most common reporter in gastric carcinogenesis events, a better understanding of its expressing tendency and neoplastic transformation subjected to H. pylori chronic infection is needed [10]. The inhibited Cx32 expression was first reported to be associated with CagA-positive H. pylori infection [11]. Moreover, our previous in vivo studies confirmed significantly lower Cx32 expression in the H. pylori-infected Mongolian gerbil than in the mucosa with the same stage in the inflammationcarcinoma chain, paving the way to further study how H. pylori accelerates gastric carcinogenesis [12]. Cxs function with high turnover rates with halflives of h, and the kinetics of Cx32 is largely dependent on its transcriptional regulation [13]. Accumulating evidence has shown multiple binding sites of transcriptional factors (TFs) in the promoter of Cx32 (TFSEARCH, version 1.3). In the present study, we collected gastric mucosal samples from patients with an H. pylori-infected inflammationcarcinoma chain and analyzed the expression levels of TFs. The homeodomain transcription factor PBX1 (Pre-B-cell leukemia transcription factor 1) was considerably upregulated following H. pylori-associated carcinogenesis. Further studies delineated PBX1- related transcriptional activity, which might account for Cx32 downregulation, thereby proposing a prominent mechanism of altered Cx32 in the progression of H. pylori-related gastric carcinogenesis. MATERIALS AND METHODS Bacterial culture The malignant H. pylori (East-Asian type CagA + ) used in this research was isolated from gastric carcinoma patients during gastroscopy and was grown on Columbia blood agar plates supplemented with antibiotics (10 mg/l vancomycin, 5 mg/l cefsulodin, 5 mg/l amphotericin, 5 mg/l trimethoprim and 10% sheep blood (Bianzhen Biotech, Nanjing, China) at 37 under microaerophilic conditions (5% O2, 10% CO2 and 85% N2) for 3-4 d. Next, H. pylori, which was in the early log phase with good motility and activity for subculture or intervention, was scraped and resuspended in PBS (with calcium). The concentration of H. pylori was analyzed by measuring the optical density of colony-forming units at 600 nm. Cell culture and cell/bacterial co-culture The human gastric epithelial cell line GES-1 and poorly differentiated human gastric cancer cell line BGC823 were purchased from Bogu Biotech (Shanghai, China). All cells were maintained in high-glucose (4.5 g/l) Dulbecco s modified Eagle s medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, 15 mmol/l HEPES (ph 7.4), 2 mmol/l L-glutamine, and 1% non-essential amino Table 1 Gender, age (mean ± SD) and disease duration (median) of cases at each stage Stage n M F Age Duration (yr) NGM no H. pylori infection ± (0.02-2) (21-55) NAG with H. pylori infection ± (0.01-7) (17-61) CAG with H. pylori infection ± 6.42 (39-66) 3 (0.08-7) IM with H. pylori infection ± (0.17-8) (38-76) DYS with H. pylori infection ± (31-67) 2.5 ( ) GC with H. pylori infection ± 9.94 (41-74) 0.25 (0.08-2) NGM: Normal gastric mucosa; NAG: Non-atrophic gastritis; CAG: Chronic atrophic gastritis; IM: Intestinal metaplasia; DYS: Dysplasia; GC: Gastric carcinoma. acids (HyClone, Logan, UT, United States) at 37 in an incubator containing 5% CO2 with a certain humidified atmosphere and was passaged with 0.25% trypsin. H. pylori was added at an H. pylori/ges-1 cell ratio of 35:1. Clinical/animal tissue collection Clinical specimens of the gastric antral mucosa were obtained from a total number of 4190 patients who underwent gastroscopy and were diagnosed at the Third Xiangya Affiliated Hospital of Central South University from August 2012 to August All included patients had signed written informed consent for the use of materials. Six specimens at the developmental stages of carcinogenesis (NAG, CAG, IM, DYS and GC) with H. pylori infection [H. pylori (+)] and five normal gastric mucosa (NGM) specimens without H. pylori infection [H. pylori (-)] were analyzed by transcriptional factor array. Additionally, 15 tissue specimens from CAG and GC with H. pylori infection and NGM without H. pylori infection were subjected to quantitative real-time polymerase chain reaction (RT-PCR) analysis, and another 15 specimens from CAG, IM, and GC tissues with and without H. pylori infection and NGM tissue without H. pylori infection were subjected to Western blot analysis. Endoscopic and pathological diagnosis was performed according to criteria depicted in our previous study [12]. Table 1 shows the clinical characteristics of the study population. Regarding animal tissues, the experimental protocol was approved by the ethics committee of the hospital. Twenty male Mongolian gerbils were divided randomly into an experimental group and a control group. After 24 h of fasting for all gerbils, the experimental group was inoculated with H. pylori (East-Asian type CagA + from GC patients) by intragastric gavage once every two days for a week, and the control group was inoculated with saline. Forty-eight weeks after intragastric gavage, the gerbils were sacrificed, 5347 August 7, 2017 Volume 23 Issue 29

106 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC and their gastric antrum tissues were collected and maintained in liquid nitrogen immediately for further detection. All gerbils were dieted with the same food and sterile water. Detection of PBX1 and Cx32 by RT-PCR and Western blot Total RNA was isolated from cells, clinical specimens, and Mongolian gerbil gastric tissues according to the manufacturer s instructions using the RNeasy Mini kit (Invitrogen, Life Technologies, Carlsbad, CA, United States). The cdna was synthesized using random primers and M-MLV reverse transcriptase (Qiagen) with the removal of genomic DNA contamination by DNaseI treatment (Qiagen, Valencia, CA, United States). Realtime PCR reactions were performed using the MyiQ Single Color Real-time PCR Detection system (Bio-Rad, Hercules, CA, United States), the iscript TM two-step RT- PCR kit with SYBR Green (Invitrogen) and gene primers (PBX1: forward: 5 -AAAGGAGATTGAGCGGATGGT-3, reverse: 5 -GGGTAAGGGTTGCTGAGATGG-3 ; Cx32: forward: 5 -GGATGCTCCGACAGCGTCTC-3, reverse: 5 -GCCCTCTGCTCCTCTTACCC-3 ; Cx32: forward: 5 -ATGAACTGGACAGGTTTGTAC-3, reverse: 5 -ATGTGTTGCTGGTGCAGCCA-3 ). The Ct values were normalized to those of β-actin (forward: 5 -GGCTGTGGAGACAAAAATGACCTC-3, reverse: 5 -AGGCTTGGGCTTGAATGGAGTC-3 ). The PBX1 or Cx32 protein levels were analyzed using Western blot; however, the gastric antrum tissues from the Mongolian gerbil were not analyzed due to the lack of specific antibodies. The cells and clinical specimens were washed twice with PBS (with calcium) and then homogenized in RIPA lysis buffer (150 mmol/l NaCl, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 50 mmol/l Tris at ph 8.0) containing protease, phosphatase inhibitors and phenylmethylsulfonyl fluoride (all from Sigma, St Louis, MO, United States). Following sonication and centrifugation at g for 10 min at 4, the supernatant (soluble proteins) was collected. The protein concentration of each sample was determined using a protein assay kit (Pierce, Rockford, IL, United States). The samples were denatured in loading buffer. Equivalent amounts of proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, United States). After incubation with antibodies specific for PBX1 (Santa Cruz, Dallas, TX, United States; diluted 1:200), Cx32 (Proteintech, Chicago, IL, United States; diluted 1:500), β-actin (Proteintech; diluted 1:4000), calnexin (Cell Signaling, Danvers, MA, United States; diluted 1:10000), and tubulin (Cell Signaling; diluted 1:10000) at 4 overnight, the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody (1:5000, Jackson Immuno-Research, West Grove, PA, United States). The membranes were then visualized using the enhanced chemiluminescence Western blotting substrate (Bio-Rad). Transcriptional factor/dna array Cx32 promoter (-2000 bp) sequences (H. sapiens) were downloaded from UCSC [14]. The candidate transcriptional factor binding sites of the Cx32 promoters were predicted with TFSEARCH ( jp/research/db/tfsearch.html) [15]. Nuclear extracts of gastric mucosal biopsies were subjected to the TranSignal Protein/DNA Array (Panomics, Redwood City, CA, United States) according to the manufacturer s instructions. In short, biotin-labeled DNA-binding oligonucleotides (TranSignal Probe Mix) were incubated with 10 μg of nuclear extract at 15 for 30 min to form transcription factor/dna complexes. These complexes were then separated from the free probes by 2% agarose gel electrophoresis in 0.5 TBE at 120 V for 15 min. The probes in the complexes were released, ethanol-precipitated, and hybridized to the TranSignal Protein/DNA Array. The detection of signals was obtained using an enhanced chemiluminescence imaging system. Transfection Three RNAi target sequences were selected according to stealth RNAi of the human PBX1 mrna (Accession No. NM_ ). The sequences of the synthesized oligonucleotides were as follows: sirna-1: sense 5 -ACAAUCAACACCGUCAUUGAG-3, antisense 5 -CUCAAUGACGGUGUUGAUUGU-3 ; sirna-2: sense 5 -AAAGGAAAAGGCUCAAACCCC-3, antisense 5 -GGGGUUUGAGCCUUUUCCUUU-3 ; sirna-3: sense 5 -UAAGAAUCCCCAUUGAGUGAC-3, antisense 5 -GUCACUCAAUGGGGAUUCUUA-3. Lipofectamine reagent (Invitrogen) was used to transfect synthesized Stealth RNAi against PBX1 into BGC823 cells, and the negative control duplexes were delivered into BGC823 cells as well. BLOCK-iT Alexa Fluor Red Fluorescent (Invitrogen) was used to confirm the transfection efficiency of each duplex sirna. Regarding PBX1 overexpression, the full-length human PBX1 3 untranslated region and coding sequence region were amplified by PCR and cloned into the pcdna 3.1(+) plasmid (GenePharma Inc. Shanghai, China), followed by transfection into GES-1 cells according to the manufacturer s instructions. Plasmid construction and dual-luciferase assay The pgl3 Basic vector containing the entire sequence of the Cx32 promoter was a kind gift from Yingrun Biotechnology (Changsha, China), and no mutation was previously confirmed by DNA sequencing. To validate the PBX1 binding sites in the Cx32 promoters, PBX1 cdna was amplified by PCR using the BamH Ⅰ and EcoR Ⅰ digestion sites in the pdoubleex-egfp plasmid (sense, 5 -CGGGATCCGCCACCATGGACGAGCAGCCCAGG 5348 August 7, 2017 Volume 23 Issue 29

107 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC A The relative expression of PBX1 mrna e e B The relative expression of Cx32 mrna b e 0 NGM CAG GC 0.00 NGM CAG GC C H. pylori NGM CAG CAG IM IM GC GC PBX1 (Higher exposure) Cx32 Actin Figure 1 Comparison of PBX1 and connexin 32 expression among developmental stages of Helicobacter pylori-associated gastric carcinoma in clinical specimens. Quantitative RT-PCR analysis of PBX1 (A) and Cx32 (B) in H. pylori (-) NGM and H. pylori (+) CAG and GC patients (n = 15). C: Representative images of the PBX1 and Cx32 protein levels in H. pylori (-) NGM and H. pylori (-/+) CAG, IM and GC tissues. b P < 0.01, e P < NGM: Normal gastric mucosa; CAG: Chronic atrophic gastritis; GC: Gastric cancer; IM: Intestinal metaplasia. CTGAT-3 ; antisense, 5 GGAATTCTCAGTTGGAGGTA TCAGAGT-3 ). The constructed CX32-pGL3 Basic and pdoubleex-egfp-pbx1 vectors were co-transfected into HEK293T cells. The firefly and Renilla luciferase activities in the cell lysates were triplicated and determined using a dual-luciferase assay system (Promega), and the normalized ratio of the Renilla/ firefly reflected the expression activity. Statistical analysis Statistical analyses were performed using the Statistical Package for Social Sciences software 12 (SPSS Inc., Chicago, IL, United States). All data are expressed as mean ± SD. Multiple-group comparisons were characterized using one-way analysis of variance (ANOVA) with Dunnett s multiple comparison tests. Two-sided t-tests and Spearmen s correlation test were applied to determine the correlations between groups, and a value of P < 0.05 was considered statistically significant. RESULTS Upregulated PBX1 but downregulated Cx32 is confirmed along with H. pylori-associated gastric carcinogenesis in clinical specimens Comparison of H. pylori (-) NGM and H. pylori (+) NAG, CAG, IM, DYS and GC tissues revealed the increased expression of PBX1 as follows: (1) a consistent trend of endogenous expression along the gastric inflammation-carcinoma chain; and (2) a remarkable change with clinical significance between any two successive stages (> 2-fold or < 0.5-fold). It was previously shown by TF microarray that PBX1 is rarely found in H. pylori (-) NGM, but its accumulation is initiated in H. pylori (+) NAG and CAG, enriched in IM and DYS, and highest in GC tissues [16]. H. pylori infection accounting for stimulated PBX was, for the first time, based on the comparison between each single-stage exposure to H. pylori and NGM. Moreover, because CAG is widely accepted as the initiating phase of gastric precancerous lesions, further amounts of PBX1 shown above could be counted as the molecular event involved in gastric epithelial neoplasia. PBX1 malignancy was first classified as showing gastric epithelial specificity given the continuous high expression in IM, DYS and GC. The pertinent roles of incremental PBX1 in the H. pylori-related gastric epithelial inflammation-carcinoma chain were further investigated. Consistent with the TF microarray results, enriched PBX1 mrna was timedependently subjected to H. pylori (Figure 1A, p < 0.001) and showed the opposite tendency towards Cx32 mrna levels in the same samples (Figure 1B, p < 0.01). PBX1 and Cx32 protein levels in typical specimens from H. pylori (-) NGM, H. pylori (-/+) CAG, IM and GC demonstrated that PBX1 upregulation and Cx32 inhibition were associated with GC progression as well as the presence of H. pylori (Figure 1C). It was conceivable that the accelerated PBX1 activation 5349 August 7, 2017 Volume 23 Issue 29

108 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC A b B e 4 e e 8 e e The relative expression of PBX1 mrna Hp (-) Hp (+) Hp (-) Hp (+) 24 h 48 h The relative expression of Cx32 mrna Hp (-) Hp (+) Hp (-) Hp (+) 24 h 48 h C H. pylori 24 h 48 h PBX1 Cx32 Tubulin Figure 2 Effects of Helicobacter pylori infection on PBX1 and connexin 32 expression in GES-1 cells. Quantitative RT-PCR analysis of PBX1 (A) and Cx32 (B) in GES-1 cells with 24- and 48-h H. pylori infection; C: Western blot analysis of PBX1 and Cx32 protein levels in GES-1 cell under 24- and 48-h H. pylori infection. b P < 0.01, e P < and inhibited Cx32 were synchronous with gastric carcinoma progression. H. pylori triggers PBX1 augmentation and Cx32 inhibition in vitro Dramatic elevation of PBX1 mrna expression was found after 24 h co-cultures of H. pylori and GES-1 cells, and this enrichment was maintained for 48 h (Figure 2A, p < 0.01). The expected time-dependent Cx32 mrna decrease (Figure 2B, p < 0.001) was in accordance with the malfunction of GJIC revealed by the Scrape-loading and dye transfer technique (SLDT, data not shown). The increased PBX1 protein levels, as well as decreased Cx32 protein levels, were detected with prolonged time (Figure 2C), which is consistent with a previous report that H. pylori infection is correlated with GJ inhibition [17]. These findings verified a significant stimulatory effect of short-time H. pylori on the gastric mucosa even in low-infectious titers. PBX1 downregulates Cx32 by binding to its promoters The increased PBX1 was accompanied by decreased Cx32 upon H. pylori infection as mentioned above. It was confirmed that the PBX1 overexpression in GES-1 cells (Figure 3A, p < 0.001) considerably reduced the Cx32 expression (Figure 3B, p < 0.001). Given that other PBX family proteins theoretically compensate for the endogenous PBX1 alteration if there are indeed overlapping structure and biological function among them, we additionally addressed specific functions in PBX1 attenuation studies. The relatively enriched PBX1 was previously found in the poorly differentiated gastric adenocarcinoma cell line BGC-823 (data not shown); thus, these monolayers were subjected to PBX1 silencing (sirna-1, sirna-2 and sirna-3) as the downregulated PBX1 mrna (Figure 3C, p < 0.001). Restoration of the Cx32 mrna (Figure 3D, p < 0.01) and protein levels (Figure 3E) supported the ameliorated Cx32 expression in GC cells subsequent to PBX1 suppression. It is tempting to speculate that H. pylori-mediated Cx32 disruption and gap junctional functions could be alleviated by restraining further PBX1 activation. Given the inverse trends of Cx32 expression upon enforced PBX1 changes, we next explored how PBX1 transcriptionally regulates the Cx32 gene using the dual-luciferase reporter assay. The PBX1- overexpressing plasmid (pdoubleex-egfp-pbx1, see vector map in Supplemental Figure 1) without any mutation (sequence alignment in Supplemental Figure 2) and Cx32 promoters were successfully transfected into HEK293T cells (Supplemental Figure 3). The activity of the wild-type Cx32 promoter reporter was reduced by approximately 30% shortly after pdoubleex-egfp-pbx1 co-transfection (Figure 3F; p < 0.001), suggesting that PBX1 reduced the Cx August 7, 2017 Volume 23 Issue 29

109 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC A B C e The relative expression of PBX1 mrna e The relative expression of Cx32 mrna b The relative expression of PBX1 mrna e 0 NC OE 0 NC OE 0.0 NT NC sirna-1 sirna-2 sirna-3 D 1.0 b e E Control Negative control sirna1 sirna2 sirna3 The relative expression of Cx32 mrna PBX1 Cx NT NC sirna-1 sirna-2 sirna-3 β-actin F Relative lucife rase activity of Cx b p-cx32 p-cx32 pgl3 pgl VC PBX1 PBX1 VC Figure 3 PBX1 negatively regulates connexin 32 by directly binding to its promoters. Quantitative RT-PCR analysis of PBX1 (A) and Cx32 (B) levels in GES-1 cells enforced with the PBX1 overexpressing (OE) vector and transfected with a negative control (NC) vector. Quantitative RT-PCR analysis of PBX1 (C) and Cx32 (D) levels in human adenocarcinoma BGC823 cells treated with a scrambled control, PBX1 sirna-1, PBX1 sirna-2, and PBX1 sirna-3. E: PBX1 and Cx32 protein levels in BGC823 treated with a scrambled control, PBX1 sirna-1, PBX1 sirna-2, and PBX1 sirna-3. F: PBX1 directly binds to Cx32 promoters. HEK293T cells cotransfected with pdoubleex-egfp-pbx1 and Cx32-pGL3 vectors. The results are displayed as the ratio of firefly luciferase activity in pgl3-cx32-pbx1-transfected cells to the activity in Cx32-pGL3 controls. b P < 0.01, e P < activity by binding to its promoters. PBX1 enrichment and Cx32 inhibition are found in H. pylori-infected Mongolian gerbils The augmented PBX1 and inhibited Cx32 mrna levels in H. pylori (+) antral tissues were detected (Figure 4A and B) compared with the control group, showing an inverse correlation between PBX1 and Cx32 (Figure 4C). Among 21 gerbils with 48-week H. pylori infection, 17 manifested with erosion, hemorrhage, edema, hyperemia, and food retention macroscopically. As for the pathological sections, 4 were unchanged, 12 were non-atrophic gastritis (7 with mild inflammation, 4 with moderate inflammation, and 1 with severe inflammation), 3 were atrophic gastritis, and 2 were intestinal metaplasia. Alternatively, no inflammatory status were found in the control group (Figure 4D). The lack of MGs-specific antibodies hindered the 5351 August 7, 2017 Volume 23 Issue 29

110 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC A 1.0 e B 1.5 e C The relative expression of PBX1 mrna Hp (-) Hp (+) The relative expression of Cx32 mrna Hp (-) Hp (+) The relative expression of Cx32 mrna y = x R 2 = The relative expression of PBX1 mrna D Normal gastric mucosa Non-atrophic gastritis Non-atrophic gastritis Hp (-) mild inflammation Hp (+) moderate inflammation Hp (+) 20μm Non-atrophic gastritis Atrophic gastritis Intestinal metaplasia severe inflammation Hp (+) Hp (+) Hp (+) Figure 4 Effects of Helicobacter pylori on PBX1 and connexin 32 expression in Mongolian gerbils. Alteration in the PBX1 (A) and Cx32 (B) mrna expression levels in Mongolian gerbils with 48-wk H. pylori infection (n = 21) compared with those in the control group (n = 4). e P < 0.001; C: Correlation between the PBX1 and Cx32 mrna levels in Mongolian gerbils (21 from the experimental group and 4 from the control group); D: Pathological outcome of Mongolian gerbils (HandE staining 400 ) after 48-wk H. pylori infection: NGM with no H. pylori infection; NAG (mild/moderate/severe inflammation), CAG, and IM in the experimental group. Scale bar: 20 μm. NGM: Normal gastric mucosa; NAG: Non-atrophic gastritis; CAG: Chronic atrophic gastritis; IM: Intestinal metaplasia. further test of PBX1 and Cx32 protein expression. But overall, these in vivo data strengthened the PBX1 and Cx32 tendencies in gastric mucosa models. DISCUSSION Studies of gap junction proteins during the progression of gastric epithelial carcinogenesis have provided us with remarkable insights into various outcomes of host-bacterial interactions. Reduced or absent Cx32 expression has been implicated in the entire process of H. pylori-associated gastric carcinogenesis, one mechanism of which is promoter methylation [12]. Meanwhile, a growing number of transcriptional factors involved in Cx32 regulation for a potential pathway remain unidentified. One of our previous studies confirmed the augmented transcriptional factor GATA-3 in H. pylori-related GC occurrence, and GATA-3 enables the Cx32 transcriptional downregulation by directly binding to its promoters; these results are in line with the sequence prediction using a bioinformatics approach [18]. These observations raise the possibility that the emerging transcriptional factors directly regulate Cxs genes that participate in key pathways related to gastric oncogenesis. PBX1 is a well-established transcriptional factor in the self-renewal of hematopoietic stem cells and participates in reprogramming lineage-committed blood cells into hematopoietic stem cells [19,20]. Studies in mice have suggested that PBX1 may be involved 5352 August 7, 2017 Volume 23 Issue 29

111 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC in the regulation of osteogenesis, and it is required for skeletal, neuronal, pancreatic island, spleen, and urogenital tract patterning by binding to known regulatory regions of growth-related genes [20-23]. In human cancer, PBX1 was first referred to as a translocated proto-oncogene in leukemia, and the translocated gene product (together with the TCF3/ E2A gene) was shown to have oncogenic potential [24,25]. Its hematopoietic malignancy was partly addressed by the signaling networks, including those of the E2A- PBX1 target genes ZAP70, SYK, and LCK that encode kinases upstream of PLCγ2; particularly, PBX1 plays an oncogenic role in pre-b-all [26]. Furthermore, PBX1 is highly expressed in solid tumors, including melanoma, prostate, ovarian, and breast cancers [27-30]. For instance, PBX1 has been identified as an effector in the NOTCH3 signaling pathway in ovarian cancer and is strongly related to a high extent of prostate cancer from TF microarray analysis and is known to be positively correlated with multiple epithelial malignancies through regulation of the PI3K/Akt pathway [28,31]. The in silico analysis of the Cx32 promoter sequence data demonstrated that PBX1 may act as an upstream molecular hub by directly regulating Cx32. We report here that PBX1 is a critical transcriptional regulator required for Cx32 expression. At the tissue level, PBX1 is upregulated significantly compared with the matched stages in non-h. pylori infected tissues, and its upregulation is associated with a less favorable prognosis in patients. Moreover, the high affinity of PBX1-Cx32 transcriptional regulation was confirmed by luciferase reporter assay. These findings established a novel but determinant role of PBX1 in the event of reduced Cx32 along the development of H. pylorirelated gastric carcinogenesis and provide a molecular basis for targeting PBX1 or its downstream effectors to overcome the inflammation-carcinoma progression. The association between PBX1 expression and development of cell neoplasia suggests that the PBX1 pathway is potentially actionable for targetbased therapy. In fact, PBX1 orchestrates multiple functional networks, and additional PBX1-regulated signaling pathways are yet to be discovered. A direct strategy employing a combination of PBX1 antagonists and chemotherapeutic agents may at least offer a better intervention to delay tumor advancement and recurrence. Another feasible rationale is to target downstream effectors of PBX1 such as JAK2/STAT3 (JAK2, a tyrosine kinase that directly phosphorylates and activates STAT3) that leads to transcriptional activation of various STAT3-regulated genes that work in concert to promote tumor progression [30]. Similarly, E2A-PBX1 notably expands progenitor B-cell subpopulations in pre-leukemic mice, increasing penetrance and shortening leukemia latency accompanied most notably by JAK/STAT activation, which is required for leukemia cell proliferation [32]. It was recently reported that PBX1 acts directly on the STAT3 promoter to induce STAT3 transcription. More intriguingly, STAT3 is responsible for all PBX1-mediated phenotypes [30]. Further efforts are needed to illuminate the mechanisms through which PBX1 is reactivated or its network reprogrammed in response to challenges in the tumor environment, such as experiencing inflammation or under pathogen invasion. Cx32 has a strong tumorsuppressive effect on multiple cancer cell lines via various pathways [33,34]. A previous study considers Cx32 as a tumor suppressor gene in a renal carcinoma (Caki-1 cell) since this tumor-suppressive effect partly depends on the inhibited Src-Stat3-VEGF signaling [35]. Overall, our data largely illustrate the sequential up/ downstream relationship between PBX and Cx32, revealing a convenient access to Cx32 regulation independent of intermediate networks such as STAT3. It would be meaningful to further study potential crosstalk between these signaling pathways. Collectively, H. pylori retarded gap junction function by reducing Cx32 expression, expediting gastric cancerous susceptibility. TF screening shows that PBX1 activation is one of novel events of H. pylori-related gastric carcinogenesis. A global view of increasing PBX1 is presented in H. pylori-associated clinical specimens, gastric epithelial cells and Mongolian gerbils. The reversed regulating trend of Cx32 by PBX1 presumably presents an approach for the restoration of Cx32 in precancerous lesion tissues. Apart from binding directly to the Cx32 promoter, the research direction of PBX1 in gastric epithelial cells is challenging but warrants further investigation. PBX1 would be a crucial mediator that unravels H. pylori-dependent microenvironment and the gastric inflammationcarcinoma chain. It could be expected that the PBX1- Cx32 targeting site sheds light on preventing further damage by H. pylori chronic infection. COMMENTS Background Helicobacter pylori (H. pylori) infection has been widely suggested to accelerate gastric carcinogenesis through an inflammation-carcinoma chain. Connexin 32 (Cx32), a gap-junction protein, plays a suppressive role in gastric carcinogenesis. Our studies previously revealed the reduced Cx32 expression in H. pylori-infected gastric mucosa and its association with the carcinogenesis, but its regulating patterns, including transcriptional control, remain enigmatic. Research frontiers Previous studies have demonstrated the decreasing expression of Cx32 from normal gastric mucosa to precancerous lesions and gastric carcinomas (GCs). Cx32 abnormality is a crucial molecular event for loss of gap junctional functions. The changing expression patterns of transcriptional factors (TFs) caused by H. pylori might affect Cx32 expression. It is requisite to clarify the mechanisms regarding how Cx32 is downregulated by potential TFs to unravel the transcriptional regulation mechanism of GC occurrence. Innovations and breakthroughs The authors draw attention to PBX1 because of its increasing tendency toward H. pylori-associated gastric carcinogenesis and its Cx32 binding sites predicted by bioinformatics tools. The multiple H. pylori-infected cell, animal and clinical specimen models were rigorously designed and performed in terms of PBX1 and Cx32 expression, whose negative correlation is in line with our previous 5353 August 7, 2017 Volume 23 Issue 29

112 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC work. It is intriguing that PBX1 downregulates Cx32 expression by directly binding to its promoters, and inhibition of PBX1 leads to Cx32 upregulation, indicating PBX1 as a promising anti-cancer target. Applications This study showed increased PBX1 expression during gastric carcinogenesis stages with H. pylori infection that is largely responsible for Cx32 downregulation. It is therefore expected that Cx32 inhibition could be somehow reversed by treating against potential TFs, which provides new insights for H. pylori-related GC therapy. Peer-review This is a very-well designed, performed and written experimental and clinical study for deciphering PBX1-Cx32 regulating axis under H. pylori infection and its association with gastric carcinogenesis. REFERENCES 1 Malfertheiner P, Sipponen P, Naumann M, Moayyedi P, Mégraud F, Xiao SD, Sugano K, Nyrén O; Lejondal H. pylori- Gastric Cancer Task Force. Helicobacter pylori eradication has the potential to prevent gastric cancer: a state-of-the-art critique. Am J Gastroenterol 2005; 100: [PMID: DOI: /j x] 2 Marshall B. Helicobacter pylori: past, present and future. Keio J Med 2003; 52: [PMID: ] 3 Saez JC, Berthoud VM, Branes MC, Martinez AD, Beyer EC. Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev 2003; 83: [PMID: DOI: /physrev ] 4 de Feijter AW, Matesic DF, Ruch RJ, Guan X, Chang CC, Trosko JE. Localization and function of the connexin 43 gap-junction protein in normal and various oncogene-expressing rat liver epithelial cells. Mol Carcinog 1996; 16: [PMID: DOI: /(SICI) (199608)16:43.0.CO;2-G] 5 Nagy JI, Ionescu AV, Lynn BD, Rash JE. Coupling of astrocyte connexins Cx26, Cx30, Cx43 to oligodendrocyte Cx29, Cx32, Cx47: Implications from normal and connexin32 knockout mice. Glia 2003; 44: [PMID: DOI: / glia.10278] 6 Degen J, Schütz M, Dicke N, Strenzke N, Jokwitz M, Moser T, Willecke K. Connexin32 can restore hearing in connexin26 deficient mice. Eur J Cell Biol 2011; 90: [PMID: DOI: /j.ejcb ] 7 Uchida Y, Matsuda K, Sasahara K, Kawabata H, Nishioka M. Immunohistochemistry of gap junctions in normal and diseased gastric mucosa of humans. Gastroenterology 1995; 109: [PMID: ] 8 Radebold K, Horakova E, Gloeckner J, Ortega G, Spray DC, Vieweger H, Siebert K, Manuelidis L, Geibel JP. Gap junctional channels regulate acid secretion in the mammalian gastric gland. J Membr Biol 2001; 183: [PMID: ] 9 Jee H, Nam KT, Kwon HJ, Han SU, Kim DY. Altered expression and localization of connexin32 in human and murine gastric carcinogenesis. Dig Dis Sci 2011; 56: [PMID: DOI: /s z] 10 Yokozaki H. Molecular characteristics of eight gastric cancer cell lines established in Japan. Pathol Int 2000; 50: [PMID: ] 11 Mine T, Endo C, Kushima R, Kushima W, Kobayashi I, Muraoka H, Taki R, Fujita T. The effects of water extracts of CagA positive or negative Helicobacter pylori on proliferation, apoptosis and connexin formation in acetic acid-induced gastric ulcer of rats. Aliment Pharmacol Ther 2000; 14 Suppl 1: [PMID: ] 12 Wang Y, Huang LH, Xu CX, Xiao J, Zhou L, Cao D, Liu XM, Qi Y. Connexin 32 and 43 promoter methylation in Helicobacter pyloriassociated gastric tumorigenesis. World J Gastroenterol 2014; 20: [PMID: DOI: /wjg.v20.i ] 13 Leithe E, Rivedal E. Ubiquitination of gap junction proteins. J Membr Biol 2007; 217: [PMID: DOI: / s z] 14 Goldman M, Craft B, Swatloski T, Ellrott K, Cline M, Diekhans M, Ma S, Wilks C, Stuart J, Haussler D, Zhu J. The UCSC Cancer Genomics Browser: update Nucleic Acids Res 2013; 41: D949-D954 [PMID: DOI: /nar/gks1008] 15 Wingender E. The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief Bioinform 2008; 9: [PMID: DOI: /bib/bbn016] 16 Hu TZ, Huang LH, Xu CX, Liu XM, Wang Y, Xiao J, Zhou L, Luo L, Jiang XX. Expressional profiles of transcription factors in the progression of Helicobacter pylori-associated gastric carcinoma based on protein/dna array analysis. Med Oncol 2015; 32: 265 [PMID: DOI: /s y] 17 Xu C, Chen Y, Chen X, Wang F. Effects of different types of Helicobacter pylori on the gap junction intercellular communication in GES-1 cells. Zhong Nan Da Xue Xue Bao Yi Xue Ban 2011; 36: [PMID: DOI: /j.issn ] 18 Liu X, Cao K, Xu C, Hu T, Zhou L, Cao D, Xiao J, Luo L, Guo Y, Qi Y. GATA-3 augmentation down-regulates Connexin43 in Helicobacter pylori associated gastric carcinogenesis. Cancer Biol Ther 2015; 16: [PMID: DOI: / ] 19 Riddell J, Gazit R, Garrison BS, Guo G, Saadatpour A, Mandal PK, Ebina W, Volchkov P, Yuan GC, Orkin SH, Rossi DJ. Reprogramming committed murine blood cells to induced hematopoietic stem cells with defined factors. Cell 2014; 157: [PMID: DOI: /j.cell ] 20 Ficara F, Murphy MJ, Lin M, Cleary ML. Pbx1 regulates selfrenewal of long-term hematopoietic stem cells by maintaining their quiescence. Cell Stem Cell 2008; 2: [PMID: DOI: /j.stem ] 21 Grebbin BM, Hau AC, Groß A, Anders-Maurer M, Schramm J, Koss M, Wille C, Mittelbronn M, Selleri L, Schulte D. Pbx1 is required for adult subventricular zone neurogenesis. Development 2016; 143: [PMID: DOI: / dev ] 22 Selleri L, Depew MJ, Jacobs Y, Chanda SK, Tsang KY, Cheah KS, Rubenstein JL, O Gorman S, Cleary ML. Requirement for Pbx1 in skeletal patterning and programming chondrocyte proliferation and differentiation. Development 2001; 128: [PMID: ] 23 Brendolan A, Ferretti E, Salsi V, Moses K, Quaggin S, Blasi F, Cleary ML, Selleri L. A Pbx1-dependent genetic and transcriptional network regulates spleen ontogeny. Development 2005; 132: [PMID: DOI: /dev.01884] 24 Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith SD, Cleary ML. Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mrna that codes for a potential chimeric transcription factor. Cell 1990; 60: [PMID: ] 25 Kamps MP, Look AT, Baltimore D. The human t(1;19) translocation in pre-b ALL produces multiple nuclear E2A-Pbx1 fusion proteins with differing transforming potentials. Genes Dev 1991; 5: [PMID: ] 26 Duque-Afonso J, Lin CH, Han K, Wei MC, Feng J, Kurzer JH, Schneidawind C, Wong SH, Bassik MC, Cleary ML. E2A-PBX1 Remodels Oncogenic Signaling Networks in B-cell Precursor Acute Lymphoid Leukemia. Cancer Res 2016; 76: [PMID: DOI: / CAN ] 27 Shiraishi K, Yamasaki K, Nanba D, Inoue H, Hanakawa Y, Shirakata Y, Hashimoto K, Higashiyama S. Pre-B-cell leukemia transcription factor 1 is a major target of promyelocytic leukemia zinc-finger-mediated melanoma cell growth suppression. Oncogene 2007; 26: [PMID: DOI: / sj.onc ] 28 Yeh HY, Cheng SW, Lin YC, Yeh CY, Lin SF, Soo VW. Identi August 7, 2017 Volume 23 Issue 29

113 Liu XM et al. PBX1 downregulates Cx32 in H. pylori GC fying significant genetic regulatory networks in the prostate cancer from microarray data based on transcription factor analysis and conditional independency. BMC Med Genomics 2009; 2: 70 [PMID: DOI: / ] 29 Magnani L, Stoeck A, Zhang X, Lánczky A, Mirabella AC, Wang TL, Gyorffy B, Lupien M. Genome-wide reprogramming of the chromatin landscape underlies endocrine therapy resistance in breast cancer. Proc Natl Acad Sci USA 2013; 110: E1490-E1499 [PMID: DOI: /pnas ] 30 Jung JG, Shih IM, Park JT, Gerry E, Kim TH, Ayhan A, Handschuh K, Davidson B, Fader AN, Selleri L, Wang TL. Ovarian Cancer Chemoresistance Relies on the Stem Cell Reprogramming Factor PBX1. Cancer Res 2016; 76: [PMID: DOI: / CAN ] 31 Wang J, Wakeman TP, Lathia JD, Hjelmeland AB, Wang XF, White RR, Rich JN, Sullenger BA. Notch promotes radioresistance of glioma stem cells. Stem Cells 2010; 28: [PMID: DOI: /stem.261] 32 Duque-Afonso J, Feng J, Scherer F, Lin CH, Wong SH, Wang Z, Iwasaki M, Cleary ML. Comparative genomics reveals multistep pathogenesis of E2A-PBX1 acute lymphoblastic leukemia. J Clin Invest 2015; 125: [PMID: DOI: / JCI81158] 33 Katoch P, Mitra S, Ray A, Kelsey L, Roberts BJ, Wahl JK 3rd, Johnson KR, Mehta PP. The carboxyl tail of connexin32 regulates gap junction assembly in human prostate and pancreatic cancer cells. J Biol Chem 2015; 290: [PMID: DOI: /jbc.M ] 34 Kawasaki Y, Omori Y, Li Q, Nishikawa Y, Yoshioka T, Yoshida M, Ishikawa K, Enomoto K. Cytoplasmic accumulation of connexin32 expands cancer stem cell population in human HuH7 hepatoma cells by enhancing its self-renewal. Int J Cancer 2011; 128: [PMID: DOI: /ijc.25308] 35 Fujimoto E, Sato H, Shirai S, Nagashima Y, Fukumoto K, Hagiwara H, Negishi E, Ueno K, Omori Y, Yamasaki H, Hagiwara K, Yano T. Connexin32 as a tumor suppressor gene in a metastatic renal cell carcinoma cell line. Oncogene 2005; 24: [PMID: DOI: /sj.onc ] P- Reviewer: De Re V, Garcia-Olmo D, Slomiany BL, Vorobjova T S- Editor: Gong ZM L- Editor: Wang TQ E- Editor: Huang Y 5355 August 7, 2017 Volume 23 Issue 29

114 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) ORIGINAL ARTICLE Case Control Study Influence of dietary isoflavone intake on gastrointestinal symptoms in ulcerative colitis individuals in remission Dominika Głąbska, Dominika Guzek, Dominika Grudzińska, Gustaw Lech Dominika Głąbska, Dominika Grudzińska, Department of Dietetics, Faculty of Human Nutrition and Consumer Sciences, Warsaw University of Life Sciences (WULS-SGGW), Warsaw, Poland Dominika Guzek, Department of Organization and Consumption Economics, Faculty of Human Nutrition and Consumer Sciences, Warsaw University of Life Sciences (WULS-SGGW), Warsaw, Poland Gustaw Lech, Department of General, Gastroenterological and Oncological Surgery, Medical University of Warsaw, Warsaw, Poland Author contributions: Głąbska D designed the study; Głąbska D, Guzek D, Grudzińska D and Lech G conducted the research; Głąbska D analysed the data and performed the statistical analysis; Głąbska D, Guzek D, Grudzińska D and Lech G wrote the paper; Głąbska D had the primary responsibility for the final content; all authors read and approved the final manuscript. Supported by Ministry of Science and Higher Education grant (WULS-SGGW: L /2014) Institutional review board statement: The study was reviewed and approved by the by the Bioethical Commission of the Central Clinical Hospital of the Ministry of Interior in Warsaw (No 35/ 2009) and the Bioethical Commission of the National Food and Nutrition Institute (No 1604/ 2009). Informed consent statement: All the participants provided written consent to participate in the study. Conflict-of-interest statement: The authors declare no conflict of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Dominika Głąbska, PhD, Chair of Dietetics, Department of Dietetics, Faculty of Human Nutrition and Consumer Sciences, Warsaw University of Life Sciences (WULS-SGGW), 159c Nowoursynowska Str, Warsaw, Poland. dominika_glabska@sggw.pl Telephone: Fax: Received: February 2, 2017 Peer-review started: February 8, 2017 First decision: March 16, 2017 Revised: March 31, 2017 Accepted: May 19, 2017 Article in press: May 19, 2017 Published online: August 7, 2017 Abstract AIM To analyse the association between isoflavone intake and ulcerative colitis motility symptoms in individuals in remission. METHODS Cross-sectional study was conducted in a group of ulcerative colitis remission individuals, in subgroups characterised by various intestinal motility and functioning characteristics (abdominal pain, flatulence, constipations, tenesmus). Total of 56 individuals with ulcerative colitis in remission (19 males and 37 females) were recruited for the study. Assessment of diet was based on self-reported data from each patient s dietary 5356 August 7, 2017 Volume 23 Issue 29

115 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms records taken over a period of three typical, random days (2 weekdays and 1 d of the weekend). The daily isoflavone intake (daidzein, genistein, glycitein and total isoflavones) and daily isoflavone intake per 1000 kcal of diet were assessed. RESULTS No correlations between isoflavone intake levels and number of bowel movements per day were observed both in the case of intake and intake per 1000 kcal of diet. In the group of individuals declaring lack of abdominal pain, the higher intakes of daidzein (p = ), daidzein per 1000 kcal of diet (p = ) and total isoflavone (p = ) were stated, than in the group of individuals declaring abdominal pain. In the group of individuals declaring lack of constipations, the lower intakes of glycitein (p = ) and glycitein per 1000 kcal of diet (p = ) were stated, than in the group of individuals declaring presence of constipations. No differences were observed in isoflavone intake between groups of ulcerative colitis individuals declaring lack of flatulence and declaring presence of flatulence, as well as between groups declaring lack of tenesmus and declaring presence of tenesmus. CONCLUSION The moderate dietary isoflavone intake may be beneficial for individuals with ulcerative colitis in remission, however, before including it into recommendations, further prospective studies are needed. Key words: abdominal pain; constipations ulcerative colitis; daidzein; genistein; glycitein; isoflavone The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Studies assessing influence of isoflavones on inflammatory bowel disease are contradictory. In presented study a higher daidzein, glycitein and total isoflavones intake in ulcerative colitis individuals in remission were associated with lack of abdominal pain and declared constipations. The effect of isoflavone may be dose-dependent, as in conducted study, an isoflavone intake was over 10 times lower, that in Japanese study, in which it was indicated, that isoflavone intake may be associated with increased risk of the disease. It may be stated, that in European countries, due to lower intake than in Asian ones, beneficial isoflavone effect may be observed. INTRODUCTION In spite of the fact, that nutritional support and therapy in inflammatory bowel diseases guidelines is indicated, as an element of the high-quality clinical care [1], the diet therapy is applied by only 10% of patients with inflammatory bowel disease [2]. It is associated with the fact, that there is little evidence, indicating, that diet plays the proven role in etiology [3] or may change the natural course of ulcerative colitis or Crohn s disease [4]. Although evidence-based dietary guidelines in inflammatory bowel diseases are lacking [4], there are number of studies indicating potential influence of nutrition and suggesting dietary modifications in prevention [5-7] or therapy of inflammatory bowel diseases [8,9]. Among other nutrients, isoflavones are indicated as characterized by potential influence on inflammatory bowel disease, but the conclusions seem to be contradictory, as the effects of isoflavones on development and course of the disease may differ. The first study proving the association between dietary isoflavone intake and ulcerative colitis development, indicated, that isoflavone intake may be associated with an increased risk of the disease [10]. However, a number of animal-model studies indicated, that isoflavone intake may prevent exacerbations by inhibiting the colitis [11-13]. Due to the fact, that in the group of inflammatory bowel disease individuals, isoflavone supplementation is not indicated as recommended [14], in the mentioned group isoflavone intake depends on the diet. Although the main sources of isoflavone in western diets are soy products [15], also other foods may deliver a certain amount of isoflavone [16]. In the case of inflammatory bowel disease individuals, all the sources of isoflavone are important, as the soy products intake in some individuals may be limited [4]. Especially for individuals with ulcerative colitis or colon-affecting Crohn s disease, the choice of products may be essential, as it may influence the motility symptoms [17]. Such symptoms, being affected by the disease even during remission, due to the course of the disease and psychological factors [18] are for patients especially important, as they may influence directly their quality of life. The aim of the study was to analyse the association between isoflavone intake (daidzein, genistein, glycitein and total isoflavones) and ulcerative colitis motility symptoms (number of bowel movements, abdominal pain, flatulence, constipations, tenesmus) in individuals in remission. Głąbska D, Guzek D, Grudzińska D, Lech G. Influence of dietary isoflavone intake on gastrointestinal symptoms in ulcerative colitis individuals in remission. World J Gastroenterol 2017; 23(29): Available from: URL: com/ /full/v23/i29/5356.htm DOI: org/ /wjg.v23.i MATERIALS AND METHODS Study design The study was conducted at the Dietetic Outpatient Clinic of the Department of Dietetics, Warsaw University of Life Sciences (WULS-SGGW). The study was carried out according to the guidelines laid down 5357 August 7, 2017 Volume 23 Issue 29

116 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms in the Declaration of Helsinki and all the procedures involving human subjects were approved by the Bioethical Commission of the Central Clinical Hospital of the Ministry of Interior in Warsaw and the Bioethical Commission of the National Food and Nutrition Institute. The study s hypothesis was that isoflavone intake may influence gastrointestinal motility symptoms of ulcerative colitis. The three-days dietary records of remission ulcerative colitis individuals were collected and analysed. The intestinal motility and functioning were assessed on the basis of the self-reported data (questionnaire regarding number of bowel movements, abdominal pain, flatulence, constipations, tenesmus). Study participants The study was carried out on male and female individuals with ulcerative colitis in remission, recruited and monitored at the Warsaw Gastroenterology Outpatient Clinics: Gastroenterology Outpatient Clinic in Maria Skłodowska-Curie Memorial Cancer Center and Institute of Oncology, Gastroenterology Outpatient Clinic in Central Clinical Hospital of the Ministry of Interior in Warsaw and Gastroenterology Outpatient Clinic in Public Central Teaching Hospital in Warsaw. Total number of 56 remission ulcerative colitis individuals (19 males and 37 females), age years, was recruited for the study. Inclusion criteria were described in the previous publication [19]. All of the participants provided written consent to participate in the study. Analysis of intestinal motility and functioning All the participants with ulcerative colitis in remission were interviewed and asked about the presence of abdominal pain, flatulence, constipations, tenesmus and frequency of bowel movements. The presence of abdominal pain, flatulence, constipations and tenesmus were subjectively assessed by patients. They were asked to compare the current frequency and intensity of the symptoms with those before the diagnosis of ulcerative colitis. A lack of abdominal pain, flatulence, constipations, tenesmus during remission or no increase in frequency or intensity of symptoms compared to those observed before the ulcerative colitis diagnosis were interpreted as a lack of the above-mentioned symptoms. Analysis of diet Assessment of the diets was based on the self-reported data from dietary records conducted in three typical random days (2 weekdays and 1 weekend day). The dietary record was conducted on the basis of widely accepted and applied rules, the same as in the case of previously published analysis assessing the retinoid intake in the ulcerative colitis individuals [19]. To provide the reliable estimates of food intake, participants were instructed about the principles of conducting dietary record, as well as about the necessity of accurate and scrupulous recording of all consumed food products and beverages. The serving sizes were verified using the Polish Atlas of Food Products and Dishes Portion Sizes [20]. The serving sizes, recipes and number of glasses of beverages drunk daily were verified during personal interview. The energy values of diets (kcal) were analysed using the Polish dietician software (National Food and Nutrition Institute, version 2.0) and the Polish base of the nutritional value of the products [21]. Isoflavone intake: daidzein (µg), genistein (µg), glycitein (µg) and total isoflavones (µg) were assessed using the National Nutrient Database for Standard Reference of the United States Department of Agriculture [16], due to the lack of Polish database. The obtained average intake levels of the analyzed nutrients (mean values from three recorded days) were presented and were recalculated per 1000 kcal of diet (µg/1000 kcal) in order to analyze also the nutrient density of the diets. Individuals affected and unaffected by detailed ulcerative colitis symptoms were treated as groups and isoflavone intake was compared between them. The analysis of correlation between daily number of bowel movements and isoflavone intake was also conducted. Statistical analysis The obtained data are presented as mean ± SD values with minimum, maximum and median values indicated. The distributions of the analysed factors were verified using Shapiro-Wilk test. The correlations between analysed factors were verified using Spearman rank correlation coefficient (applied due to nonparametric distribution). The differences between groups were analysed using U Mann-Whitney test (applied due to nonparametric distribution). The level of significance p 0.05 was accepted. The statistical analysis was carried out using Statistica software version 8.0 (StatSoft Inc., Tulsa, OK, United States). RESULTS The analysis of correlation between isoflavone intake levels and number of bowel movements per day is presented in Table 1. No correlations were observed both in the case of intake and intake per 1000 kcal of diet. The isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of abdominal pain and declaring presence of abdominal pain is presented in Table 2. In the group of individuals declaring lack of abdominal pain, the higher intakes of daidzein (p = ), daidzein per 1000 kcal of diet (p = ) and total isoflavone (p = ) were stated, than in the group of individuals declaring abdominal pain. The isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of flatulence and 5358 August 7, 2017 Volume 23 Issue 29

117 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms Table 1 Analysis of correlation between isoflavone intakes and number of bowel movements per day declared in group of ulcerative colitis individuals (analysis conducted using Spearman rank correlation coefficient) declaring presence of flatulence is presented in Table 3. No differences were observed in isoflavone intake between groups. The isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of constipations and declaring presence of constipations is presented in Table 4. In the group of individuals declaring lack of constipations, the lower intakes of glycitein (p = ) and glycitein per 1000 kcal of diet (p = ) were stated, than in the group of individuals declaring presence of constipations. The isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of tenesmus and declaring presence of tenesmus is presented in Table 5. No differences were observed in isoflavone intake between groups. DISCUSSION P value Intake Daidzein (mg) Genistein (mg) Glycitein (mg) Total isoflavones (mg) Intake per 1000 kcal Daidzein (mg/1000 kcal) Genistein (mg/1000 kcal) Glycitein (mg/1000 kcal) Total isoflavones (mg/1000 kcal) In the study of Magee et al [8], legumes were indicated among beneficial food products, contributing to better results in the sigmoidoscopy screening in ulcerative colitis individuals. It was observed, that while consumed in typical amount of 120 g per week, legumes may contribute to lower clinical activity of the ulcerative colitis, so they were stated to be an element of potentially therapeutic diet for such patients [8]. The indicated role of legumes is in agreement with the report of World Cancer Research Fund and American Institute for Cancer Research [22], stating, that legumes are beneficial factor preventing colon cancer. It may be of a great value especially for ulcerative colitis patients, as the risk of colon cancer is for them higher than for individuals with no inflammatory bowel diseases diagnosed [23]. The observations of Magee et al [8] are in the contrast with the general belief, that a specific carbohydrate diet, described by Haas and Haas [24], including restriction of legumes such as soybeans, or chickpeas, may be beneficial for ulcerative colitis patients [4]. However, the food products are the complex source of various nutrients, so in spite of the fact, that R simple carbohydrates limitation may force ulcerative colitis patients to avoid inter alia legume intake, such products may also be considered as a source of healthpromoting components for them. Magee et al [8] were trying to explain the associations that they observed, but in spite of the fact that for legumes they indicated some potential reasons of proved association (high content of thiamin, resistant starch, prebiotics), they were not able to definitely conclude about the causes of mentioned relation. Since the study of Magee et al [8] was published, more insight into the role of legumes and their composition was gained. In spite of the fact, that in the meta-analysis of Yan et al [25] positive influence of soy intake on the colorectal cancer risk reduction was stated for women, but not for men, the other metaanalysis seem to be more promising. In the metaanalysis of Wang et al [26], among beneficial nutrients from legumes, that may reduce the risk of colon cancer, isoflavone was indicated. Also in the systematic review and meta-analysis of Yu et al [27], the soy isoflavone intake was stated to be associated with reduced colorectal cancer risk, that was observed while studied both in Asian populations and in case-control studies. Among the fears experienced by inflammatory bowel disease patients, except these associated with complications of the disease, mainly with cancer risk, are also the fears and discomforts associated with the symptoms of the disease (uncertainty of the disease course, fear of feeling fatigue, body image concern, discomfort of feeling dirty) [28]. As a result, the quality of life of ulcerative colitis individuals is often decreased [29], so all the actions, that would be able to reduce their symptoms are of a great value. The presented study revealed, that the higher isoflavone intake may contribute to lower abdominal pain incidence, but simultaneously, to higher constipations incidence. However, as the presence of constipations was subjectively assessed by patients and reported by them, also misunderstanding of the term must be taken into account, as it is well-known, that there exists a disparity between self-reported and definitions-based constipations frequency [30]. Moreover, in spite of the fact, that in general population, the constipations incidence is a negative symptom, decreasing quality of life [31], in the case of ulcerative colitis individuals situation may be different. As, even in remission, a number of ulcerative colitis patients experience abdominal pain and diarrhea [32], they may perceive decreased stool frequency as a positive symptom. As a consequence, the fact that ulcerative colitis individual declared constipations should be rather interpreted as decreased frequency of bowel movements, that may be even positively perceived by patient. However, it must be also indicated, that in the case of the analysis of correlation between isoflavone intake and number of bowel movements per day, no significance was stated August 7, 2017 Volume 23 Issue 29

118 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms Table 2 Isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of abdominal pain and declaring presence of abdominal pain (comparison conducted using U Mann-Whitney test) Individuals declaring lack of abdominal pain (n = 29) Individuals declaring abdominal pain (n = 27) P value Mean ± SD Median (min-max) Mean ± SD Median (min-max) Intake Daidzein (μg) ± ( ) ± ( ) Genistein (μg) ± ( ) ± ( ) Glycitein (μg) 0.5 ± ( ) 3.4 ± ( ) Total isoflavones (μg) ± ( ) ± ( ) Intake per 1000 kcal Daidzein (μg/1000 kcal) 94.6 ± ( ) 60.4 ± ( ) Genistein (μg/1000 kcal) 88.3 ± ( ) ± ( ) Glycitein (μg/1000 kcal) 0.3 ± ( ) 2.1 ± ( ) Total isoflavones (μg/1000 kcal) ± ( ) ± ( ) Nonparametric distribution (verified using the Shapiro-Wilk test; P < 0.05). Table 3 Isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of flatulence and declaring presence of flatulence (comparison conducted using U Mann-Whitney test) Individuals declaring lack of flatulence (n = 46) Individuals declaring flatulence (n = 10) P value Mean ± SD Median (min-max) Mean ± SD Median (min-max) Intake Daidzein (μg) ± ( ) ± ( ) Genistein (μg) ± ( ) ± ( ) Glycitein (μg) 2.2 ± ( ) 0.4 ± ( ) Total isoflavones (μg) ± ( ) ± ( ) Intake per 1000 kcal Daidzein (μg/1000 kcal) 78.9 ± ( ) 74.3 ± ( ) Genistein (μg/1000 kcal) 97.3 ± ( ) 79.4 ± ( ) Glycitein (μg/1000 kcal) 1.4 ± ( ) 0.3 ± ( ) Total isoflavones (μg /1000 kcal) ± ( ) ± ( ) Nonparametric distribution (verified using the Shapiro-Wilk test; P < 0.05). Table 4 Isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of constipations and declaring presence of constipations (comparison conducted using U Mann-Whitney test) Individuals declaring lack of constipations (n = 49) Individuals declaring constipations (n = 7) P value Mean ± SD Median (min-max) Mean ± SD Median (min-max) Intake Daidzein (μg) ± ( ) ± ( ) Genistein (μg) ± ( ) ± ( ) Glycitein (μg) 1.0 ± ( ) 8.6 ± ( ) Total isoflavones (μg) ± ( ) ± ( ) Intake per 1000 kcal Daidzein (μg/1000 kcal) ± ( ) ± ( ) Genistein (μg/1000 kcal) ± ( ) 97.6 ± ( ) Glycitein (μg/1000 kcal) 1.0 ± ( ) 5.7 ± ( ) Total isoflavones (μg/1000 kcal) ± ( ) ± ( ) Nonparametric distribution (verified using the Shapiro-Wilk test; P < 0.05). Taking into account the possible positive interpretation of constipations reported by ulcerative colitis patients, the results of the presented study may be treated as a confirmation of the results of animalmodel studies assessing the influence of isoflavone intake on the course of ulcerative colitis. Due to the fact, that no similar studies were conducted in the groups of ulcerative colitis patients, the conducted study must be treated as a significant contribution. In the animal-based studies, it was stated, that isoflavone intake may diminish the secretion or overexpression of tumor necrosis factor-α [11,13,33], interleukin (IL)-1β [11], IL-6 [12], IL-12p40 [12], interferon-γ [11,12], cyclooxygenase-2 [34] and inducible nitric oxide synthase [13,35]. In animal model, while disease activity index (including inter alia body weight loss, diarrhea, 5360 August 7, 2017 Volume 23 Issue 29

119 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms Table 5 Isoflavone intake levels in groups of ulcerative colitis individuals declaring lack of tenesmus and declaring presence of tenesmus (comparison conducted using U Mann-Whitney test) Individuals declaring lack of constipations (n = 47) Individuals declaring constipations (n = 9) P value Mean ± SD Median (min-max) Mean ± SD Median (min-max) Intake Daidzein (μg) ± ( ) ± ( ) Genistein (μg) ± ( ) ± ( ) Glycitein (μg) 2.3 ± ( ) 0.0 ± ( ) Total isoflavones (μg) ± ( ) ± ( ) Intake per 1000 kcal Daidzein (μg/1000 kcal) 70.6 ± ( ) ± ( ) Genistein (μg/1000 kcal) ± ( ) 55.7 ± ( ) Glycitein (μg/1000 kcal) 1.4 ± ( ) 0.0 ± ( ) Total isoflavones (μg/1000 kcal) ± ( ) ± ( ) Nonparametric distribution (verified using the Shapiro-Wilk test; P < 0.05). gross bleeding) of colitis was assessed, isoflavone intake was also stated to be beneficial [13]. As a result, isoflavone was indicated among natural compounds positively influencing cytokines in inflammatory bowel diseases [36]. Especially in the context of presented own results indicating influence on subjectively perceived symptoms such as abdominal pain or stool frequency, the potential role of isoflavone intake must be confirmed. Taking into account previously mentioned human study of Ohfuji et al [10] indicating opposite effect of isoflavone in ulcerative colitis development, the effect of dose must be considered. In the mentioned study, the total isoflavones intake was 13.6 mg/1000 kcal in the study group and 11.1 mg/1000 kcal in the control group [10], while in own study it was not higher than mg/1000 kcal. It must be mentioned, that the study of Ohfuji et al [10] was conducted in Japan and the stated isoflavone intake was similar as in the case of other Japanese studies [37]. In European countries, isoflavone intake is significantly lower than in Asian ones [38], while in Japan it is even higher than in other Asian countries [39]. The possible explanation of the isoflavone influence and observed contradictory results may arise from the fact, that isoflavone impact may depend on the microbiota [40]. In the study of Bowey et al [40], it was proven that colonization of germ-free rats with a human faecal microbiota resulted in specific conversion of dietary daidzein into equol, being its metabolite decreasing level of anti-inflamatory IL-10 and causing weight loss [41]. As an equol is produced after isoflavone intake by only 25%-30% of adults in Western countries [42], it should be stated that the effect of isoflavone intake depends not only on the dose, but also on the intestinal microbiota [43]. Not only the influence of microbiota on the course of ulcerative colitis was indicated by other authors, but also it was stated, that ulcerative colitis individuals are often characterized by different microbiota than healthy ones, as they have inter alia higher content of fecal microbiota [44]. Taking it into account, in the context of presented studies, excessive isoflavone intake, such as observed in Asian populations, may be confirmed for ulcerative colitis patients as not recommended. However, the isoflavone intake in own study was lower than in Asian populations, being on the level typical for Western ones. The observed beneficial effect may be explained as dependent on the lower dietary isoflavone intake and caused by positive anti-inflammatory effect confirmed in a number of animal-based studies. However, before including it into recommendations, further prospective studies are needed to expand the sample size and to confirm stated association. In conclusion, higher daidzein and total isoflavone intakes in individuals with ulcerative colitis in remission were associated with lower incidence of abdominal pain. higher glycitein intake in individuals with ulcerative colitis in remission was associated with higher constipations incidence declared by them, which may be interpreted as decreased frequency of bowel movements. the moderate dietary isoflavone intake may be beneficial for individuals with ulcerative colitis in remission, however, before including it into recommendations, further prospective studies are needed to confirm. COMMENTS Background Among other nutrients, isoflavones are indicated as characterized by potential influence on inflammatory bowel disease, but the conclusions seem to be contradictory, as the effects of isoflavones on development and course of the disease may differ. Research frontiers In presented study a higher daidzein, glycitein and total isoflavones intake in ulcerative colitis individuals in remission were associated with lack of abdominal pain and declared constipations. The study of association between single isoflavones intake and a specific gastrointestinal symptoms is a novel approach. Innovations and breakthroughs The moderate dietary isoflavone intake may be beneficial for individuals with 5361 August 7, 2017 Volume 23 Issue 29

120 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms ulcerative colitis in remission. Applications The observed beneficial effect may be explained as dependent on the lower dietary isoflavone intake in typical Western populations, than in Asian ones, and may be caused by positive anti-inflammatory effect confirmed in a number of animal-based studies. However, before including it into recommendations, further prospective studies are needed. Peer-review It is interesting to reveal that the higher isoflavone intake may contribute to lower abdominal pain incidence, but to higher constipations incidence in this study. REFERENCES 1 Mowat C, Cole A, Windsor A, Ahmad T, Arnott I, Driscoll R, Mitton S, Orchard T, Rutter M, Younge L, Lees C, Ho GT, Satsangi J, Bloom S; IBD Section of the British Society of Gastroenterology. Guidelines for the management of inflammatory bowel disease in adults. Gut 2011; 60: [PMID: DOI: /gut ] 2 Cassinotti A, Keshav S, Ardizzone S, Mortensen N, Sampietro G, Fociani P, Duca P, George B, Lazzaroni M, Manes G, Warren B, Foschi D, Vago G, Porro GB, Travis S. IBD care in Europe: A comparative audit of the inpatient management of Crohn s disease and ulcerative colitis using the national UK IBD audit tool. J Crohns Colitis 2009; 3: [PMID: DOI: / j.crohns ] 3 Carter MJ, Lobo AJ, Travis SP; IBD Section, British Society of Gastroenterology. Guidelines for the management of inflammatory bowel disease in adults. Gut 2004; 53 Suppl 5: V1-V16 [PMID: DOI: /gut ] 4 Hou JK, Lee D, Lewis J. Diet and inflammatory bowel disease: review of patient-targeted recommendations. Clin Gastroenterol Hepatol 2014; 12: [PMID: DOI: / j.cgh ] 5 Reif S, Klein I, Lubin F, Farbstein M, Hallak A, Gilat T. Pre-illness dietary factors in inflammatory bowel disease. Gut 1997; 40: [PMID: ] 6 Russel MG, Engels LG, Muris JW, Limonard CB, Volovics A, Brummer RJ, Stockbrügger RW. Modern life in the epidemiology of inflammatory bowel disease: a case-control study with special emphasis on nutritional factors. Eur J Gastroenterol Hepatol 1998; 10: [PMID: ] 7 Sakamoto N, Kono S, Wakai K, Fukuda Y, Satomi M, Shimoyama T, Inaba Y, Miyake Y, Sasaki S, Okamoto K, Kobashi G, Washio M, Yokoyama T, Date C, Tanaka H; Epidemiology Group of the Research Committee on Inflammatory Bowel Disease in Japan. Dietary risk factors for inflammatory bowel disease: a multicenter case-control study in Japan. Inflamm Bowel Dis 2005; 11: [PMID: ] 8 Magee EA, Edmond LM, Tasker SM, Kong SC, Curno R, Cummings JH. Associations between diet and disease activity in ulcerative colitis patients using a novel method of data analysis. Nutr J 2005; 4: 7 [PMID: DOI: / ] 9 Uchiyama K, Nakamura M, Odahara S, Koido S, Katahira K, Shiraishi H, Ohkusa T, Fujise K, Tajiri H. N-3 polyunsaturated fatty acid diet therapy for patients with inflammatory bowel disease. Inflamm Bowel Dis 2010; 16: [PMID: DOI: /ibd.21251] 10 Ohfuji S, Fukushima W, Watanabe K, Sasaki S, Yamagami H, Nagahori M, Watanabe M, Hirota Y; Japanese Case-Control Study Group for Ulcerative Colitis. Pre-illness isoflavone consumption and disease risk of ulcerative colitis: a multicenter case-control study in Japan. PLoS One 2014; 9: e [PMID: DOI: /journal.pone ] 11 Ko JK, Chik CW. The protective action of radix Astragalus membranaceus against hapten-induced colitis through modulation of cytokines. Cytokine 2009; 47: [PMID: DOI: /j.cyto ] 12 Morimoto M, Watanabe T, Yamori M, Takebe M, Wakatsuki Y. Isoflavones regulate innate immunity and inhibit experimental colitis. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 13 Park DK, Park HJ. Ethanol extract of Cordyceps militaris grown on germinated soybeans attenuates dextran-sodiumsulfate- (DSS-) induced colitis by suppressing the expression of matrix metalloproteinases and inflammatory mediators. Biomed Res Int 2013; 2013: [PMID: DOI: /2013/102918] 14 Dignass A, Lindsay JO, Sturm A, Windsor A, Colombel JF, Allez M, D Haens G, D Hoore A, Mantzaris G, Novacek G, Oresland T, Reinisch W, Sans M, Stange E, Vermeire S, Travis S, Van Assche G. Second European evidence-based consensus on the diagnosis and management of ulcerative colitis part 2: current management. J Crohns Colitis 2012; 6: [PMID: DOI: /j.crohns ] 15 Kirk P, Patterson RE, Lampe J. Development of a soy food frequency questionnaire to estimate isoflavone consumption in US adults. J Am Diet Assoc 1999; 99: [PMID: DOI: /S (99)00139-X] 16 USDA. USDA Database for the Isoflavone Content of Selected Foods, Release 2.0. Available from: URL: gov/northeast-area/beltsville-md/beltsville-human-nutritionresearch-center/nutrient-data-laboratory/docs/usda-database-forthe-isoflavone-content-of-selected-foods-release-20/ 17 Olendzki BC, Silverstein TD, Persuitte GM, Ma Y, Baldwin KR, Cave D. An anti-inflammatory diet as treatment for inflammatory bowel disease: a case series report. Nutr J 2014; 13: 5 [PMID: DOI: / ] 18 Simrén M, Axelsson J, Gillberg R, Abrahamsson H, Svedlund J, Björnsson ES. Quality of life in inflammatory bowel disease in remission: the impact of IBS-like symptoms and associated psychological factors. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 19 Głąbska D, Guzek D, Zakrzewska P, Włodarek D, Lech G. Lycopene, Lutein and Zeaxanthin May Reduce Faecal Blood, Mucus and Pus but not Abdominal Pain in Individuals with Ulcerative Colitis. Nutrients 2016; 8: pii: E613 [PMID: DOI: /nu ] 20 Szponar L, Wolnicka K, Rychlik E. Atlas of Food Products and Dishes Portion Sizes; IŻŻ: Warsaw, Poland, Kunachowicz H, Nadolna J, Iwanow K, Przygoda B. Food Composition Tables; PZWL: Warsaw, Poland, World Cancer Research Fund/American Institute for Cancer Research. Food, Nutrition, Physical Activity, and the Prevention of Cancer: a Global Perspective. Washington DC: AICR, Eaden JA, Abrams KR, Mayberry JF. The risk of colorectal cancer in ulcerative colitis: a meta-analysis. Gut 2001; 48: [PMID: ] 24 Haas SV, Haas MP. The treatment of celiac disease with the specific carbohydrate diet; report on 191 additional cases. Am J Gastroenterol 1955; 23: [PMID: ] 25 Yan L, Spitznagel EL, Bosland MC. Soy consumption and colorectal cancer risk in humans: a meta-analysis. Cancer Epidemiol Biomarkers Prev 2010; 19: [PMID: DOI: / EPI ] 26 Wang Y, Wang Z, Fu L, Chen Y, Fang J. Legume consumption and colorectal adenoma risk: a meta-analysis of observational studies. PLoS One 2013; 8: e67335 [PMID: DOI: / journal.pone ] 27 Yu Y, Jing X, Li H, Zhao X, Wang D. Soy isoflavone consumption and colorectal cancer risk: a systematic review and meta-analysis. Sci Rep 2016; 6: [PMID: DOI: / srep25939] 28 Casati J, Toner BB. Psychosocial aspects of inflammatory bowel disease. Biomed Pharmacother 2000; 54: [PMID: DOI: /S (01) ] 5362 August 7, 2017 Volume 23 Issue 29

121 Głąbska D et al. Isoflavones intake and gastrointestinal symptoms 29 Irvine EJ. Quality of life of patients with ulcerative colitis: past, present, and future. Inflamm Bowel Dis 2008; 14: [PMID: DOI: /ibd.20301] 30 Leung L, Riutta T, Kotecha J, Rosser W. Chronic constipation: an evidence-based review. J Am Board Fam Med 2011; 24: [PMID: DOI: /jabfm ] 31 Belsey J, Greenfield S, Candy D, Geraint M. Systematic review: impact of constipation on quality of life in adults and children. Aliment Pharmacol Ther 2010; 31: [PMID: DOI: /j x] 32 Long MD, Drossman DA. Inflammatory bowel disease, irritable bowel syndrome, or what?: A challenge to the functional-organic dichotomy. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 33 Jiang H, Przybyszewski J, Mitra D, Becker C, Brehm-Stecher B, Tentinger A, MacDonald RS. Soy protein diet, but not Lactobacillus rhamnosus GG, decreases mucin-1, trefoil factor-3, and tumor necrosis factor-α in colon of dextran sodium sulfatetreated C57BL/6 mice. J Nutr 2011; 141: [PMID: DOI: /jn ] 34 Seibel J, Molzberger AF, Hertrampf T, Laudenbach-Leschowski U, Diel P. Oral treatment with genistein reduces the expression of molecular and biochemical markers of inflammation in a rat model of chronic TNBS-induced colitis. Eur J Nutr 2009; 48: [PMID: DOI: /s ] 35 González-Mauraza H, Martín-Cordero C, Alarcón-de-la-Lastra C, Rosillo MA, León-González AJ, Sánchez-Hidalgo M. Antiinflammatory effects of Retama monosperma in acute ulcerative colitis in rats. J Physiol Biochem 2014; 70: [PMID: DOI: /s ] 36 Hur SJ, Kang SH, Jung HS, Kim SC, Jeon HS, Kim IH, Lee JD. Review of natural products actions on cytokines in inflammatory bowel disease. Nutr Res 2012; 32: [PMID: DOI: /j.nutres ] 37 Akhter M, Iwasaki M, Yamaji T, Sasazuki S, Tsugane S. Dietary isoflavone and the risk of colorectal adenoma: a case-control study in Japan. Br J Cancer 2009; 100: [PMID: DOI: /sj.bjc ] 38 van Erp-Baart MA, Brants HA, Kiely M, Mulligan A, Turrini A, Sermoneta C, Kilkkinen A, Valsta LM. Isoflavone intake in four different European countries: the VENUS approach. Br J Nutr 2003; 89 Suppl 1: S25-S30 [PMID: DOI: / BJN ] 39 Messina M, Nagata C, Wu AH. Estimated Asian adult soy protein and isoflavone intakes. Nutr Cancer 2006; 55: 1-12 [PMID: DOI: /s nc5501_1] 40 Bowey E, Adlercreutz H, Rowland I. Metabolism of isoflavones and lignans by the gut microflora: a study in germ-free and human flora associated rats. Food Chem Toxicol 2003; 41: [PMID: ] 41 Sakai T, Furoku S, Nakamoto M, Shuto E, Hosaka T, Nishioka Y, Sone S. Soy isoflavone equol perpetuates dextran sulfate sodiuminduced acute colitis in mice. Biosci Biotechnol Biochem 2011; 75: [PMID: DOI: /bbb ] 42 Setchell KD, Clerici C. Equol: history, chemistry, and formation. J Nutr 2010; 140: 1355S-1362S [PMID: DOI: / jn ] 43 Bosscher D, Breynaert A, Pieters L, Hermans N. Food-based strategies to modulate the composition of the intestinal microbiota and their associated health effects. J Physiol Pharmacol 2009; 60 Suppl 6: 5-11 [PMID: ] 44 Ohkusa T, Koido S. Intestinal microbiota and ulcerative colitis. J Infect Chemother 2015; 21: [PMID: DOI: /j.jiac ] P- Reviewer: Liu F S- Editor: Gong ZM L- Editor: A E- Editor: Zhang FF 5363 August 7, 2017 Volume 23 Issue 29

122 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) ORIGINAL ARTICLE Case Control Study Genetic polymorphisms of MAFK, encoding a small Maf protein, are associated with susceptibility to ulcerative colitis in Japan Tomiyasu Arisawa, Masakatsu Nakamura, Toshimi Otsuka, Wu Jing, Naoko Sakurai, Hikaru Takano, Tasuku Hayashi, Masafumi Ota, Tomoe Nomura, Ranji Hayashi, Takeo Shimasaki, Tomomitsu Tahara, Tomoyuki Shibata Tomiyasu Arisawa, Masakatsu Nakamura, Toshimi Otsuka, Wu Jing, Naoko Sakurai, Hikaru Takano, Tasuku Hayashi, Masafumi Ota, Tomoe Nomura, Ranji Hayashi, Takeo Shimasaki, Department of Gastroenterology, Kanazawa Medical University, Ishikawa , Japan Tomomitsu Tahara, Tomoyuki Shibata, Department of Gastroenterology, Fujita Health University, Kutsukake-cho, Toyoake , Japan Author contributions: Arisawa T analyzed the data, wrote the paper and was responsible for the conception of the study and designed the study; Nakamura M, Otsuka T, Sakurai N, Takano H, Hayashi T, Ota M, Nomura T and Hayashi R obtained the samples and the data; Jing W and Shimasaki T determined genotype; Tahara T and Shibata T participated in the design of the study. Institutional review board statement: The study was approved by the Ethics Committee of Kanazawa Medical University (Uchinada-machi, Japan) and Fujita Health University (Toyoake, Japan). Informed consent statement: All patients gave informed consent. Conflict-of-interest statement: There are no conflicts of interest. Data sharing statement: Technical appendix, statistical code and dataset available from the corresponding author at tarisawa@ kanazawa-med.ac.jp. Informed consent form participants for data sharing was not obtained but the presented data are anonymized and risk of identification is low. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Tomiyasu Arisawa, MD, PhD, Department of Gastroenterology, Kanazawa Medical University, 1-1 Daigaku, Uchinada-machi, Ishikawa , Japan. tarisawa@kanazawa-med.ac.jp Telephone: Fax: Received: January 24, 2017 Peer-review started: February 1, 2017 First decision: March 3, 2014 Revised: March 14, 2014 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, 2017 Abstract AIM To investigate whether single nucleotide polymorphisms in maf protein K (MAFK ), which encodes the MAFK, lead to increased susceptibility to ulcerative colitis in the Japanese population. METHODS This case control study examined the associations between MAFK single nucleotide polymorphisms (rs G>A, rs T>C and rs C>T) and ulcerative colitis susceptibility in 174 patients with ulcerative colitis (UC) cases, and 748 subjects without no lower abdominal symptoms, diarrhea or hematochezia (controls). In addition, as the second 5364 August 7, 2017 Volume 23 Issue 29

123 Arisawa T et al. MAFK polymorphisms and UC susceptibility controls, we set 360 subjects, who have an irregular bowel movement without abnormal lower endoscopic findings (IBM controls). RESULTS The genotype frequency of rs AA and allelic frequency of the rs a allele were significantly higher in the UC cases than in both controls (P = and < , P = and vs controls and IBM controls, respectively). Logistic regression analysis after adjustment for age and gender showed that the rs AA and rs CC genotypes were significantly associated with susceptibility to UC development (OR = 2.63, 95%CI: , P = and OR = 1.81; 95%CI: , P = 0.015, respectively). Similar findings were observed by the comparison with IBM controls. In addition, the rs AA genotype was significantly associated with all phenotypes of UC except early onset. There was no significant association between rs and ulcerative colitis. CONCLUSION Our results provide the first evidence that MAFK genetic polymorphisms are significantly associated with susceptibility to UC development. In particular, rs is closely associated with an increased risk for the development of UC. Key words: Maf protein K; Genetic polymorphism; Reactive oxygen species; Ulcerative colitis; Nuclear factor-erythroid 2-related factor 2 The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: We investigated the association between maf protein K (MAFK ), polymorphisms and ulcerative colitis in Japan. Both rs and rs minor allele homozygotes were significantly associated with the susceptibility to ulcerative colitis (UC) development. In addition, rs minor allele homozygote was significantly associated with all phenotypes of UC except the phenotype with younger age onset. Our results provided the first evidence that MAFK genetic polymorphisms were significantly associated with the susceptibility to UC development. Arisawa T, Nakamura M, Otsuka T, Jing W, Sakurai N, Takano H, Hayashi T, Ota M, Nomura T, Hayashi R, Shimasaki T, Tahara T, Shibata T. Genetic polymorphisms of MAFK, encoding a small Maf protein, are associated with susceptibility to ulcerative colitis in Japan. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5364.htm DOI: i INTRODUCTION The number of inflammatory bowel disease (IBD) patients in several Asian countries, including Japan and China, has recently rapidly increased with adaptation of a westernization life style and diet [1]. Ulcerative colitis (UC) is a representative IBD whose exact etiology is unclear, but environmental and genetic factors are implicated in its onset [2,3]. UC is a nonspecific inflammatory disease possibly involving the colonic mucosa spanning from the rectum to the cecum. It has been clarified that the degradation of inflammation and immune response related molecules prescribed genetically participate [4]. UC is a multifactorial, polygenic disease with probable genetic heterogeneity, and the associations between the polymorphisms of various genes and UC have been studied [5,6]. Reactive oxygen species (ROS) are involved in promoting inflammation in various diseases, including UC [7,8]. Nuclear factor-erythroid 2-related factor 2 (Nrf2) plays an important role in the removal of ROS [9,10]. Nrf2 cannot induce anti-oxidant enzymes such as heme oxygenase-1 (HO-1) and peroxiredoxin 1 alone, and shows transcriptional activity when hetero-dimerized with small musculoaponeurotic fibrosarcoma (Maf) [11]. Thus, it has been clarified that small Maf proteins are regulated transcription factors through heterodimer formation, with Nrf2 and BTB And CNC Homology 1 (Bach1) [12], although small Mafs do not contain an obvious transcriptional activation domain [13]. We previously reported a significant association between Nrf2 genetic polymorphisms and susceptibility to UC [14]. In the present study, we investigated the association between genetic polymorphisms of MAFK, one of the small Mafs, and UC susceptibility in a Japanese population. MATERIALS AND METHODS Clinical samples The study was performed using a population comprising 226 patients with UC (UC cases) and 748 subjects without lower abdominal symptoms, diarrhea or hematochezia (controls). In addition, as the second controls, we prepared 360 subjects, who have an irregular bowel movement without abnormal lower endoscopic findings (IBM controls). UC was diagnosed according to standard clinical, endoscopic, radiological, and histological criteria [15]. Genomic DNA was isolated from peripheral blood using FlexiGene DNA Kit (QIAGEN GmbH, Hilden, Germany). The Ethics Committees of Fujita Health University and Kanazawa Medical University approved the protocol, and written informed consent was obtained from all participating subjects. Classification According to their clinical courses, UC cases were classified into 2 types: continuous, or not continuous, disease (i.e., relapsing or only one episode) [16]. UC patients were also classified by endoscopic findings as total or not total colitis (left sided, distal colitis) according to the location and extension of the 5365 August 7, 2017 Volume 23 Issue 29

124 Arisawa T et al. MAFK polymorphisms and UC susceptibility Table 1 Condition of PCR and SSCP Table 2 Characteristics of the subjects and allelic frequency Primer set PCR condition SSCP temperature (rs ) 5'-TAATCCCAACTCGCAGCA TCTGTGT-3' 5'-GGTCTGACTTAGCTGGGG AAAGTGC-3' (rs ) 5'-ATCTCAGCGGACACAGG CAGGA-3' 5'-CTGCACTGACCACAGTTG GTGAGAA-3' (rs ) 5'-GTCCCTCCTGTGACTGGG GTCTCT-3' 5'-AGGCACCACCTTGCAGGT CTTATGT-3' s, s, s 35 cycle s, s, s 35 cycle s, s, s 35 cycle inflammatory lesions. In addition, the cases were classified into two groups according to the past highest UC disease activity index (UCDAI) during the course of the disease ( 8 or 9) [17]. Selection of single nucleotide polymorphisms of MAFK There are two large linkage disequilibrium blocks within 20kbp of MAFK with a Hardy-Weinberg equilibrium (HWE) P value of above 0.05 and a minor allele frequency of above We selected rs G>A and rs T>C (*910 T>C) as a Tag single nucleotide polymorphism (SNP) in each block and another SNP, rs C>T (*1506 C>T), located in the 3 -UTR where several microrna bind, was also selected. Genotyping of polymorphisms Polymorphisms were genotyped using the PCR-SSCP method as reported previously [14,18]. The PCR and SSCP conditions are shown in Table 1. All PCR reactions were carried out in a volume of 20 µl containing 0.1 µg of genomic DNA using Takara HS Taq (TAKARA Bio Inc., Japan). SSCP was carried out using a GenePhor DNA separation system with GeneGel Excel 12.5/24 (GE Health Care Bio-Sciences AB, Sweden) at 6 temperature, and then the denatured single strand DNA bands were detected using a DNA Silver Staining Kit (GE Health Care Bio-Sciences AB). Statistical analysis HWE was assessed by χ 2 statistics. The age data were expressed as mean ± SD. Mean ages between the cases and the controls was compared by Student s t-test, and the male/female ratio was compared by Fisher s exact test. The allele counts and the distribution of genotype were compared between the two groups by a 2 2 table using Fisher s exact test. The odds ratios (OR) and 95%CI were calculated by logistic regression with adjustment for age and gender. A probability value of less than 0.05 was considered statistically significant in all analyses Controls IBM controls UC cases Number of sample Mean age ± SD 57.1 ± ± ± 14.2 a (age of onset) (33.6 ± 13.5) Male:female 438: :195 b 125:101 rs G>A GG GA AA c A allele freqency 29.40% 27.20% 35.6% d rs T>C TT TC CC C allele freqency 32.90% 30.80% 34.50% rs C>T CC CT TT T allele freqency 32.00% 30.40% 33.20% a P < vs controls and IBM controls; b P < vs controls and P = vs UC cases; c P = vs controls and P < vs IBM controls; d P = vs controls and P = vs IBM controls. UC: Ulcerative colitis. RESULTS Characteristics of the study subjects and frequencies of the genotypes The characteristics of the subjects in this study are summarized in Table 2. The mean ages of both controls and IBM controls were significantly higher than that of the UC cases. The male/female ratio of IBM controls was significantly lower than those of the controls and UC cases. Single strand DNAs of all genotypes were clearly separated by SSCP (Figure 1). The distribution of genotypes in the controls was in Hardy-Weinberg equilibrium (rs , rs and rs : P = 0.25, P = 0.21 and P = 0.87, respectively). The ratio of the mutant homozygote (AA genotype) of rs was significantly higher in the UC cases compared to the controls and IBM controls (P = and < , respectively). However, no significant differences in the distributions of rs and rs genotypes were observed. There were no significant differences in the distributions of genotypes between the controls and IBM controls. Association between MAFK polymorphisms and UC susceptibility When the controls was compared with UC cases, logistic regression analysis after adjustment for age and gender showed that the rs mutant homozygote (AA genotype) was strongly associated with susceptibility to UC (OR = 2.63, 95%CI: , P = ; Table 3), and the rs mutant homozygote (CC genotype) was also significantly associated with UC susceptibility (OR = 1.81, 95%CI: , P = 0.015). When IBM controls was compared with UC cases, similar findings were obtained (OR = 3.54, 5366 August 7, 2017 Volume 23 Issue 29

125 Arisawa T et al. MAFK polymorphisms and UC susceptibility Table 3 Association between MAFK polymorphisms and ulcerative colitis Genotype (n ) AA vs others Genotype (n ) CC vs others Genotype (n ) TT vs others GG GA AA OR (95%CI); P value TT TC CC OR (95%CI); P value rs G>A Controls (748) Reference - IBM controls (358) ( ); P = 0.16 Reference UC cases (226) ( ); P = ( ); P = rs T>C Controls (748) Reference - IBM controls (358) ( ); Reference P = 0.30 UC cases (174) ( ); P = ( ); P = CC CT TT OR (95%CI); P value rs C>T Controls (748) Reference - IBM controls (358) ( ); P = 0.24 Reference UC cases (174) ( ); P = ( ); P = 0.17 UC: Ulcerative colitis. phenotype of UC (Table 4). rs rs rs GG GA AA GG GG GA GG CC TC CC TC TT TT CC CT TT CC CC CT Figure 1 Images of PCR-SSCP using clinical samples. Single strand DNAs were clearly separated by SSCP. The genotypes could be determined. 95%CI: , P = and OR = 2.14; 95%CI: , P = 0.015, for rs and rs , respectively). No significant association between rs and UC was seen. The influence of MAFK genotypes on the symptoms from irregular bowel movement did not seem to be large. Association between rs and UC phenotypes The observed strong association between rs and UC susceptibility prompted us to investigate an association between this SNP and UC phenotypes. The rs genotype was only associated with UC cases with onset after 21 years of age. Regarding as clinical type, disease extension, the past history of hospitalization and the past maximum UCDAI score, rs was significantly associated with each DISCUSSION Three small Maf proteins have been identified to date: MafG, MafK and MafF were identified [19]. These three Maf proteins have high homology and form homodimers or heterodimers with each another and also heterodimers with a group of other b-zip proteins [20]. Previous studies using knockout mice showed that MafG -/- /K -/- mice are die by the peri- or postnatal stage, whereas both MafF -/- /G -/- and MafF -/- /K -/- mice are viable and fertile [21-23]. We therefore selected the two small Mafs, MafG and MafK, because of their apparent importance in biology. In HapMap-JPT, there are large linkage blocks of SNPs around MAFK but not around MAFG. Furthermore, previous studies revealed that MafK-Bach1 controls the expression of a subset of oxidative stress-inducible genes, such as HO-1 and ferritins [24], whereas MafK-Nrf2 heterodimer activates their expression [25]. We therefore suspected that MAFK genetic variations might affect the development and process of inflammatory diseases, including UC. Our results provide the first evidence that MAFK genetic polymorphisms are significantly associated with susceptibility to UC in the Japanese population. In these polymorphisms, the rs G>A minor allele homozygote is closely associated with an increased risk for the development of UC. The allele frequencies of rs and rs in our controls, which were in HWE, were the same as that in the Japanese population reported in the HapMap database (P = August 7, 2017 Volume 23 Issue 29

126 Arisawa T et al. MAFK polymorphisms and UC susceptibility Table 4 Association between rs and phenotype of ulcerative colitis Genotype (n ) AA vs others GG GA AA OR (95%CI) P value Controls (748) Reference - Age of onset 20 (31) ( ) (176) ( ) Unknown (19) Clinical type Not continuous (124) ( ) Continuous (97) ( ) Unknown (5) Extension Not total colitis (115) ( ) Total colitis (105) ( ) Unknown (6) Hospitalization None (139) ( ) One time (76) ( ) Unknown (11) Past max. UCDAI score 8 (135) ( ) (81) ( ) Unknown (10) UC: Ulcerative colitis. and 0.39, respectively). However, the distribution of rs genotype in our controls was different from that in HapMap-JPT (P = 0.011). The distribution of rs in our controls is in HWE (P = 0.21) whereas it is not in HapMap-JPT (P = 0.025). The cause of this discrepancy is unknown, but we believe that rs is worthy of further examination. There are few reports linking MAFK genetic variations and clinical disease susceptibility [26,27]. Nanashima et al [26] reported that the mutant allele of rs , located in the same linkage block as rs , is significantly associated with anti-tuberculosis drug induced hepatotoxicity susceptibility, whereas rs , located in the same block as rs , is not associated. This suggests that the rs mutant genotype might be associated with an increased risk of druginduced injury via alteration of the toxicity of drug metabolites, although the detailed mechanisms remain unclear. Similarly, in our study, the rs mutant homozygote was strongly associated with UC susceptibility. In addition, this genotype was associated with all phenotypes of UC except age of onset. These findings suggest that rs may be associated with the development but not the progression of UC. The lack of association of early onset with UC may be due to the small number of cases and/or the younger controls. It is not clear how rs participates in the development of UC. Small Maf proteins are transcription factors localized to the nucleus that dimerize with CNC family proteins, including Nrf2 and Bach1 [13]. Small Maf-Bach1 heterodimers are removed from antioxidant-responsive element (ARE) by oxidative stress, and small Maf-Nrf2 heterodimers replace and bind to ARE, leading to the activation of antioxidant enzyme expression. Therefore, our data suggest that rs may act as a repressor for the expression of small Maf (dimerized with Nrf2) and/or as an activator for the expression of small Maf (dimerized with Bach1), resulting in association with UC susceptibility. Another possibility is that the mechanism involves the inflammatory response. Overexpression of MafK protein in T cells decreased T-cell proliferation and interleukin-2 (IL-2) secretion [28]. Therefore, IL-2 secretion, resulting in persistent inflammation, may be increased by the diminished expression of MafK protein in the rs mutant homozygote. However, the presence of enhancers or repressors in the genome region containing the linkage block with rs remains unknown. In addition, the downregulation of Nrf2 or upregulation of Bach1 in UC patients with the rs mutant homozygote should be verified by further studies. There are some clinical limitations in our study. We recruited patients who visited our hospital for various reasons and therefore the mean age of the controls was relatively high. Age-matched subjects with no symptom are essential for the control group. In addition, the UC treatment regimens were not standardized, possibly affecting the clinical type and extent of inflammation observed. Furthermore, we had no data on the effects of MAFK gene polymorphisms on the expressions of MafK protein. Our study was a casecontrol studyand therefore further examination is necessary regarding this point. The major problem in this study is the relatively small sample size, especially the number of UC cases. A larger cohort will be required to clearly assess the association of genetic 5368 August 7, 2017 Volume 23 Issue 29

127 Arisawa T et al. MAFK polymorphisms and UC susceptibility variation with disease susceptibility. Finally, the design of this study used only samples stored at a single center and were analyzed retrospectively. In conclusion, the present study demonstrated that MAFK polymorphisms are significantly associated with susceptibility to UC. In particular, the rs minor homozygote is strongly associated with increased risk for the development of UC. COMMENTS Background Both environmental and genetic factors participate in the onset of ulcerative colitis (UC). Therefore, genetic alteration of inflammation related molecules may affect the susceptibility to UC. Research frontiers Reactive oxygen species (ROS) are involved in promoting inflammation in various diseases, including UC. Small Maf proteins are regulated transcription factors thorough heterodimer formation, such as nuclear factor-erythroid 2-related factor 2 which play an important role in a removal process of these ROS. Therefore, it is of interest whether genetic alteration of Maf protein K (MAFK), encoding small MAFK, may affect the susceptibility to UC. Innovations and breakthroughs The results provide the first evidence that MAFK genetic polymorphisms are significantly associated with the susceptibility to UC in the Japanese population. Applications MAFK single nucleotide polymorphisms should be added to the spectrum of genetic factors involved in UC in Japanese population. Peer-review This case control study study investigated the association between genetic polymorphisms of MafK and UC susceptibility. The authors found that rs AA and rs CC genotypes were significantly associated with the susceptibility to UC. REFERENCES 1 Sakamoto N, Kono S, Wakai K, Fukuda Y, Satomi M, Shimoyama T, Inaba Y, Miyake Y, Sasaki S, Okamoto K, Kobashi G, Washio M, Yokoyama T, Date C, Tanaka H; Epidemiology Group of the Research Committee on Inflammatory Bowel Disease in Japan. Dietary risk factors for inflammatory bowel disease: a multicenter case-control study in Japan. Inflamm Bowel Dis 2005; 11: [PMID: DOI: / ] 2 Podolsky DK. Inflammatory bowel disease. N Engl J Med 2002; 347: [PMID: DOI: /NEJMra020831] 3 Newman B, Siminovitch KA. Recent advances in the genetics of inflammatory bowel disease. Curr Opin Gastroenterol 2005; 21: [PMID: ] 4 Head KA, Jurenka JS. Inflammatory bowel disease Part 1: ulcerative colitis--pathophysiology and conventional and alternative treatment options. Altern Med Rev 2003; 8: [PMID: ] 5 Uniken Venema WT, Voskuil MD, Dijkstra G, Weersma RK, Festen EA. The genetic background of inflammatory bowel disease: from correlation to causality. J Pathol 2017; 241: [PMID: DOI: /path.4817] 6 Ye BD, McGovern DP. Genetic variation in IBD: progress, clues to pathogenesis and possible clinical utility. Expert Rev Clin Immunol 2016; 12: [PMID: DOI: / X ] 7 Pérez S, Taléns-Visconti R, Rius-Pérez S, Finamor I, Sastre J. Redox signaling in the gastrointestinal tract. Free Radic Biol Med 2017; 104: [PMID: DOI: /j.freeradbiome d ] 8 Pravda J. Radical induction theory of ulcerative colitis. World J Gastroenterol 2005; 11: [PMID: DOI: /wjg.v11.i ] 9 Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y, Bannai S, Yamamoto M. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biol Chem 2000; 275: [PMID: DOI: / jbc ] 10 Loboda A, Damulewicz M, Pyza E, Jozkowicz A, Dulak J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cell Mol Life Sci 2016; 73: [PMID: DOI: / s ] 11 Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, Oyake T, Hayashi N, Satoh K, Hatayama I, Yamamoto M, Nabeshima Y. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 1997; 236: [PMID: DOI: /bbrc ] 12 Raval CM, Zhong JL, Mitchell SA, Tyrrell RM. The role of Bach1 in ultraviolet A-mediated human heme oxygenase 1 regulation in human skin fibroblasts. Free Radic Biol Med 2012; 52: [PMID: DOI: /j.freeradbiomed )] 13 Fujiwara KT, Kataoka K, Nishizawa M. Two new members of the maf oncogene family, mafk and maff, encode nuclear b-zip proteins lacking putative trans-activator domain. Oncogene 1993; 8: [PMID: ] 14 Arisawa T, Tahara T, Shibata T, Nagasaka M, Nakamura M, Kamiya Y, Fujita H, Yoshioka D, Okubo M, Sakata M, Wang FY, Hirata I, Nakano H. Nrf2 gene promoter polymorphism is associated with ulcerative colitis in a Japanese population. Hepatogastroenterology 2008; 55: [PMID: ] 15 Podolsky DK. Inflammatory bowel disease (1). N Engl J Med 1991; 325: [PMID: DOI: / NEJM ] 16 Langholz E, Munkholm P, Davidsen M, Binder V. Course of ulcerative colitis: analysis of changes in disease activity over years. Gastroenterology 1994; 107: 3-11 [PMID: DOI: / (94)90054-X] 17 Rizzello F, Gionchetti P, Venturi A, Amadini C, Romagnoli R, Campieri M. Review article: monitoring activity in ulcerative colitis. Aliment Pharmacol Ther 2002; 16 Suppl 4: 3-6 [PMID: DOI: /j s4.1.x] 18 Arisawa T, Tahara T, Ozaki K, Matsue Y, Minato T, Yamada H, Nomura T, Hayashi R, Matsunaga K, Fukumura A, Nakamura M, Toshikuni N, Shiroeda H, Shibata T. Association between common genetic variant of HRH2 and gastric cancer risk. Int J Oncol 2012; 41: [PMID: DOI: /ijo ] 19 Kataoka K, Igarashi K, Itoh K, Fujiwara KT, Noda M, Yamamoto M, Nishizawa M. Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NF-E2 transcription factor. Mol Cell Biol 1995; 15: [PMID: DOI: /MCB ] 20 Igarashi K, Kataoka K, Itoh K, Hayashi N, Nishizawa M, Yamamoto M. Regulation of transcription by dimerization of erythroid factor NF-E2 p45 with small Maf proteins. Nature 1994; 367: [PMID: DOI: /367568a0)] 21 Onodera K, Shavit JA, Motohashi H, Yamamoto M, Engel JD. Perinatal synthetic lethality and hematopoietic defects in compound mafg::mafk mutant mice. EMBO J 2000; 19: [PMID: DOI: /emboj/ ] 22 Motohashi H, Katsuoka F, Engel JD, Yamamoto M. Small Maf proteins serve as transcriptional cofactors for keratinocyte differentiation in the Keap1-Nrf2 regulatory pathway. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: /pnas ] 5369 August 7, 2017 Volume 23 Issue 29

128 Arisawa T et al. MAFK polymorphisms and UC susceptibility 23 Katsuoka F, Motohashi H, Ishii T, Aburatani H, Engel JD, Yamamoto M. Genetic evidence that small maf proteins are essential for the activation of antioxidant response elementdependent genes. Mol Cell Biol 2005; 25: [PMID: DOI: /MCB ] 24 Sun J, Hoshino H, Takaku K, Nakajima O, Muto A, Suzuki H, Tashiro S, Takahashi S, Shibahara S, Alam J, Taketo MM, Yamamoto M, Igarashi K. Hemoprotein Bach1 regulates enhancer availability of heme oxygenase-1 gene. EMBO J 2002; 21: [PMID: DOI: /emboj/cdf516] 25 Zhang J, Ohta T, Maruyama A, Hosoya T, Nishikawa K, Maher JM, Shibahara S, Itoh K, Yamamoto M. BRG1 interacts with Nrf2 to selectively mediate HO-1 induction in response to oxidative stress. Mol Cell Biol 2006; 26: [PMID: DOI: /MCB ] 26 Nanashima K, Mawatari T, Tahara N, Higuchi N, Nakaura A, Inamine T, Kondo S, Yanagihara K, Fukushima K, Suyama N, Kohno S, Tsukamoto K. Genetic variants in antioxidant pathway: risk factors for hepatotoxicity in tuberculosis patients. Tuberculosis (Edinb) 2012; 92: [PMID: DOI: / j.tube ] 27 Martínez-Hernández A, Gutierrez-Malacatt H, Carrillo-Sánchez K, Saldaña-Alvarez Y, Rojas-Ochoa A, Crespo-Solis E, Aguayo- González A, Rosas-López A, Ayala-Sanchez JM, Aquino-Ortega X, Orozco L, Cordova EJ. Small MAF genes variants and chronic myeloid leukemia. Eur J Haematol 2014; 92: [PMID: DOI: /ejh.12211] 28 Yoh K, Sugawara T, Motohashi H, Takahama Y, Koyama A, Yamamoto M, Takahashi S. Transgenic over-expression of MafK suppresses T cell proliferation and function in vivo. Genes Cells 2001; 6: [PMID: DOI: / j x] P- Reviewer: Lakatos PL, Rong L, Swierczynski JT S- Editor: Qi Y L- Editor: A E- Editor: Huang Y 5370 August 7, 2017 Volume 23 Issue 29

129 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Retrospective Study ORIGINAL ARTICLE Elaboration and validation of Crohn s disease anoperineal lesions consensual definitions Clémence Horaist, Vincent de Parades, Laurent Abramowitz, Paul Benfredj, Guillaume Bonnaud, Dominique Bouchard, Nadia Fathallah, Agnès Sénéjoux, Laurent Siproudhis, Ghislain Staumont, Manuelle Viguier, Philippe Marteau Clémence Horaist, Department of Digestive Disease, Centre Hospitalier Intercommunal Le Raincy-Montfermeil, Montfermeil, France Vincent de Parades, Paul Benfredj, Nadia Fathallah, Department of Proctology, Hôpital Saint-Joseph, Institut Léopold Bellan, Paris, France Laurent Abramowitz, Department of Proctology and Digestive Diseases, University Hospital Bichat, AP-HP, Paris, France Guillaume Bonnaud, Department of Digestive Diseases, Clinique des Cèdres, Cornebarrieu, France Dominique Bouchard, Department of Proctology, Hôpital Bagatelle, Talence, France Agnès Sénéjoux, Department of Proctology, Centre Hospitalier Privé Rennes de Saint-Grégoire, Saint-Grégoire, France Laurent Siproudhis, Department of Digestive Diseases, Pontchaillou University Hospital, Rennes, France Ghislain Staumont, Department of Proctology, Clinique St Jean Languedoc, Toulouse, France Manuelle Viguier, AP-HP, Hôpital Saint Louis, Dermatology and Denis Diderot-Paris 7 University, Paris, France Philippe Marteau, Sorbonne Universités, UPMC Univ Paris 06, Paris, France Philippe Marteau, INSERM-ERL 1157, CHU Saint-Antoine 27, Paris, France Philippe Marteau, CNRS, UMR7203, Paris, France Philippe Marteau, APHP, Hépatologie et Gastroentérologie, Hôpital Saint Antoine, Paris, France Author contributions: Abramowitz L, Benfredj P, Bonnaud G, Bouchard D, Fathallah N, Sénéjoux A, Siproudhis L and Staumont G were in the expert group and contributed to the manuscript; Horaist C, de Parades V and Marteau P performed the literature review, coordinated the expert group, analyzed the data and wrote the draft and final version of the manuscript. Conflict-of-interest statement: No potential conflicts of interest relevant to this article were reported. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Philippe Marteau, MD, PhD, Professor of Medicine, Hépatologie et Gastroentérologie, Hôpital Saint Antoine, 184 rue du Faubourg Saint Antoine, Paris, France. philippe.marteau@aphp.fr Telephone: Fax: Received: December 27, 2016 Peer-review started: December 28, 2016 First decision: Febraury 10, 2017 Revised: May 11, 2017 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, August 7, 2017 Volume 23 Issue 29

130 Horaist C et al. Consensual definitions of anoperineal CD Abstract AIM To establish consensual definitions of anoperineal lesions of Crohn s (APLOC) disease and assess interobserver agreement on their diagnosis between experts. METHODS A database of digitally recorded pictures of APLOC was examined by a coordinating group who selected two series of 20 pictures illustrating the various aspects of APLOC. A reading group comprised: eight experts from the Société Nationale Française de Colo Proctologie group of study and research in proctology and one academic dermatologist. All members of the coordinating and reading groups participated in dedicated meetings. The coordinating group initially conducted a literature review to analyse verbatim descriptions used to evaluate APLOC. The study included two phases: establishment of consensual definitions using a formal consensus method and later assessment of interobserver agreement on the diagnosis of APLOC using photos of APLOC, a standardised questionnaire and Fleiss s kappa test or descriptive statistics. RESULTS Terms used in literature to evaluate visible APLOC did not include precise definitions or reference to definitions. Most of the expert reports on the first set of photos agreed with the main diagnosis but their verbatim reporting contained substantial variation. The definitions of ulceration (entity, depth, extension), anal skin tags (entity, inflammatory activity, ulcerated aspect), fistula (complexity, quality of drainage, inflammatory activity of external openings), perianal skin lesions (abscess, papules, edema, erythema) and anoperineal scars were validated. For fistulae, they decided to follow the American Gastroenterology Association s guidelines definitions. The diagnosis of ulceration (κ = 0.70), fistulae (κ = 0.75), inflammatory activity of external fistula openings (86.6% agreement), abscesses (84.6% agreement) and erythema (100% agreement) achieved a substantial degree of interobserver reproducibility. CONCLUSION This study constructed consensual definitions of APLOC and their characteristics and showed that experts have a fair level of interobserver agreement when using most of the definitions. Key words: Crohn s disease; Anoperineal lesions; Fistula; Interobserver agreement The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: We present the first study that establishes consensual definitions of anoperineal lesions of Crohn s disease (APLOC) and assesses interobserver agreement on their diagnosis. With the help of APLOC experts, we conducted this work using a formal consensus method validated by the French National Authority for Health. We herein establish the missing consensual definitions and show that experts have substantial interobserver agreement when using them to diagnose and describe fistulae, ulcerations, activity of external openings and erythema from photos. Even if inspection is only one step in the diagnoses of APLOC, we believe this work will help future studies evaluate if and how treatments influence these lesions. Horaist C, de Parades V, Abramowitz L, Benfredj P, Bonnaud G, Bouchard D, Fathallah N, Sénéjoux A, Siproudhis L, Staumont G, Viguier M, Marteau P. Elaboration and validation of Crohn s disease anoperineal lesions consensual definitions. World J Gastroenterol 2017; 23(29): Available from: URL: DOI: INTRODUCTION Anoperineal lesions occur frequently during Crohn s disease (CD) and are associated with a worse prognosis [1]. Some lesions require instrumental and/or medical specific treatments and the most severe may lead to severe discomfort including the loss of continence [2]. The Cardiff classification system proposed to classify them into three groups: ulceration, fistulae (or abscesses) and stenosis [3]. Their diagnosis relies on inspection and palpation and for fistulae, diagnosis is improved by endoscopic ultrasonography (EUS) and/or pelvic magnetic resonance imaging (MRI) [4,5]. The American Gastroenterological Association (AGA) guidelines recommend a physical examination of the perianal area to identify anal skin tags, anal fissures, perianal fistulae, suspected perianal abscesses, anorectal strictures and rectovaginal fistulae including an endoscopic evaluation to determine whether or not there is macroscopically evident inflammation of the rectum [4]. It recommends classifying the fistulae as either simple or complex. A simple fistula is low (superficial, intersphincteric or low transsphincteric origin of the fistula tract) with a single external opening; no pain or fluctuation to suggest perianal abscess; and no evidence of rectovaginal fistula or anorectal stricture. A complex fistula is high (high intersphincteric, high transsphincteric, extrasphincteric or suprasphincteric origin of the fistula tract); may have multiple external openings; may be associated with the presence of pain or fluctuation to suggest a perianal abscess; may be associated with the presence of a rectovaginal fistula; may be associated with the presence of an anorectal stricture; and may be associated with the presence of active rectal disease determined by endoscopy [4]. Hugues [3] anatomical and pathophysiological classification, distinguishes between primary and secondary infected lesions taking into 5372 August 7, 2017 Volume 23 Issue 29

131 Horaist C et al. Consensual definitions of anoperineal CD Literature Verbatim from reports Experts is not mandatory for non-interventional research using blinded documents. Coordinators Experts Agreement 1 st version of definitions 2 nd version of definitions Vote 1 Vote 2 Insufficient agreement Literature search Medical databases (e.g., PubMed, MEDLINE, EMBASE) were systematically searched for eligible literature. The eligibility criteria were: studies published in English or in French; studies published between 1955 and 2014 containing the terms: perianal CD, CD, perineal lesions, anal ulceration, anal fissure, anal skin tag, anoperineal fistula, vulva and anal stricture. The literature was searched for definitions of APLOC to be presented to the expert group. Consensual definition Definition rejected Figure 1 Flow chart for the consensus steps. Ulceration Complex fistula account the type of lesion, its location and depth. The Perianal Disease Activity Index uses a five-point Likert scale: discharge, pain/restriction of activity, restriction of sexual activity, type of perianal disease and degree of local induration [6]. First proposed by Present et al [7]. The Fistula Drainage Assessment defines an active fistula by the existence of a purulent discharge after gentle finger compression of an external opening. The occurrence, improvement or worsening of endoscopic lesions [8] and APLOC need to be carefully described in daily practice and clinical trials and this requires consensual definitions with good interobserver agreement. The aims of this study were: (1) to find in literature, or to establish, a list of consensual descriptors of APLOC; and (2) to evaluate inter-individual variation in the use of these descriptors. MATERIALS AND METHODS Scar appearance Simple fistula Complex fistula Complex fistula Figure 2 Selection of photos used in phase 1. Neither written consent nor institutional review board approval was required as French law considers that it Consensus method A database of digitally recorded APLOC photos was examined by a coordinating group. They selected two series of 20 pictures illustrating the various aspects of APLOC. The reading group included eight experts from GREP and one academic dermatologist. All members of the coordination and reading groups participated in dedicated meetings. The study included two phases. Phase 1: Establishment of consensual definitions A formal consensus method was used to evaluate the level of agreement among experts on the definition wording. This method was both a guideline method and a consensus method (French National Authority for Health. Practice guidelines: formal consensus method. Saint-Denis. HAS; 2010). The experts identified and selected, through iterative ratings with feedback, the points on which they agreed, disagreed or were undecided (Figure 1). For the first round of reading, each expert provided a written report for each of the first series of APLOC photos (Figure 2). The only information provided to them were the photos and they did not have access to MRI or digital examinations. The verbatim descriptions of the APLOC (names and adjectives) were extracted from these reports and from the literature. The coordinating group provided, to the whole group, the list of descriptors and corresponding definitions. Agreement on those definitions was assessed using two votes. First, each expert assessor graded their agreement for each proposal between 1 (meaning the proposal was totally inappropriate) and 9 (meaning the proposal was totally appropriate). Agreement for every term was defined on the basis of the distribution of the scores of all experts: there was agreement when the scores were all 5 or all 5. Proposals were immediately accepted as appropriate when all scores were between 7 and 9 (median 7). They were immediately considered as inappropriate and rejected when all scores were between 1 and 3 (median 3). A meeting was then held to allow the reconsideration of the definitions which had not received strong agreement at the first vote. It consisted of a general discussion leading to the proposition of revised 5373 August 7, 2017 Volume 23 Issue 29

132 Horaist C et al. Consensual definitions of anoperineal CD definitions and a second vote, on the new definitions, took place. In the case of missing values, analysis was considered valid if at least 9 scores were obtained for a proposal. If there were no missing values, one of the scores could be excluded, in the analysis of the degree of agreement, according to the following rules: the lowest score was excluded if the median was > 5, the highest score was excluded if the median was 5. The analysis distinguished the proposals that were deemed appropriate, those that were deemed inappropriate and those on which the group did not reach a consensus. Phase 2: Study of interobserver agreement on the diagnosis of APLOC Each expert evaluated a second set of 20 new APLOC photos, selected by the organising group and completed an online questionnaire on a Formstack platform. This platform provides the ability to set-up a conditional algorithm and enables the automatic input of the results into a Microsoft Excel database. The questionnaire required the evaluation of the presence or absence of each of the descriptors selected during the first phase of the study. All items for each picture had to be completed on the platform to allow access to the next photo. Statistical analysis Quantitative data from the two ratings were expressed as averages. Qualitative data from the annex of the first vote were expressed as proportions. Statistical analysis was performed with IBM SPSS Statistic for Windows Version The interobserver agreement on the diagnosis of ulceration, anal skin tag, fistula, anoperineal scar and perianal skin lesion was measured using Fleiss s kappa coefficient with 95%CI. The interpretation of the values was performed according to the Landis and Koch scale [9] : almost perfect agreement between , substantial agreement between , moderate agreement between , fair agreement between , slight agreement between and absence of agreement < 0. The interobserver agreement for the other items was estimated using descriptive statistics and a threshold of 80% was arbitrarily chosen to define agreement. RESULTS Phase 1: Establishment of consensual definitions of descriptor terms and adjectives Analysis of the usual descriptions used in literature and reports Terms used in literature to evaluate visible APLOC do not include precise definitions or reference to definitions. Most of the expert reports on the first set of photos agreed with the main diagnosis but their verbatim descriptions contained substantial variation. For example, some experts used the term fissure while others used the term ulceration; and the fistula opening was qualified as inflammatory, productive or active. Consensus steps Vote 1: A list and definition of descriptors was discussed (each with its own qualifier). The list of definitions submitted to the first vote and the results are shown in Table 1. During the subsequent consensus meeting that aimed to reconsider definitions without strong agreement, experts considered it important to qualify ulceration by location, inflammatory aspect of edges and depth. They also considered it worth describing the extension of the lesions. For fistulae, they decided to follow the AGA s guidelines which defines fistula complexity and insisted that while complexity can sometimes be diagnosed from a photo, inspection alone is insufficient to qualify a fistula as simple [3]. Vote 2: The list of definitions submitted for the second vote and the results are shown in Table 2. In accordance with the protocol, extreme data were excluded for six of the proposals. The definition of a lesion node obtained relative agreement [median 7.8 (6-9); two values < 7]. The remaining definitions received strong agreement. Phase 2: Interobserver agreement on the description of APLOC using consensual definitions There was substantial agreement for the diagnosis of ulceration (κ = 0.70, 95%CI: ). There was 73.3% agreement for qualifying marginal and perianal locations. There was no consensus for either the qualification of anal canal location (53.3%). The depth feature did not reach an agreement for ulceration, as well as the characteristic extension. There was moderate agreement for the diagnosis of anal skin tags (κ = 0.49, 95%CI: ) and 75% agreement for the evaluation of activity and ulcerated appearance. There was substantial agreement for the diagnosis of fistulae (κ = 0.75, 95%CI: ) and the evaluation of external opening inflammation (86.6%). There was some disagreement when appreciating complexity (60%) and quality of drainage (33.3%). Experts considered that fistula complexity and quality of drainage could not be evaluated from the photos in 10% and 21% of the test cases respectively. The diagnosis of perineal skin lesions obtained moderate agreement (κ = 0.50, 95%CI: ). The items erythema and abscesses obtained good agreement (100% and 84.6% respectively). There was fair agreement for the diagnosis of scar appearance (κ = 0.34, 95%CI: ) and an agreement of 75% for the inflammatory characteristics. Figure 3 shows the APLOC where diagnosis had substantial interobserver agreement (four photos from the selection used in Phase 2). DISCUSSION Consensual definition of the words and adjectives used to describe the APLOC are lacking in medical 5374 August 7, 2017 Volume 23 Issue 29

133 Horaist C et al. Consensual definitions of anoperineal CD Table 1 Initial proposed definitions submitted for the first vote and the results of the agreement for those propositions Lesions and descriptors Definitions submitted to the votes Agreement scores 1 Ulceration Skin or mucosal defect 8.7 (8-9) 2 Depth Deep or cavitating Visible muscular and/or granulation tissue and/or undermined and inflammatory edges 8 (7-9) 2 Superficial Which is not deep 7.7 (7-9) 2 Location Anal canal and anal margin Visible after unfolding the anal radial folds 7 (1-9) Anal margin Anal external edges 7.9 (5-9) Perianal Outside the anus radial folds 8.6 (6-9) Extension Extensive 5 mm 5.6 (1-9) 3 Limited < 5 mm 5.6 (1-9) 3 Skin tag Tense nodular lesion with granulomatous but not papillomatous aspect 4.8 (2-9) 3 Activity Inflammatory Edematous aspect 6 (3-9) 3 Non inflammatory Fibrous aspect 6.2 (3-9) 3 Perianal skin lesions Papula Visible and elevated palpable lesion < 2 cm in diameter 8 (6-9) Node Nodular cutaneous elevation, visible and/or palpable, diameter 2 cm 6.1 (1-9) Edema Swollen area 6 (3-7) 3 Erythema Redness Pustula Raised, visible and palpable lesion, with cloudy fluid content 8.2 (6-9) Abscess Swollen red skin, sometimes surrounded by necrosis area and which can release pus 6.5 (5-9) Fistulae Complexity Complex Recto-vaginal fistula or multiple external openings or abscess or remote external opening 6.6 (4-9) Simple Single external opening, next to anal margin, without abscess 6.3 (3-9) 3 Note Inspection alone can sometimes confirm the diagnosis of a complex fistula 9 (9-9) 3 Inspection alone cannot establish a diagnosis of simple fistula with certainty 8 (6-9) 3 Drainage Well drained No abscess, no visible discharge and non-inflammatory external openings 7.6 (5-9) Poorly drained Inflammatory external opening(s) and/or abscess 7.4 (4-9) External opening(s) Inflammatory Erythematous surrounded skin and budding port(s) with undermined edges 8.5 (7-9) 2 Scar appearance Fibrous and retracted aspect of the anal margin 7.8 (6-9) Deformed anus 7.8 (5-9) 1 Median and distribution; 2 Definitions with strong agreement; 3 Missing data. literature except for fistulae. We established the missing consensual definitions and showed that experts have substantial interobserver agreement when using them to diagnose and describe fistulae, ulcerations, activity of external openings and erythema from photos. This study has several limitations. The first is that inspection is only one step in the diagnoses of APLOC which also requires palpation (digital external and anal examination), endoscopic rectal examination and often MRI and/or EUS when fistulae are suspected [5]. The experts had only access to the photos but not to MRI or digital examination, which are often considered as confirmation elements or gold standard. Another limitation is that only French experts were involved. However, there is a need to establish consensual wording describing the visible lesions and we believe that this step will help future studies evaluate if and how treatments influence lesions. Obtaining expert group consensus was relatively simple and consequently, we expect the definitions will also get consensus in other countries and continents. A similar approach, using consensual definitions, has allowed significant improvement in medical trials and daily practice using endoscopy as an endpoint, although central reading by specialised experts still decreases interobserver variability [10,11]. Consequently, we feel it is important for surgeons and non-operating specialists to use a common language (the majority of the experts in this study perform surgical treatment of APLOC). Even though a fistula cannot be considered as completely closed without palpation, especially under anesthesia, visual inspection of lesions without a surgeon present does provide additional information and we believe the definition of lesions and their characteristics as proposed here is valid. APLOC are heterogeneous. The most severe are deep ulcers, fistulae and abscesses (penetrating lesions) and stenosis. Established classifications of fistulae help predict the risks and influence of treatment decisions [4,12]. The Fistula Drainage Assessment, established and first used by Present et al [7], characterises fistulae as open (i.e., actively draining) or closed. A fistula is considered to be open if an investigator can express purulent material from the fistula by gentle finger compression. Following the principles of this study, improvement can be recognised in the case of reduction of an open or secreting fistula by greater than 50% compared with baseline levels on at least two consecutive examinations 5375 August 7, 2017 Volume 23 Issue 29

134 Horaist C et al. Consensual definitions of anoperineal CD Table 2 Consensual definitions and agreement scores Lesions and descriptors Consensual definitions Agreement scores 1 Ulceration Skin or mucosal defect 8.7 (8-9] 3 Depth Superficial Which is not deep 8 (7-9) 3 Deep Visible muscular and/or granulation tissue and/or undermined and inflammatory edges 7.7 (7-9) 3 Cavitating Deep decaying and destructive ulceration 8.6 (8-9) Localisation Anal canal Visible after unfolding the anus radial folds 8.5 (7-9) Anal margin Anal external edges 8.5 (7-9) Perianal Outside the anus radial folds 9 Extension Number 8.6 (8-9) Percentage of ulcerated area < 25%, 26-50%, > 50% of the anal circumference 8.3 (5-9) Skin tag Skin thickening of the anus 7.2 (3-9) Activity Inflammatory Oedematous, swollen, tense 8 (4-9) Non inflammatory Fibrous, firm and non-oedematous aspect 8.7 (2-9) Ulcerated (vs not) Ulceration on the skin tag (vs no ulceration on the skin tag) 7.8 (2-9) Perianal skin lesions Papula Elevated, circumscribed and solid lesion without liquid content 8.1 (6-9) Node 2 Elevated, nodular and protruding lesion, impression of deep extension 7.8 (6-9) Oedema Swollen appearance 8.2 (7-9) Erythema Flat redness 8.3 (5-9) Abscess Swollen red skin, which may be surrounded by necrosis area and which can release pus 8.3 (7-9) Fistula Complexity AGA s definitions (3) It is possible to recognize that a fistula is complex by inspection alone 7.2 (1-9) Inspection alone is not always sufficient to reliably recognize that a fistula is simple 8.5 (7-9) Drainage Well drained Absence of abscess, of purulent discharge an non inflammatory external opening(s) 7.8 (5-9) Poorly drained Inflammatory external opening(s) and/or abscess and/or spontaneous purulent discharge 7.5 (5-9) Poor drainage of a fistula can be diagnosed by inspection alone 8.6 (7-9) Inspection alone is often not sufficient to be certain that a fistula is well drained 7.6 (1-9) External opening Inflammatory Erythematous surrounded skin and budding port(s) with undermined edges Validated by vote 1 Scar appearance Deformed anus with fibrous aspect and/or retractile appearance of the anal margin 7.6 (8-9) With inflammatory activity or not 7.6 (3-9) 1 Median and distribution; 2 Validated by vote 1; 3 All definitions obtained a strong agreement except the entity node. and remission can be defined as a cessation of secretion of all fistulae in relation to the baseline level on at least two consecutive examinations. The gentle finger compression technique can vary between investigators and its reproducibility is unknown. Moreover, several studies using MRI or EUS have demonstrated that a fistulae may have persistent activity even when it looks closed [13]. We think that the inflammatory aspect of the external orifice provides meaningful information for the clinician and show here that it can be assessed with good interobserver reproducibility using our definitions. On the other hand, some chronic fistulae have a cold appearance with epithelialization of the external opening allowing them to open. Using a proper description to classify them would probably help establish the best treatment strategy in this specific setting. We consensually concluded that the adjectives: well drained or poorly drained ; and inflammatory or not inflammatory aspects of the external opening(s) and their definitions were the most appropriate way to qualify fistula during inspection. We also believe, in daily practice these characteristics are often taken into account when deciding to optimise anti-tnf treatment and common wording would assist the assessment for future treatment studies. The duration of fistula persistence, sometimes dependent on its mode of onset, is probably important for the risk of evolution towards a complex form and fibrosis. Using a validated and consensual vocabulary should allow the demonstration and quantification of this. Superficial APLOC also have a prognostic value as some represent the early stages of penetrating and stenosing lesions. In the literature and the spontaneous verbatim reporting by the experts during the first step of this study, the words fissure, ulceration and ulcer had not been defined neither their differences. We came to the consensus that the term ulceration was appropriate for all losses of substances (be it in the skin or anal area) and the depth of ulceration could be reproducibly and meaningfully described using the adjectives superficial, deep and cavitating. The definitions we have proposed should help future studies describe the natural history of lesions or their evolution during treatment. We think that inflammatory lesions including inflammatory skin tags, inflammatory external openings and frank 5376 August 7, 2017 Volume 23 Issue 29

135 Horaist C et al. Consensual definitions of anoperineal CD Ulcerations, fistula, inflammatory external openings Fistula, inflammatory external openings, erythema Ulceration Fistula, erythema, non inflammatory external openings Ulceration Fistula, inflammatory external openings Ulcerations, fistula, inflammatory external openings Fistula, non inflammatory external openings, erythema Figure 3 Anoperineal lesions of Crohn's which achieved a substantial degree of interobserver reproducibility for their diagnosis (photos used in phase 2). erythema also benefit from treatment optimisation (especially with anti-tnf agents) and this should be evaluated in future studies. In conclusion, this study constructed consensual definitions of APLOC and their characteristics and demonstrated that experts have substantial interobserver agreement when using them. While definitions of the most severe lesions (fistulae) had been proposed here, there was a lack of definition for early-lesions which should be treated more aggressively to avoid irreversible lesions. These definitions should ease clinical studies and improve teaching of fellows and clinical investigators. ACKNOWLEDGMENTS The authors thank the GREP for their contribution to the study. COMMENTS Background Except for fistulae, there are no consensual definitions of anoperineal lesions of Crohn s (APLOC) disease. The verbatim reporting is thus variable in clinical reports and literature. Research frontiers Studying the evolution of APLOC requires proper and precise description (i.e., consensual definitions of their nature and characteristics) to establish if and how any treatment modifies the lesions. Innovations and breakthroughs They arrived at consensual definitions of ulceration (entity, depth, extension), anal skin tags (entity, inflammatory activity, ulcerated aspect), fistula (complexity, quality of drainage, inflammatory activity of external openings), perianal skin lesions (abscess, papules, edema, erythema) and anoperineal scars. For fistulae, they decided to follow the American Gastroenterology Association s guideline definitions. From a series of APLOC photos, the diagnosis of ulceration, fistulae, inflammatory activity of external fistula openings, abscesses and erythema achieved a substantial degree of interobserver reproducibility. Applications Using these consensual definitions in daily practice and clinical studies should allow for improvement in the reproducibility of reports describing APLOC and their fate. Terminology The definitions of fistulae which already exist in literature have not been changed. Those of other APLOC are easy to remember and apply. Peer-review It is a study which explored the elaboration of consensual definitions of APLOC and inter observer agreement on the diagnosis of these lesions between experts. Authors suggest that herein they established the missing consensual definitions and show that experts have a substantial interobserver agreement when using them to diagnose and describe ulcerations, fistulas, activity of external openings and erythema on photographs. REFERENCES 1 Siproudhis L, Mortaji A, Mary JY, Juguet F, Bretagne JF, Gosselin M. Anal lesions: any significant prognosis in Crohn s disease? Eur J Gastroenterol Hepatol 1997; 9: [PMID: DOI: / ] 2 Lam TJ, van Bodegraven AA, Felt-Bersma RJ. Anorectal complications and function in patients suffering from inflammatory bowel disease: a series of patients with long-term follow-up. Int J Colorectal Dis 2014; 29: [PMID: DOI: /s ] 3 Hughes LE. Clinical classification of perianal Crohn s disease. Dis Colon Rectum 1992; 35: [PMID: DOI: / BF ] 4 Sandborn WJ, Fazio VW, Feagan BG, Hanauer SB; American Gastroenterological Association Clinical Practice Committee. AGA technical review on perianal Crohn s disease. Gastroenterology 2003; 125: [PMID: DOI: / j.gastro ] 5377 August 7, 2017 Volume 23 Issue 29

136 Horaist C et al. Consensual definitions of anoperineal CD 5 Van Assche G, Dignass A, Reinisch W, van der Woude CJ, Sturm A, De Vos M, Guslandi M, Oldenburg B, Dotan I, Marteau P, Ardizzone A, Baumgart DC, D Haens G, Gionchetti P, Portela F, Vucelic B, Söderholm J, Escher J, Koletzko S, Kolho KL, Lukas M, Mottet C, Tilg H, Vermeire S, Carbonnel F, Cole A, Novacek G, Reinshagen M, Tsianos E, Herrlinger K, Oldenburg B, Bouhnik Y, Kiesslich R, Stange E, Travis S, Lindsay J; European Crohn's and Colitis Organisation (ECCO). The second European evidencebased Consensus on the diagnosis and management of Crohn s disease: Special situations. J Crohns Colitis 2010; 4: [PMID: DOI: /j.crohns ] 6 Irvine EJ. Usual therapy improves perianal Crohn s disease as measured by a new disease activity index. McMaster IBD Study Group. J Clin Gastroenterol 1995; 20:27-32 [PMID: DOI: / ] 7 Present DH, Rutgeerts P, Targan S, Hanauer SB, Mayer L, van Hogezand RA, Podolsky DK, Sands BE, Braakman T, DeWoody KL, Schaible TF, van Deventer SJ. Infliximab for the treatment of fistulas in patients with Crohn s disease. N Engl J Med 1999; 340: [PMID: DOI: / NEJM ] 8 Panés J, Feagan BG, Hussain F, Levesque BG, Travis SP. Central Endoscopy Reading in Inflammatory Bowel Diseases. J Crohns Colitis 2016; 10 Suppl 2: S542-S547 [PMID: DOI: /ecco-jcc/jjv171] 9 Landis JR, Koch GG. The measurement of observer agreement for categorical data. Biometrics 1977; 33: [PMID: DOI: / ] 10 Mary JY, Modigliani R. Development and validation of an endoscopic index of the severity for Crohn s disease: a prospective multicentre study. Groupe d Etudes Thérapeutiques des Affections Inflammatoires du Tube Digestif (GETAID). Gut 1989; 30: [PMID: DOI: /gut ] 11 Travis SP, Schnell D, Krzeski P, Abreu MT, Altman DG, Colombel JF, Feagan BG, Hanauer SB, Lichtenstein GR, Marteau PR, Reinisch W, Sands BE, Yacyshyn BR, Schnell P, Bernhardt CA, Mary JY, Sandborn WJ. Reliability and initial validation of the ulcerative colitis endoscopic index of severity. Gastroenterology 2013; 145: [PMID: DOI: /j.gastro ] 12 Gecse KB, Bemelman W, Kamm MA, Stoker J, Khanna R, Ng SC, Panés J, van Assche G, Liu Z, Hart A, Levesque BG, D Haens G; World Gastroenterology Organization, International Organisation for Inflammatory Bowel Diseases IOIBD, European Society of Coloproctology and Robarts Clinical Trials; World Gastroenterology Organization International Organisation for Inflammatory Bowel Diseases IOIBD European Society of Coloproctology and Robarts Clinical Trials. A global consensus on the classification, diagnosis and multidisciplinary treatment of perianal fistulising Crohn s disease. Gut 2014; 63: [PMID: DOI: /gutjnl ] 13 Ardizzone S, Maconi G, Colombo E, Manzionna G, Bollani S, Bianchi Porro G. Perianal fistulae following infliximab treatment: clinical and endosonographic outcome. Inflamm Bowel Dis 2004; 10: [PMID: DOI: / ] P- Reviewer: Katsanos KH, Lakatos PL, Ryu DH S- Editor: Qi Y L- Editor: A E- Editor: Wang S 5378 August 7, 2017 Volume 23 Issue 29

137 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Retrospective Study Efficacy of tolvaptan for the patients with advanced hepatocellular carcinoma ORIGINAL ARTICLE Masayuki Miyazaki, Masayoshi Yada, Kosuke Tanaka, Takeshi Senjyu, Takeshi Goya, Kenta Motomura, Motoyuki Kohjima, Masaki Kato, Akihide Masumoto, Kazuhiro Kotoh Masayuki Miyazaki, Masayoshi Yada, Kosuke Tanaka, Takeshi Senjyu, Kenta Motomura, Akihide Masumoto, Department of Hepatology, Iizuka Hospital, Iizuka , Japan Takeshi Goya, Motoyuki Kohjima, Masaki Kato, Department of Medicine and Bioregulatory Science, Graduate School of Medical Science, Kyushu University, Fukuoka , Japan Kazuhiro Kotoh, Department of Hepatology, Harasanshin Hospital, Fukuoka , Japan Author contributions: Miyazaki M, Motomura K and Kotoh K wrote the paper; Yada M, Tanaka K, Senjyu T and Kotoh K analyzed the data; Kohjima M, Kato M and Masumoto A supervised writing of the paper; all authors contributed to this manuscript. Institutional review board statement: This study protocol was approved by the Ethics Committees at Iizuka Hospital (approval No ). Informed consent statement: For this type of retrospective study formal consent in not required. Only patient administered tolvaptan at 15 mg/day received a sufficient explanation of the aim and contents of this study. Conflict-of-interest statement: The authors declare no conflict of interest in this study. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Masayuki Miyazaki, MD, Department of Hepatology, Iizuka Hospital, 3-83 Yoshio, Iizuka , Japan. mmasayuk@med.kyushu-u.ac.jp Telephone: Fax: Received: January 19, 2017 Peer-review started: January 19, 2017 First decision: February 23, 2017 Revised: March 10, 2017 Accepted: April 21, 2017 Article in press: April 21, 2017 Published online: August 7, 2017 Abstract AIM To investigate the factors influenced the efficacy of tolvaptan (TLV) in liver cirrhosis. METHODS We retrospectively enrolled 61 consecutive patients with refractory hepatic ascites. All of them had been treated with furosemide and spironolactone before admission, and treated with TLV for 7 d in our hospital. The effect of TLV was defined by the rate of body weight loss, and the factors that influenced TLV efficacy were analyzed using multiple regression. RESULTS Coexistent hepatocellular carcinoma (HCC) was the only significant predictive variable that attenuated the efficacy of TLV. In stratified analysis, high doses of furosemide decreased the efficacy of TLV in patients with HCC, and increased efficacy in those without HCC. In the latter, a high Child-Pugh-Turcotte score had a positive influence and a high concentration of lactate dehydrogenase had a negative influence on the 5379 August 7, 2017 Volume 23 Issue 29

138 Miyazaki M et al. Efficacy of tolvaptan effectiveness of TLV. CONCLUSION Development of ascites may differ between patients with liver failure and those with HCC progression. A sufficient preceding dose of furosemide decreases diuretic effect of TLV. Key words: Ascites; Tolvaptan; Furosemide; Cirrhosis; Hepatocellular carcinoma The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Efficacy of tolvaptan (TLV) for hepatic ascites has been confirmed but some patients are resistant to the drug. We investigate influencing factors of the efficacy of TLV. As a result, coexistent hepatocellular carcinoma (HCC) was the only significant predictive variable that attenuated the efficacy of TLV. In stratified analysis, high doses of furosemide decreased the efficacy of TLV in patients with HCC, and increased efficacy in those without HCC. This study suggests that development of ascites may differ between patients with liver failure and those with HCC progression. A sufficient preceding dose of furosemide decreases diuretic effect of TLV. Miyazaki M, Yada M, Tanaka K, Senjyu T, Goya T, Motomura K, Kohjima M, Kato M, Masumoto A, Kotoh K. Efficacy of tolvaptan for the patients with advanced hepatocellular carcinoma. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5379.htm DOI: i INTRODUCTION Fluid retention such as ascites, edema or pleural effusion is a major complication of advanced liver cirrhosis, which results from distortion of hepatic architecture and increased hepatic vascular tone, and a subsequent derangement in the extracellular fluid volume regulatory mechanisms [1,2]. Tolvaptan (TLV) is a vasopressin V2 receptor antagonist, which has been accepted as a useful diuretic for patients with cirrhosis. Hypersecretion of antidiuretic hormone (ADH) is involved in the development of hepatic ascites, and inhibition of ADH causes free water excretion [3]. Cumulated reports investigating the influence of TLV on patients with cirrhosis have demonstrated its effectiveness, although a few patients are resistant to TLV [4-9]. The renin-angiotensinaldosterone (RAA) system, another hormonal regulator of hepatic ascites, is thought to be one of the main causes of hepatic ascites. Spironolactone, an inhibitor of aldosterone, combined with furosemide, is recommended as the first-line treatment [10,11]. However, there are also non-responders as well as responders to TLV [12,13]. Those findings indicate that the pathogenesis of cirrhotic ascites includes multiple hormonal pathways and the dominant pathway varies among individuals. Portal hypertension is also involved in the development of cirrhotic ascites. Overt ascites is rarely seen if the post-sinusoidal pressure gradient is < 12 mmhg [14]. Tumor thrombus in the main portal vein trunk can cause an abrupt development of ascites. Although many patients with cirrhosis are complicated by hepatocellular carcinoma (HCC), studies investigating the correlation between ascites and HCC have been rare. Furthermore, scarce investigators payed attention to the influence of HCC on the effect of TLV. Suzuki et al [15] recently reported the efficacy and safety of TLV for the patients with advanced HCC, but the number of the enrolled patients was only 9. A recent study analyzing the efficacy of TLV has shown that uncontrolled neoplasm is an independent factor that negatively affects TLV treatment, but the mechanism remains to be clarified [5]. Excess excretion of free water with TLV carries a risk of hypernatremia [16]. The use of concomitant natriuretic diuretics such as furosemide or spironolactone is required to avoid such an adverse reaction. However, the best plan for the combination of TLV and other diuretics relating to efficacy and safety has been rarely examined. It is possible that appropriate use of concomitant diuretics might reduce the number of nonresponders to TLV. We have treated patients suffering from refractory hepatic ascites with TLV regardless of being complicated with HCC for 5 years. Compared with earlier studies, the population included a high number of patients with advanced HCC. In the present study, we retrospectively investigated the factors that influenced the efficacy of TLV with multiple regression analysis, to clarify the best combination of TLV and other diuretics. Richness of variety of our treated patients might contribute to draw some useful information. MATERIALS AND METHODS Patients From July 2011 to September 2015, 84 consecutive patients with refractory hepatic ascites who were treated with TLV were referred to our hospital. All of them were hospitalized for 1 wk to monitor their serum sodium concentration and body weight (BW). Although they had been treated with furosemide and/ or spironolactone before admission, only 61 patients who had received both drugs were enrolled. They consisted of 36 men and 25 women, ranging in age from 43 to 91 years. They all underwent computed tomography on admission, which showed liver cirrhosis and massive ascites, and 32 had HCC (Table 1). The daily dose of TLV was determined to be 3.75, 5380 August 7, 2017 Volume 23 Issue 29

139 Miyazaki M et al. Efficacy of tolvaptan Decreased body weight (%) P < 0.05 HCC (+) HCC (-) Figure 1 Comparison of decreased body weight (%) between patients with and without hepatocellular carcinoma. The diuretic effect of tolvaptan was significantly higher in patients without hepatocellular carcinoma. HCC: Hepatocellular carcinoma. Table 1 Characteristics of the patients with and without hepatocellular carcinoma HCC (+) HCC (-) P vaule n Age 71.0 ± ± Sex (M/F) 19/13 17/ Decreased BW (kg) 1.68 ± ± Decreased BW (%) 2.56 ± ± TLV (3.75/7.5/15 mg/d) 3/24/5 2/22/ Furosemide 8/13/11 8/11/ ( 20/20 <, 40/> 40 mg/d) Spironolactone 2/8/22 2/10/ ( 25/25 <, 50/> 50 mg/d) Portal thrombus (+/-) 8/24 0/ Albumin (g/dl) 2.64 ± ± CPT score 10.7 ± ± BUN (mg/dl) 21.3 ± ± Na (meq/l) ± ± K (meq/l) 4.02 ± ± egfr (ml/min) ± ± LDH (IU/L) ± ± Platelet count ( 10 4 /µl) ± ± T factor of TNM classification (T1/T2/T3a and T3b) 6/13/ CPT score: Child-Pugh-Turcotte score; BW: Body weoght; HCC: Hepatocellular carcinoma; egfr: Estimated glemerular filtration rate; BUN: Blood urea nitrogen; LDH: Lactate dehydrogenase; TLV: Tolvaptan. 7.5, or 15 mg roughly according to the patient s body size. TLV was continuously administered for 7 d from the time of admission, while the preceding furosemide and spironolactone were concomitantly given without changing the doses. This study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the ethics committees at our institutions. Judgment of the efficacy of TLV The efficacy of TLV was determined using the following formula: Decreased BW% = (BW before TLV - BW at day 7)/BW before TLV 100%. Statistical analysis The individual correlation between the decreased BW% and the factors that might influence TLV efficacy was tested by linear regression analysis for consecutive variables, or by post hoc analysis for categorical ones. To confirm the predictive factors for the decreased BW%, those variables were analyzed using stepwise multiple regression analysis. The evaluated factors were the daily dose of TLV, furosemide and spironolactone, complicating HCC, portal thrombosis in the main trunks, T factor of TNM classification of Union for International Cancer Control, Child-Pugh-Turcotte (CPT) score, serum levels of blood urea nitrogen, sodium, potassium, and lactate dehydrogenase (LDH), estimated glomerular filtration rate, and platelet count. All laboratory data were derived upon admission. If the samples of consecutive variables did not conform to a normal distribution, they were transformed into logistic or Johnson s SU distribution before application to regression analysis. In comparison between two groups, averages of consecutive variables were tested by Wilcoxon s test, and the categorical variables were tested by Pearson s χ 2 test. All statistical analyses were performed using JMP version software (SAS Institute Inc., Cary, NC, United States). In all analysis, a P value < 0.05 was considered statistically significant. RESULTS Analysis of all patients In evaluating the correlation between decreased BW% and individual variables, there was no significant correlation, except for the coexistence of HCC (Figure 1). Stepwise multiple regression analysis showed that a model with the coexistence of HCC and serum LDH concentration was significant for predicting the decrease of BW% (Table 2), but the coefficient of the latter was not significant (P = ). Coexistence of HCC was the only significant predictive factor, which means that the patients with HCC would be more resistant to TLV treatment than those without HCC. The coefficient of determination of this model was small (R 2 = ), and the result indicated the possibility that the ascites of the patients with HCC had a different development mechanism from that of the patients without HCC. Therefore, a stratified analysis was subsequently performed dividing the patients into those with and without HCC. Analysis of patients with and without HCC Patients with HCC were younger by about 10 years than those without HCC, but the other variables did not differ significantly, except that serum albumin concentration was higher in the former (Table 1). The correlations between decreased BW% and every variable in Table 1 were examined by linear regression analysis or by post hoc analysis for the 5381 August 7, 2017 Volume 23 Issue 29

140 Miyazaki M et al. Efficacy of tolvaptan Decreased body weight (%) 15 HCC (+) 10 5 r = P = HCC (-) r = P = Serum sodium concentration (meq/ml) Spironolactone (mg/d) Density of population Low High Furosemide (mg/d) Figure 2 In patients with hepatocellular carcinoma, serum sodium concentration before treatment with tolvaptan was positively correlated with decreased body weight (%), while no significant correlation was seen in those without hepatocellular carcinoma. HCC: Hepatocellular carcinoma. Figure 4 Individual doses of furosemide and spironolactone were plotted. The area of the black-to-white gradation shows the population density. When the total amount of natriuretic diuretics, it was mainly controlled by the dose of furosemide. Decreased body weight (%) HCC (+) HCC (-) > > 40 Furosemide (mg/d) Figure 3 Influence of concomitant furosemide on decreased body weight (%). Although the difference between each dose category was not significant, high dose of furosemide attenuated the decreased body weight (%) in patients with hepatocellular carcinoma (HCC), while the tendency was opposite in those without HCC. patients with and without HCC. Only the correlation between sodium concentration and decreased BW% in the patients with HCC was significant (Figure 2), and patients with lower sodium concentration were resistant to TLV. Stepwise multiple regression analysis selected the dose of furosemide and T factor as predictive factors in patients with HCC, but the coefficient of the T factor was not significant (P = ). In the patients without HCC, the dose of furosemide, CPT score, and serum LDH concentration were independent significant predictive factors (Table 2). Although the dose of furosemide was selected as a significant predictive factor in both groups, the effect was opposite. The high dose of furosemide decreased TLV efficacy in patients with HCC, whereas it improved efficacy in those without HCC (Figure 3). In contrast, spironolactone, the other natriuretic diuretic, was not a predictive factor of TLV efficacy. In comparing the doses of both natriuretic diuretics, a large amount of total diuretics was mainly regulated by increasing the dose of furosemide (Figure 4). DISCUSSION The diuretic efficacy of TLV in patients with cirrhosis has been confirmed in earlier studies [4-9]. The reported effective ratio, however, was 36%-63%, and the prediction of the effectiveness before treatment is still difficult. The diuretic effect of TLV appears as an antagonist of ADH, and the heterogeneous efficacy is thought to be based on various degrees of contribution of ADH to development of ascites. In this study, we showed that the response to TLV differed between patients with and without HCC, which indicates that ascites develops differently in patients with and without HCC. Although the pathogenic factors and signaling pathways that cause cirrhotic ascites are complex, it is commonly accepted that two main events trigger the development of ascites: splanchnic vascular dilatation caused by vasodilators relating to the progression of liver failure, and portal hypertension [17,18]. The former leads to a decrease of systemic circulating blood flow volume and subsequent reabsorption of sodium by the RAA system and water by the ADH system (Figure 5B). If patients with HCC have a unique mechanism for development of ascites, it might be a dominant role of portal hypertension because it has been established that HCC progresses with microvascular invasion, even in its early stage. Pawlik et al [19] analyzed patients with HCC who underwent liver transplantation, and revealed that HCC < 3 cm in diameter was already accompanied by 25% minor vascular invasion, which reached 63% in HCC > 6.5 cm. Recently, Chen et al [20] showed that macro- and microvascular invasion were independent factors relating to the development of ascites in patients with HCC caused by hepatitis B virus. These findings indicate that the development of ascites following HCC progression is mainly caused by portal hypertension subsequent to vascular invasion. In our study, stepwise multivariate regression analysis of patients with HCC selected a high T factor and a large dose of furosemide as independent factors 5382 August 7, 2017 Volume 23 Issue 29

141 Miyazaki M et al. Efficacy of tolvaptan A Increased portal vein pressure B Splanchnicvasodilatation Ascites Excess furosemide Effective circulating blood flow Plasma Na Concentration ADH secretion RAA system Effective circulating blood flow H2O reabsorption Na reabsorption H2O intake ADH secretion ADH secretion Ascites H2O intake Figure 5 If a sufficient dose of furosemide was administered to patients whose ascites mainly developed mainly because of portal hypertension, such as in aggressive hepatocellular carcinoma, it decreased serum sodium concentration and subsequently attenuated antidiuretic hormone secretion. In that condition, the effect of tolvaptan might be limited (A). In contrast, in patients with ascites that developed mainly because of attenuated liver function, hormonal diuretic systems were activated. A sufficient dose of furosemide reduced the role of the RAA system, and increased that of ADH (B). ADH: Antidiuretic hormone; RAA: Reninangiotensin-aldosterone. Table 2 Stepwise multiple regression analysis to predict the decreased body weoght (%) Variables Coefficient 95%CI F P value For all patients HCC (-/+) ( , ) Ln (LDH) ( , ) For the patients with HCC Furosemide ( 40 mg vs > 40 mg/d) ( , ) T-factor (T1 and T2 vs T3) ( , ) For the patients without HCC Furosemide ( 20 mg vs > 20 mg/d) (3.8667, ) CPT score (0.3801, ) Ln (LDH) ( , ) For all patients: Decreased BW% = [HCC (-/+)] [Ln (LDH)], R2 = , P = , [HCC (-) = -1, HCC (+) = 1]; For the patients with HCC: Decreased BW% = (T factor) (Furosemide), R2 = , P = , (T1 and T2 = -1, T3 = 1), (Furosemide 40 mg/d = -1, Furosemide > 40 mg/d = 1); For the patients without HCC: Decreased BW% = (Furosemide) (CPT score) [Ln (LDH)], R2 = , P = (Furosemide 20 mg/d = -1, Furosemide > 20 mg/d = 1). CPT score: Child-Pugh-Turcotte score; HCC: Hepatocellular carcinoma; LDH: Lactate dehydrogenase. that could attenuate the diuretic effect of TLV. Patients with HCC had a significantly higher level of serum albumin and were younger by about 10 years than those without HCC, which indicated that ascites in the former appeared at an earlier stage of liver cirrhosis. In many of the patients with HCC, therefore, vascular invasion and increased portal hypertension might have triggered the development of ascites. Administration of a sufficient dose of furosemide in such conditions should have decreased plasma osmotic pressure and systemic circulating blood flow volume. As a decline in plasma osmotic pressure suppresses secretion of ADH, it is possible that the efficacy of TLV in patients with such a background would have been limited (Figure 5A). The positive significant correlation between sodium concentration before treatment with TLV and decreased BW% seems to support this hypothesis. Pose et al [21] recently reported that TLV had a limited effect in patients with cirrhosis and severe hyponatremia. Their result has a similar explanation. Nakagawa et al [22] reported the analysis of 40 cirrhotic patients treated with TLV including 12 with HCC. They showed that the progression of portal hypertension attenuated the effect of TLV, but the mechanism was unclear. A multivariate analysis including the dose of concomitant natriuretic diuretics and serum sodium concentration might have been helpful to clarify the process. In patients without HCC, a high CPT score and a large dose of furosemide amplified the efficacy of TLV, while high serum LDH concentration attenuated efficacy. High CPT score indicates progression of liver failure involving an increase in vasodilators, therefore, the RAA system and ADH should play a greater role than portal hypertension in the development of ascites. A sufficient dose of furosemide in that condition should offset the effect of the RAA system, leading to an increase in ADH signaling. This speculation might 5383 August 7, 2017 Volume 23 Issue 29

142 Miyazaki M et al. Efficacy of tolvaptan explain the positive correlation of CPT score and dose of furosemide with TLV response. The increase of serum LDH concentration is thought to reflect the excessive decrease of systemic circulating blood flow volume, because transcription of LDH increases in hypoxic circumstances [23]. The significant LDH increase indicates an excessive decrease in renal blood flow, which should reduce the effect of ADH. The dose of spironolactone was not selected as a significant parameter in the multiple regression analysis in contrast to that of furosemide. The difference could have arisen from the imbalanced use of the drugs. As shown in Figure 4, the total dose of diuretic drugs seems to have been controlled mainly by the dose of furosemide, which was probably based on the desire to avoid hyperkalemia. In discussing the mechanism of the combined use of furosemide and spironolactone with TLV, the important thing is the natriuretic potency of them. Therefore, at least in this study, the dose of furosemide should roughly represent the total natriuretic potency of furosemide and spironolactone. We believe that the opposite influence of the concomitant use of furosemide on the efficacy of TLV is clinically important. Generalizing our results to patients with hepatic ascites, furosemide should be given in sufficient dose with TLV to patients with ascites that is predominantly induced by liver failure. However, furosemide should be withheld from patients with ascites that is predominantly caused by portal hypertension, which includes many of the patients with advanced HCC-induced ascites. However, the number of patients in our study was too small to make definite recommendations, and an additional, larger study is required. In conclusion, our results suggest that ascites in patients with HCC responds less well to TLV compared with ascites in patients without HCC. The difference arises from the variant mechanisms of the development of ascites. Excess use of preceding natriuretic diuretics might attenuate the diuretic efficacy of TLV. Further studies including hormonal parameters are required to establish appropriate combined treatment with TLV and natriuretic diuretics. COMMENTS Background The efficacy of tolvaptan (TLV) for hepatic ascites has been confirmed but some patients are resistant to the drug. The mechanism of the development of hepatic ascites is complex, and the influence of concomitant natriuretic diuretics or complicated hepatocellular carcinoma (HCC) on the efficacy of TLV remains to be clarified. Research frontiers The authors investigated the factors that influenced the efficacy of TLV with multiple regression analysis, to clarify the best combination of TLV and other diuretics. Innovations and breakthroughs In this study, coexistent HCC was the only significant predictive variable that attenuated the efficacy of TLV. In stratified analysis, high doses of furosemide decreased the efficacy of TLV in patients with HCC, and increased efficacy in those without HCC. Applications This study suggests that development of ascites may differ between patients with liver failure and those with HCC progression. A sufficient preceding dose of furosemide decreases diuretic effect of TLV. Terminology TLV is a vasopressin V2 receptor antagonist, which has been accepted as a useful diuretic for patients with cirrhosis. Peer-review The manuscript presents a good idea in the project of experimentation but the background, the introduction as well as the conclusions are very deficient of adequate and recent bibliography in the field and of a well discussed comment on results. REFERENCES 1 Kashani A, Landaverde C, Medici V, Rossaro L. Fluid retention in cirrhosis: pathophysiology and management. QJM 2008; 101: [PMID: DOI: /qjmed/hcm121] 2 Hernández-Guerra M, García-Pagán JC, Bosch J. Increased hepatic resistance: a new target in the pharmacologic therapy of portal hypertension. J Clin Gastroenterol 2005; 39: S131-S137 [PMID: ] 3 Ferguson JW, Therapondos G, Newby DE, Hayes PC. Therapeutic role of vasopressin receptor antagonism in patients with liver cirrhosis. Clin Sci (Lond) 2003; 105: 1-8 [PMID: DOI: /CS ] 4 Sakaida I, Yamashita S, Kobayashi T, Komatsu M, Sakai T, Komorizono Y, Okada M, Okita K; ASCITES 14-Day Administration Study Group. Efficacy and safety of a 14-day administration of tolvaptan in the treatment of patients with ascites in hepatic oedema. J Int Med Res 2013; 41: [PMID: DOI: / ] 5 Ohki T, Sato K, Yamada T, Yamagami M, Ito D, Kawanishi K, Kojima K, Seki M, Toda N, Tagawa K. Efficacy of tolvaptan in patients with refractory ascites in a clinical setting. World J Hepatol 2015; 7: [PMID: DOI: /wjh. v7.i ] 6 Kogiso T, Yamamoto K, Kobayashi M, Ikarashi Y, Kodama K, Taniai M, Torii N, Hashimoto E, Tokushige K. Response to tolvaptan and its effect on prognosis in cirrhotic patients with ascites. Hepatol Res 2016; Epub ahead of print [PMID: DOI: /hepr.12822] 7 Uojima H, Kinbara T, Hidaka H, Sung JH, Ichida M, Tokoro S, Masuda S, Takizawa S, Sasaki A, Koizumi K, Egashira H, Kako M. Close correlation between urinary sodium excretion and response to tolvaptan in liver cirrhosis patients with ascites. Hepatol Res 2017; 47: E14-E21 [PMID: DOI: /hepr.12716] 8 Kawaratani H, Fukui H, Moriya K, Noguchi R, Namisaki T, Uejima M, Kitade M, Takeda K, Okura Y, Kaji K, Nishimura N, Takaya H, Aihara Y, Sawada Y, Sato S, Seki K, Mitoro A, Yamao J, Yoshiji H. Predictive parameter of tolvaptan effectiveness in cirrhotic ascites. Hepatol Res 2016; Epub ahead of print [PMID: DOI: /hepr.12826] 9 Chishina H, Hagiwara S, Nishida N, Ueshima K, Sakurai T, Ida H, Minami Y, Takita M, Kono M, Minami T, Iwanishi M, Umehara Y, Watanabe T, Komeda Y, Arizumi T, Kudo M. Clinical Factors Predicting the Effect of Tolvaptan for Refractory Ascites in Patients with Decompensated Liver Cirrhosis. Dig Dis 2016; 34: [PMID: DOI: / ] 10 Pérez-Ayuso RM, Arroyo V, Planas R, Gaya J, Bory F, Rimola A, Rivera F, Rodés J. Randomized comparative study of efficacy of furosemide versus spironolactone in nonazotemic cirrhosis with 5384 August 7, 2017 Volume 23 Issue 29

143 Miyazaki M et al. Efficacy of tolvaptan ascites. Relationship between the diuretic response and the activity of the renin-aldosterone system. Gastroenterology 1983; 84: [PMID: ] 11 Garcia N, Sanyal AJ. Ascites. Curr Treat Options Gastroenterol 2001; 4: [PMID: ] 12 Singhal S, Baikati KK, Jabbour II, Anand S. Management of refractory ascites. Am J Ther 2012; 19: [PMID: DOI: /MJT.0b013e3181ff7a8b] 13 Schouten J, Michielsen PP. Treatment of cirrhotic ascites. Acta Gastroenterol Belg 2007; 70: [PMID: ] 14 Casado M, Bosch J, García-Pagán JC, Bru C, Bañares R, Bandi JC, Escorsell A, Rodríguez-Láiz JM, Gilabert R, Feu F, Schorlemer C, Echenagusia A, Rodés J. Clinical events after transjugular intrahepatic portosystemic shunt: correlation with hemodynamic findings. Gastroenterology 1998; 114: [PMID: ] 15 Suzuki E, Chiba T, Ogasawara S, Saito T, Kanogawa N, Motoyama T, Ooka Y, Tawada A, Maruyama H, Ogawa M, Yokosuka O. Tolvaptan treatment for patients with decompensated cirrhosis and advanced hepatocellular carcinoma. Hepatol Res 2015; 45: E161-E162 [PMID: DOI: /hepr.12465] 16 Hirai K, Shimomura T, Moriwaki H, Ishii H, Shimoshikiryo T, Tsuji D, Inoue K, Kadoiri T, Itoh K. Risk factors for hypernatremia in patients with short- and long-term tolvaptan treatment. Eur J Clin Pharmacol 2016; 72: [PMID: DOI: /s ] 17 Fukui H. Do vasopressin V2 receptor antagonists benefit cirrhotics with refractory ascites? World J Gastroenterol 2015; 21: [PMID: DOI: /wjg.v21.i ] 18 Pedersen JS, Bendtsen F, Møller S. Management of cirrhotic ascites. Ther Adv Chronic Dis 2015; 6: [PMID: DOI: / ] 19 Pawlik TM, Delman KA, Vauthey JN, Nagorney DM, Ng IO, Ikai I, Yamaoka Y, Belghiti J, Lauwers GY, Poon RT, Abdalla EK. Tumor size predicts vascular invasion and histologic grade: Implications for selection of surgical treatment for hepatocellular carcinoma. Liver Transpl 2005; 11: [PMID: DOI: /lt.20472] 20 Chen C, Chen DP, Gu YY, Hu LH, Wang D, Lin JH, Li ZS, Xu J, Wang G. Vascular invasion in hepatitis B virus-related hepatocellular carcinoma with underlying cirrhosis: possible associations with ascites and hepatitis B viral factors? Tumour Biol 2015; 36: [PMID: DOI: / s ] 21 Pose E, Solà E, Piano S, Gola E, Graupera I, Guevara M, Cárdenas A, Angeli P, Ginès P. Limited Efficacy of Tolvaptan in Patients with Cirrhosis and Severe Hyponatremia: Real-Life Experience. Am J Med 2017; 130: [PMID: DOI: / j.amjmed ] 22 Nakagawa A, Atsukawa M, Tsubota A, Kondo C, Okubo T, Arai T, Itokawa N, Narahara Y, Iwakiri K. Usefulness of portal vein pressure for predicting the effects of tolvaptan in cirrhotic patients. World J Gastroenterol 2016; 22: [PMID: DOI: /wjg.v22.i ] 23 Firth JD, Ebert BL, Ratcliffe PJ. Hypoxic regulation of lactate dehydrogenase A. Interaction between hypoxia-inducible factor 1 and camp response elements. J Biol Chem 1995; 270: [PMID: ] P- Reviewer: Ohira M, Pelagalli A, Yuan YS S- Editor: Qi Y L- Editor: A E- Editor: Zhang FF 5385 August 7, 2017 Volume 23 Issue 29

144 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Retrospective Study ORIGINAL ARTICLE outcomes of preoperative endoscopic nasobiliary drainage and endoscopic retrograde biliary drainage for malignant distal biliary obstruction prior to pancreaticoduodenectomy Guo-Qiang Zhang, Yong Li, Yu-Ping Ren, Nan-Tao Fu, Hai-Bing Chen, Jun-wu Yang, Wei-Dong Xiao Guo-Qiang Zhang, Yong Li, Yu-Ping Ren, Nan-Tao Fu, Hai-Bing Chen, Jun-wu Yang, Wei-Dong Xiao, Department of General Surgery, the First Affiliated Hospital of Nanchang University, Nanchang , Jiangxi Province, China Author contributions: Zhang GQ and Li Y designed the research; Zhang GQ analyzed the data and drafted the article; Li Y interpreted the data, revised the article and finally approved the version of the manuscript; Ren YP, Fu NT, Chen HB and Yang JW collected the data; Xiao WD assisted in drafting the article; all authors had approved the article to be published. Institutional review board statement: The study was reviewed and approved by the Institutional Review Board of the First Affiliated Hospital of Nanchang University, Nanchang, China. Conflict-of-interest statement: The authors declare that there is no conflict of interest related to this report. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Yong Li, MD, Professor, Department of General Surgery, the First Affiliated Hospital of Nanchang University, No. 17, Yongwai Zhengjie, Nanchang , Jiangxi Province, China. yfyly@163.com Telephone: Fax: Received: March 20, 2017 Peer-review started: March 23, 2017 First decision: April 21, 2017 Revised: May 3, 2017 Accepted: June 19, 2017 Article in press: June 19, 2017 Published online: August 7, 2017 Abstract AIM to compare the outcomes of preoperative endoscopic nasobiliary drainage (ENBD) and endoscopic retrograde biliary drainage (ERBD) in patients with malignant distal biliary obstruction prior to pancreaticoduodenectomy (PD). METHODS Data from 153 consecutive patients who underwent preoperative endoscopic biliary drainage prior to PD between January 2009 and July 2016 were analyzed. We compared the clinical data, procedure-related complications of endoscopic biliary drainage (EBD) and postoperative complications of PD between the ENBD and ERBD groups. Univariate and multivariate analyses with odds ratios (ORs) and 95% confidence intervals (95%CIs) were used to identify the risk factors for deep abdominal infection after PD. RESULTS One hundred and two (66.7%) patients underwent ENBD, and 51 (33.3%) patients underwent ERBD. Endoscopic sphincterotomy was less frequently performed in the ENBD group than in the ERBD group (P = 0.039); the EBD duration in the ENBD group was shorter than that in the ERBD group (P = 0.036). After EBD, the levels of total bilirubin (TB) and alanine aminotransferase (ALT) were obviously decreased in both groups, and the decreases of TB and ALT in the ERBD group were greater than those in the ENBD group (P = and P = 0.000, respectively). However, 5386 August 7, 2017 Volume 23 Issue 29

145 Zhang GQ et al. Outcomes of PEBD prior to PD the rate of EBD procedure-related cholangitis was significantly higher in the ERBD group than in the ENBD group (P = 0.007). The postoperative complications of PD as graded by the Clavien-Dindo classification system were not significantly different between the two groups (P = 0.864). However, the incidence of deep abdominal infection after PD was significantly lower in the ENBD group than in the ERBD group (P = 0.019). Male gender (OR = 3.92; 95%CI: ; P = 0.002), soft pancreas texture (OR = 3.60; 95%CI: ; P = 0.009), length of biliary stricture ( 1.5 cm) (OR = 5.20; 95%CI: ; P = 0.000) and ERBD method (OR = 4.08; 95%CI: ; P = 0.002) were independent risk factors for deep abdominal infection after PD. CONCLUSION ENBD is an optimal method for patients with malignant distal biliary obstruction prior to PD. ERBD is superior to ENBD in terms of patient tolerance and the effect of biliary drainage but is associated with an increased risk of EBD procedure-related cholangitis and deep abdominal infection after PD. Key words: preoperative endoscopic biliary drainage; endoscopic nasobiliary drainage; endoscopic retrograde biliary drainage; pancreaticoduodenectomy; malignant distal biliary obstruction The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: To compare the outcomes of preoperative endoscopic biliary drainage via endoscopic nasobiliary drainage (ENBD) and endoscopic retrograde biliary drainage (ERBD) in patients with malignant distal biliary obstruction prior to pancreaticoduodenectomy (PD), we studied 153 patients with malignant distal biliary obstruction who underwent ENBD or ERBD prior to PD. ERBD was superior to ENBD in terms of patient tolerance and the effect of biliary drainage, but the incidence rates of endoscopic biliary drainage procedure-related complications and deep abdominal infection after PD were higher than those associated with ENBD. Multivariate analysis showed that ERBD was an independent risk factor for deep abdominal infection after PD. ENBD is the optimal method for patients with malignant distal biliary obstruction prior to PD. Zhang GQ, Li Y, Ren YP, Fu NT, Chen HB, Yang JW, Xiao WD. outcomes of preoperative endoscopic nasobiliary drainage and endoscopic retrograde biliary drainage for malignant distal biliary obstruction prior to pancreaticoduodenectomy. World J Gastroenterol 2017; 23(29): Available from: URL: DOI: INTRODUCTION Malignant distal biliary obstruction, which is caused by periampullary carcinoma, pancreatic carcinoma and other malignant diseases, can lead to obstructive jaundice. Pancreaticoduodenectomy (PD) is the curative treatment for malignant distal biliary obstruction. Hyperbilirubinemia causes organ dysfunction, including liver and cardiac dysfunction, as well as coagulation dysfunction, bacterial translocation and cholangitis. Preoperative biliary drainage (PBD) can reduce serum bilirubin levels, which may improve the outcomes of surgical treatment [1]. However, controversy regarding the use of PBD for malignant distal biliary obstruction prior to PD has existed for decades. Some studies found that PBD did not improve the outcomes of surgery but did increase postoperative complications (infectious complication, postoperative pancreatic fistula, delayed gastric emptying, etc.) and hospitalization, and PBD was considered a negative prognostic factor for the long-term survival of patients with malignant distal biliary obstruction after PD. Therefore, some researchers suggested that PBD should be avoided or should not be performed routinely in patients with malignant distal biliary obstruction after PD [2-6]. No consensus regarding whether to perform PBD for malignant obstructive jaundice has been established. However, PBD is still used at many centers for patients presenting with hyperbilirubinemia or cholangitis to improve their preoperative state. PBD can be performed via endoscopic biliary drainage (EBD) or via percutaneous transhepatic biliary drainage (PTBD). EBD has been shown to be superior to PTBD for the treatment of malignant distal biliary obstruction prior to PD because PTBD is more invasive and is associated with a higher rate of complications and higher incidence of catheter tract metastasis [7,8]. Several recent reports have shown that EBD is the preferred method because patients with malignant distal biliary obstruction who undergo PTBD prior to PD have poorer long-term survival than those who undergo EBD [9-12]. EBD can be performed via endoscopic nasobiliary drainage (ENBD) with a nasobiliary catheter or via endoscopic retrograde biliary drainage (ERBD) with a plastic stent. There is debate regarding which is the more beneficial method for patients with malignant distal biliary obstruction, and several papers have suggested that ENBD is superior to ERBD when considering the incidence of stent dysfunction, perioperative complication rate and mortality [13,14]. In the present study, we retrospectively investigated the outcomes of EBD via ENBD with a nasobiliary catheter and ERBD with a plastic stent in patients with malignant distal biliary obstruction prior to PD. MATERIALS AND METHODS Patients Between January 2009 and July 2016, a prospectively collected database of patients with malignant distal biliary obstruction who had undergone EBD prior to PD (Whipple) at the First Affiliated Hospital of Nanchang 5387 August 7, 2017 Volume 23 Issue 29

146 Zhang GQ et al. Outcomes of PEBD prior to PD University was retrospectively reviewed. EBD was performed for patients with hyperbilirubinemia and poor liver function prior to PD. This study was approved by the ethics committee of the First Affiliated Hospital of Nanchang University. A total of 153 patients with malignant distal biliary obstruction (total bilirubin 100 µmol/l) underwent EBD (ENBD or ERBD). The ENBD group was matched in a 2:1 ratio to the ERBD group with respect to patient clinical characteristics, data of EBD and PD. Endoscopic sphincterotomy (EST) was performed in patients with severe stenosis when balloon dilatation was not possible. We used a 7.5-Fr tube in the ENBD group and an 8.5-Fr plastic stent in the ERBD group. After the drainage procedure, the surgeon evaluated the patients regarding bilirubin to determine whether the surgical goals were achieved or whether the drainage was dysfunctional, after which PD was performed. Data collection We retrospectively reviewed the clinical data, including age, gender, concomitant diseases (hypertension, cardiac disease, diabetes mellitus, acute pancreatitis and cholangitis), biochemical indicators [total bilirubin (TB) and alanine aminotransferase (ALT)], EBD-related data (the type and diameter of the nasobiliary catheter and plastic stent and the length of the biliary stricture), PD-related data (pancreatic texture, pancreatic duct diameter, common bile duct diameter, operative time, bleeding volume, and blood transfusion), the complications of EBD and the postoperative complications of PD. Definition of complications The complications of EBD included stent/tube dysfunction, pancreatitis, cholangitis and others (hemorrhage, perforation, etc.). Stent/tube dysfunction included occlusion or migration that prevented the serum bilirubin and transaminase from decreasing or increasing. Pancreatitis was characterized by upper abdominal pain, abdominal distension, vomiting and other clinical symptoms, including serum amylase concentration that was three or more times higher than the upper limit of normal. Cholangitis was characterized by fever, jaundice, and abdominal pain with an increase in white blood cell count. The postoperative complications of PD included pancreatic fistula (PF), delayed gastric emptying (DGE), postpancreatectomy hemorrhage (PPH), bile leakage, deep abdominal infection, wound infection and pneumonia. According to the guidelines of the International Study Group on Pancreatic Fistula, PF was confirmed when the concentration of amylase in the peritoneal drainage fluid or abdominal puncture fluid was three or more times higher than the upper limit of the normal serum concentration after postoperative day 3, and PF was divided into three grades (A, B and C) based on clinic symptoms and treatment [15]. DGE and PPH were also diagnosed according to the ISGPS guidelines and were also divided into three grades (A, B and C) [16,17]. Bile leakage was diagnosed when bile was present in the drainage fluid or abdominal puncture fluid. Deep abdominal infections, including peritoneal infection and intra-abdominal abscess, were diagnosed when there were signs of peritonitis, increased white blood cell count, and positive drainage-fluid culture or were confirmed by CT scan and puncture drainage. Wound infection was diagnosed according to the guidelines of the US Centers for Disease Control and Prevention [18]. Pneumonia diagnosis required clinical symptoms and radiographic evidence, such as X-ray or CT. In accordance with the Clavien-Dindo classification system, the complications were classified into five grades, and we further stratified the patients into the mild (Ⅰ-Ⅱ), moderate (Ⅲ) and severe groups (Ⅳ-Ⅴ) according to the severity of the symptoms [19]. Mortality was defined as death during the perioperative period or death from surgery-related complications within 1 mo after discharge. Statistical analysis SPSS 18.0 software (Chicago, IL, United States) was used for all statistical analyses. Data are expressed as the mean ± SD or median values and percentages. Statistical analyses were performed using the χ 2 test or Fisher s exact test for categorical variables and t-tests for numerical variables. The risk factors were evaluated by univariate and multivariate analyses with odds ratios (ORs) and 95% confidence intervals (95%CIs). A two-sided P-value < 0.05 was considered statistically significant. RESULTS Patient characteristics and surgical characteristics of EBD and PD In the study, 153 consecutive patients underwent EBD (ENBD or ERBD) prior to PD, of whom 102 (67.7%) underwent ENBD and 51 (33.3%) underwent ERBD. All patients were diagnosed by postoperative pathology, including 111 (72.6%) cases of papilla adenocarcinoma, 25 (16.3%) cases of distal cholangiocarcinoma and 17 (11.1%) cases of pancreatic head cancer. All patients presented with severe jaundice, and the levels of TB and ALT at admission were not significantly different between the ENBD and ERBD groups (P = and P = 0.241, respectively). There were no differences in age, gender or concomitant diseases (hypertension, cardiac disease, diabetes mellitus, acute pancreatitis and cholangitis) between the two groups (Table 1). The data regarding the EBD procedure showed that the EST and EBD durations were significantly different between the two groups (Table 1). EST was less frequently performed in the ENBD group than in the ERBD group (P = 0.039), and the mean EBD duration in the ENBD 5388 August 7, 2017 Volume 23 Issue 29

147 Zhang GQ et al. Outcomes of PEBD prior to PD Table 1 Demographic and clinical characteristics of patients who underwent endoscopic biliary drainage (endoscopic nasobiliary drainage and endoscopic retrograde biliary drainage) prior to pancreaticoduodenectomy n (%) Variable ENBD (n = 102) ERBD (n = 51) P value Age (yr) ± ± Gender (Male) 58 (56.9) 29 (56.9) Concomitant diseases Hypertension 9 (8.8) 5 (9.8) Cardiac disease 16 (15.7) 6 (11.8) Diabetes mellitus 22 (21.6) 13 (25.5) Anemia 39 (38.2) 24 (47.1) Hypoproteinemia 31 (30.4) 20 (39.2) Acute pancreatitis 6 (5.9) 4 (7.8) Acute cholangitis 7 (6.9) 7 (13.7) Malignant disease Papilla adenocarcinoma 70 (68.7) 41(80.4) Distal cholangiocarcinoma 19 (18.6) 6 (11.8) Pancreatic carcinoma 13 (12.7) 4 (7.8) ALT at admission (IU/L) ± ± TB at admission (µmol/l) ± ± Data of EBD EST 48 (47.1) 33 (64.7) Length of biliary stricture (cm) 1.55 ± ± EBD duration (d) ± ± Data of PD Operative time (min) ± ± Intraoperative bleeding (ml) ± ± Blood transfusion 45 (44.1) 21 (41.2) Pancreas texture (soft) 56 (54.9) 22 (43.1) Diameter of pancreatic duct (mm) 3.35 ± ± Diameter of common bile duct (cm) 1.73 ± ± Total hospital stay (d) ± ± Postoperative hospital stay (d) ± ± Total expenditure (USD) ± ± EBD: endoscopic biliary drainage; ENBD: endoscopic nasobiliary drainage; EST: Endoscopic sphincterotomy; ERBD: endoscopic retrograde biliary drainage; PD: Pancreaticoduodenectomy. group was shorter than that in ERBD group (P = 0.036). The mean length of biliary stricture was not significantly different between the two groups (P = 0.849). There were no differences in the procedure of PD between the two groups, such as operative time, intraoperative bleeding, blood transfusion, pancreatic texture, and the diameter of the pancreatic duct and common bile duct (Table 1). Finally, the total expenditure, total hospital stay and postoperative hospital stay were not significantly different between the two groups (Table 1). Changes in the levels of TB and ALT between the two groups The level of TB at admission was not significantly different between the ENBD and ERBD groups ( ± µmol/l and ± µmol/l, respectively; P = 0.667). After EBD, the level of TB at 1 d before PD was obviously lower in all patients in the two groups, and the extent of the TB decrease in the ENBD group was less than that in the ERBD group (96.45 ± µmol/l and ± µmol/l, respectively; P = 0.004). Similarly, the level of TB decreased more slowly in the ENBD group than in the ERBD group after PD (42.16 ± µmol/l and ± µmol/l, respectively; P = 0.014) (Table 2, Figure 1A). The level of ALT at admission was not significantly different between the ENBD and ERBD groups ( ± IU/L and ± IU/L, respectively; P = 0.241). After EBD, the level of ALT at 1 d before PD decreased more slowly in the ENBD group than in the ERBD group (72.63 ± IU/L and ± IU/L, respectively; P = 0.000). However, the level of ALT in the ENBD group decreased as rapidly as that in the ERBD group after PD (35.49 ± IU/L and ± IU/L, respectively; P = 0.872) (Table 2, Figure 1B). Procedure-related complications of EBD and postoperative complications of PD between the two groups After EBD, the rate of EBD procedure-related cholangitis was significantly lower in the ENBD group than in the ERBD group (7.8% vs 23.5%, P = 0.007); however, there was no difference in EBD dysfunction, EBD procedure-related pancreatitis or other adverse events between the two groups (Table 3). The postoperative complications of PD between the two groups are shown in Table 3. The incidence of deep abdominal infection after PD was significantly lower in the ENBD group than in the ERBD group (24.5% vs 43.1%, P = 0.019), but there was no difference 5389 August 7, 2017 Volume 23 Issue 29

148 Zhang GQ et al. Outcomes of PEBD prior to PD Table 2 Changes in bilirubin and transaminase in patients who underwent endoscopic nasobiliary drainage or endoscopic retrograde biliary drainage prior to pancreaticoduodenectomy A ERND ERBD B ERND ERBD Variable ENBD ERBD P value TB at admission (µmol/l) ± ± ALT at admission (IU/L) ± ± TB at 1 d before PD (µmol/l) ± ± ALT at 1 d before PD (IU/L) ± ± TB at discharge (µmol/l) ± ± ALT at discharge (IU/L) ± ± Bilirubin (μmol/l) ALT (μmol/l) ENBD: endoscopic nasobiliary drainage; ERBD: endoscopic retrograde biliary drainage; PD: Pancreaticoduodenectomy; TB: total bilirubin; ALT: Alanine aminotransferase At admission At 1 d before PD Time At discharge 0.00 At admission At 1 d At before PD discharge Time in the incidence of wound infection or pulmonary infection (P = and P = 0.386, respectively). The Clavien-Dindo classification of complications was not significantly different between the two groups (58.8% vs 66.7%, P = 0.864). The rate of pancreatic fistula was not significantly different between the ENBD group and the ERBD group (33.3% vs 41.2%, P = 0.350), nor was the difference in the rate of biliary fistula (P = 1.000). The incidence of DGE and PPH as graded by the ISGPS between the two groups was not significantly different (P = and P = 0.523, respectively). The rate of reoperation in the ENBD group was not significantly different from that in the ERBD group (P = 1.000). Five (4.9%) patients in the ENBD group and three (5.9%) patients in the ERBD group died during the perioperative period, and there was no significant difference in the perioperative mortality rate (P = 1.000). Risk factors for deep abdominal infection after PD The preceding data revealed a significant difference in the incidence of deep abdominal infection between the ENBD and ERBD groups. We performed a univariate analysis to assess the 22 clinical factors of deep abdominal infection between the deep abdominal infection group and the no-deep abdominal infection group. The results showed that gender (male), length of biliary stricture ( 1.5 cm), diameter of pancreatic duct ( 3 mm), pancreas texture (soft) and EBD method (ERBD) were significant factors. Then, the independent risk factors for deep abdominal infection were identified by multivariate logistic regression analysis. Male gender (OR = 3.92; 95%CI: ; P = 0.002), soft pancreas texture (OR = 3.60; 95%CI: ; P = 0.009), length of biliary stricture ( 1.5 cm) (OR = 5.20; 95%CI: ; P = 0.000) and ERBD method (OR = 4.08; 95%CI: ; P = 0.002) were independent risk factors for deep abdominal infection after PD (Table 4). DISCUSSION Preoperative EBD was performed in patients with Figure 1 the decreases in bilirubin (A) and alanine aminotransferase (B) in patients who underwent endoscopic nasobiliary drainage or endoscopic retrograde biliary drainage prior to pancreaticoduodenectomy. ENBD: endoscopic nasobiliary drainage; ERBD: endoscopic retrograde biliary drainage; PD: Pancreaticoduodenectomy; ALT: Alanine aminotransferase. malignant distal biliary obstruction with severe jaundice and poor physical condition who were waiting for surgery and preoperative chemotherapy. There is no consensus on whether ENBD or ERBD is preferable prior to PD. In the clinic, surgeons perform ENBD or ERBD primarily based on personal opinion, the degree of bile duct stenosis, equipment conditions, hospital stay duration and economic costs. In the present study, we compared the effects of EBD, the procedurerelated complications of EBD, and the postoperative complications of PD between the two groups. ENBD and ERBD are both effective methods for decreasing the levels of TB and ALT, but ERBD had a better effect on biliary drainage and EBD duration compared to ENBD in the present study due to better tolerance by the patients. However, some studies have shown that the rate of ERBD dysfunction was higher than that of ENBD dysfunction [13,14]. Others have suggested that there was no difference in the rate of EBD dysfunction and the duration from PBD to the time of EBD dysfunction between the two groups [20]. The incidence of EBD dysfunction was associated with pancreatic cancer and the small diameter of the stent [20,21]. In the present study, we found no difference in EBD dysfunction between the ENBD and ERBD groups. This result may be explained by the fact that most of the patients who underwent EBD prior to PD had papilla adenocarcinoma (72.6%), and we typically used the large-diameter plastic stent (> 8 Fr) at our center. In the current study, the self-expandable metal stent seemed to be superior to a plastic stent due to the lower rate of dysfunction [22], but it is not often used because of the high price and lack of compelling evidence. Procedure-related cholangitis is the most common complication after EBD. Some studies have suggested that because ENBD is an external drainage procedure, 5390 August 7, 2017 Volume 23 Issue 29

149 Zhang GQ et al. Outcomes of PEBD prior to PD Table 3 Procedure-related complications of endoscopic biliary drainage and the postoperative complications of pancreaticoduodenectomy between the two groups n (%) Variable ENBD (n = 102) ERBD (n = 51) P value Complications of EBD EBD dysfunction 16 (15.7) 5 (9.8) Adverse events after EBD Pancreatitis 12 (11.8) 12 (23.5) Cholangitis 8 (7.8) 12 (23.5) Others 3 (2.9) 2 (3.9) Complications of PD Pancreatic fistula 34 (33.3) 21 (41.2) grade A 14 (13.7) 13 (25.5) grade B 16 (15.7) 7 (13.7) grade C 4 (3.9) 1 (2.0) Delayed gastric emptying 25 (23.6) 12 (23.5) grade A + B 14(12.8) 7 (13.7) grade C 11 (10.8) 5 (9.8) PPH 7 (6.9) 5 (9.8) grade A + B 6 (5.9) 3 (5.9) grade C 1 (1.0) 2 (3.9) Biliary fistula 2 (2.0) 1 (2.0) Deep abdominal infection 25 (24.5) 22 (43.1) Wound infection 17 (16.7) 10 (19.6) Pulmonary infection 11 (10.8) 8 (15.7) Reoperation 2 (2.0) 1 (2.0) Perioperative death 5 (4.9) 3 (5.9) Complication 60 (58.8) 34 (66.7) grade Ⅰ-Ⅱ 39 (38.2) 21 (41.2) grade Ⅲ 13 (12.8) 9 (17.6) grade Ⅳ-Ⅴ 8 (7.8) 4 (7.9) EBD: endoscopic biliary drainage; ENBD: endoscopic nasobiliary drainage; PPH: postpancreatectomy hemorrhage; ERBD: endoscopic retrograde biliary drainage; PD: Pancreaticoduodenectomy. it has a lower incidence of preoperative cholangitis than ERBD [14]. However, some researchers have not found significant differences between ENBD and ERBD in the incidence of EBD procedure-related cholangitis, pancreatitis and other complications [20]. In the present study, we showed that the rate of procedure-related cholangitis in the ERBD group was higher than that in the ENBD group. There are several possible explanations for this result. First, EST is more frequently performed in the ERBD group than in the ENBD group. Second, the intestinal contents, including gastrointestinal or external bacteria, run countercurrent to the pancreatic or bile duct past the Odyssey sphincter in ERBD, while the ENBD involves external drainage with less gastrointestinal or bile reflux. Although PBD has been widely performed at many centers, it was very difficult to identify the optimal EBD duration due to different PBD methods and the different sites of bile duct obstruction. ERBD is more comfortable than ENBD due to the absence of irritation from the nasobiliary catheter to the pharynx and larynx, and it is more easily tolerated by patients. Some studies have shown that the EBD duration in ERBD is longer than that in ENBD [23,24]. Many centers adhere to the 4-6 wk minimum PBD duration, but this protocol may not be universally appropriate because the long PBD duration may increase infectious morbidity and may not be adaptable to all cancers. We showed that a PBD duration < 2 wk was more beneficial for severely jaundiced patients with periampullary cancer than a long duration (> 2 wk); there were fewer drainagerelated complications and a shorter hospital stay observed in the cohort that experienced the short PBD duration [25]. In this study, the mean PBD duration was less than 2 wk between the ENBD and ERBD groups, and the PBD duration in the ENBD group was significantly shorter than that in the ERBD group. The reason for this is not clear, but it may be related to the higher incidence of procedure-related complications and the better tolerance by patients in the ERBD group, which might have contributed to a longer PBD duration in the ERBD group than in the ENBD group. Prospective randomized studies are required to identify the optimal drainage duration. Pancreatic fistula, DGE, biliary fistula, and deep abdominal infection are the most common postoperative complications of PD, especially pancreatic fistula. There are various factors that contribute to the formation of postoperative complications after PD. Some studies have reported that PBD can increase the complications of PD, including pancreatic fistula and infectious complications. Most have shown that the incidence of wound infection was significantly higher in patients with PBD prior to PD than in the patients without PBD treatment before PD due to procedurerelated cholangitis and biliary bacterial translocation after PBD [26,27]. Gavazzi et al [27] reported that the overall incidence of the postoperative complications of PD was not significantly different between patients with stented and non-stented treatments. However, the rate of deep incisional surgical site infections was higher in the PBD group than the no-pbd group, and a difference in wound infection was not observed between the two groups; the most common bacterium in the bile or drain fluid was Enterococcus spp. Fujii et al [4] also reported that the cultures of bile or drainage fluid were more often positive in the ERBD group than in the ENBD group, and the incidence of abdominal abscess formation was significantly higher in the ERBD group than in the ENBD group. In the present study, we did not find that the overall complications of PD as graded by the Clavien-Dindo classification were different between the ENBD group and the ERBD group; there was a significant difference in the incidence of deep abdominal infection but not wound infection or pulmonary infection. The evidence shows that the infection complications of PD are important factors affecting the treatment of EBD. We also found that gender (male), pancreas texture (soft), the length of the biliary stricture ( 1.5 cm), and ERBD method were independent risk factors for deep abdominal infection according to univariate and multivariate analyses in the present study. We have several possible explanations for these results. Some researchers have found that male gender is 5391 August 7, 2017 Volume 23 Issue 29

150 Zhang GQ et al. Outcomes of PEBD prior to PD Table 4 Univariate and multivariate analyses of the risk factors for deep abdominal infection after pancreaticoduodenectomy Variable Univariate Multivariate OR (95%CI) P value OR (95%CI) P value Age ( 57 yr) 0.99 ( ) Gender (Male) 2.27 ( ) ( ) Hypertension 0.89 ( ) Cardiac disease 1.06 ( ) Diabetes mellitus 1.72 ( ) Anemia 0.65 ( ) Hypoproteinemia 1.05 ( ) Acute pancreatitis 1.55 ( ) Acute cholangitis 1.28 ( ) Malignant disease (pancreatic carcinoma) 0.60 ( ) TB at admission ( 200 µmol/l) 0.85 ( ) ALT at admission ( 200 IU/L) 1.91 ( ) ERBD method 2.34 ( ) ( ) EST 0.90 ( ) Length of biliary stricture ( 1.5 cm) 3.89 ( ) ( ) EBD duration ( 12 d) 0.91 ( ) Operative time ( 380 min) 0.72 ( ) Intraoperative bleeding ( 600 ml) 0.66 ( ) Blood transfusion 0.85 ( ) Pancreas texture (soft) 3.20 ( ) ( ) Diameter of pancreatic duct ( 3 mm) 2.11 ( ) ( ) Diameter of common bile duct (> 1.5 cm) 1.52 ( ) EST: Endoscopic sphincterotomy; EBD: endoscopic biliary drainage; ERBD: endoscopic retrograde biliary drainage; TB: total bilirubin; ALT: Alanine aminotransferase. a risk factor for pancreatic fistula [28], and the higher rate of pancreatic fistula may increase infectious complications. Similarly, some studies have suggested that the soft pancreas texture is the most important independent risk for pancreatic fistula after PD [29,30]. The length of the biliary stricture may increase the difficulty of the endoscopic retrograde cholangiopancreatography (ERCP) and prolong the operative time, which can cause procedure-related cholangitis or bacterial translocation. Finally, ERBD was identified as a risk factor for deep abdominal infection; however, prospective randomized studies are required to identify the ERBD as a risk factor for deep abdominal infection. Meanwhile, the results suggest that preoperative EBD via ERBD should be selectively performed in jaundiced patients with high risk factors for infection. Additionally, the ERBD procedure and stent materials should be improved. There are several limitations to this study. First, due to the retrospective design, the data may not be fully convincing. Second, the study should have included bacterial culture and antibiotic sensitivity tests. Third, a prospective randomized trial will be required to identify ERBD method and length of the biliary stricture as risk factors for infectious complications after PD. In conclusion, ENBD and ERBD are both effective biliary drainage methods for patients with malignant distal biliary obstruction. ERBD is superior to ENBD in terms of patient tolerance and the effect of biliary drainage, but it increases the risk of EBD procedurerelated cholangitis and deep abdominal infection after PD. Therefore, ENBD is the optimal method for patients with malignant distal biliary obstruction prior to PD. COMMENTS Background Malignant distal biliary obstruction can lead to obstructive jaundice, and it is caused by periampullary carcinoma, pancreatic carcinoma, and other malignant diseases. Pancreaticoduodenectomy (PD) is recognized as the curative treatment for malignant distal biliary obstruction. Preoperative biliary drainage (PBD) can reduce serum bilirubin levels, which may improve the outcomes of surgical treatment. PBD is used at many centers to improve the preoperative state of patients with hyperbilirubinemia or cholangitis. EBD is superior to PTBD for the treatment of malignant distal biliary obstruction prior to PD because PTBD is more invasive and has a higher rate of complication, a higher incidence of catheter tract metastasis, and poorer long-term survival. It remains unknown whether endoscopic nasobiliary drainage (ENBD) or endoscopic retrograde biliary drainage (ERBD) is more beneficial for patients with malignant distal biliary obstruction prior to PD. Research frontiers The curative treatment for patients with malignant distal biliary obstruction is PD. However, despite considerable improvements in surgery and perioperative management, the incidence of complications and postoperative mortality after PD remains high due to severe jaundice and poor preoperative state. This study evaluated the outcomes of preoperative EBD via ENBD and ERBD and the risk factors for deep abdominal infection after PD. Innovations and breakthroughs Both ENBD and ERBD are effective methods for biliary drainage in patients with malignant distal biliary obstruction and severe jaundice. However, the rate of EBD procedure-related cholangitis was significantly higher in the ERBD group than in the ENBD group, and the incidence of deep abdominal infection after PD was significantly higher in the ERBD group than in the ENBD group. Male gender, soft pancreas texture, the length of the biliary stricture and ERBD method were independent risk factors for deep abdominal infection after PD August 7, 2017 Volume 23 Issue 29

151 Zhang GQ et al. Outcomes of PEBD prior to PD Applications Although ERBD is superior to ENBD in terms of patient tolerance and the effect of biliary drainage, the ERBD method has a high rate of EBD procedure-related complications and is an independent risk factor for deep abdominal infection after PD. Therefore, preoperative endoscopic biliary drainage via ERBD should be selectively performed in jaundiced patients with high risk factors for infection. Additionally, the ERBD procedure and stent materials should be improved. Terminology PD is recognized as the curative treatment for malignant distal biliary obstruction that is caused by periampullary carcinoma, pancreatic carcinoma and other malignant diseases. EBD can be performed by ENBD with a nasobiliary catheter or ERBD with a plastic stent. Peer-review This study is well written and worthy of publication. REFERENCES 1 Sauvanet A, Boher JM, Paye F, Bachellier P, Sa Cuhna A, Le Treut YP, Adham M, Mabrut JY, Chiche L, Delpero JR; French Association of Surgery. Severe Jaundice Increases Early Severe Morbidity and Decreases Long-Term Survival after Pancreaticoduodenectomy for Pancreatic Adenocarcinoma. J Am Coll Surg 2015; 221: [PMID: DOI: /j.jamcoll surg ] 2 Povoski SP, Karpeh MS Jr, Conlon KC, Blumgart LH, Brennan MF. Association of preoperative biliary drainage with postoperative outcome following pancreaticoduodenectomy. Ann Surg 1999; 230: [PMID: ] 3 van der Gaag NA, Rauws EA, van Eijck CH, Bruno MJ, van der Harst E, Kubben FJ, Gerritsen JJ, Greve JW, Gerhards MF, de Hingh IH, Klinkenbijl JH, Nio CY, de Castro SM, Busch OR, van Gulik TM, Bossuyt PM, Gouma DJ. Preoperative biliary drainage for cancer of the head of the pancreas. N Engl J Med 2010; 362: [PMID: DOI: /NEJMoa ] 4 Fujii T, Yamada S, Suenaga M, Kanda M, Takami H, Sugimoto H, Nomoto S, Nakao A, Kodera Y. Preoperative internal biliary drainage increases the risk of bile juice infection and pancreatic fistula after pancreatoduodenectomy: a prospective observational study. Pancreas 2015; 44: [PMID: DOI: /MPA ] 5 Barauskas G, Urbonas K, Smailyte G, Pranys D, Pundzius J, Gulbinas A. Preoperative Endoscopic Biliary Drainage May Negatively Impact Survival Following Pancreatoduodenectomy for Ampullary Cancer. Dig Surg 2016; 33: [PMID: DOI: / ] 6 Macías N, Sayagués JM, Esteban C, Iglesias M, González LM, Quiñones-Sampedro J, Gutiérrez ML, Corchete LA, Abad MM, Bengoechea O, Muñoz-Bellvis L. Histologic Tumor Grade and Preoperative Bilary Drainage are the Unique Independent Prognostic Factors of Survival in Pancreatic Ductal Adenocarcinoma Patients After Pancreaticoduodenectomy. J Clin Gastroenterol 2017; Epub ahead of print [PMID: DOI: /MCG ] 7 Takahashi Y, Nagino M, Nishio H, Ebata T, Igami T, Nimura Y. Percutaneous transhepatic biliary drainage catheter tract recurrence in cholangiocarcinoma. Br J Surg 2010; 97: [PMID: DOI: /bjs.7228] 8 Inamdar S, Slattery E, Bhalla R, Sejpal DV, Trindade AJ. Comparison of Adverse Events for Endoscopic vs Percutaneous Biliary Drainage in the Treatment of Malignant Biliary Tract Obstruction in an Inpatient National Cohort. JAMA Oncol 2016; 2: [PMID: DOI: /jamaoncol ] 9 Strom TJ, Klapman JB, Springett GM, Meredith KL, Hoffe SE, Choi J, Hodul P, Malafa MP, Shridhar R. Comparative long-term outcomes of upfront resected pancreatic cancer after preoperative biliary drainage. Surg Endosc 2015; 29: [PMID: DOI: /s ] 10 Komaya K, Ebata T, Fukami Y, Sakamoto E, Miyake H, Takara D, Wakai K, Nagino M; Nagoya Surgical Oncology Group. Percutaneous biliary drainage is oncologically inferior to endoscopic drainage: a propensity score matching analysis in resectable distal cholangiocarcinoma. J Gastroenterol 2016; 51: [PMID: DOI: /s ] 11 Miura F, Sano K, Wada K, Shibuya M, Ikeda Y, Takahashi K, Kainuma M, Kawamura S, Hayano K, Takada T. Prognostic impact of type of preoperative biliary drainage in patients with distal cholangiocarcinoma. Am J Surg 2017; Epub ahead of print [PMID: DOI: /j.amjsurg ] 12 Uemura K, Murakami Y, Satoi S, Sho M, Motoi F, Kawai M, Matsumoto I, Honda G, Kurata M, Yanagimoto H, Nishiwada S, Fukumoto T, Unno M, Yamaue H. Impact of Preoperative Biliary Drainage on Long-Term Survival in Resected Pancreatic Ductal Adenocarcinoma: A Multicenter Observational Study. Ann Surg Oncol 2015; 22 Suppl 3: S1238-S1246 [PMID: DOI: /s ] 13 Sasahira N, Hamada T, Togawa O, Yamamoto R, Iwai T, Tamada K, Kawaguchi Y, Shimura K, Koike T, Yoshida Y, Sugimori K, Ryozawa S, Kakimoto T, Nishikawa K, Kitamura K, Imamura T, Mizuide M, Toda N, Maetani I, Sakai Y, Itoi T, Nagahama M, Nakai Y, Isayama H. Multicenter study of endoscopic preoperative biliary drainage for malignant distal biliary obstruction. World J Gastroenterol 2016; 22: [PMID: DOI: /wjg.v22.i ] 14 Lin H, Li S, Liu X. The safety and efficacy of nasobiliary drainage versus biliary stenting in malignant biliary obstruction: A systematic review and meta-analysis. Medicine (Baltimore) 2016; 95: e5253 [PMID: DOI: /MD ] 15 Bassi C, Dervenis C, Butturini G, Fingerhut A, Yeo C, Izbicki J, Neoptolemos J, Sarr M, Traverso W, Buchler M; International Study Group on Pancreatic Fistula Definition. Postoperative pancreatic fistula: an international study group (ISGPF) definition. Surgery 2005; 138: 8-13 [PMID: DOI: / j.surg ] 16 Wente MN, Bassi C, Dervenis C, Fingerhut A, Gouma DJ, Izbicki JR, Neoptolemos JP, Padbury RT, Sarr MG, Traverso LW, Yeo CJ, Büchler MW. Delayed gastric emptying (DGE) after pancreatic surgery: a suggested definition by the International Study Group of Pancreatic Surgery (ISGPS). Surgery 2007; 142: [PMID: DOI: /j.surg ] 17 Wente MN, Veit JA, Bassi C, Dervenis C, Fingerhut A, Gouma DJ, Izbicki JR, Neoptolemos JP, Padbury RT, Sarr MG, Yeo CJ, Büchler MW. Postpancreatectomy hemorrhage (PPH): an International Study Group of Pancreatic Surgery (ISGPS) definition. Surgery 2007; 142: [PMID: DOI: /j.surg ] 18 Mangram AJ, Horan TC, Pearson ML, Silver LC, Jarvis WR. Guideline for Prevention of Surgical Site Infection, Centers for Disease Control and Prevention (CDC) Hospital Infection Control Practices Advisory Committee. Am J Infect Control 1999; 27: ; quiz ; discussion 96 [PMID: ] 19 Dindo D, Demartines N, Clavien PA. Classification of surgical complications: a new proposal with evaluation in a cohort of 6336 patients and results of a survey. Ann Surg 2004; 240: [PMID: ] 20 Sugiyama H, Tsuyuguchi T, Sakai Y, Nisikawa T, Miyazaki M, Yokosuka O. Preoperative drainage for distal biliary obstruction: endoscopic stenting or nasobiliary drainage? Hepatogastroenterology 2013; 60: [PMID: DOI: /hge12621] 21 Hashimoto S, Ito K, Koshida S, Kanno Y, Ogawa T, Masu K, Iwashita Y, Horaguchi J, Kobayashi G, Noda Y. Risk Factors for Post-Endoscopic Retrograde Cholangiopancreatography (ERCP) Pancreatitis and Stent Dysfunction after Preoperative Biliary Drainage in Patients with Malignant Biliary Stricture. Intern Med 2016; 55: [PMID: DOI: /internal medicine ] 22 Moole H, Jaeger A, Cashman M, Volmar FH, Dhillon S, Bechtold 5393 August 7, 2017 Volume 23 Issue 29

152 Zhang GQ et al. Outcomes of PEBD prior to PD ML, Puli SR. Are self-expandable metal stents superior to plastic stents in palliating malignant distal biliary strictures? A metaanalysis and systematic review. Med J Armed Forces India 2017; 73: [PMID: DOI: /j.mjafi ] 23 Hong SK, Jang JY, Kang MJ, Han IW, Kim SW. Comparison of clinical outcome and cost-effectiveness after various preoperative biliary drainage methods in periampullary cancer with obstructive jaundice. J Korean Med Sci 2012; 27: [PMID: DOI: /jkms ] 24 Huang X, Liang B, Zhao XQ, Zhang FB, Wang XT, Dong JH. The effects of different preoperative biliary drainage methods on complications following pancreaticoduodenectomy. Medicine (Baltimore) 2015; 94: e723 [PMID: DOI: / MD ] 25 Son JH, Kim J, Lee SH, Hwang JH, Ryu JK, Kim YT, Yoon YB, Jang JY, Kim SW, Cho JY, Yoon YS, Han HS, Woo SM, Lee WJ, Park SJ. The optimal duration of preoperative biliary drainage for periampullary tumors that cause severe obstructive jaundice. Am J Surg 2013; 206: [PMID: DOI: / j.amjsurg ] 26 Ngu W, Jones M, Neal CP, Dennison AR, Metcalfe MS, Garcea G. Preoperative biliary drainage for distal biliary obstruction and postoperative infectious complications. ANZ J Surg 2013; 83: [PMID: DOI: /j x] 27 Gavazzi F, Ridolfi C, Capretti G, Angiolini MR, Morelli P, Casari E, Montorsi M, Zerbi A. Role of preoperative biliary stents, bile contamination and antibiotic prophylaxis in surgical site infections after pancreaticoduodenectomy. BMC Gastroenterol 2016; 16: 43 [PMID: DOI: /s ] 28 Yamamoto Y, Sakamoto Y, Nara S, Esaki M, Shimada K, Kosuge T. A preoperative predictive scoring system for postoperative pancreatic fistula after pancreaticoduodenectomy. World J Surg 2011; 35: [PMID: DOI: /s x] 29 Gaujoux S, Cortes A, Couvelard A, Noullet S, Clavel L, Rebours V, Lévy P, Sauvanet A, Ruszniewski P, Belghiti J. Fatty pancreas and increased body mass index are risk factors of pancreatic fistula after pancreaticoduodenectomy. Surgery 2010; 148: [PMID: DOI: /j.surg ] 30 Callery MP, Pratt WB, Kent TS, Chaikof EL, Vollmer CM Jr. A prospectively validated clinical risk score accurately predicts pancreatic fistula after pancreatoduodenectomy. J Am Coll Surg 2013; 216: 1-14 [PMID: DOI: /j.jamcollsurg ] P- Reviewer: Altonbary A, Espinel J, Shih SC S- Editor: Gong ZM L- Editor: Wang TQ E- Editor: Li D 5394 August 7, 2017 Volume 23 Issue 29

153 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Clinical Trials Study ORIGINAL ARTICLE Phase Ⅰ clinical study of personalized peptide vaccination combined with radiotherapy for advanced hepatocellular carcinoma Jie Shen, Li-Feng Wang, Zheng-Yun Zou, Wei-Wei Kong, Jing Yan, Fan-Yan Meng, Fang-Jun Chen, Juan Du, Jie Shao, Qiu-Ping Xu, Hao-Zhen Ren, Ru-Tian Li, Jia Wei, Xiao-Ping Qian, Bao-Rui Liu Jie Shen, Li-Feng Wang, Zheng-Yun Zou, Wei-Wei Kong, Jing Yan, Fan-Yan Meng, Fang-Jun Chen, Juan Du, Jie Shao, Qiu-Ping Xu, Ru-Tian Li, Jia Wei, Xiao-Ping Qian, Bao-Rui Liu, Comprehensive Cancer Centre of Drum Tower Hospital, Medical School of Nanjing University, Clinical Cancer Institute of Nanjing University, Nanjing , Jiangsu Province, China Hao-Zhen Ren, Department of Hepatobiliary Surgery, Drum Tower Hospital, Medical School of Nanjing Universit-y, Nanjing , Jiangsu Province, China Author contributions: Shen J, Wang LF and Zou ZY contributed equally to this work; Shen J, Liu BR, Wang LF and Chen FJ were responsible for the study design and experiment adjustments; Shen J, Zou ZY, Du J, Xu QP and Meng FY performed the experiments, drafted the manuscript and conducted the statistical analysis; Li RT, Wang LF, Qian XP and Wei J collected the blood samples and clinical information of patients; All authors read and approved the final manuscript. Supported by National Natural Science Foundation of China, No ; Jiangsu Provincial Medical Youth Talent, No. QNRC ; and the Key Medical Science and Technology Development Project of Nanjing, No. ZKX Institutional review board statement: The study was reviewed and approved by the ethical review board of Comprehensive Cancer Centre of Drum Tower Hospital and by the Drum Tower Hospital ethical review board. Clinical trial registration statement: This study was registered at The registration identification number is ChiCTR-OIC Informed consent statement: All study participants, or their legal guardian, provided informed written consent prior to study enrollment. Conflict-of-interest statement: None declared. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Bao-rui Liu, MD, PhD, Comprehensive Cancer Centre of Drum Tower Hospital, Medical School of Nanjing University, Clinical Cancer Institute of Nanjing University, 321 Zhongshan Road, Nanjing , Jiangsu Province, China. baoruiliu@nju.edu.cn Telephone: Fax: Received: January 15, 2016 Peer-review started: January 16, 2016 First decision: February 9, 2017 Revised: February 25, 2017 Accepted: March 4, 2017 Article in press: March 6, 2017 Published online: August 7, 2017 Abstract AIM To assess the efficacy and safety of a new treatment modality, cellular immune therapy based on personalized peptide vaccination (PPV-DC-CTL) combined with radiotherapy, for treating advanced hepatocellular carcinoma (HCC). METHODS A total of nine patients with advanced HCC were enrolled. Multidisciplinary consultation confirmed that 5395 August 7, 2017 Volume 23 Issue 29

154 Shen J et al. personalized peptide vaccination in HCC all the patients definitely had no opportunity of surgery, because four patients had multiple liver metastases (the number of liver lesions > 3), one patient had liver metastases and portal vein tumor thrombosis, one patient had lung and bone metastases, two patients had liver and lung metastases and one patient had liver metastasis and peritoneal metastasis. Patients with metastasis were treated with precise radiotherapy combined with PPV-DC-CTL. RESULTS Following radiotherapy and one to three cycles of PPV-DC-CTL treatment, AFP levels were significantly decreased in six patients and imaging assessment of the lesions showed a partial response (PR) in three patients and stable disease in the other three patients. The response rate was 33% and disease control rate was 66%. This regimen was found to be safe and well tolerated. None of the patients developed liver or kidney side effects. Only one patient developed grade Ⅱ bone marrow suppression and the remaining patients had no significant hematological side effects. CONCLUSION Radiotherapy combined with PPV-DC-CTL provides a new therapeutic strategy for patients with advanced HCC, which is well tolerated, safe, feasible and effective. Key words: Personalized peptide vaccination; TOMO radiotherapy; Cytotoxic lymphocytes; Hepatocellular carcinoma The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Advanced hepatocellular carcinoma (HCC) is a challenging disease to treat because of its advanced stage at diagnosis and rapid progression. We developed a new treatment modality, cellular immune therapy based on personalized peptide vaccination combined with radiotherapy, to treat advanced HCC. It integrates personalized peptide vaccination in tumor immunotherapy, takes full advantages of the immune modulation of radiotherapy, promotes tumor cells to release antigens and results in a more effective therapeutic strategy with regard to local and systemic control. Shen J, Wang LF, Zou ZY, Kong WW, Yan J, Meng FY, Chen FJ, Du J, Shao J, Xu QP, Ren HZ, Li RT, Wei J, Qian XP, Liu BR. Phase Ⅰ clinical study of personalized peptide vaccination combined with radiotherapy for advanced hepatocellular carcinoma. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5395.htm DOI: i INTRODUCTION Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third leading cause of cancerrelated death worldwide [1]. The resection rate for HCC is approximately 10%-30% and the overall prognosis is very poor with a 5-year survival rate of 5%-6% [2]. Even worse, the recurrence rate is high after radical resection. In addition to surgery, radiofrequency ablation, transcatheter arterial chemoembolization (TACE), microwave ablation, cryoablation, radioactive seed implantation, high-intensity focused ultrasound, radiation therapy, chemotherapy and targeted drugs are available for patients with unresectable tumors; however, the efficacy of these treatments is limited and the long-term prognosis in these patients is still poor [3]. Moreover, serious side effects induced by treatments such as TACE, chemotherapy and targeted drugs make it less likely for patients to receive longterm treatment with these therapies. Due to the success of immunotherapy in other tumor types, especially melanoma, it has been used with high expectation in HCC treatment [4]. The liver, as a metabolizing organ and immune organ, has unique characteristics and patients with HCC present with special anti- and pro-tumor responses during the development of this malignancy [4-6]. Currently, based on the tumor-associated antigens (TAAs) identified in different tumors, many cancer vaccination strategies have been investigated [7,8]. However, therapeutic vaccines for HCC are still unavailable, although the application of prophylactic vaccines, including the hepatitis B virus vaccine, has been reported to decrease the prevalence of HCC. Numerous factors hinder tumor vaccine research, which are mainly associated with the way the host immune system is stimulated to kill cancer cells. Shortage of TAAs or tumor specific antigens is the most important among these factors [9]. Recently, personalized peptide vaccination (PPV), a novel immunotherapeutic approach based on a specific pool of peptides, was introduced. The pool of peptides includes all information on the personal human leukocyte antigen class 1A type (HLA class 1A) and the pre-existing immunity of the host before vaccination. host before vaccination (Figure 1). A maximum of four HLA class 1A-matched peptides were selected from this pool and used for the PPV [7]. Compared with other methods of immunotherapy, the PPV has several advantages. First, it increases the possibility of avoiding both tumor heterogeneity and immunological diversity. Second, the vaccine contains personalized antigens with pre-existing immunity which can trigger antigen specific memory T cells to produce rapid and strong secondary immune responses. Moreover, an important characteristic of PPV is that it activates cytotoxic lymphocytes (CTL), which have stronger antitumor cytotoxicity, higher proliferative ability and more cytolytic activity than lymphokineactivated killer cells in vitro and in vivo. Recent studies have suggested that immunotherapy with cytotoxic lymphocytes plays an important role in preventing HCC recurrence and metastasis [4-6] August 7, 2017 Volume 23 Issue 29

155 Shen J et al. personalized peptide vaccination in HCC PHA BRCA2-1 CTRL BRCA2-2 NOTCH2 BCR PTCH1 MC1R Pt 06 Count HLA-A02 P2 IFN-γ spots/10 5 cells Figure 1 Selection personalized peptide from the peptide candidate library by peptide-specific IFN-γ production assay in consideration of the pre-existing host immunity. a P < 0.05, b P < No Ag PHA NOTCH2 p.a21t-1 a NOTCH2 p.a21t-2 a a a NOTCH2 p.a21t-3 PTCH1 p.t1195s TEK p.1148t BRCA2 p.n991d-1 BRCA2 p.n991d-2 BRCA2 p.n289h TSC1 p.m271t-1 b a a TSC1 p.m271t-2 BCR p.d1062n MC1R p.i120t TEK p.v600l FANCE p. R89L FANCE p. I877L KRAS G12D KRAS G12V Table 1 Characteristics of all the patients Patients Age Sex BCLC stage HK Tumor site(s) Radiotherapy target Dose of radiotherapy Cycle(s) of PPV-DC-CTL P1 66 Male B ⅢB Liver Partial liver mass PGTV 5 Gy*10f; PTV 2.5 Gy*10f 3 P2 56 Female B ⅢB Liver Partial liver mass PGTV 5 Gy*10f; PTV 2.5 Gy*10f 3 P3 54 Male C IVa Liver and portal vein Portal vein tumor thrombosis PGTV 5 Gy*10f; PTV 2.5 Gy*10f 2 tumor thrombosis P4 37 Male C Ⅳa Bone and lung Bone metastasis PGTV 4 Gy*10f; PTV 3 Gy*10f 3 P5 56 Male C Ⅳa Liver and peritoneal Peritoneal metastasis PTV 0.5 Gy BID *2f 2 metastases P6 45 Male B ⅢB Liver P7 43 Male B ⅢB Liver Partial liver mass PGTV 5 Gy*10f; PTV 2.5 Gy*10f 3 P8 59 Male C Ⅳa Liver and lung Partial lung mass PGTV 5 Gy*10f; PTV 2.5 Gy*10f 1 P9 72 Male C Ⅳa Lung In order to improve the efficacy and reduce the side effects of such treatment, we conducted a phase Ⅰ clinical trial and treated unresectable HCC patients with radiation therapy combined with immunotherapy consisting of PPV peptides, dendritic cells (DC) and CTL (PPV- DC-CTL). We successfully developed a new PPV-based immunotherapeutic approach using a maximum of four HLA class 1A-matched peptides selected from the pooled peptides of the host. MATERIALS AND METHODS Patients A total of nine patients with advanced HCC were enrolled. Multidisciplinary consultation confirmed that all the patients had no opportunity of surgery, because four patients had multiple liver metastases ( the number of liver lesions > 3), one patient had liver metastases and portal vein tumor thrombosis, one patient had lung and bone metastases, two patients had liver and lung metastases and one patient had liver metastasis and peritoneal metastasis (Table 1). Every patient has been informed of the study protocol and signed an informed consent form prior to the study. This clinical trial was approved by the Drum Tower Hospital ethical review board. Treatment schedule Radiotherapy: Patients with liver metastasis, portal vein tumor thrombosis and pulmonary metastasis 5397 August 7, 2017 Volume 23 Issue 29

156 Shen J et al. personalized peptide vaccination in HCC PPV-DC CTL Unmatured DC PBMC collection Subcutaneous injection PPV-loaded Maturation promoting DC + lymphocyte matured DC Transinfusion CTL activation CTL Figure 2 Time schedule of collection of peripheral blood mononuclear cells and transfusion of DC-CTL. PPV: Personalized peptide vaccination; DC: dendritic cells; CTL: Cytotoxic lymphocytes; PBMC: Peripheral blood mononuclear cells. were treated with precise radiotherapy [planning gross target volume (PGTV), ten fractions at 5 Gy each; planning target volume (PTV), ten fractions at 2.5 Gy each] combined with PPV-DC-CTL; patients with bone metastasis were treated with precise radiotherapy of bone (PGTV, ten fractions at 4 Gy each; PTV, ten fractions at 3 Gy each) combined with PPV-DC-CTL; patients with peritoneal metastasis were treated with precise TomoTherapy of the peritoneum (PTV, two fractions at 0.5 Gy each, BID) combined with PPV-DC- CTL. Selection of PPV peptides: First, peptide candidate library, including mutated peptides and highly expressed peptides, was established according to the gene mutation and expression spectra of HCC and previous studies about PPV. Peptides for vaccination of every specific patient were selected from the peptide candidate library with the consideration of the preexisting immunity of the host before vaccination (Figure 1). The detailed procedure was described in references [7,9] and the personalized peptides for these nine patients are as follows: P1: CORE-18, MUC-12, KRAS-A02-G13D1, PSCA-76 P2: PI3KCA-A02-H1047L-1, CORE-35, WTP53-149, AFP-137 P3: EGFR-800, KRAS-A11-G13D, CYPB-84, CTNNB1- A11-S45F P4: KRAS11-12C, EGFR-54, AFP-403, Survivin28-80 P5: AFP-357, VEGFR2-169, KRAS-A11-12C, MRP P6: KRAS-A11-12D, CTNNB1-A11-41A, CTNNB1-A11- S45F, KRAS-A11-12R P7: SART3-109, CORE-18, PSCA-7, htert-540 P8: AFP-357, KRAS-A11-12D, VEGFR2-169, PSCA-776 P9: CTNNB1-A11-S45F, CTNNB11-41A, CTNNB11-45P, EGFR-54 Collection of peripheral blood mononuclear cells (PBMC) and transfusion of DC-CTL: PPV peptides were load on DC (D0), which were sorted from PBMC and then these DC were infused back to patients after culture for 7 d in vitro (D7). To obtain the CTL, we used PPV and PPV-DC to stimulate the T cells. In 12 to 15 days, these CTL were transfused to patients (D12-15) (Figure 2). The above steps were defined as one cycle and it was repeated every 21 d. Main outcome measures To assess the immune responses to and other effects of PPV, the levels of CD3 +, CD8 +, CD4 + T lymphocytes, natural killer (NK) cells and B lymphocytes were examined prior to blood collection and after CTL transfusion. Alphafetoprotein (AFP) test was performed once a cycle after vaccinations. Routine blood tests and liver and kidney function tests were performed once a cycle. Other side effects such as rash, fever and diarrhea were also monitored. Radiological evaluation Clinical response was evaluated by computed tomography scans and abdominal magnetic resonance imaging prior 5398 August 7, 2017 Volume 23 Issue 29

157 Shen J et al. personalized peptide vaccination in HCC Table 2 Clinical outcomes of the nine patients Patient Change of AFP AFP before treatment AFP after first cycle AFP after second cycle AFP after third cycle Radiological evaluation P PR P PR P PR P SD P SD P SD P PD P PD P PD AFP: Alpha-fetoprotein; PR: Partial response; SD: Stable disease; PD: Progressive disease A B Cycle 1 Cycle 2 Cycle 3 p1 p Cycle 1 Cycle 2 Cycle3 p3 p4 C Cycle 1 Cycle 2 p5 p6 Figure 3 Changes of alpha-fetoprotein levels in patients 1-6 before and after treament. A: AFP levels of patients 1 and 2; B: AFP levels of patients 3 and 4; C: AFP levels of patients 5 and 6. AFP: Alpha-fetoprotein. to vaccination and once every two cycles of therapy. The RESIST-based clinical response levels were assessed by partial response (PR), stable disease (SD) and progressive disease (PD). The percentage of patients with PR was defined as the response rate (RR) to treatment while PR plus SD was defined as the disease control rate (DCR). Statistical analysis Paired-samples t-test was used to compare the levels of CD3 +, CD8 +, CD4 + T lymphocytes, NK cells and B lymphocytes between prior to blood collection and after CTL transfusion. Statistical significance was set at P < Statistical analyses were performed using SPSS, version RESULTS Following radiotherapy and 1-3 cycles of PPV-DC-CTL treatment, AFP levels were significantly decreased in six patients and imaging assessment of the lesions showed a PR in three patients and SD in the other three patients. RR was 33% and DCR was 66% (Table 2). This regimen was found to be safe and well tolerated. None of the patients developed liver or kidney side effects. Only one patient developed grade 2 bone marrow suppression and the remaining patients had no significant hematological side effects. Only two patients developed grade Ⅰ rash and the remaining patients had no skin side effects. Six patients had low-grade fever (37-38 ) and none of the patients developed diarrhea (Table 3). As indicated in Figure 3, the levels of AFP were significantly decreased in patients 1 to 6 and radiological evaluation showed PR or SD. Radiation treatment had a partial effect in patient 1 for certain tumor lesions. However, due to their large size, radiation may not reach all tumor metastases in the liver. The liver masses within and out of the radiation field were both significantly reduced in size after combined radiotherapy 5399 August 7, 2017 Volume 23 Issue 29

158 Shen J et al. personalized peptide vaccination in HCC count Tube_03 P3 count Tube_04 P3 count HLA-A Tube_03 P2 HLA-A24 count Tube_04 P2 HLA A2 PE-A HLA A2 PE-A HLA Z4 FITC-A HLA Z4 FITC-A ) core-18 2) MUCI AFP ng/ml 118 ng/ml ng/ml ng/ml concentration of IFN-γ (ng/ml) ) KRAS02-13D1 4) PSCA AFP AFP ) 2) 3) 4) mutayion EBVHIVEBV HIV N A02+A24 peptide library library A02 A24 peptide O control Figure 4 Treatment outcome of patient 1. The liver mass within and out of the radiation field were both significantly decreased in size after treatment with a combination of radiotherapy and PPV-DC-CTL. AFP had a significant decline as well. and PPV-DC-CTL treatment (Figure 4). This result suggested that CTL-based immune therapy and radiotherapy together reduced tumor progression even in those patients who did not receive radiotherapy. Patient 4 had tumor metastases in T4 vertebra and the lung. After treatment with radiotherapy and PPV- DC-CTL, AFP significantly declined and chest pain was alleviated. This provided further evidence that the synergistic combination of radiotherapy and PPV-DC- CTL effectively controlled tumor lesions, even in the lung where radiotherapy was not administered (Figure 5). Four of nine patients completed three cycles of PPV-DC-CTL treatment, four patients completed two cycles and the remaining patient only received one cycle of treatment. Patient 3 did not continue the 3 rd cycle of PPV-DC-CTL treatment due to carcinoma emboli in the portal vein which was controlled following treatment. The patient was treated with sorafenib instead with improvement. This patient was diagnosed in April 2015 with the last follow-up in June Compared with the reported mean overall survival (OS) of patients with carcinoma emboli in the portal vein in previous studies, the survival time of this patient was much longer (14 mo vs 3 mo). Due to a decrease in tumor markers, patients 5 and 6 both completed the 2 nd cycle of treatment. Patient 5 received sorafenib 5400 August 7, 2017 Volume 23 Issue 29

159 Shen J et al. personalized peptide vaccination in HCC A01- Gate: P1 HLA-A02 HLA-A24 A01- Gate: P Count 200 Count PE-HLA-A02-A FITC-HLA-A24-A Concentration of IFN-γ (ng/ml) ) KRAS11-12C 2) EGFR-54 3) AFP-403 4) Survivin2B AFP ng/ml ng/ml 495 ng/ml ng/ml AFP AFP 0 1)2)3)4) A02 peptide library HIV NO A02 peptide control Figure 5 Treatment outcome of patient 4. Patient 4 was a case with tumor metastasis in T4 vertebra and the lung. After treatment with a combination of radiotherapy and PPV-DC-CTL, AFP had a significant decline and chest pain was relieved. Table 3 Side effects of radiotherapy combined with PPV-DC- CTL immunotherapy Grade 1 Grade 2 Grade 3 Grade 4 Constitutional symptom Fever Tumor pain Rash Diarrhea Respiratory Dyspnea Hypoxia Neurological CNS cerebrovascular ischemia Blood/bone marrow Anemia Neutropenia Lymphocytopenia Thrombocytopenia Metabolic and laboratory AST elevation ALT elevation Scr elevation BUN elevation instead and patient 6 received traditional Chinese medicine. To date, these two patients are still alive and their OS is over 10 mo. Patient 8 dropped out of the clinical trial due to a rise in tumor markers after the 1 st cycle. Patient 9 did not continue treatment due to the development of rash. However, compared with pretreatment, patients 8 and 9 improved after PPV- DC-CTL treatment. In addition, cellular immune responses specific to the treatment, including the levels of CD3 +, CD8 +, CD4 +, NK cells and B lymphocytes, were analyzed in blood samples before and after CTL transfusion at each cycle. It was found that CD3 +, CD8 + cytotoxic T lymphocytes and NK cells increased after CTL transfusion (P < 0.05), suggesting the possibility of immune activation (Table 4, Figure 6). However, B lymphocytes were decreased and CD4 + cytotoxic T lymphocytes showed no significant change. DISCUSSION To the best of our knowledge, this is the first report of the application and outcome of radiotherapy combined with PPV-DC-CTL for the treatment of advanced HCC. In the nine patients included in this study, this regimen was well tolerated without serious side effects and achieved good disease control, with an RR of 33% and a DCR of 66%, which was significantly better than those of TACE, sorafenib and chemotherapy [10]. It has been hypothesized that radiotherapy may successfully immunize some patients against cancer, converting the irradiated tissue into an in situ vaccine and endowing the host with a set of new and powerful 5401 August 7, 2017 Volume 23 Issue 29

160 Shen J et al. personalized peptide vaccination in HCC Table 4 Changes of lymphocytes before and after treatment CD3 + CD4 + CD8 + NK B Before treatment 54.7% ± 18.5% 32.3% ± 11.9% 15.4% ± 7.0% 16.0% ± 9.3% 8.5% ± 5.3% After treatment 76.9% ± 16.1% a 37.9% ± 11.0% 32.0% ± 14.8% a 23.8% ± 14.8% a 2.8% ± 3.1% a a P < NK: Natural killer P P P3 CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK P P5 CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK P7 1 2 P P6 P9 PR SD PD CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK CD3 CD3/CD4 CD3/CD8 B NK Figure 6 Cellular immune responses specific to the treatment. CD3 +, CD8 + cytotoxic T lymphocytes and NK cells were increased after CTL transfusion in most cases, suggesting the possibility of immune activation. Other lymphocyte subsets had no significant changes. NK: Natural killer; PR: Partial response; SD: Stable disease; PD: Progressive disease. tools to control systemic disease [11]. Radiotherapy can be used as a more general immune response modifier, a novel tool to add to the arsenal of immunotherapy agents, but the response varies with the dose per fraction [12-16]. It is still unclear how the host-tumor relationship is affected by radiation, but it has been proved that when switching from a conventional schedule (2 Gy/fraction, 5 fractions a week) to a 5-10 Gy/fraction schedule, the immune effect is more significant [17]. This may be due to more rapid cell killing, more vascular damage and stronger inflammatory cytokine induction at higher radiation doses. Therefore, in this context, the radiotherapy regimen we chose for liver and lung metastases was 5 Gy/fraction, 5 fractions a week. This schedule improves local control and can enhance the immune effect. However, we chose 4 Gy/fraction, 5 fractions a week for bone metastasis in order to protect the spinal cord. For peritoneal metastasis, we chose 0.5 Gy/fraction, 2-fractions, BID, with the purpose of reducing side effects in the colon and increasing the immune effect. Based on pre-existing host immunity, a number of peptide antigens selected and screened from vaccine candidates are appropriate for this treatment regimen. In earlier studies on PPV, the assay of peptide specific IFN-γ production with an average cut-off level of 1 in cells was used to define pre-existing immunity. It was discovered that the enlargement and magnitude of CTL activation partly depend on the frequency of peptide specific CTL precursors from PBMC [7,18]. When CTL precursors are tested in PBMC before vaccination followed by the administration of specific peptides, a strong and rapid stimulation of CTL with potent clinical benefit is induced in specific patients as reported in some clinical trials of advanced cancer [19,20]. To date, a number of phase Ⅰ and Ⅱ clinical trials on PPV have been carried out [7]. All the trials mentioned above have indicated that PPV is well tolerated and 5402 August 7, 2017 Volume 23 Issue 29

161 Shen J et al. personalized peptide vaccination in HCC safe without serious adverse effects and can stimulate a much stronger immune response in certain patients. Assessed using the response evaluation criteria, some patients who received PPV exhibited objective clinical responses with boosted immune responses [20]. In the current study, we also designed and conducted a phase Ⅰ clinical trial involving patients with advanced HCC. First, we developed a new immunotherapeutic strategy of personalized peptide vaccination, according to the mutation spectrum of liver cancer and previous literature on vaccine peptides. We then stimulated strong activation of CTL with PPV peptide-loaded DC, which were transfused into patients to enhance the effect of immunotherapy. In addition, radiotherapy was administered to release vaccination in situ and to control the disease. Undoubtedly, PPV-DC-CTL and radiotherapy showed synergetic effects, especially in patients 1 and 4, as the tumors both within and out of the radiation field decreased in size or remained stable after treatment. Other advantages of this combined treatment were the avoidance of chemotherapyinduced side effects and overcoming the limitation of radiation therapy for extensive metastases. In conclusion, we have shown the potential of PPV as a novel treatment strategy for advanced HCC patients. Further randomized clinical trials are essential to verify the clinical benefit of PPV in HCC patients. In addition, accurate biomarkers for predicting patients who would benefit most from PPV-based treatment remain to be identified. COMMENTS Background Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third leading cause of cancer-related death worldwide. The resection rate for HCC is approximately 10%-30% and the overall prognosis is very poor with a 5-year survival rate of 5%-6%. Even worse, the recurrence rate is high after radical resection. In addition to surgery, radiofrequency ablation, transcatheter arterial chemoembolization (TACE), microwave ablation, cryoablation, radioactive seed implantation, high-intensity focused ultrasound, radiation therapy, chemotherapy and targeted drugs are available for patients with unresectable tumors; however, the efficacy of these treatments is limited and the long-term prognosis in these patients is still poor. Moreover, serious side effects induced by treatments such as TACE, chemotherapy and targeted drugs make it less likely for patients to receive long-term treatment with these therapies. The authors herein successfully developed a new PPV-based immunotherapeutic approach combined with radiotherapy, which was proved to be more effective and safe in HCC. Research frontiers Immunotherapy has been used with high expectation in HCC treatment. The liver, as a metabolizing organ and immune organ, has unique characteristics and patients with HCC present with special anti- and pro-tumor responses during the development of this malignancy. Currently, based on the tumorassociated antigens (TAA) identified in different tumors, many cancer vaccination strategies have been investigated. However, therapeutic vaccines for HCC are still unavailable, although the application of prophylactic vaccines, including the hepatitis B virus vaccine, has been reported to decrease the prevalence of HCC. Numerous factors hinder tumor vaccine research, which are mainly associated with the way the host immune system is stimulated to kill cancer cells. In the current study, the authors developed a new PPV-based immunotherapeutic approach combined with radiotherapy, which was proved to be more effective and safe in HCC. Innovations and breakthroughs To the best of our knowledge, this is the first report of the application and outcome of radiotherapy combined with PPV-DC-CTL for the treatment of advanced HCC. In the current study, the authors have shown the potential of PPV as a novel treatment strategy for advanced HCC patients. Further randomized clinical trials are essential to verify the clinical benefit of PPV in HCC patients. In addition, accurate biomarkers for predicting patients who would benefit most from PPV-based treatment remain to be identified. Applications Radiotherapy combined with PPV-DC-CTL provides a new therapeutic strategy for patients with advanced HCC, which is well tolerated, safe, feasible and effective. Terminology PPV-DC-CTL refers to personalized peptide vaccination. It is a novel immunotherapeutic approach based on a specific pool of peptides. The pool of peptides includes all information on the personal human leukocyte antigen class 1A type (HLA class 1A) and the pre-existing immunity of the host before vaccination. A maximum of four HLA class 1A-matched peptides were selected from this pool and used for the PPV. Compared with other methods of immunotherapy, the PPV has several advantages. First, it increases the possibility of avoiding both tumor heterogeneity and immunological diversity. Second, the vaccine contains personalized antigens with pre-existing immunity which can trigger antigen specific memory T cells to produce rapid and strong secondary immune responses. Moreover, an important characteristic of PPV is that it activates cytotoxic lymphocytes (CTL), which have stronger antitumor cytotoxicity, higher proliferative ability and more cytolytic activity than lymphokine-activated killer cells in vitro and in vivo. Peer-review This is an interesting study. The issue proposed by the authors is an important and potential method in the future. REFERENCES 1 Siegel RL, Miller KD, Jemal A. Cancer Statistics, CA Cancer J Clin 2017; 67: 7-30 [PMID: DOI: /caac.21387] 2 Buonaguro L, Petrizzo A, Tagliamonte M, Tornesello ML, Buonaguro FM. Challenges in cancer vaccine development for hepatocellular carcinoma. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 3 Dhir M, Melin AA, Douaiher J, Lin C, Zhen WK, Hussain SM, Geschwind JF, Doyle MB, Abou-Alfa GK, Are C. A Review and Update of Treatment Options and Controversies in the Management of Hepatocellular Carcinoma. Ann Surg 2016; 263: [PMID: DOI: /SLA ] 4 Prieto J, Melero I, Sangro B. Immunological landscape and immunotherapy of hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol 2015; 12: [PMID: DOI: /nrgastro ] 5 Lee JH, Lee JH, Lim YS, Yeon JE, Song TJ, Yu SJ, Gwak GY, Kim KM, Kim YJ, Lee JW, Yoon JH. Adjuvant immunotherapy with autologous cytokine-induced killer cells for hepatocellular carcinoma. Gastroenterology 2015; 148: e6 [PMID: DOI: /j.gastro ] 6 Hong YP, Li ZD, Prasoon P, Zhang Q. Immunotherapy for hepatocellular carcinoma: From basic research to clinical use. World J Hepatol 2015; 7: [PMID: DOI: /wjh.v7.i7.980] 7 Noguchi M, Sasada T, Itoh K. Personalized peptide vaccination: a new approach for advanced cancer as therapeutic cancer vaccine. Cancer Immunol Immunother 2013; 62: [PMID: DOI: /s ] 8 Yamada A, Sasada T, Noguchi M, Itoh K. Next-generation peptide vaccines for advanced cancer. Cancer Sci 2013; 104: [PMID: DOI: /cas.12050] 5403 August 7, 2017 Volume 23 Issue 29

162 Shen J et al. personalized peptide vaccination in HCC 9 Yamada T, Terazaki Y, Sakamoto S, Yoshiyama K, Matsueda S, Komatsu N, Waki K, Yamada A, Kawahara A, Kage M, Sugawara S, Yamashita Y, Sasada T, Takamori S, Itoh K. Feasibility study of personalized peptide vaccination for advanced non-small cell lung cancer patients who failed two or more treatment regimens. Int J Oncol 2015; 46: [PMID: DOI: /ijo ] 10 Qin S, Bai Y, Lim HY, Thongprasert S, Chao Y, Fan J, Yang TS, Bhudhisawasdi V, Kang WK, Zhou Y, Lee JH, Sun Y. Randomized, multicenter, open-label study of oxaliplatin plus fluorouracil/ leucovorin versus doxorubicin as palliative chemotherapy in patients with advanced hepatocellular carcinoma from Asia. J Clin Oncol 2013; 31: [PMID: DOI: / JCO ] 11 Formenti SC, Demaria S. Radiation therapy to convert the tumor into an in situ vaccine. Int J Radiat Oncol Biol Phys 2012; 84: [PMID: DOI: /j.ijrobp ] 12 Formenti SC, Demaria S. Combining radiotherapy and cancer immunotherapy: a paradigm shift. J Natl Cancer Inst 2013; 105: [PMID: DOI: /jnci/djs629] 13 Matsumura S, Wang B, Kawashima N, Braunstein S, Badura M, Cameron TO, Babb JS, Schneider RJ, Formenti SC, Dustin ML, Demaria S. Radiation-induced CXCL16 release by breast cancer cells attracts effector T cells. J Immunol 2008; 181: [PMID: ] 14 Golden EB, Chhabra A, Chachoua A, Adams S, Donach M, Fenton-Kerimian M, Friedman K, Ponzo F, Babb JS, Goldberg J, Demaria S, Formenti SC. Local radiotherapy and granulocytemacrophage colony-stimulating factor to generate abscopal responses in patients with metastatic solid tumours: a proof-ofprinciple trial. Lancet Oncol 2015; 16: [PMID: DOI: /S (15) ] 15 Klug F, Prakash H, Huber PE, Seibel T, Bender N, Halama N, Pfirschke C, Voss RH, Timke C, Umansky L, Klapproth K, Schäkel K, Garbi N, Jäger D, Weitz J, Schmitz-Winnenthal H, Hämmerling GJ, Beckhove P. Low-dose irradiation programs macrophage differentiation to an inos + /M1 phenotype that orchestrates effective T cell immunotherapy. Cancer Cell 2013; 24: [PMID: DOI: /j.ccr ] 16 Yang G, Kong Q, Wang G, Jin H, Zhou L, Yu D, Niu C, Han W, Li W, Cui J. Low-dose ionizing radiation induces direct activation of natural killer cells and provides a novel approach for adoptive cellular immunotherapy. Cancer Biother Radiopharm 2014; 29: [PMID: DOI: /cbr ] 17 Schaue D, Ratikan JA, Iwamoto KS, McBride WH. Maximizing tumor immunity with fractionated radiation. Int J Radiat Oncol Biol Phys 2012; 83: [PMID: DOI: / j.ijrobp ] 18 Hida N, Maeda Y, Katagiri K, Takasu H, Harada M, Itoh K. A simple culture protocol to detect peptide-specific cytotoxic T lymphocyte precursors in the circulation. Cancer Immunol Immunother 2002; 51: [PMID: DOI: / s ] 19 Mine T, Gouhara R, Hida N, Imai N, Azuma K, Rikimaru T, Katagiri K, Nishikori M, Sukehiro A, Nakagawa M, Yamada A, Aizawa H, Shirouzu K, Itoh K, Yamana H. Immunological evaluation of CTL precursor-oriented vaccines for advanced lung cancer patients. Cancer Sci 2003; 94: [PMID: ] 20 Tsuda N, Mochizuki K, Harada M, Sukehiro A, Kawano K, Yamada A, Ushijima K, Sugiyama T, Nishida T, Yamana H, Itoh K, Kamura T. Vaccination with predesignated or evidencebased peptides for patients with recurrent gynecologic cancers. J Immunother 2004; 27: [PMID: ] P- Reviewer: Facciorusso A, Kao JT, Streba LAM S- Editor: Ma YJ L- Editor: Wang TQ E- Editor: Wang S 5404 August 7, 2017 Volume 23 Issue 29

163 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) ORIGINAL ARTICLE Observational Study Transition clinic attendance is associated with improved beliefs and attitudes toward medicine in patients with inflammatory bowel disease Nancy Fu, Kevan Jacobson, Andrew Round, Kathi Evans, Hong Qian, Brian Bressler Nancy Fu, Brian Bressler, Division of Gastroenterology, Department of Medicine, University of British Columbia, Vancouver, BC V5Z 1M9, Canada Kevan Jacobson, Kathi Evans, Division of Gastroenterology, Hepatology and Nutrition, Department of Pediatrics, University of British Columbia, Vancouver, BC V6H 3V4, Canada Andrew Round, Faculty of Medicine, University of British Columbia, Vancouver, BC V6T 1Z3, Canada Hong Qian, Centre of Health Evaluation and Outcome Sciences, Vancouver, BC V6Z 1Y6, Canada Author contributions: Fu N and Bressler B designed the study; Fu N, Round A and Evans K distributed the questionnaires; Fu N and Round A collected data; Qian H analyzed data; Fu N, Jacobson K, Evans K and Bressler B interpreted and evaluated the data; Fu N drafted initial manuscript; Fu N, Jacobson K, Evans K and Bressler B critically revised the manuscript. Institutional review board statement: The study was reviewed and approved by Research Ethics Board of University of British Columbia. Informed consent statement: All study participants, or their legal guardians, provided informed written consent prior to study enrolment. Conflict-of-interest statement: All authors declare no conflicts of interest. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Nancy Fu, MD, Division of Gastroenterology, Department of Medicine, University of British Columbia, Gilbert Road, Richmond, BC V7C 5L9, Canada. nfu@interchange.ubc.ca Telephone: Fax: Received: January 8, 2017 Peer-review started: January 11, 2017 First decision: February 9, 2017 Revised: March 7, 2017 Accepted: May 19, 2017 Article in press: May 19, 2017 Published online: August 7, 2017 Abstract AIM To evaluated the differences in knowledge, adherence, attitudes, and beliefs about medicine in adolescents with inflammatory bowel disease (IBD) attending transition clinics. METHODS We prospectively enrolled patients from July 2012 to June All adolescents who attended a tertiarycentre-based dedicated IBD transition clinic were invited to participate. Adolescent controls were recruited from university-affiliated gastroenterology offices. Participants completed questionnaires about their disease and reported adherence to prescribed therapy. Beliefs in Medicine Questionnaire was used to evaluate patients attitudes and beliefs. Beliefs of medication overuse, harm, necessity and concerns were rated on a Likert 5405 August 7, 2017 Volume 23 Issue 29

164 Fu N et al. IBD transition clinic and attitudes toward medicine scale. Based on necessity and concern ratings, attitudes were then characterized as accepting, ambivalent, skeptical and indifferent. RESULTS one hundred and twelve adolescents were included and 59 attended transition clinics. Self-reported adherence rates were poor, with only 67.4% and 56.8% of patients on any IBD medication were adherent in the transition and control groups, respectively. Adolescents in the transition cohort held significantly stronger beliefs that medications were necessary (p = ). Approximately 20% of adolescents in both cohorts had accepting attitudes toward their prescribed medicine. However, compared to the control group, adolescents in the transition cohort were less skeptical of (6.8% vs 20.8%) and more ambivalent (61% vs 34%) (OR = 0.15; 95%CI: ; p = 0.02) to treatment. CONCLUSION Attendance at dedicated transition clinics was associated with differences in attitudes in adolescents with IBD. Key words: Inflammatory bowel disease; Adolescents; Transition; Beliefs; Knowledge; Attitudes The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Inflammatory bowel disease (IBD) transition clinics may improve care of adolescents. Comparing ones attended transition clinics to those didn t, this study assessed adolescents with IBD s self-reported adherence to prescribed therapy and evaluated their attitudes and beliefs using Beliefs in Medicine Questionnaire. Self-reported adherence rates were poor in both cohorts. Adolescents in the transition cohort held significantly stronger beliefs that medications were necessary. They were also less skeptical of and more ambivalent to prescribed treatments. Attendance at dedicated transition clinics was associated with differences in attitudes in adolescents with IBD. Fu N, Jacobson K, Round A, Evans K, Qian H, Bressler B. Transition clinic attendance is associated with improved beliefs and attitudes toward medicine in patients with inflammatory bowel disease. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5405.htm DOI: i INTRODUCTION Inflammatory bowel disease (IBD) is a chronic, idiopathic, immune-mediated illness that typically follows a relapsing and remitting course [1]. Pediatriconset IBD accounts for up to 25% of all IBD cases, and its natural history and health impacts can differ greatly from adult-onset IBD [2,3]. Adolescence is a critical period for physical, cognitive, emotional, and social development. Compared to their peers, adolescents with IBD often face additional challenges such as difficult decisions concerning therapeutic options, trouble with medication adherence, and potential anxiety surrounding health-related appointments and interventions [4]. Two commonly identified issues surrounding the transition of adolescents with IBD are this patient population s limited disease-specific knowledge and poor adherence to medical therapy [5,6]. These are important elements for the establishment of selfmanagement skills and protection against future disease flares. Many adult gastroenterologists feel the deficiencies in understanding among adolescents relating to their condition and treatment are prevalent and consequently represent a substantial barrier to successful transition [5,6]. Previous studies have demonstrated that adolescents with IBD could provide basic disease-related information such as their diagnosis and current medication; however, participants were unable to recall specifics pertaining to disease extent, medication side effects, previous surgery, and results of investigations [7,8]. Nonadherence to medical therapy in adolescents with IBD is reported to be very high, ranging from 50% to 75% [9-12]. Typical reasons for nonadherence to medication among adolescents with IBD include forgetfulness, feeling well, lack of time, interference with other activities, medication side effects, and complex medical regimens [9-12]. Medication nonadherence can lead to undesirable consequences such as disease flares, health deterioration, and increased healthcare utilization [13-16]. Important predictors of adherence to medical therapy are patients beliefs and attitudes toward medicine [17-22]. The aim of this study was to explore the attitudes toward, and beliefs about, medical therapy among adolescents with IBD. Additionally, this study compared the differences in disease-specific knowledge and adherence to medical therapy between adolescents who attended the IBD transition clinics and those who did not. MATERIALS AND METHODS Adolescent transition clinic British Columbia (BC) is the third largest province in Canada with a population of 4.4 million [23]. Ninetyfive percent of all children diagnosed with IBD in BC are treated at the BC Children s Hospital (BCCH), a tertiary-care academic hospital. An IBD transition clinic was established at BCCH in Annually, approximately 80 adolescents with IBD graduate from BCCH, typically at around 17 to 18 years of age. Adolescents selected to attend the transition clinics are usually those with a more complex disease course or those receiving anti-tumor necrosis factor (anti August 7, 2017 Volume 23 Issue 29

165 Fu N et al. IBD transition clinic and attitudes toward medicine TNF) agents. Many of them have disease phenotypes such as extensive or pancolitis; upper tract, extended small bowel involvement, stricturing or penetrating Crohn s disease (CD); or have required surgical resections. Adolescents who have had adverse effects or intolerances to conventional IBD medications are also chosen. Approximately half of the adolescents graduating from BCCH attended the transition clinics. Adolescents attending the IBD transition clinics were jointly assessed by adult and pediatric IBD specialists and nurses. Most adolescents, prior to transfer of care, attended the transition clinic up to twice in their last year at BCCH. The transition clinics served as the final summative clinical visits. During the transition clinic visits, medical/surgical histories, past/current medications, and future therapeutic plans of the patient were thoroughly reviewed. Both adult and pediatric IBD specialists discussed each patient in detail with each other and with the patient to establish a comprehensive plan. Adolescents were reminded of the importance of IBD medications, potential side effects of the medications, and the need for regular monitoring of blood work. Pediatric IBD nurse assisted in creating a one-page concise summary for the patients to take home after the clinic. Complete summaries were later prepared and provided to patients and the adult gastroenterologists who received the transfer of care. Another form of care transfer was direct referrals to adult gastroenterologist. Selected documents depicting patients diagnosis, therapies and progressions were sent to the receiving adult gastroenterologists along with a discharge/transfer summary from BCCH. The adolescents then attend regular adult gastroenterology clinics for consultation and meet their physicians at the appointment. Unlike direct care transfer, the transition clinics provide an intermediate step for the adolescents to become acquainted with the differences in practice styles between pediatric and adult settings. The transition clinic visit is longer but not as frequent as the usual adult gastroenterology appointment. Both pediatric and adult IBD nurses are present to give additional support. Although adolescents graduating from BCCH are typically referred to adult gastroenterologists based on geographical locations and their residence in BC, many adolescents attended the transitions clinics are preferentially referred to university-affiliated IBD specialists as opposed to community-based gastroenterologists. Study design We prospectively enrolled IBD patients from July 1 st, 2012 to June 30 th, All adolescents within 1 year of their attendance at the BCCH IBD transition clinics were invited to participate as the study cohort. Agedmatched patients who did not attend the transition clinics but were being treated at a university affiliated gastroenterology office served as the control cohort. Study invitation letters and web-linked questionnaires were delivered via secured personalized s to potential participants (73 transition and 75 control). Follow-up telephone calls, to provide further details or to clarify any questions, were placed to all adolescents interested in participating in the study. All available clinical charts were reviewed and compared with responses provided by the participants. All participants provided signed informed consent. The study received full institutional ethics approval. All participants completed an online questionnaire regarding their disease and their adherence to prescribed medical therapy (see Supplementary Table 1). Attitudes and beliefs about medical therapy were assessed using the Beliefs about Medicine Questionnaire (BMQ) (see Supplementary Table 2), a validated 17-question tool evaluating patient opinions on medical therapy [24,25]. The BMQ assesses both specific and general beliefs about medicine; specific beliefs include those relating to either necessity or concerns, while general beliefs include those relating to overuse or harm. Respondents indicate their degree of agreement with each statement about medicine on a five-point Likert scale (1 = strongly disagree, 5 = strongly agree). The BMQ has been used in various chronic diseases and recently in IBD [20,21,24], and has consistently demonstrated greater adherence to be associated with a stronger perception of necessity and fewer concerns relating to treatment [26]. Additionally, the BMQ allows for further analysis of patient attitudes toward medicine by delineation of respondents into one of 4 attitudinal groups: accepting (high necessity, low concerns), ambivalent (high necessity, high concerns), skeptical (low necessity, high concerns), or indifferent (low necessity, low concerns) [21,22]. Disease-specific knowledge among the adolescents was assessed by comparing responses provided on the questionnaire to information available in their clinical charts. If necessary, the patient s healthcare professionals were consulted for clarification. Level of basic knowledge such as the type of IBD (CD or ulcerative colitis, without specifying disease location) and previous gastrointestinal surgery (yes or no) was formally evaluated by comparing physician records and patient responses. Information on disease phenotypes and current IBD-specific medication (yes or no for mesalamines, immunomodulators, anti-tnf agents) was also collected. The general concern among healthcare professionals about the increased risks of loss to follow up in the adolescent population prompted us to collect the self-reported physician contact/follow up rate. Self-reported adherence to prescribed medical therapy was recorded and subsequently dichotomized by classifying those who were missing less than 30% of prescribed therapy as adherent. This cuff-off, as opposed to conventional 20%, was selected to account for previously observed high nonadherence rate in the adolescent population. Self-reporting of adherence was 5407 August 7, 2017 Volume 23 Issue 29

166 Fu N et al. IBD transition clinic and attitudes toward medicine Table 1 Demographics Transition Control P value n (%) or mean ± SD n (%) or mean ± SD Gender Female 23 (40.4) 31 (56.4) 0.13 Diagnosis CD 47 (79.7) 34 (64.2) 0.07 UC/IBDU 12 (20.3) 19 (35.8) Age (yr) At diagnosis 13.0 ± ± Current 19.7 ± ± Disease duration (yr) 6.9 ± ± Prior GI surgery 13 (22.0) 12 (21.8) 0.98 Medication 1 5-ASA 14 (25.0) 20 (37.0) 0.24 IM 17 (30.4) 12 (22.2) 0.33 Anti-TNF 6 (10.7) 6 (11.1) 1.00 Combination 13 (23.2) 5 (9.3) 0.07 Any 43 (76.8) 37 (68.5) 0.33 Regular blood work 45 (80.4) 30 (55.6) Subgroups in medication row denote patients receiving oral 5-ASA products, IM only, anti-tnf only, combination therapy (IM and anti- TNF) only, or any IBD medication; 2 Statistically significant. 5-ASA: 5-aminosalicylic acid; anti-tnf: Anti-tumour necrosis factor agents including infliximab and adalimumab; CD: Crohn s disease; IBDU: Inflammatory bowel disease unspecified; IM: Immunomodulators including methotrexate, 6-mercaptopurine, and azathioprine; UC: Ulcerative colitis. used for ease of data collection although it carries a known risk of overestimation [22,27,28]. The BMQ responses were examined in several ways, as per published literature [21,24,25]. The individual scores for each subclass (necessity, concerns, overuse, harm) were summed and analyzed as a continuous variable or a scaled score by dividing the summed value with the number of questions in each subclass. A higher score indicated stronger agreement with the scale constructs. A necessity-concerns differential was also calculated by subtracting the summed concerns score from the summed necessity score. A higher differential signified greater belief in the necessity of treatment. Finally, to explore attitudes toward medicine in a clinical meaningful way, we divided the patients into one of four attitudinal groups ( accepting, ambivalent, skeptical, or indifferent ) based on whether their scaled necessity and concerns scores were above or below midpoint (< 3 or 3). Self-reported medication adherence of participants was then correlated to their attitudes and beliefs. Comparisons between adolescents who attended the transition clinics and those did not were also performed. Statistical analysis Statistical analyses were conducted using SAS Version 9.2 (Cary, NC, United States). The sample size calculation determined that 42 participants per cohort was required in order to detect a 30% difference while assuming 40% nonadherence rate in the study cohort and bearing an 80% power. All statistical tests were two-sided with a 0.05 significance level. Continuous variables were summarized as means and standard deviations. Categorical variables were reported as counts and percentages. Comparisons between groups were conducted using two-sample t-test for continuous data and χ 2 or Fisher s exact test when appropriate for categorical data. Logistic regression modelling was performed to explore the association of transition clinic use with medication adherence. Attitudes toward medicine were analyzed with the use of a multinomial logistic regression model. Linear regression was conducted to assess the impact of the transition clinic on beliefs about medicine. All models were adjusted for prespecified confounding variables including age, gender, diagnosis, disease duration, surgical history, and medication use. RESULTS A total of 112 adolescents participated in the study. Of those, 59 attended transition clinics. The response rates were 81% and 71% for transition and control group, respectively. Most adolescents continued to have physician contact (with family physicians or adult gastroenterologists) after leaving the pediatric setting (transition vs control: 85.1% vs 87.3%). The predominant reasons for care discontinuation were difficulty obtaining accepting physicians and a belief that physician assessments were not needed. Demographic data were similar between cohorts (Table 1). However, the transition group had a higher proportion of patients with CD (79.7% vs 64.2%), and on both anti-tnf medication and immunomodulator therapy (23.2% vs 9.3%), compared to controls. Similar levels of disease-specific knowledge and selfreported adherence rates were found between cohorts (Table 2). Approximately 80% of the adolescents reported their basic knowledge (diagnosis and surgical history) in concordance with physician reports. Awareness of specific disease phenotype was similar in both transition and control groups (65.5% vs 60.4%; p = 0.69). Self-reported adherence to any medication was poor among adolescents with IBD in both transition and control groups (67.4% vs 56.8%). No significant difference was observed between the two groups on self-reported adherence (OR = 1.38; 95%CI: ; p = 0.54). The beliefs about and attitudes toward medicine among the adolescents were assessed using the BMQ. Adolescents in the transition cohort held significantly stronger beliefs that medications were necessary (3.4 vs 3.0, p = ), but had comparable concerns (3.2 vs 3.1, p = 0.29) toward those medications (Table 3). A higher necessity-concern differential was also noted in the transition cohort (0.2 vs -0.06, p = 0.11). The higher differential signifies a greater belief in the necessity of treatment. Both groups had comparable general beliefs (overuse or harm) about 5408 August 7, 2017 Volume 23 Issue 29

167 Fu N et al. IBD transition clinic and attitudes toward medicine High concerns Table 3 Beliefs about and attitudes toward medicine Low necessity Skeptical 7% vs 21% Indifferent 15% vs 23% P = 0.02 Low concerns Ambivalent 61% vs 34% Accepting 17% vs 23% High necessity Figure 1 Attitudes toward medicine in adolescents with inflammatory bowel disease (percentages denote proportion of adolescents who attended transition clinics vs control). Adolescents who attended the transition clinics were more ambivalent and less skeptical toward medicine. Overall, significant different composite attitudes were noted between the two groups of adolescents. Transition Control P value n (%) or mean ± SD n (%) or mean ± SD Beliefs about medicine 1 Specific Necessity 17.2 ± ± ± ± 0.8 Concern 16.1 ± ± ± ± 0.7 Differential 1.1 ± ± ± ± 0.9 General Overuse 9.7 ± ± ± ± 1.0 Harm 14.9 ± ± ± ± 0.7 Attitudes toward medicine 2 Accepting 10 (16.9) 12 (22.6) 0.45 Ambivalent 36 (61.0) 18 (34.0) Skeptical 4 (6.8) 11 (20.8) Indifferent 9 (15.3) 12 (22.6) 0.32 Composite Table 2 Disease-specific knowledge and self-reported adherence to prescribed medical therapy n (%) medicine. Overall, approximately 20% of adolescents had an accepting attitude toward their prescribed medication. However, the transition cohort was less likely to be skeptical (6.8% vs 20.8%) and more likely to be ambivalent (61% vs 34%) to their treatment compared to controls (OR = 0.15, 95%CI: ; P = 0.02) (Figure 1). DISCUSSION Transition Control P value Knowledge 1 Diagnosis 44 (78.6) 44 (80.0) 1.00 Prior GI surgery 50 (84.7) 49 (89.1) 0.49 Adherence 2 Medication 3 5-ASA 8 (57.1) 13 (65.0) 0.73 IM 10 (58.8) 7 (58.3) 1.00 Anti-TNF 5 (83.3) 3 (50.0) 0.55 Combination 13 (76.9) 4 (80.0) 1.00 Any 29 (67.4) 21 (56.8) 0.33 Regular blood work 31 (68.9) 18 (60.0) Knowledge is defined as concordant physician records and patient responses; 2 Adherence is defined as missing less than 30% of prescribed therapy; 3 Subgroups in medication row denote patients receiving oral 5-ASA products, IM only, anti-tnf only, combination therapy (IM and anti-tnf) only, or any IBD medication. 5-ASA: 5-aminosalicylic acid; anti-tnf: Anti-tumour necrosis factor agents including infliximab and adalimumab; IM: Immunomodulators including methotrexate, 6-mercaptopurine, and azathioprine. Appropriate transitioning of pediatric patients with IBD into an adult setting is an important and complex process. Common difficulties identified among adolescents with IBD include poor knowledge related to their disease and a lack of adherence to medical therapy [5,6]. 1 Results presented in each subcategory were summative (top) and scaled (bottom). Differential was calculated by subtracting concerns score from necessity score; 2 Four attitudinal groups were created after dichotomizing scaled necessity and concerns scores above or below midpoint (< 3 high or 3 low) giving: accepting (high necessity, low concerns), ambivalent (high necessity, high concerns), skeptical (low necessity, high concerns), and indifferent (low necessity, low concerns); 3 Statistically significant. Despite the potential for inflation of adherence rates due to self-reporting [27], we still observed rates as low as 56.8% for medication and 60% for blood work. These data are comparable to previously reported adherence rates of 50%-75% for adolescents with IBD [9-12]. Similarly, adherence rates among adolescents with other chronic diseases such as asthma and diabetes, as well as those who have undergone procedures where subsequent nonadherence to medication can greatly compromise treatment efficacy (e.g., hematopoietic stem cell transplant), are also reported to be low (40%-80%) [15,29,30]. Studies have investigated factors that may influence adherence rates in adolescents. Some modifiable aspects include lifestyle, medication regimen, social/ healthcare support, knowledge, beliefs, and attitudes [9,10,17,18,21,22,25,30-34]. A substantial proportion of adolescents in this study had general basic knowledge about their disease type. However, it was difficult to detect subtle and more refined differences in knowledge between the two groups. Similar to reports by Fishman et al [7] and Benchimol et al [8], we noted a limited number of adolescents who were aware of their disease location and/or phenotype. Compared to controls, slightly more adolescents in the transition cohort were better informed of their disease phenotype. This may be a result of more intense education and healthcare support provided [30,32-34]. Indeed, increased knowledge and awareness of disease has been associated 5409 August 7, 2017 Volume 23 Issue 29

168 Fu N et al. IBD transition clinic and attitudes toward medicine with better adherence in adolescents with other chronic diseases typically diagnosed in childhood (e.g., asthma) [30,34]. Attitudes and beliefs regarding medication are strong predictors of adherence to medical therapy [21,22,24-26]. Compared to controls, adolescents in the transition cohort showed significantly stronger beliefs about the necessity of medical therapy. They were also more ambivalent and less skeptical toward medication. Patients with IBD who have an accepting attitude have been found to be least likely to be nonadherent compared to those with one of the other three attitudes [21,22]. Augmented education sessions such as review on the importance of IBD medications, their side effects and the need for regular monitoring blood works provided in the transition clinics may contribute to the observed difference in attitudes. It is likely that adolescents attending the transition clinics are more aware of the necessity of medical therapy, but remain concerned about the potential side effects, leading to their ambivalent attitudes. Nonetheless, that our study did not demonstrate a significant difference between cohorts in adherence to therapy, suggests that other factors, together with beliefs and attitudes, influence adherence [9,10,17,18,21,22,25,30-34]. Therefore, clinicians not only should thoroughly review planned medical therapy with the adolescents but also explore other potential aspects such as finance, cultural practices, family and social stability that may impact adherence [9,10,17,32]. One potential limitation of this study was that the control cohort included patients from a universityaffiliated clinic, many of whom were treated by an IBD specialist and as such may have received education comparable to those in the transition group. Therefore, some of the observed differences may be diminished. Additionally, characteristics such as socioeconomic status, ethnicities and locations of residence (urban vs. rural) may affect the adolescents beliefs and were not collected in this study. To our knowledge, this is the first study assessing the impact of transition clinics on the knowledge, attitudes, and beliefs of medical therapy in adolescent patients with IBD. This study also explored the differences in adherence rates. Future studies should focus on determining ways to improve knowledge and adherence among adolescents, as well as the impact of transition clinics on long-term outcomes. Moreover, healthcare professionals should work on determining factors that are essential to conducting successful transition clinics. In conclusion, adolescents with IBD were found to have low overall adherence to medical therapy, despite exhibiting adequate general knowledge about their disease. Attendance at dedicated transition clinics was associated with adolescents who held a stronger belief that medical therapies were necessary and carried attitudes that were more ambivalent (high necessity, high concerns), but less skeptical (low necessity, high concerns) toward their prescribed therapies. COMMENTS Background Commonly identified issues surrounding the transition of adolescents with inflammatory bowel disease (IBD) are this patient population s limited diseasespecific knowledge and poor adherence to medical therapy. Medication nonadherence can lead to undesirable consequences. Important predictors of adherence to medical therapy are patients beliefs and attitudes toward medicine. Research frontiers Adolescence is a vulnerable period. Determining key factors associated with successful transition of adolescents with IBD to adult service may minimize complications. Previous studies have demonstrated that adolescents with IBD could only provide basic disease-related information. Nonadherence to medical therapy in adolescents with IBD is reported to be very high, ranging from 50% to 75%. Innovations and breakthroughs This study was the first to show that dedicated transition clinics were associated with differences in beliefs and attitudes. Adolescents who attended held a stronger belief that medical therapies were necessary and carried attitudes that were more ambivalent (high necessity, high concerns), but less skeptical (low necessity, high concerns) toward their prescribed therapies. Applications This study showed association between attendance to transition clinic with differences in beliefs and attitudes towards medical therapy. Future studies should focus on determining the impact of transition clinics on long-term outcomes. Moreover, healthcare professionals should work on determining factors that are essential to conducting successful transition clinics. Terminology IBD, encompassing Crohn s disease and ulcerative colitis, is a chronic, idiopathic, immune-mediated illness that typically follows a relapsing and remitting course. Transition is defined as the purposeful planned movement of adolescents and young adults from child-centered to adult-oriented healthcare system. Beliefs about Medicine Questionnaire (BMQ) is a validated 17-question tool that evaluates both specific and general beliefs about medicine. BMQ allows for further analysis of attitudes toward medicine. Peer-review The authors reported transition clinic attendance is associated with improved beliefs and attitudes toward medicine in patients with IBD. The article is informative and well-presented. REFERENCES 1 Cosnes J, Gower-Rousseau C, Seksik P, Cortot A. Epidemiology and natural history of inflammatory bowel diseases. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 2 Benchimol EI, Fortinsky KJ, Gozdyra P, Van den Heuvel M, Van Limbergen J, Griffiths AM. Epidemiology of pediatric inflammatory bowel disease: a systematic review of international trends. Inflamm Bowel Dis 2011; 17: [PMID: DOI: /ibd.21349] 3 Abraham BP, Mehta S, El-Serag HB. Natural history of pediatriconset inflammatory bowel disease: a systematic review. J Clin Gastroenterol 2012; 46: [PMID: DOI: / MCG.0b013e318247c32f] 4 Goodhand J, Hedin CR, Croft NM, Lindsay JO. Adolescents with IBD: the importance of structured transition care. J Crohns Colitis 2011; 5: [PMID: DOI: / j.crohns ] 5 Hait EJ, Barendse RM, Arnold JH, Valim C, Sands BE, Korzenik JR, Fishman LN. Transition of adolescents with inflammatory 5410 August 7, 2017 Volume 23 Issue 29

169 Fu N et al. IBD transition clinic and attitudes toward medicine bowel disease from pediatric to adult care: a survey of adult gastroenterologists. J Pediatr Gastroenterol Nutr 2009; 48: [PMID: DOI: /MPG.0b013e31816d71d8] 6 Sebastian S, Jenkins H, McCartney S, Ahmad T, Arnott I, Croft N, Russell R, Lindsay JO. The requirements and barriers to successful transition of adolescents with inflammatory bowel disease: differing perceptions from a survey of adult and paediatric gastroenterologists. J Crohns Colitis 2012; 6: [PMID: DOI: /j.crohns ] 7 Fishman LN, Barendse RM, Hait E, Burdick C, Arnold J. Selfmanagement of older adolescents with inflammatory bowel disease: a pilot study of behavior and knowledge as prelude to transition. Clin Pediatr (Phila) 2010; 49: [PMID: DOI: / ] 8 Benchimol EI, Walters TD, Kaufman M, Frost K, Fiedler K, Chinea Z, Zachos M. Assessment of knowledge in adolescents with inflammatory bowel disease using a novel transition tool. Inflamm Bowel Dis 2011; 17: [PMID: DOI: / ibd.21464] 9 Ingerski LM, Baldassano RN, Denson LA, Hommel KA. Barriers to oral medication adherence for adolescents with inflammatory bowel disease. J Pediatr Psychol 2010; 35: [PMID: DOI: /jpepsy/jsp085] 10 Hommel KA, Baldassano RN. Brief report: Barriers to treatment adherence in pediatric inflammatory bowel disease. J Pediatr Psychol 2010; 35: [PMID: DOI: / jpepsy/jsp126] 11 Greenley RN, Stephens KA, Nguyen EU, Kunz JH, Janas L, Goday P, Schurman JV. Vitamin and mineral supplement adherence in pediatric inflammatory bowel disease. J Pediatr Psychol 2013; 38: [PMID: DOI: /jpepsy/jst037] 12 Mackner LM, Crandall WV. Oral medication adherence in pediatric inflammatory bowel disease. Inflamm Bowel Dis 2005; 11: [PMID: ] 13 Kane S, Huo D, Aikens J, Hanauer S. Medication nonadherence and the outcomes of patients with quiescent ulcerative colitis. Am J Med 2003; 114: [PMID: ] 14 Cervený P, Bortlík M, Kubena A, Vlcek J, Lakatos PL, Lukás M. Nonadherence in inflammatory bowel disease: results of factor analysis. Inflamm Bowel Dis 2007; 13: [PMID: DOI: /ibd.20189] 15 McGrady ME, Hommel KA. Medication adherence and health care utilization in pediatric chronic illness: a systematic review. Pediatrics 2013; 132: [PMID: DOI: / peds ] 16 Higgins PD, Rubin DT, Kaulback K, Schoenfield PS, Kane SV. Systematic review: impact of non-adherence to 5-aminosalicylic acid products on the frequency and cost of ulcerative colitis flares. Aliment Pharmacol Ther 2009; 29: [PMID: DOI: /j x] 17 Hanghøj S, Boisen KA. Self-reported barriers to medication adherence among chronically ill adolescents: a systematic review. J Adolesc Health 2014; 54: [PMID: DOI: /j.jadohealth ] 18 Kane SV. Systematic review: adherence issues in the treatment of ulcerative colitis. Aliment Pharmacol Ther 2006; 23: [PMID: DOI: /j x] 19 Sewitch MJ, Abrahamowicz M, Barkun A, Bitton A, Wild GE, Cohen A, Dobkin PL. Patient nonadherence to medication in inflammatory bowel disease. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 20 Ediger JP, Walker JR, Graff L, Lix L, Clara I, Rawsthorne P, Rogala L, Miller N, McPhail C, Deering K, Bernstein CN. Predictors of medication adherence in inflammatory bowel disease. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] 21 Horne R, Parham R, Driscoll R, Robinson A. Patients attitudes to medicines and adherence to maintenance treatment in inflammatory bowel disease. Inflamm Bowel Dis 2009; 15: [PMID: DOI: /ibd.20846] 22 Moshkovska T, Stone MA, Clatworthy J, Smith RM, Bankart J, Baker R, Wang J, Horne R, Mayberry JF. An investigation of medication adherence to 5-aminosalicylic acid therapy in patients with ulcerative colitis, using self-report and urinary drug excretion measurements. Aliment Pharmacol Ther 2009; 30: [PMID: DOI: /j x] 23 Census Population of BC and Canada. Victoria, BC: BCStats, Available from: URL: StatisticsBySubject/Census/2011Census/PopulationHousing/ BCCanada.aspx 24 Horne R, Weinman J, Hankins M. The beliefs about medicines questionnaire: The development and evaluation of a new method for assessing the cognitive representation of medication. Psychol Health 1999; 14: Horne R, Weinman J. Patients beliefs about prescribed medicines and their role in adherence to treatment in chronic physical illness. J Psychosom Res 1999; 47: [PMID: ] 26 Horne R, Chapman SC, Parham R, Freemantle N, Forbes A, Cooper V. Understanding patients adherence-related beliefs about medicines prescribed for long-term conditions: a meta-analytic review of the Necessity-Concerns Framework. PLoS One 2013; 8: e80633 [PMID: DOI: /journal.pone ] 27 Hommel KA, Davis CM, Baldassano RN. Objective versus subjective assessment of oral medication adherence in pediatric inflammatory bowel disease. Inflamm Bowel Dis 2009; 15: [PMID: DOI: /ibd.20798] 28 Rapoff MA. Management of adherence and chronic rheumatic disease in children and adolescents. Best Pract Res Clin Rheumatol 2006; 20: [PMID: DOI: / j.berh ] 29 McGrady ME, Williams SN, Davies SM, Pai AL. Adherence to outpatient oral medication regimens in adolescent hematopoietic stem cell transplant recipients. Eur J Oncol Nurs 2014; 18: [PMID: DOI: /j.ejon ] 30 Koster ES, Philbert D, Winters NA, Bouvy ML. Adolescents inhaled corticosteroid adherence: the importance of treatment perceptions and medication knowledge. J Asthma 2015; 52: [PMID: DOI: / ] 31 Greenley RN, Stephens M, Doughty A, Raboin T, Kugathasan S. Barriers to adherence among adolescents with inflammatory bowel disease. Inflamm Bowel Dis 2010; 16: [PMID: DOI: /ibd.20988] 32 Reed-Knight B, Lewis JD, Blount RL. Association of disease, adolescent, and family factors with medication adherence in pediatric inflammatory bowel disease. J Pediatr Psychol 2011; 36: [PMID: DOI: /jpepsy/jsq076] 33 Waters BM, Jensen L, Fedorak RN. Effects of formal education for patients with inflammatory bowel disease: a randomized controlled trial. Can J Gastroenterol 2005; 19: [PMID: ] 34 Mosnaim G, Li H, Martin M, Richardson D, Belice PJ, Avery E, Ryan N, Bender B, Powell L. Factors associated with levels of adherence to inhaled corticosteroids in minority adolescents with asthma. Ann Allergy Asthma Immunol 2014; 112: [PMID: DOI: /j.anai ] P- Reviewer: Chiba T, Rosen DJ S- Editor: Gong ZM L- Editor: A E- Editor: Zhang FF 5411 August 7, 2017 Volume 23 Issue 29

170 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Observational Study ORIGINAL ARTICLE Gut barrier failure biomarkers are associated with poor disease outcome in patients with primary sclerosing cholangitis Tamas Tornai, Eszter Palyu, Zsuzsanna Vitalis, Istvan Tornai, David Tornai, Peter Antal-Szalmas, Gary L Norman, Zakera Shums, Gabor Veres, Antal Dezsofi, Gabriella Par, Alajos Par, Peter Orosz, Ferenc Szalay, Peter Laszlo Lakatos, Maria Papp Tamas Tornai, Zsuzsanna Vitalis, Istvan Tornai, Eszter Palyu, Maria Papp, Institute of Internal Medicine, Department of Gastroenterology, University of Debrecen, Faculty of Medicine, Debrecen, Hungary, H-4032 Debrecen, Hungary David Tornai, Peter Antal-Szalmas, Department of Laboratory Medicine, University of Debrecen, Faculty of Medicine Debrecen, Hungary, H-4032 Debrecen, Hungary Gary L Norman, Zakera Shums, Inova Diagnostics, Inc., San Diego, CA 92131, United States Gabor Veres, Antal Dezsofi, 1 st Department of Pediatrics, Semmelweis University, H-1083 Budapest, Hungary Gabriella Par, Alajos Par, 1 st Department of Medicine, University of Pecs, H-7624 Pecs, Hungary Peter Orosz, Gastroenterology Department of Medicine, Borsod- Abauj Zemplen County Hospital, H-3526 Miskolc, Hungary Ferenc Szalay, Peter Laszlo Lakatos, 1 st Department of Medicine, Semmelweis University, H-1083 Budapest, Hungary Author contributions: Papp M, Tornai I and Antal-Szamas P designed research; Papp M, Tornai T, Tornai D, Palyu E, Vitalis Z, Norman GL, Shums Z, Veres G, Dezsofi A, Par G, Par A, Orosz P, Szalay F and Lakatos PL performed research; Papp M and Tornai T analyzed data; Papp M and Tornai T wrote paper. Supported by Research Grant of National Research Development and Innovation Office, No.K115818/2015/1; János Bólyai Research Scholarship of Hungarian Academy of Sciences to Papp M; and the New National Excellence Program of the Ministry of Human Capacities, No.ÚNKP-16-3 to Tornai T Institutional review board statement: The study protocol was approved by the Regional and Institutional Research Ethics Committee of University of Debrecen and the National Scientific and Research Ethics Committee (DEOEC-RKEB/ IKEB /2011, , 3885/2012/EKU [60/PI/2012], 3880/2012/EKU [59/PI/2012], /2016/EKU ad 167/2016). Informed consent statement: All study participants, or their legal guardian, provided informed written consent prior to study enrolment. Conflict-of-interest statement: Gary L Norman and Zakera Shums are employees of Inova Diagnostics. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Maria Papp, MD, PhD, Institute of Internal Medicine, Department of Gastroenterology, University of Debrecen, Faculty of Medicine, Nagyerdei krt. 98, H-4032 Debrecen, Hungary. papp.maria@med.unideb.hu Telephone: Fax: Received: March 27, 2017 Peer-review started: March 29, 2017 First decision: April 26, 2017 Revised: May 9, 2017 Accepted: June 18, August 7, 2017 Volume 23 Issue 29

171 Tornai T et al. Gut barrier failure markers in PSC Article in press: June 19, 2017 Published online: August 7, 2017 Abstract AIM To assess the prevalence of a panel of serologic markers that reflect gut barrier dysfunction in a mixed cohort of pediatric and adult primary sclerosing cholangitis (PSC) patients. METHODS Sera of 67 PSC patients [median age (range): 32 (5-79) years, concomitant IBD: 67% and cirrhosis: 20%] were assayed for the presence of antibodies against to F-actin (AAA IgA/IgG) and gliadin (AGA IgA/IgG)] and for serum level of intestinal fatty acid-binding protein (I-FABP) by ELISA. Markers of lipopolysaccharide (LPS) exposure [LPS binding protein (LBP)] and various antimicrobial antibodies [anti-omp Plus IgA and endotoxin core IgA antibody (EndoCAb)] were also determined. Poor disease outcome was defined as orthotopic liver transplantation and/or liver-related death during the follow-up [median: 99 (14-106) mo]. One hundred and fifty-three healthy subjects (HCONT) and 172 ulcerative colitis (UC) patients were the controls. RESULTS A total of 28.4%, 28.0%, 9% and 20.9% of PSC patients were positive for AAA IgA, AAA IgG, AGA IgA and AGA IgG, respectively. Frequencies of AAA IgA and AAA IgG (P < 0.001, for both) and AGA IgG (P = 0.01, for both) but not AGA IgA were significantly higher compared to both of the HCONT and the UC groups. In survival analysis, AAA IgA-positivity was revealed as an independent predictor of poor disease outcome after adjusting either for the presence of cirrhosis [HR = 5.15 ( ), P = or for the Mayo risk score (HR = 4.24 ( ), P = 0.052]. AAA IgA-positivity was significantly associated with higher frequency of antimicrobial antibodies (P < for EndoCab IgA and P = for anti-omp Plus IgA) and higher level of the enterocyte damage marker (median I-FABPAAA IgA pos vs neg: 365 vs 166 pg/ml, P = 0.011), but not with serum LBP level. CONCLUSION Presence of IgA type AAA identified PSC patients with progressive disease. Moreover, it is associated with enhanced mucosal immune response to various microbial antigens and enterocyte damage further highlighting the importance of the gut-liver interaction in PSC. Key words: Primary sclerosing cholangitis; Gut barrier dysfunction; Intestinal fatty acid-binding protein; Anti- F-actin antibody; Anti-gliadin antibody The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Importance of gut-liver interaction in the pathogenesis of primary sclerosing cholangitis (PSC) has been certified by a variety of clinical and experimental evidences. Clinical manifestations and progression of the disease are heterogeneous. No reliable biomarkers have been identified to this point that is able to predict the pace of progression. In the present, prospective follow-up study, we evaluated the clinical importance of novel serological markers related to gut barrier function in the prediction of progressive disease course in a cohort of PSC patients. IgA type anti-f-actin antibody was identified as a novel serologic marker during the prognostic work-up of PSC. Presence of anti-f-actin IgA identified PSC patients with progressive disease course and was associated with enhanced mucosal immune response to various microbial antigens and enterocyte damage further highlighting the importance of the gutliver interaction in PSC. Tornai T, Palyu E, Vitalis Z, Tornai I, Tornai D, Antal-Szalmas P, Norman GL, Shums Z, Veres G, Dezsofi A, Par G, Par A, Orosz P, Szalay F, Lakatos PL, Papp M. Gut barrier failure biomarkers are associated with poor disease outcome in patients with primary sclerosing cholangitis. World J Gastroenterol 2017; 23(29): Available from: URL: com/ /full/v23/i29/5412.htm DOI: org/ /wjg.v23.i INTRODUCTION Primary sclerosing cholangitis (PSC) is a chronic cholestatic liver disease characterized by persistent, progressive biliary inflammation, fibrosis and eventually end-stage liver disease. Clinical manifestations and progression of the disease are heterogeneous. No reliable biomarkers have been identified to this point that able to predict the pace of progression. Consequently, patients with PSC cannot be stratified properly [1]. The etiology of PSC is poorly understood. Importance of gut-liver interaction in the pathogenesis of the disease however, has been certified by a large body of clinical evidence [2]. On the one hand, there is a close relation of the disease with inflammatory bowel diseases (IBD), up to 80% of the patients have both conditions [3]. On the other hand, in PSC patients with concomitant IBD, high peritransplant IBD activity was associated with higher [4], while colectomy before liver transplantation with considerably lower recurrent rate of PSC [5]. Experimental findings also supported the role of inflamed permeable gut in the subsequent inflammation of the biliary tract [6,7]. Patients with PSC display an exaggerated immune response to intestinal endotoxins with a lack of tolerance to repeated endotoxin exposure [8,9]. Prolonged and active intestinal inflammation interrupts the gut mucosal barrier function with a subsequent endotoxin exposure to cholangiocytes. Disruption of cholangiocytes tight 5413 August 7, 2017 Volume 23 Issue 29

172 Tornai T et al. Gut barrier failure markers in PSC Table 1 Clinical and laboratory characteristics of primary sclerosing cholangitis patients Patients with PSC (n = 67) Age at diagnosis (yr) 25 (17-36) Disease duration (yr) 6 (3-10) Children 10 (14.5) Male 49 (71.0) Cirrhosis 14 (20.3) Prior OLTx 4 (5.8) IBD 52 (75.4) Crohn's Disease 17 (32.7) Ulcerative Colitis 35 (67.3) Overlap syndrome 9 (13.0) Small duct PSC 5 (7.2) Celiac disease 1 (1.5) Albumin (g/l) 44 (40-47) Bilirubin (μmol/l) 15 (11-22) ALT (U/L) 52 (26-99) AST (U/L) 41 (28 66) GGT (U/L) 152 (60-310) ALP (U/L) 524 ( ) INR 1 ( ) Platelet (10 9 /L) 252 ( ) Mayo risk score ( ) Atypical P-ANCA IgG 57 (85.1) EMA IgA 1 (1.5) EMA IgG 1 (1.5) Data are summarized as median, (interquartile range: 25 th -75 th percentile) or as n (%). ALP: Alkaline phosphatase; ALT: Alanine transaminase; AST: Aspartate transaminase; GGT: Gamma glutamyl transferase; INR: International normalized ratio; P-ANCA: Perinuclear anti-neutrophil cytoplasmic antibodies; EMA: Anti-endomysial antibodies; OLTx: Orthotopic liver transplantation; IBD: Inflammatory bowel disease; IQR: inter-quartile range. junctions expose them various substances, such as bile acids, that could promote injury and inflammation [3]. Disruption of cholangiocytes tight junctions is an important step in the development of PSC in animal models [10,11]. Recently, reliable biomarkers of gut barrier function have been identified. Concerning enterocyte integrity, intestinal fatty acid-binding protein (I-FABP), a cytoplasmic protein of enterocytes, was reported as marker of enterocyte damage that could be considered as the troponin of the gut [12]. Anti-F-actin IgA antibodies (AAA-IgA) directed against intracellular cytoskeletal actin filaments and anti-gliadin IgA antibodies (AGA-IgA) serve as the markers of the structural intestinal mucosal damage. Presence of AAA-IgA strongly correlated with the histological findings of total or subtotal small intestinal atrophy in patients with celiac disease [13]. Presence of AGA-IgA was associated with increased intestinal permeability in patients with cirrhosis and significant portal hypertension [14]. The aims of this study were to assess: (1) the prevalence of a panel of serologic markers that reflect gut barrier dysfunction in a mixed cohort of pediatric and adult PSC patients; (2) associations between these markers and both the clinical and laboratory characteristics of the disease; (3) whether serologic markers of gut failure is associated with the longterm disease course in PSC; and (4) association of gut failure markers with the markers of lipopolysaccharide exposure and mucosal immune reactivity. MATERIALS AND METHODS Patient population We performed an observational cohort study among adult and pediatric PSC patients recruited in Hungarian referral hepatology centers (Hungarian Autoimmune Liver Disease Study Group). In total 67, wellcharacterized PSC patients with a complete clinical follow-up [adult: 56 (male/female: 40/16), median age at presentation: 29 years (IQR: 19-37), median disease duration: 6 years (3-12) and children: 11 (male/female: 8/3), median age at presentation: 10 years (IQR: 6-12), disease duration: 5 (1-7)] were included between January, 2006 and December, Clinical characteristics of patients at enrolment are presented in Table 1. Diagnosis of PSC was based on clinical, biochemical, serological and cholangiographic (magnetic resonance or endoscopic imaging) features or, when indicated, on histological findings [15]. Patients with any concomitant malignant disease were excluded. Blood samples and detailed description of clinical phenotypes were obtained at inclusion. Clinical data were determined by thorough review of patients medical records, which had been collected in a uniform format. Medical records that documented disease phenotype (age at onset, duration, type of PSC - large duct or small duct), presence and type of concomitant IBD, presence of overlap syndrome, presence of cirrhosis and portal hypertension related complications (e.g., ascites, encephalopathy, oesophageal varices or variceal bleeding), prior orthotopic liver transplantation (OLTx), co-morbidities and medication (e.g., ursodeoxycholic acid, steroid, immunosuppressive and/or biological therapy) at inclusion were retrospectively analyzed for the period prior to the prospective follow-up. At enrolment, revised Mayo risk score was calculated [16] and biochemical analyses were performed using standard routine laboratory protocols for tests including platelet count, creatinine, total bilirubin, albumin, international normalized ratio (INR) of prothrombin time, aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP) and γ-glutamyl-transferase (GGT). Phenotypical characterization of PSC patients during prospective follow-up Fifty-five out of 67 PSC patients were available to be enrolled into a prospective follow-up study, where the treating physicians registered laboratory data, imaging and endoscopic findings, medical treatment, date and type of complications (cirrhosis, colorectal cancer, biliary tract cancer: cholangiocarcinoma gallbladder cancer or cholangitis) during regular and additional 5414 August 7, 2017 Volume 23 Issue 29

173 Tornai T et al. Gut barrier failure markers in PSC outpatient follow-up visits and inpatient stays. In Hungary, a follow-up visit is usually scheduled for every 6 mo at a specialized hepatology center (the actual interval varies between 3 mo-6 mo). Collected data were transferred and stored in a database for analysis. On December 1, 2015, all patients charts and data were reviewed and updated for the data points mentioned above. Adverse outcome was defined as need for OLTx and/or liver-related death (composite end-point). Follow-up for a particular patient was terminated if there was no further record available or adverse outcome occurred. Cases with non-liver related death were censored at the time of event. Median follow-up from inclusion was 2646 (IQR: ) d. Control groups Healthy controls and patients with ulcerative colitis (UC) as disease control group were included. Healthy control group consisted of 153 individuals selected from consecutive blood donors in Debrecen. Control subjects did not have any known gastrointestinal or liver diseases. Ulcerative colitis group consisted of a previously reported cohort of 172 patients without PSC [male/ female: 79/93, age: 34 (23-44) years] [17]. Serological analysis Blood samples were obtained at enrolment from each patient and were frozen at -70 until testing. All the serological assays were performed in a blinded fashion without prior knowledge of the patient s clinical information. Commercially available ELISAs were used according to the manufacturer s protocol to determine serologic markers of gut barrier function, lipopolysaccharide (LPS) exposure and anti-microbial antibodies. Positive cut-off levels for individual markers were defined either by the manufacturer s recommendation or by the 95 th percentile of healthy controls and used to dichotomize absolute values. Presence of IgA or IgG type antibodies against F-actin (AAA) and gliadin (AGA) (QUANTA Lite ; INOVA Diagnostics, San Diego, CA) and level of intestinal fatty acid-binding protein (I-FABP) (Hycult Biotechnology, Uden, Netherlands) were determined as the serologic markers of gut barrier function. The cut-off for positivity was 35 U and 25 U for both types of AAA and AGA, respectively. Level of acute phase protein, lipopolysaccharide (LPS) - binding protein (LBP) and endotoxin core IgA antibody (EndoCAb IgA) (Hycult Biotechnology, Uden, Netherlands) were determined as markers of LPS exposure. The cut-off for positivity was 195 U/mL for EndoCAb IgA. Of the classic anti-microbial serologic antibodies, anti-omp Plus antibody (QUANTA Lite, Inova Diagnostics, San Diego, CA, United States) was detected. This assay detects IgA antibody against multiple bacterial proteins derived from two species of intestinal bacteria (one Gram-positive and one Gram-negative). Neither bacteria are from the phylum Proteobacteria, of which Escherichia coli is a member. The cutoff for positivity was 25 U as recommended by the manufacturer. Atypical P-ANCA and anti-endomysial (EMA) antibodies were determined by commercially available indirect immunofluorescence test (IIF) as a part of the differential diagnostic procedure of autoimmune liver diseases and celiac disease. Atypical P-ANCA (IgA and IgG) and EMA (IgA and IgG) antibody positivities were considered in case of specific fluorescencent patterns in IIFT (Euroimmun Medizinische Labordiagnostika AG, Lübeck, Germany) at a dilution 1:32 or 1:10, respectively as recommended by the manufacturer. Detailed description has been reported previously [17,18]. Ethical permission The study protocol was approved by the Regional and Institutional Research Ethics Committee of University of Debrecen and the National Scientific and Research Ethics Committee [DEOEC-RKEB/IKEB /2011, , 3885/2012/EKU (60/PI/2012), 3880/2012/ EKU (59/PI/2012)]. Each patient was informed of the nature of the study and gave informed consent in writing. Statistical analysis Variables were tested for normality using Shapiro Wilk s W test. Continuous variables were summarized as medians [interquartile range (IQR, lowest 25%-highest 25%)] and were compared with the Mann-Whitney U test. Categorical variables were compared with χ 2 test or Fisher s exact test, as appropriate. We used Kaplan- Meier analysis to determine association between serological antibodies and adverse disease outcome (OLTx and/or liver-related mortality). Differences in observed survival were assessed by the log-rank test. The association of categorical clinical variables or serological antibodies with adverse disease outcome during the follow-up was evaluated by univariate Cox-regression analysis. Multivariate analyses were performed to adjust for the Mayo risk score or presence of cirrhosis with forced entry method. Associations are given as hazard ratio [HR] with 95%CI. For statistical analysis and graphical presentation, the SPSS v.22.0 (SPSS, Chicago, IL, United States) and GraphPad Prism 6 (San Diego, CA, United States) programs were used. A two-sided probability value of < 0.05 was considered to be statistically significant. RESULTS Biomarkers of gut barrier function in PSC and their association with clinical or laboratory characteristics of PSC Frequencies of IgA and IgG isotype AAA and AGA in PSC and control groups comprising healthy blooddonors and patients with UC but without PSC are summarized in Table 2. A total of 40.3% (27/67) and 22.4% (15/67) of PSC patients were positive for IgA 5415 August 7, 2017 Volume 23 Issue 29

174 Tornai T et al. Gut barrier failure markers in PSC Table 2 Gut failure markers in patients with primary sclerosing cholangitis and various healthy and diseases control groups n (%) PSC (n = 67) UC (n = 172) P value 1 HC (n = 153) P value 1 AAA IgA 19 (28.4) 19 (11.2) (4.4) < IgG 17 (25.4) 7 (4.1) < (2.7) < IgA or IgG 27 (40.3) 25 (14.7) < (6.2) < IgA and IgG 9 (13.4) 1 (0.6) < (0.9) AGA IgA 6 (9.0) 6 (3.5) (2.6) IgG 14 (20.9) 15 (8.7) (5.9) IgA or IgG 15 (22.4) 20 (11.6) (7.2) IgA and IgG 5 (7.5) 1 (0.6) (1.3) P-values pertain to comparisons between PSC and the given control group. AAA IgA/G was measured in 170 patients with UC and 113 healthy controls. PSC: Primary sclerosing cholangitis; UC: Ulcerative colitis; HC: Healthy controls; AAA: Anti-F-actin antibody; AGA: Anti-gliadin antibody. or IgG isotype AAA and AGA, respectively. Antibody prevalence was significantly higher compared to either that in patients with UC [14.7% (25/170), P < for AAA and 11.6% (20/172), P = for AGA] or in healthy controls [6.2% (7/113), P < for AAA and 7.2% (11/153), P = for AGA]. AGA positivity was mainly IgG isotype (9% vs 20.9%), while AAA was of both IgA and IgG isotypes (28.4% vs 25.4%) and there was no significant overlap between IgA and IgG subtypes of the given antibody. Likewise, no significant overlap was observed between AAA and AGA. Only 10.4% (7/67) PSC patients positive for either type of these antibodies had both AAA (IgA or IgG) and AGA (IgA or IgG) antibodies. We analyzed clinical and laboratory characteristics of PSC patients according to their antibody status and summarized these results in Table 3. AAA antibody status according to its immunoglobulin subtypes was not associated with gender, younger age at diagnosis, presence of cirrhosis, or concomitant IBD. However, values of several biochemical laboratory parameters and the Mayo risk score that indicate more severe disease were significantly higher in the presence of IgA isotype of AAA. In case of IgG isotype of AAA, only a single association was reported, namely the median level of ALP was significantly higher in antibody positive cases compared to antibody negative ones (715 vs 493 U/L, P = 0.048). Different AGA isotypes, however, were not associated with either the clinical or the laboratory characteristics of more severe PSC phenotype. The presence of AAA IgG was higher in patients with overlapping autoimmune hepatitis [55.6% (5/9) vs 20.7% (12/58), P = 0.040] compared to patients without. In contrast, the frequency of AAA IgA was not different between the two groups [33.3% (3/9) vs 27.6% (16/58), P = 0.706]. cholangitis. Seven patients underwent OLTx. Five patients died due to liver-related complications. Composite end-point (OLTx and/or liver-related death) occurred in a total of 9 patients. One patient died due to acute myocardial infarction, this case was censored at time of death. We analyzed the association of clinical variables and the different isotypes of AAA and AGA. In Kaplan-Meier analysis, the median time to OLTx and/or liver-related death was 578 d (IQR: ). Presence of cirrhosis and increased Mayo risk score (plogrank = and < 0.001, respectively), but not gender (P = 0.547), age at onset (P = 0.845), disease location (P = 0.548) or concomitant IBD (P = 0.762) were significantly associated with faster disease progression. Positivity for IgA isotype AAA and AGA (plogrank = and 0.005, respectively), but not for IgG isotypes of these antibodies (plogrank = and 0.130, respectively) predicted OLTx and/or liverrelated death, see Figure 1. Accordingly, univariate Cox regression analysis revealed AAA IgA and AGA IgA-positivity as predictors of poor disease outcome [HR = 4.54 ( ), P = and 5.83 ( ), P = 0.013]. Thereafter, we used Cox regression analysis to adjust for important clinical variables that influence disease progression. Both IgA isotype AAA and AGA remained significant predictors of disease progression after adjusting for the presence of cirrhosis [HR = 5.15 ( ), P = and 5.07 ( ), P = 0.023, respectively]. Similar results, but with weakened statistical significance was observed in the case of AAA IgA-positivity [HR = 4.24 ( ), P = 0.052] after adjusting for the Mayo risk score, however the significant association was lost in case of AGA IgA-positivity [3.67 ( ), P = 0.074]. Significance of gut failure markers in the risk of the progressive disease course in PSC Development of colon cancer occurred in two, while biliary tract cancer in one patient during the followup period. Nine patients had at least one episode of Role of bacterial translocation and enterocyte damage markers in the risk of progressive disease course in PSC As a next step, we analyzed various serological markers of bacterial translocation and enterocyte 5416 August 7, 2017 Volume 23 Issue 29

175 Tornai T et al. Gut barrier failure markers in PSC Table 3 Associations between gut failure markers and disease or laboratory characteristics in patients with primary sclerosing cholangitis at enrolment Anti-F-actin IgA Anti-F-actin IgG Anti-gliadin IgA Anti-gliadin IgG Negative (n = 48) Positive (n = 19) P value Negative (n = 50) Positive (n = 17) P value Negative (n = 61) Positive (n = 6) P value Negative (n = 53) Positive (n = 14) P value Male gender, n (%) 35 (72.9) 13 (68.4) (76.0) 10 (58.8) (72.1) 4 (66.7) (69.8) 11 (78.6) Presence of cirrhosis, n (%) 8 (16.7) 5 (26.3) (18.0) 4 (23.5) (18) 2 (33.3) (18.9) 3 (21.4) Presence of IBD, n (%) 36 (75) 15 (78.9) (80.0) 11 (64.7) (77) 4 (66.7) (75.5) 11 (78.6) Median, IQR Age at diagnosis (yr) 23 (17-33) 26 (18-37) (17-37) 20 (11-31) (17-35) 23 (18-29) (17-37) 22 (17-29) Disease duration (yr) 6 (3-8) 7 (2-12) (4-10) 6 (1-9) (3-9) 9 (1-12) (3-8) 6 (2-17) Albumin (g/l) 44 (42-46) 39 (38-47) (40-46) 43 (39-47) (40-47) 39 (39-42) (40-46) 43 (39-47) Bilirubin (μmol/l) 15 (11-20) 14 (11-37) (11-20) 13 (10-22) (10-22) 17 (16-21) (11-23) 17 (12-20) AST (U/L) 35 (25-56) 55 (37-94) (27-56) 44 (34-85) (28-61) 41 (34-48) (28-61) 35 (25-55) ALT (U/L) 46 (21-92) 65 (45-165) (25-97) 55 (32-165) (25-100) 44 (37-52) (32-111) 42 (24-65) GGT (U/L) 142 (45-269) 193 ( ) (63-305) 153 (60-420) (60-310) 140 (93-305) (54-310) 126 (88-305) ALP (U/L) 406 ( ) 1198 ( ) < ( ) 715 ( ) ( ) 1204 ( ) ( ) 652 ( ) PLT (G/L) 238 ( ) 315 ( ) ( ) 320 ( ) ( ) 274 ( ) ( ) 241 ( ) Mayo risk score ( to ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; GGT: γ-glutamyl-transferase; ALP: Alkaline phosphatase. Table 4 Serum level of bacterial translocation and enterocyte damage markers according to the different serologic antibody statuses Anti-F-actin IgA Anti-F-actin IgG Anti-gliadin IgA Anti-gliadin IgG Negative (n = 48) Positive (n = 19) P value Negative (n = 50) Positive (n = 17) P value Negative (n = 61) Positive (n = 6) P value Negative (n = 53) Positive (n = 14) P value Median, IQR LBP (μg/l) 7132 ( ) 7374 ( ) ( ) 6847 ( ) ( ) ( ) ( ) 8090 ( ) EndoCab IgA (U) 58 (40-92) 123 (93-215) < (49-97) 113 (52-150) (43-106) 134 (66-241) (43-112) 94 (52-150) OMP Plus IgA, n (%) 5 (10.60) 7 (36.80) (22) 1 (6.30) (20) 0 (0) (21.20) 1 (7.10) I-FABP (pg/ml) 166 (90-365) 365 ( ) ( ) 300 (90-365) (99-443) 342 ( ) (99-379) 342 ( ) LBP: Lipopolysaccharide [LPS]-binding protein; EndoCab: Endotoxin core antibody; I-FABP: Intestinal fatty acid-binding protein; siga: Secretory IgA; IQR: Inter-quartile range. damage. Patients with AAA IgA-positivity had significantly higher EndoCab IgA titers [median (IQR): 123 (93-215) U vs 58 (40-92) U, P < 0.001] and higher frequency of anti-omp Plus IgA antibody (36.8% vs 10.6%, P = 0.012) and also significantly higher level of the enterocyte damage marker, I-FABP [median (IQR): 365 ( ) pg/ml vs 166 (90-365) pg/ml, P = 0.011). However, LBP was not different between AAA IgA positive and negative patients. No other statistically significant association was found in case of AAA IgG or any isotypes of AGA (summarized in Table 4). DISCUSSION The importance of gut-liver interaction in the pathogenesis of PSC has been certified by a variety of clinical and experimental evidence as discussed previously [2]. In the present study, therefore we investigated the clinical importance of different serological biomarkers related to gut barrier function in the prediction of progressive disease course in a cohort 5417 August 7, 2017 Volume 23 Issue 29

176 Tornai T et al. Gut barrier failure markers in PSC A 100 B 100 OLTx/Liver related death free survival (%) anti-f-actin lga negative anti-f-actin lga positive P = anti-f-actin lgg negative anti-f-actin lgg positive P = at risk t /yr C OLTx/Liver related death free survival (%) P = anti-gliadin lga negative anti-gliadin lga positive 0 at risk t /yr D t /yr anti-gliadin lgg negative anti-gliadin lgg positive t /yr P = Figure 1 Progressive disease course in primary sclerosing cholangitis according to the presence of different gut-failure related serological antibodies. Patients positive for anti-f-actin IgA (A) or anti-gliadin IgA (C) have higher cumulative probability of disease progression defined by need for OLTx and/or death compared to those negative for these antibodies. IgG isotypes of these antibodies were not associated with progressive disease course (B and D). of PSC patients. To our knowledge, this is the first study examining disease outcomes in PSC according to these serological markers [19]. The cytoskeleton protein, F-actin was identified as a specific target of smooth muscle cell antibodies (SMA) in autoimmune hepatitis [20] and for over a decade IgG isotype AAA testing - either by immunofluorescence technique or ELISA - has been incorporated into the diagnostic procedure of the disease [21]. Increased occurrence of this antibody was reported in other autoimmune diseases (e.g., celiac disease or connective tissue disease) [22]. To our knowledge no previous study assessed, however, the prevalence and isotype characteristics of AAAs in PSC. In the present study, we demonstrated - for the first time - that enhanced AAA formation is a feature of PSC regardless of overlapping AIH. A quarter of our PSC patients showed positivity for AAA that was significantly higher compared to either patients with UC or healthy controls. Contrary to routine laboratory practice, AAA was identified by anti-iga secondary antibody in addition to anti-igg one. This approach revealed isotype dependent association of AAA with clinical characteristics of the disease. The presence of IgA, but not IgG type AAA indicated more severe disease at baseline based on Mayo risk score and different biochemical parameters. Concordantly, previous studies in celiac disease reported that the presence of IgA isotype AAA were strongly associated with the degree of active tissue damage of the intestinal mucosa. At the same time, AAA IgA-positivity disappeared parallel to mucosal healing after gluten free diet was introduced. Of note, cases with persistent intestinal mucosa damage despite gluten-free diet, remained positive for AAA IgA antibody [23]. As a further novel finding of our study, the presence of AAA IgA-positivity predicted faster disease progression during follow-up, even after adjusting for the presence of cirrhosis or the Mayo risk score. We considered both liver-related death and OLTx as equal endpoints, since they represent the development of end-stage liver disease as the result of the progressive fibrosis. The mechanism how the breakdown of tolerance towards F-actin is associated with the development of enhanced fibrosis and thus disease progression in the liver remaines to be elucidated. Interestingly, in our study patients with positivity for AAA IgA had an enhanced mucosal immune response to microbial antigens, like endotoxin (EndoCab IgA) or bacterial proteins (anti-omp Plus IgA). This immune response seems to be restricted to the intestinal mucosal compartment without leading to systemic reaction 5418 August 7, 2017 Volume 23 Issue 29

177 Tornai T et al. Gut barrier failure markers in PSC since serum LBP concentration, the serologic hallmark of systemic LPS exposure were similar in AAA IgA positive and negative cases. This result is in agreement with the findings of previous studies. Namely, portal venous bacteraemia is not frequent in PSC. However, exposure of endotoxins to biliary epithelial cells leads to disruption of enterocytes and cholangiocytes tight junctions through TLR4 mediated signaling that is an important step in the pathogenesis in animal models of PSC [3,24]. Our observation that serum level of I-FABP was significantly higher in the group of patients with AAA IgA-positivity compared to those with AAA IgA-negativity corresponds to these abovementioned literature findings. I-FABP is considered an accurate marker of enterocyte damage, since it is specifically produced by enterocytes and is released to systemic circulation in case of cellular injury during inflammatory processes. Autoantibodies are generally not pathogenic in PSC, therefore it may be unlikely that the severity of biliary injury is driven by humoral factors. Production of AAA may reflect, however an enhanced (immune) reactivity of lymphocytes towards surrounding tissue and/or cellular debris. Of note, AAA is not organspecific since they may be present in a wide range of immune-mediated diseases other than PSC, as mentioned previously. IgG isotype AAA was associated with disease activity and poor survival in autoimmune hepatitis [25,26]. In the study of Czaja et al [26] patients seropositive for AAA were more commonly HLA- DR3 positive, while seronegative patients had higher frequency of HLA-DR4 positivity than healthy subjects. In the same study AAA were also associated with HLA-B8 positivity. Interestingly, in PSC Wiencke et al [27] also demonstrated that HLA-DR3 and B8 are associated with progressive disease course. Conversely, patients with HLA-DR4 do not experience an accelerated disease progression, they also have a decreased risk for disease recurrence after liver transplantation [28,29]. Based on these previous findings we speculate that the formation of AAA IgA in PSC might reflect a phenotype with distinct immunological function and genetic susceptibility for a more severe inflammatory process, similarly as in autoimmune hepatitis. A recent report on the association between autoantibodies, like atypical P-ANCA and HLA status in PSC might further support this hypothesis [30]. Hypothetical sero-genotype linkage between AAA IgA-positivity and more aggressive HLA genotype warrants further exploration. In the present study, occurrence of AGA was significantly higher in patients with PSC compared to either that in patients with UC or healthy subjects. Frequency of AGA IgG/IgA corresponds to the findings of Sjöberg et al [31] (22.4% vs 24%). Distinctly only IgG but not IgA isotype were more frequent in our study. Higher frequency of AGA is observed in various disorders, such as celiac disease, neurodegenerative diseases, systemic lupus erythematosus and autoimmune liver diseases [32-34]. Investigators have attributed the formation of these antibodies to an increased uptake of peptides from the gut lumen to the intestinal mucosa and presence of AGA is considered as a marker of a non-specific immune reaction towards a dietary peptide. Furthermore, Reiberger et al [14] reported a surprisingly high frequency (about 60%) of AGA in patients with liver cirrhosis, mainly of alcoholic origin. Patients with AGA had higher portal venous pressure and increased intestinal permeability assessed by the sucrose-lactulose-mannitol test. Nevertheless, a Swedish study including 22 patients with PSC failed to detect an altered intestinal permeability in PSC [35]. Intestinal permeability in PSC might rather be considered as an immunological barrier dysfunction [8,36]. We found an association between IgA type AGA and accelerated disease progression in our cohort, however due to the low number of positive cases, this finding should be interpreted with caution. The increased chance of a false positive finding as a result of the small number of positive cases is a limitation to be acknowledged. We speculate that the finding of an earlier study from a French research group might serve as a possible explanation. They showed that AGA IgA facilitated an increased transport of gliadin peptides from the intestinal lumen to the gut mucosa via CD71. In the subepithelial space these undigested toxic peptides are able to perpetuate intestinal inflammation [37]. Of note, the design of our study was mainly explorative and did not include experimental methods that could give an exact explanation for the increased risk of disease progression in the presence of specific antibodies. To conclude, we reported that antibodies against F-actin are frequent in patients with PSC. Presence of IgA isotype of this antibody was associated with an enhanced mucosal immune response to various microbial antigens and also with the presence of enterocyte damage. Furthermore, AAA IgA identified a subgroup of patients with an increased risk of accelerated disease progression. These results serve as additional proof for the importance of the gutliver interaction in PSC. If they confirmed in largescale cohorts, IgA isotype of AAA could be a candidate biomarker for serological risk stratification of patients with PSC. COMMENTS Background Clinical manifestation and progression of primary sclerosing cholangitis are heterogeneous. A large body of clinical evidence has certified the importance of the gut-liver interaction in primary sclerosing cholangitis (PSC): (1) inflammatory bowel diseases (IBD) is associated to PSC in up to 80% of the patients; (2) high peritransplant IBD activity increases the risk, while colectomy before liver transplantation decreases the risk of disease recurrence after transplantation; and (3) patients with PSC display an exaggerated immune response to endotoxins with a lack of tolerance to repeated exposure. To date, no widely used biomarkers are able to predict rapid progression of PSC. Research frontiers A cytoplasmic protein of enterocytes, intestinal fatty acid-binding protein 5419 August 7, 2017 Volume 23 Issue 29

178 Tornai T et al. Gut barrier failure markers in PSC (I-FABP) is as marker of enterocyte damage. Anti-F-actin IgA antibodies were showed to serve as the markers of the structural intestinal mucosal damage. Presence of anti-gliadin IgA antibodies was associated with increased intestinal permeability in patients with cirrhosis and significant portal hypertension. In the present study, they tested these different novel serological biomarkers related to gut barrier function in the prediction of progressive disease course in a cohort of PSC patients. Innovations and breakthroughs In the present study, they demonstrated - for the first time - that enhanced AAA IgA formation is a feature of PSC. A quarter of their PSC patients showed positivity for AAA IgA. Immune response to microbial antigens was more frequent in patients with AAA IgA. The presence of AAA IgA predicted faster disease progression during follow-up, even when adjusting for the presence of cirrhosis or the Mayo risk score. Applications AAA IgA is a candidate biomarker for stratifying patients with PSC in terms of risk of disease progression. Terminology AAA IgA is an autoantibody of immunoglobulin A isotype directed against filamentous actin. Peer-review This is an original and interesting manuscript. There are very few data on this topic. REFERENCES 1 Lazaridis KN, LaRusso NF. Primary Sclerosing Cholangitis. N Engl J Med 2016; 375: [PMID: DOI: /NEJMra ] 2 Eksteen B. The Gut-Liver Axis in Primary Sclerosing Cholangitis. Clin Liver Dis 2016; 20: 1-14 [PMID: DOI: / j.cld ] 3 Eaton JE, Talwalkar JA, Lazaridis KN, Gores GJ, Lindor KD. Pathogenesis of primary sclerosing cholangitis and advances in diagnosis and management. Gastroenterology 2013; 145: [PMID: DOI: /j.gastro ] 4 Joshi D, Bjarnason I, Belgaumkar A, O Grady J, Suddle A, Heneghan MA, Aluvihare V, Rela M, Heaton N, Agarwal K. The impact of inflammatory bowel disease post-liver transplantation for primary sclerosing cholangitis. Liver Int 2013; 33: [PMID: DOI: /j x] 5 Alabraba E, Nightingale P, Gunson B, Hubscher S, Olliff S, Mirza D, Neuberger J. A re-evaluation of the risk factors for the recurrence of primary sclerosing cholangitis in liver allografts. Liver Transpl 2009; 15: [PMID: DOI: /lt.21679] 6 Lichtman SN, Keku J, Schwab JH, Sartor RB. Hepatic injury associated with small bowel bacterial overgrowth in rats is prevented by metronidazole and tetracycline. Gastroenterology 1991; 100: [PMID: ] 7 Yamada S, Ishii M, Liang LS, Yamamoto T, Toyota T. Small duct cholangitis induced by N-formyl L-methionine L-leucine L-tyrosine in rats. J Gastroenterol 1994; 29: [PMID: ] 8 Mueller T, Beutler C, Picó AH, Shibolet O, Pratt DS, Pascher A, Neuhaus P, Wiedenmann B, Berg T, Podolsky DK. Enhanced innate immune responsiveness and intolerance to intestinal endotoxins in human biliary epithelial cells contributes to chronic cholangitis. Liver Int 2011; 31: [PMID: DOI: /j x] 9 Medvedev AE, Sabroe I, Hasday JD, Vogel SN. Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease. J Endotoxin Res 2006; 12: [PMID: DOI: / X102255] 10 Fickert P, Fuchsbichler A, Marschall HU, Wagner M, Zollner G, Krause R, Zatloukal K, Jaeschke H, Denk H, Trauner M. Lithocholic acid feeding induces segmental bile duct obstruction and destructive cholangitis in mice. Am J Pathol 2006; 168: [PMID: DOI: /ajpath ] 11 Fickert P, Fuchsbichler A, Wagner M, Zollner G, Kaser A, Tilg H, Krause R, Lammert F, Langner C, Zatloukal K, Marschall HU, Denk H, Trauner M. Regurgitation of bile acids from leaky bile ducts causes sclerosing cholangitis in Mdr2 (Abcb4) knockout mice. Gastroenterology 2004; 127: [PMID: ] 12 Piton G, Capellier G. Biomarkers of gut barrier failure in the ICU. Curr Opin Crit Care 2016; 22: [PMID: DOI: /MCC ] 13 Schirru E, Danjou F, Cicotto L, Rossino R, Macis MD, Lampis R, Jores RD, Congia M. Anti-actin IgA antibodies identify celiac disease patients with a Marsh 3 intestinal damage among subjects with moderate anti-tg2 levels. Biomed Res Int 2013; 2013: [PMID: DOI: /2013/630463] 14 Reiberger T, Ferlitsch A, Payer BA, Mandorfer M, Heinisch BB, Hayden H, Lammert F, Trauner M, Peck-radosavljevic M, Vogelsang H, Hepatic V. Non-selective betablocker therapy decreases intestinal permeability and serum levels of LBP and IL-6 in patients with cirrhosis. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 15 Martins EB, Chapman RW. Sclerosing cholangitis. Curr Opin Gastroenterol 2001; 17: [PMID: ] 16 Kim WR, Therneau TM, Wiesner RH, Poterucha JJ, Benson JT, Malinchoc M, LaRusso NF, Lindor KD, Dickson ER. A revised natural history model for primary sclerosing cholangitis. Mayo Clin Proc 2000; 75: [PMID: DOI: / ] 17 Papp M, Sipeki N, Tornai T, Altorjay I, Norman GL, Shums Z, Roggenbuck D, Fechner K, Stöcker W, Antal-Szalmas P, Veres G, Lakatos PL. Rediscovery of the Anti-Pancreatic Antibodies and Evaluation of their Prognostic Value in a Prospective Clinical Cohort of Crohn s Patients: The Importance of Specific Target Antigens [GP2 and CUZD1]. J Crohns Colitis 2015; 9: [PMID: DOI: /ecco-jcc/jjv087] 18 Papp M, Sipeki N, Vitalis Z, Tornai T, Altorjay I, Tornai I, Udvardy M, Fechner K, Jacobsen S, Teegen B, Sumegi A, Veres G, Lakatos PL, Kappelmayer J, Antal-Szalmas P. High prevalence of IgA class anti-neutrophil cytoplasmic antibodies (ANCA) is associated with increased risk of bacterial infection in patients with cirrhosis. J Hepatol 2013; 59: [DOI: / j.jhep ] 19 Infantino M, Meacci F, Grossi V, Macchia D, Manfredi M. Anti-gliadin antibodies in non-celiac gluten sensitivity. Minerva Gastroenterol Dietol 2017; 63: 1-4 [PMID: DOI: /S X ] 20 Gabbiani G, Ryan GB, Lamelin JP, Vassalli P, Majno G, Bouvier CA, Cruchaud A, Lüscher EF. Human smooth muscle autoantibody. Its identification as antiactin antibody and a study of its binding to nonmuscular cells. Am J Pathol 1973; 72: [PMID: ] 21 Hennes EM, Zeniya M, Czaja AJ, Parés A, Dalekos GN, Krawitt EL, Bittencourt PL, Porta G, Boberg KM, Hofer H, Bianchi FB, Shibata M, Schramm C, Eisenmann de Torres B, Galle PR, McFarlane I, Dienes HP, Lohse AW. Simplified criteria for the diagnosis of autoimmune hepatitis. Hepatology 2008; 48: [PMID: DOI: /hep.22322] 22 Chretien-Leprince P, Ballot E, Andre C, Olsson NO, Fabien N, Escande A, Oksman F, Dubuquoi S, Jego S, Goetz J, Chevailler A, Sanmarco M, Humbel RL, Johanet C. Diagnostic value of anti-f-actin antibodies in a French multicenter study. Ann N Y Acad Sci 2005; 1050: [PMID: DOI: / annals ] 23 Clemente MG, Musu MP, Troncone R, Volta U, Congia M, Ciacci C, Neri E, Not T, Maggiore G, Strisciuglio P, Corazza GR, Gasbarrini G, Cicotto L, Sole G, Fasano A, De Virgiliis S. Enterocyte actin autoantibody detection: a new diagnostic tool in celiac disease diagnosis: results of a multicenter study. Am J Gastroenterol 2004; 99: [PMID: DOI: /j x] 24 Guo S, Al-Sadi R, Said HM, Ma TY. Lipopolysaccharide causes 5420 August 7, 2017 Volume 23 Issue 29

179 Tornai T et al. Gut barrier failure markers in PSC an increase in intestinal tight junction permeability in vitro and in vivo by inducing enterocyte membrane expression and localization of TLR-4 and CD14. Am J Pathol 2013; 182: [PMID: DOI: /j.ajpath ] 25 Couto CA, Bittencourt PL, Porta G, Abrantes-Lemos CP, Carrilho FJ, Guardia BD, Cançado EL. Antismooth muscle and antiactin antibodies are indirect markers of histological and biochemical activity of autoimmune hepatitis. Hepatology 2014; 59: [PMID: DOI: /hep.26666] 26 Czaja AJ, Cassani F, Cataleta M, Valentini P, Bianchi FB. Frequency and significance of antibodies to actin in type 1 autoimmune hepatitis. Hepatology 1996; 24: [PMID: DOI: /hep ] 27 Wiencke K, Spurkland A, Schrumpf E, Boberg KM. Primary sclerosing cholangitis is associated to an extended B8-DR3 haplotype including particular MICA and MICB alleles. Hepatology 2001; 34: [PMID: DOI: / jhep ] 28 Bowlus CL, Li CS, Karlsen TH, Lie BA, Selmi C. Primary sclerosing cholangitis in genetically diverse populations listed for liver transplantation: unique clinical and human leukocyte antigen associations. Liver Transpl 2010; 16: [PMID: DOI: /lt.22161] 29 Boberg KM, Spurkland A, Rocca G, Egeland T, Saarinen S, Mitchell S, Broomé U, Chapman R, Olerup O, Pares A, Rosina F, Schrumpf E. The HLA-DR3,DQ2 heterozygous genotype is associated with an accelerated progression of primary sclerosing cholangitis. Scand J Gastroenterol 2001; 36: [PMID: ] 30 Hov JR, Boberg KM, Taraldsrud E, Vesterhus M, Boyadzhieva M, Solberg IC, Schrumpf E, Vatn MH, Lie BA, Molberg Ø, Karlsen TH. Antineutrophil antibodies define clinical and genetic subgroups in primary sclerosing cholangitis. Liver Int 2017; 37: [PMID: DOI: /liv.13238] 31 Sjöberg K, Lindgren S, Eriksson S. Frequent occurrence of nonspecific gliadin antibodies in chronic liver disease. Endomysial but not gliadin antibodies predict coeliac disease in patients with chronic liver disease. Scand J Gastroenterol 1997; 32: [PMID: ] 32 Chatzicostas C, Roussomoustakaki M, Drygiannakis D, Niniraki M, Tzardi M, Koulentaki M, Dimoulios P, Mouzas I, Kouroumalis E. Primary biliary cirrhosis and autoimmune cholangitis are not associated with coeliac disease in Crete. BMC Gastroenterol 2002; 2: 5 [PMID: ] 33 Reichelt KL, Jensen D. IgA antibodies against gliadin and gluten in multiple sclerosis. Acta Neurol Scand 2004; 110: [PMID: DOI: /j x] 34 Rensch MJ, Szyjkowski R, Shaffer RT, Fink S, Kopecky C, Grissmer L, Enzenhauer R, Kadakia S. The prevalence of celiac disease autoantibodies in patients with systemic lupus erythematosus. Am J Gastroenterol 2001; 96: [PMID: DOI: /j x] 35 Björnsson E, Cederborg A, Akvist A, Simren M, Stotzer PO, Bjarnason I. Intestinal permeability and bacterial growth of the small bowel in patients with primary sclerosing cholangitis. Scand J Gastroenterol 2005; 40: [PMID: ] 36 Terjung B, Söhne J, Lechtenberg B, Gottwein J, Muennich M, Herzog V, Mähler M, Sauerbruch T, Spengler U. p-ancas in autoimmune liver disorders recognise human beta-tubulin isotype 5 and cross-react with microbial protein FtsZ. Gut 2010; 59: [PMID: DOI: /gut ] 37 Matysiak-Budnik T, Moura IC, Arcos-Fajardo M, Lebreton C, Ménard S, Candalh C, Ben-Khalifa K, Dugave C, Tamouza H, van Niel G, Bouhnik Y, Lamarque D, Chaussade S, Malamut G, Cellier C, Cerf-Bensussan N, Monteiro RC, Heyman M. Secretory IgA mediates retrotranscytosis of intact gliadin peptides via the transferrin receptor in celiac disease. J Exp Med 2008; 205: 143 LP-154 [PMID: DOI: /jem ] P- Reviewer: Bonaz B, Popp C S- Editor: Qi Y L- Editor: A E- Editor: Li D 5421 August 7, 2017 Volume 23 Issue 29

180 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) ORIGINAL ARTICLE Observational Study Efficacy of forced coagulation with low high-frequency power setting during endoscopic submucosal dissection Tsukasa Ishida, Takashi Toyonaga, Yoshiko Ohara, Tadao Nakashige, Yasuaki Kitamura, Ryusuke Ariyoshi, Hiroshi Takihara, Shinichi Baba, Tetsuya Yoshizaki, Fumiaki Kawara, Shinwa Tanaka, Yoshinori Morita, Eiji Umegaki, Namiko Hoshi, Takeshi Azuma Tsukasa Ishida, Yoshiko Ohara, Yasuaki Kitamura, Ryusuke Ariyoshi, Tetsuya Yoshizaki, Fumiaki Kawara, Shinwa Tanaka, Yoshinori Morita, Eiji Umegaki, Namiko Hoshi, Takeshi Azuma, Division of Gastroenterology, Department of Internal Medicine, Graduate School of Medicine, Kobe University, Kobe , Japan Takashi Toyonaga, Department of Endoscopy, Kobe University Hospital, Kobe , Japan Takashi Toyonaga, Tadao Nakashige, Hiroshi Takihara, Shinichi Baba, Department of Endoscopy, Kishiwada Tokushukai Hospital, Osaka , Japan Author contributions: Ishida T, Toyonaga T and Ohara Y designed the study; Kitamura Y, Ariyoshi R, Takihara H, Baba S, Yoshizaki T, Kawara F and Tanaka S participated in the acquisition, analysis, and interpretation of the data; Ishida T wrote the manuscript; Ohara Y and Hoshi N revised the article and suggested the comments; Morita Y, Umegaki E and Azuma T supervised the report. Institutional review board statement: This study was reviewed and approved by both the ethics committees of Kobe University Hospital and Kishiwada Tokushukai Hospital. Informed consent statement: All study participants, or their legal guardian, provided informed written consent prior to study enrollment. Conflict-of-interest statement: Toyonaga T invented the FlushKnife-BT in conjunction with Fujifilm and received royalties from its sale; Ishida T, Ohara Y, Nakashige T, Kitamura Y, Ariyoshi R, Takihara H, Baba S, Yoshizaki T, Kawara F, Tanaka S, Morita Y, Umegaki E, Hoshi N, and Azuma T have no conflicts of interest or financial ties to disclose. Data sharing statement: No additional data are available. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Unsolicited manuscript Correspondence to: Takashi Toyonaga, MD, PhD, Department of Endoscopy, Kobe University Hospital, Kusunoki-cho, Chuo-ku, Kobe , Japan. toyonaga@med.kobe-u.ac.jp Telephone: Fax: Received: January 27, 2017 Peer-review started: February 4, 2017 First decision: March 16, 2017 Revised: March 31, 2017 Accepted: June 19, 2017 Article in press: June 19, 2017 Published online: August 7, 2017 Abstract AIM To investigated the hemostatic ability of the S and F1-10 methods in clinical and ex vivo studies. METHODS The hemostatic abilities of the two methods were analyzed retrospectively in all six gastric endoscopic submucosal dissection cases. The treated vessel diameter, compressed vessel frequency, and bleeding frequency after cutting the vessels were noted by the 5422 August 7, 2017 Volume 23 Issue 29

181 Ishida T et al. Efficacy of the forced coagulation mode recorded videos. The coagulation mechanism of the two power settings was evaluated using the data recording program and histological examination on macro- and microscopic levels in the ex vivo experiments using porcine tissues. RESULTS F1-10 method showed a significantly better hemostatic ability for vessels 2 mm in diameter and a trend of overall better coagulation effect, evaluated by the bleeding rate after cutting the vessels. F1-10 method could sustain electrical current longer and effectively coagulate the tissue wider and deeper than the S method in the porcine model. CONCLUSION F1-10 method is suggested to achieve a stronger hemostatic effect than the S method in clinical procedures and ex vivo models. Key words: Endoscopic submucosal dissection; Electrosurgery; Endoknife; Hemostatic effect; The forced coagulation mode The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: The prevention of bleeding during endoscopic submucosal dissection (ESD) is one of the most important factors in safe and successful tumor removal. We investigated the difference in bleeding rates between S method and F1-10 method in stomach ESD. The investigation suggests that F1-10 method can achieve a stronger hemostatic effect than S method for large vessels. In addition, we investigated the difference of the hemostatic strength and mechanism using ex vivo model. F1-10 method could sustain electrical current longer and effectively coagulate wider and deeper areas of tissue than S method, resulting in a strong hemostatic effect. Ishida T, Toyonaga T, Ohara Y, Nakashige T, Kitamura Y, Ariyoshi R, Takihara H, Baba S, Yoshizaki T, Kawara F, Tanaka S, Morita Y, Umegaki E, Hoshi N, Azuma T. Efficacy of forced coagulation with low high-frequency power setting during endoscopic submucosal dissection. World J Gastroenterol 2017; 23(29): Available from: URL: com/ /full/v23/i29/5422.htm DOI: org/ /wjg.v23.i INTRODUCTION Electrosurgery is used in many fields of medicine and is one of the most commonly used energy system in surgery. Basic understanding of electricity is required for the safe use of electrosurgical technology for patient care [1-6]. In the endoscopic field of gastroenterology, endoscopic mucosal resection and endoscopic submucosal dissection (ESD) are popular therapeutic strategies to resect benign and early cancerous lesions that require the use of an electrosurgical generator [7]. Preventing bleeding during operation, especially in ESD, is one of the most important factors to accomplish safe and successful tumor removal [8]. The modern electrosurgery has various coagulation modes. The forced coagulation utilizes a high output voltage > 200 Vp with an interrupted waveform. The forced coagulation creates sparks, which coagulate on superficial tissues. At the same time, a high output voltage coagulation mode, such as the forced coagulation, generally has a cutting ability [9]. In ESD, it can create appropriate coagulation for small vessels, such as the capillaries; however, its effect for nonsmall vessels larger than the capillaries is insufficient, because the non-small vessels are cut before being dehydrated adequately and have a risk of bleeding. Therefore, the forced coagulation mode is thought to be unsuitable for precoagulation of large vessels. On the other hand, the peak voltage between the active electrode and the target tissue in the soft coagulation mode is limited to < 200 Vp. This mode does not cause any sparks, only uses Joule s heat, and avoids rupturing the vessels [10,11]. We previously reported the effectiveness of vessel-sealing with endoknife compression using the soft coagulation mode (S method) in ESD [12]. This method is useful for coagulation without bleeding before cutting relatively large vessels, such as those penetrating between the muscularis propria. However, an important limitation of this mode is that the current cannot flow to the tissue when its resistance becomes too high because of the limited voltage below 200 Vp. Therefore, it has a risk of inadequate coagulation when the vessels are too large and the tissue resistance becomes too high while processing. Owing to this, hemostatic forceps were generally used to precoagulate large vessels. Therefore, we required a more effective setting for large vessels. The forced coagulation mode is usually not used for precoagulation; however, we found when the HF (highfrequency) power is reduced to a quite low level, it can avoid generating sparks. It was suggested that the forced coagulation mode with a low HF power setting be used for precoagulation to process larger vessels. Based on these, vessel-sealing with endoknife compression using the forced coagulation mode with low HF power setting (Effect 1, 10 W: F1-10 method) was also used in our facility (The peak voltage in the forced coagulation is adjusted from Effect 1 to 4; Effect 1 is the lowest peak voltage setting). Accordingly, this setting hardly causes vessel rupture in spite of using the forced coagulation mode. Therefore, we retrospectively analyzed the effectiveness of bleeding control by the S and F1-10 methods to find 5423 August 7, 2017 Volume 23 Issue 29

182 Ishida T et al. Efficacy of the forced coagulation mode A B C D E F Figure 1 Process of the vessel-sealing with endoknife compression technique. A: The vessel penetrating between the muscularis propria is exposed; B-D: The vessel is compressed by the FlushKnife-BT 2.5 mm and coagulated using the S method or F method until the color turned white, which indicates a complete desiccation of the vessel. If it does not turn white completely, we tried this method from the other side; E and F: Finally, the vessel is cut with the FlushKnife-BT 2.5 mm using the forced coagulation mode (Effect 3, 50 W). the optimum power setting. Moreover, the mechanism of coagulation was analyzed by ex vivo experiments using porcine tissues to further evaluate the coagulation ability of these two settings. MATERIALS AND METHODS Patients Between April and December 2014, a single expert endoscopist (Toyonaga T) with an experience of > 4000 cases of ESD performed ESD to treat 36 gastric lesions at Kobe University Hospital and Kishiwada Tokushukai Hospital. Based on the clinical records and recorded videos of the ESD sessions, 22 cases were treated with only the S method and 14 cases with only the F1-10 method. Of these, the patients and lesions that met the following conditions, which can influence the bleeding tendency of the patients, and those lesions typically require no precoagulation, were excluded from this study: (1) patients under medication with any antiplatelet or anticoagulation effect; (2) patients undergoing dialysis; (3) lesions in the antrum; (4) lesions with ulcer; and (5) resected specimen < 30 mm. As a result, six cases each with the S and F1-10 methods were included in the study. Informed consent for the procedure was obtained from all patients; this retrospective study was approved by both the ethics committees of Kobe University Hospital and Kishiwada Tokushukai Hospital. Vessel-sealing with endoknife compression technique ESD was carried out with a FlushKnife-BT 2.5 mm (DK- 2618JB; Fujifilm, Tokyo, Japan) through a conventional single-channel endoscope (GIF-Q240 Olympus, Tokyo, Japan) with a transparent hood (Top Co., Ltd. Tokyo, Japan) at the tip of the endoscope. VIO 300D (ERBE Elektromedizin, Tübingen, DEU) was used as the electrical surgical generator. Vessel-sealing with endoknife compression was carried out as follows: (1) exposure and isolation of the target vessel in the submucosal layer; (2) compression of the vessel with the FlushKnife-BT and coagulating it with the S method (Effect 7, 100 W) or F1-10 method (Effect 1, 10 W) until the vessel turned white, which is a sign of coagulation completion; and (3) cutting of the vessel using the forced coagulation mode (Effect 3, 50 W) (Figure 1A-F) [12]. This technique was initially applied to process the vessel; however, when sufficient coagulation was not achieved, hemostatic forceps were used. Thereafter, when the same or larger-sized vessel was found in the same patient, hemostatic forceps were sometimes used without the trial of vesselsealing because successful sealing was not expected. A total of 12 recorded ESD sessions, including six each of the S and F1-10 method, were viewed by two endoscopists (Ishida T and Ohara Y). The treatment time was counted from the beginning of the local injection to the end of the treatment. The diameter of the processed vessels, frequency of the compressed 5424 August 7, 2017 Volume 23 Issue 29

183 Ishida T et al. Efficacy of the forced coagulation mode A B Figure 2 Evaluation of coagulation by an ex vivo model. A: The FlushKnife-BT 2.5 mm was placed on the fresh pork block and lightly pressed by the transparent glass to apply even pressure to each tip; B: The 3-mm ball tip electrodes were used to investigate the width and depth of the coagulation. Table 1 Patient and lesion baseline data in the S and F1-10 methods S method (n = 6) F1-10 method (n = 6) P 3 value Age, median (yr) (range) 70 (64-87) 71 (53-79) 0.81 Sex (male/female) 5:1 4: Lesion location, U/M/L 1 3/3/0 4/2/ Histology, well/mod/poor 6/0/0 6/0/ Tumor size, median (mm) 13.5 (8-36) 16 (6-23) 0.60 (range) Resected size, median 50.5 (33-64) 44.5 (31-56) 0.63 (mm) (range) Depth of tumor invasion, 4/2/0 3/1/ M/SM1/SM2 2 Median time of treatment (min) Postoperative bleeding rate En bloc resection rate 100% 100% The three portions of the stomach; 2 Depth of tumor invasion was classified as follows: M, tumor confined to the mucosa; SM1, tumor confined within 0.5 mm of the muscularis mucosae; SM2, tumor invasion is 0.5 mm or deeper into the muscularis mucosae; 3 Categorical variables were compared using the two-sided Fisher's exact test and χ 2 test. Continuous variables were compared using the Wilcoxon's rank-sum test. U: Upper third; M: Middle third; L: Lower third. vessel by the FlushKnife-BT, and time to complete the coagulation were evaluated in a blind manner. The diameter of the vessels was calculated by comparing it with the ball tip (0.9 mm) or the shaft (0.5 mm) of the FlushKnife, sheath (2.7 mm), and length between the sheath and the ball tip (2.5 mm) [13]. Bleeding after procession was defined when it required the use of hemostatic forceps or more than thrice the additional hemostatic procedure using the FlushKnife-BT. The bleeding rates after endoknife precoagulation were compared between the S and F1-10 methods. Evaluation of coagulation by an ex vivo model A 2.5-cm thick fresh pork block with a return electrode underneath was prepared in the metal vat. The unused FlushKnife-BT 2.5 mm was placed on the block and lightly pressed by the transparent glass to apply even pressure to each tip (Figure 2A). The VIO 300D was used as the electrosurgical generator, and electrical current was applied using the two different power settings, the S method (Effect 7, 100 W) and F1-10 method (Effect 1, 10 W), five times each with an unused FlushKnife-BT every time. The peak voltage (Vp), current elapsed time (s), and electric energy (W) were measured with the lapse of time by a data recording program (VIO DOKU, ERBE Elektromedizin, Tübingen, DEU). The current elapsed time was defined as the time from the start of the electric current until it went off. The 3-mm ball tip electrodes were used to investigate the depth of coagulation (Figure 2B) because the tip of the FlushKnife-BT was too small to evaluate the deference of the coagulated area. Paraffin-embedded sections were made, and hematoxylin-eosin (H and E) staining was performed to microscopically confirm the tissue denaturation in the examination using the FlushKnife-BT. Statistical analysis Categorical variables were compared using the twosided Fisher's exact test and χ 2 test. Continuous variables were compared using the Wilcoxon's ranksum test. Statistical significances were defined as P < All statistical analyses were performed using the JMP 11 (SAS Institute Inc., Cary, NC, United States). RESULTS Clinical results of gastric ESD Patient and treated lesion characteristics are shown in Table 1. No significant difference was found between the S and F1-10 method groups. The total number of vessels that required coagulation was 61 and 63 in the S and F1-10 method groups, respectively. Notably, 12 vessels in the S method and one in the F1-10 method were treated by hemostatic forceps, without any trial of the endoknife precoagulation. Among these, seven vessels in the S method and one in the F1-10 method were treated with forceps because the vessels were 5425 August 7, 2017 Volume 23 Issue 29

184 Ishida T et al. Efficacy of the forced coagulation mode Number of subject vessels S method: n = 61 F1-10 method: n = 63 Number of vessels processed by hemostasis forceps S method: n = 12 F1-10 method: n = 1 (Number of vessels processed by hemostasis forceps without vessel-sealing) S method: n = 7 F1-10 method: n = 1 Number of vessel-sealing with endoknife compression S method: n = 49 F1-10 method: n = 62 Number of small vessels (less than 2 mm) S method: n = 23 F1-10 method: n = 33 Number of large vessels (2 mm or more) S method: n = 26 F1-10 method: n = 29 Figure 3 Vessels processed by the vessel-sealing with endoknife compression. Table 2 Results of the vessel diameter, frequency of the compressed vessel, and coagulation time in the vesselsealing with endoknife compression technique during gastric endoscopic submucosal dissection Number of vessels processed by vessel-sealing with endoknife compression Median vessel diameter (mm) (range) Median frequency of compressed vessel (times) (range) Median time of coagulation (s) (range) S method F1-10 method P 1 value (1-3) 1.5 (1-3) (1-8) 2 (1-5) (2-48) 10 (1-58) Continuous variables were compared using the Wilcoxon's rank-sum test. larger than the vessel with failed precoagulation in the same patient. The rest of the 49 and 61 vessels in the S and F1-10 methods, respectively, processed by endoknife precoagulation were compared for bleeding control efficacy of the electrical output settings (Figure 3). The details of the processed vessels are shown in Table 2. The median vessel diameter was 2 mm in the S method and 1.5 mm in the F1-10 method. The median frequency of the compressed vessel was twice in both methods, and the median coagulation time was 9 s and 10 s in the S and F1-10 methods, respectively. No significant difference was found between the S and F1-10 methods. The bleeding rate after vessel processing was 18.4% (8/49) and 4.8% (3/62) in the S and F1-10 methods, respectively (P = 0.058, OR = 3.84, 95%CI: ). No statistically significant differences were found; however, the F1-10 method strongly showed a trend in preventing bleeding after precoagulation compared with the S method (P = 0.058). We further investigated the bleeding rates of the large vessels, defined as 2 mm in diameter. There were 26 and 29 large vessels in the S and F1-10 methods, respectively. The bleeding rates of the large vessels were 26.9% (7/26) and 3.4% (1/29) in the S and F1-10 methods, respectively, which were significantly different (P = 0.021, OR = 10.32, 95%CI: ) (Table 3). Ex vivo experimental results The peak voltage, current elapsed time, and electric energy were measured by the VIO DOKU using the FlushKnife-BT in a porcine block. The median peak voltage was 172 Vp and 560 Vp in the S and F1-10 methods, respectively. The time-dependent output power is shown in Figure 4. The median current elapsed time was 0.22 s and 1.54 s in the S and F1-10 methods, respectively; the F1-10 method could keep the electric current longer than the S method. The mean total electrical energy was 6.34 W and 12.5 W in the S and F1-10 methods, respectively (Table 4). The width and depth of coagulation using the 3-mm ball tip electrode were wider (8 mm vs 5 mm) and deeper (7 mm vs 3 mm) in the F1-10 method compared with the S method in the macroscopic views (Figure 5A and B). The H&E-stained section of the porcine block coagulated with the FlushKnife- BT showed that coagulation with the F1-10 method spread wider and deeper to the surrounding tissues compared to that with the S method (Figure 5C). DISCUSSION ESD has enabled an endoscopic en bloc resection of large tumors in the esophagus, stomach, and colorectum. However, intraoperative bleeding remains one of the major complications during ESD, although 5426 August 7, 2017 Volume 23 Issue 29

185 Ishida T et al. Efficacy of the forced coagulation mode Output power (W) FORCED (1) FORCED (2) FORCED (3) FORCED (4) FORCED (5) SOFT (1) SOFT (2) SOFT (3) SOFT (4) SOFT (5) Current elapsed time (s) Figure 4 Time-dependent HF power in F1-10 and S methods measured by the VIO DOKU. A B C Figure 5 Macroscopic view after coagulation by the ball electrode with a 3-mm tip and microscopic view after coagulation by the FlushKnife-BT in the porcine block. A: Macroscopic view of the front surface after coagulation using the ball electrode with a 3-mm tip. The coagulation at the left and right is the result of the F1-10 and S methods, respectively; B: Macroscopic view of a transverse section after coagulation using the ball electrode with a 3-mm tip; C: Microscopic view of the hematoxylin-eosin staining after coagulation by the FlushKnife-BT 2.5 mm. The coagulation at the left and right is the result of the F1-10 and S methods, respectively. bleeding improved to some degree by the development of devices, such as endoknives, hemostatic forceps, and electrical surgical units [14]. In actual practice, it sometimes takes a lot of time to stop bleeding in ESD; once the lesion is bleeding, it is difficult to recognize the submucosal layers as these are blood-stained, making the procedure more difficult to perform [15]. The prevention of intraoperative bleeding is important to achieve a safe ESD. The FlushKnife-BT, which has a ball tip on top of the needle, improved the hemostasis effect compared with the conventional needle-type FlushKnife because its round ball tip compressed the vessels widely and decreased the current density [13]. However, the FlushKnife-BT still pose a bleeding risk as the vessels are cut before adequate coagulation. It was suggested that the S method is useful for precoagulation. Soft coagulation regulates the peak voltage below 200 Vp, and it can dehydrate the vessels without any spark or rupture. Therefore, this mode was thought to be appropriate for this technique. However, its efficacy was insufficient, especially for large vessels in the upper and middle thirds of the 5427 August 7, 2017 Volume 23 Issue 29

186 Ishida T et al. Efficacy of the forced coagulation mode Table 3 Rates of bleeding after vessel-sealing with endoknife compression for all vessels and large vessels S method F1-10 method P 2 value OR 95%CI Rate of bleeding 16.3% (8/49) 4.8% (3/62) Rate of large vessel bleeding % (7/26) 3.4% (1/29) Large vessels were defined as those with > 2 mm diameter; 2 Fisher's exact test was used. Table 4 Electrical condition using the FlushKnife-BT in the porcine ex vivo model analyzed by the VIO DOKU FlushKnife-BT 2.5 mm S method F1-10 method Median peak voltage (Vp) 172 ( ) 560 ( ) Median current elapse time (s) 0.22 ( ) 1.54 ( ) Median total electric energy (W) 6.34 ( ) 12.5 ( ) stomach [16]. We introduced this technique using the F1-10 setting as aforementioned by modifying the peak voltage and power setting, and the usefulness of the S and F1-10 methods were compared in this study. In the clinical study, the bleeding rates after vessel processing for large vessels were 26.9% and 3.4% in the S and F1-10 methods, respectively, which were significantly different. The median current elapsed time was longer, and the width and depth of coagulation were wider and deeper in the F1-10 method than in the S method in the ex vivo study. Forced coagulation mode usually generates the sparks and fulguration accompanying the cutting function added to the coagulation. It was known that this mode was unsuitable for the endoknife precoagulation. However, when the peak voltage and electrical power in the forced coagulation were decreased to the level of the F1-10 setting, the current elapsed time became much longer than that of the S method and sparks were not observed in both ESD and experiment with the porcine tissue. While the electrode heat dehydrates the tissues and increases tissue resistance, the electric current gradually decreased and turned off. This mechanism can be explained by Ohm's law, in which voltage (U) = resistance (R) electric current (I). Forced coagulation creates a higher voltage than that of soft coagulation and could keep the current flow much longer even after the tissue resistance increased, as shown in the experiment. It can imply that under the generation of Joule's heat without sparks, the coagulation range is decided by the current elapsed time. For this mechanism, the F1-10 method achieved a wider and deeper coagulation area than the S method. Our study showed the usefulness of the F1-10 method from the point of superior coagulation ability during ESD. On the other hand, this method may have the risk of perforation due to deep coagulation. However, we did not experience intraoperative perforation using the F1-10 method even during ESD in the esophagus and colorectum, which have thinner walls than the stomach. Further, no obvious increase in the postoperative perforation rate has been observed since the induction of the F1-10 method in our facility until the present. Such finding may be explained by the vessel-sealing with endoknife compression technique, which applies electrical energy after compressing and pulling the vessel apart from the muscle layer. Its concept is essentially the same as that of coagulation using hemostatic forceps. However, it must be emphasized that too much coagulation on the muscularis propria should be avoided to prevent deep coagulation. This caution is similar as with the hemostatic forceps should be used [17]. Recently, one research reported that the bleeding rate after endoknife precoagulation was not significantly different between the use of the F1-10 method and the hemostatic forceps with the soft coagulation during gastric ESD; further, the use of F1-10 did not result in serious intraoperative bleeding and reduced the frequency of using hemostatic forceps [18]. The F1-10 method was demonstrated to be as safe and effective for bleeding prevention as hemostatic forceps. However, there were some limitations in our study. First, the vessels processed by hemostatic forceps were excluded from the analysis (12 in the S method and one in the F1-10 method); it has a potential to be a selection bias, however, those included were only the vessels larger than the ones for which precoagulation was not accomplished. Therefore, even if endoknife precoagulation was attempted, it was highly expected that it would fail. Although there is no research that compares the precoagulation effectiveness between the S-method and hemostatic forceps method yet, it is empirically known that the coagulation ability of hemostatic forceps is stronger than the S method; further, precoagulation using hemostatic forceps can reduce the bleeding risk [19,20]. If there was a selection bias, it would be for the advantage of the S method in this study. However, the result still suggested that the F1-10 method was superior to the S method. Second, the clinical data shown are achieved under the use of the FlushKnife-BT, which has a ball tip and is capable of firm vessel compression. This FlushKnife-BT method should not be simply applied when precoagulation with different types of ESD knives is performed. The ideal generator setting should be investigated for each bleeding control strategy and for different types of devices. Further, only a skilled endoscopist performed 5428 August 7, 2017 Volume 23 Issue 29

187 Ishida T et al. Efficacy of the forced coagulation mode the ESD in the present study. The generalizability of the result in this study remains uncertain; however, we believe that if proper precoagulation procedure is conducted, similar results could be obtained. In conclusion, the vessel-sealing with endoknife compression technique using the F1-10 method is better than that using the S method, especially for large vessels. Thus, the F1-10 method is considered to promote a safer and better quality ESD. ACKNOWLEDGMENTS We would like to thank Masaki Yamazaki from AMCO Incorporated (Tokyo, Japan) for the review of terminology matters, and AMCO Incorporated (Tokyo, Japan) for supporting the VIO DOKU. COMMENTS Background Bleeding control is one of the most important factors to successful and safe endoscopic submucosal dissection (ESD). The authors reported that the endoscopic precoagulation technique using the soft coagulation mode (S-method) is effective. However, the S method is insufficient for large vessels, and they usually have used hemostatic forceps for preventing bleeding. They found that the forced coagulation mode with low high-frequency power setting (F1-10 method) can exhibit a precoagulation function. F1-10 method is suggested to be useful for large vessel. Research frontiers This studies first reported that the usefulness of the forced coagulation mode with low high-frequency power setting for the endoscopic vessel-sealing. This mode setting suggested a strong coagulation effect without rupturing the vessels compared with the conventional soft coagulation method in clinical procedure and ex vivo model. Innovations and breakthroughs The use of F1-10 method can lead to not only the prevention of bleeding but also cost savings and shortening ESD procedure. Applications This study suggested that F1-10 method achieve a stronger hemostatic effect than the S method in clinical procedures and ex vivo models. Terminology The soft coagulation mode and forced coagulation mode are functions of ERBE VIO system. The Soft coagulation regulates the peak voltage below 200 Vp. The forced coagulation utilizes a high output voltage > 200 Vp with an interrupted waveform, and usually generates the sparks and fulguration accompanying the cutting function added to the coagulation. However, the High-frequency power is reduced to a quite low level, it can avoid generating sparks. Therefore, the authors suggested the usefulness of the forced coagulation mode with low highfrequency power setting in clinical procedures and ex vivo models. Peer-review This is a paper on the timely topic, comparing S method and F1-10 method. Authors indicated that F1-10 method is suggested to be useful for large vessel. REFERENCES 1 Wu MP, Ou CS, Chen SL, Yen EY, Rowbotham R. Complications and recommended practices for electrosurgery in laparoscopy. Am J Surg 2000; 179: [PMID: ] 2 Alkatout I, Schollmeyer T, Hawaldar NA, Sharma N, Mettler L. Principles and safety measures of electrosurgery in laparoscopy. JSLS 2012; 16: [PMID: DOI: / X ] 3 Odell RC. Surgical complications specific to monopolar electrosurgical energy: engineering changes that have made electrosurgery safer. J Minim Invasive Gynecol 2013; 20: [PMID: DOI: /j.jmig ] 4 Sutton C, Abbott J. History of power sources in endoscopic surgery. J Minim Invasive Gynecol 2013; 20: [PMID: DOI: /j.jmig ] 5 Feldman LS, Fuchshuber PR, Jones DB. The SAGES manual on the fundamental use of surgical energy (FUSE). Springer, New York, Taheri A, Mansoori P, Sandoval LF, Feldman SR, Pearce D, Williford PM. Electrosurgery: part I. Basics and principles. J Am Acad Dermatol 2014; 70: 591.e1-e14; quiz [PMID: DOI: /j.jaad ] 7 Morris ML, Tucker RD, Baron TH, Song LM. Electrosurgery in gastrointestinal endoscopy: principles to practice. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 8 Ono H, Kondo H, Gotoda T, Shirao K, Yamaguchi H, Saito D, Hosokawa K, Shimoda T, Yoshida S. Endoscopic mucosal resection for treatment of early gastric cancer. Gut 2001; 48: [PMID: ] 9 Reidenbach HD, Buess G. Ancillary technology: electrocautery, thermocoagulation and laser. Springer Berlin Heidelberg, Berlin, Sakuragi T, Okazaki Y, Mitsuoka M, Itoh T. Dramatic hemostasis of the transected pulmonary artery model using SOFT COAG electrosurgical output. Interact Cardiovasc Thorac Surg 2008; 7: [PMID: DOI: /icvts ] 11 Sakuragi T, Ohma H, Ohteki H. Efficacy of SOFT COAG for intraoperative bleeding in thoracic surgery. Interact Cardiovasc Thorac Surg 2009; 9: [PMID: DOI: / icvts ] 12 Tanaka S, Toyonaga T, Morita Y. Endoscopic vessel sealing: a novel endoscopic precoagulation technique for blood vessels during endoscopic submucosal dissection. Dig Endosc 2013; 25: [PMID: DOI: /den.12045] 13 Toyonaga T, Man-I M, Fujita T, Nishino E, Ono W, Morita Y, Sanuki T, Masuda A, Yoshida M, Kutsumi H, Inokuchi H, Azuma T. The performance of a novel ball-tipped Flush knife for endoscopic submucosal dissection: a case-control study. Aliment Pharmacol Ther 2010; 32: [PMID: ] 14 ASGE Technology Committee., Maple JT, Abu Dayyeh BK, Chauhan SS, Hwang JH, Komanduri S, Manfredi M, Konda V, Murad FM, Siddiqui UD, Banerjee S. Endoscopic submucosal dissection. Gastrointest Endosc 2015; 81: [PMID: DOI: /j.gie ] 15 Yamamoto S, Uedo N, Ishihara R, Kajimoto N, Ogiyama H, Fukushima Y, Yamamoto S, Takeuchi Y, Higashino K, Iishi H, Tatsuta M. Endoscopic submucosal dissection for early gastric cancer performed by supervised residents: assessment of feasibility and learning curve. Endoscopy 2009; 41: [PMID: DOI: /s ] 16 Toyonaga T, Nishino E, Hirooka T, Ueda C, Noda K. Intraoperative bleeding in endoscopic submucosal dissection in the stomach and strategy for prevention and treatment. Dig Endosc 2006; 18; S [DOI: /j x] 17 Mann NS, Mann SK, Alam I. The safety of hot biopsy forceps in the removal of small colonic polyps. Digestion 1999; 60: [PMID: ] 18 Horikawa Y, Toyonaga T, Mizutamari H, Mimori N, Kato Y, Fushimi S, Okubo S. Feasibility of Knife-Coagulated Cut in Gastric Endoscopic Submucosal Dissection: A Case-Control 5429 August 7, 2017 Volume 23 Issue 29

188 Ishida T et al. Efficacy of the forced coagulation mode Study. Digestion 2016; 94: [PMID: DOI: / ] 19 Toyonaga T, Nishino E, Man-I M, East JE, Azuma T. Principles of quality controlled endoscopic submucosal dissection with appropriate dissection level and high quality resected specimen. Clin Endosc 2012; 45: [PMID: DOI: / ce ] 20 Park CH, Lee SK. Preventing and controlling bleeding in gastric endoscopic submucosal dissection. Clin Endosc 2013; 46: [PMID: DOI: /ce ] P- Reviewer: Xu MD S- Editor: Qi Y L- Editor: A E- Editor: Zhang FF 5430 August 7, 2017 Volume 23 Issue 29

189 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Prospective Study ORIGINAL ARTICLE Clinical outcomes of isolated renal failure compared to other forms of organ failure in patients with severe acute pancreatitis Amir Gougol, Mohannad Dugum, Anwar Dudekula, Phil Greer, Adam Slivka, David C Whitcomb, Dhiraj Yadav, Georgios I Papachristou Amir Gougol, Mohannad Dugum, Anwar Dudekula, Phil Greer, Adam Slivka, David C Whitcomb, Dhiraj Yadav, Georgios I Papachristou, Division of Gastroenterology, Hepatology and Nutrition, Department of Medicine, University of Pittsburgh, Pittsburgh, PA 15213, United States Author contributions: Dugum M, Gougol A and Papachristou GI contributed to study concept and design, acquisition of data, statistical analysis, data interpretation, drafting of the manuscript, critical revision of the manuscript for important intellectual content; Dudekula A and Greer P contributed to statistical analysis, data interpretation; Slivka A, Whitcomb DC and Yadav D contributed to acquisition of data, critical review of manuscript for important intellectual content; all authors approved the final version of the manuscript. Institutional review board statement: The study was reviewed and approved by the Institutional Review Board of the University of Pittsburgh. Informed consent statement: All study participants, or their legal guardian, provided written consent prior to study enrollment. Conflict-of-interest statement: The authors of this manuscript have no conflicts of interest to disclose. Data sharing statement: Technical appendix, statistical code, and dataset available from the corresponding author at papachri@ pitt.edu. Participants gave informed consent for data sharing. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Georgios I Papachristou, MD, PhD, Division of Gastroenterology, Hepatology and Nutrition, Department of Medicine, University of Pittsburgh, 200 Lothrop Street, UPMC Presbyterian, M2, C-Wing, Pittsburgh, PA 15213, United States. papachri@pitt.edu Telephone: Fax: Received: March 22, 2017 Peer-review started: March 28, 2017 First decision: April 20, 2017 Revised: June 3, 2017 Accepted: July 4, 2017 Article in press: July 4, 2017 Published online: August 7, 2017 Abstract AIM To assess differences in clinical outcomes of isolated renal failure (RF) compared to other forms of organ failure (OF) in patients with severe acute pancreatitis (SAP). METHODS Using a prospectively maintained database of patients with acute pancreatitis admitted to a tertiary medical center between 2003 and 2016, those with evidence of persistent OF were classified to renal, respiratory, cardiovascular, or multi-organ (2 or more organs). Data regarding demographics, comorbidities, etiology of acute pancreatitis, and clinical outcomes were prospectively recorded. Differences in clinical outcomes after development of isolated RF in comparison to other forms of OF were determined using independent t and Mann-Whitney U tests for continues variables, and χ 2 test for discrete variables August 7, 2017 Volume 23 Issue 29

190 Gougol A et al. Isolated RF vs other forms of OF RESULTS Among 500 patients with acute pancreatitis, 111 patients developed persistent OF: mean age was 54 years, and 75 (67.6%) were male. Forty-three patients had isolated OF: 17 (15.3%) renal, 25 (21.6%) respiratory, and 1 (0.9%) patient with cardiovascular failure. No differences in demographics, etiology of acute pancreatitis, systemic inflammatory response syndrome scores, or development of pancreatic necrosis were seen between patients with isolated RF vs isolated respiratory failure. Patients with isolated RF were less likely to require nutritional support (76.5% vs 96%, P = 0.001), ICU admission (58.8% vs 100%, P = 0.001), and had shorter mean ICU stay (2.4 d vs 15.7 d, P < 0.001), compared to isolated respiratory failure. None of the patients with isolated RF or isolated respiratory failure died. CONCLUSION Among patients with SAP per the Revised Atlanta Classification, approximately 15% develop isolated RF. This subgroup seems to have a less protracted clinical course compared to other forms of OF. Isolated RF might be weighed less than isolated respiratory failure in risk predictive modeling of acute pancreatitis. Key words: Renal failure; Respiratory failure; Organ failure; Acute pancreatitis; Clinical outcomes The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: In a large prospective observational study, we show that approximately 15% of patients with severe acute pancreatitis develop isolated renal failure. This subgroup has an overall better prognosis and less protracted clinical course compared to patients with other isolated or multiple organ failure. These results can be useful in allocating healthcare resources and counseling patients. We propose that isolated renal failure be weighed less in risk predictive modeling of acute pancreatitis. Gougol A, Dugum M, Dudekula A, Greer P, Slivka A, Whitcomb DC, Yadav D, Papachristou GI. Clinical outcomes of isolated renal failure compared to other forms of organ failure in patients with severe acute pancreatitis. World J Gastroenterol 2017; 23(29): Available from: URL: com/ /full/v23/i29/5431.htm DOI: org/ /wjg.v23.i INTRODUCTION Acute pancreatitis (AP) is a leading cause of gastrointestinal-related hospital admissions, and its incidence continues to increase [1]. While the majority of patients have a mild and self-limiting clinical course, about 20% progress to develop end-organ failure with or without local complications including pancreatic necrosis. Overall, 1%-2% of patients die from AP-related complications [2]. The Revised Atlanta Classification, based on an international consensus, stratifies AP according to disease severity into 3 categories: mild [no organ failure (OF) and no local complications], moderate (transient OF resolving in less than 48 h and/or local complications), and severe (persistent OF lasting at least 48 h with/ without local complications) [3]. Within the spectrum of severe AP (SAP) according to the Revised Atlanta Classification, persistent OF encompasses isolated OF or multiple OF. The three main organ systems that are affected in SAP are renal, respiratory, and/or cardiovascular. Patients with persistent OF frequently have local complications [4]. Variability of the impact of organ-specific failure on the clinical course of AP may be important to appropriately triage healthcare resources, guide management, predict long-term outcomes, and allow the comparison of different therapeutic interventions [5]. Renal failure (RF) in SAP can be isolated, but more commonly is part of multiple OF. Acute RF in the setting of multiple OF has been shown to be associated with worse clinical outcomes including prolonged hospital stay, admission to the intensive care unit (ICU), and higher mortality [6]. One study reported a 10-fold increase in mortality when acute RF complicates SAP [7]. However, the specific clinical outcomes of the SAP patient subgroup with isolated RF have not been well characterized. The aim of this study was to assess the incidence of isolated RF in patients with SAP, and analyze differences in clinical outcomes compared to other forms of OF (isolated and multiple). MATERIALS AND METHODS Study population Pancreatitis-associated risk of organ failure (PROOF) is an ongoing observational study conducted at the University of Pittsburgh Medical Center and approved by the institutional review board (protocol ID PRO ). Patients who meet at least 2 of 3 criteria for diagnosis of AP are considered eligible for enrollment: presence of abdominal pain characteristic of AP, serum lipase level 3 times the upper limit of normal, and imaging findings consistent with AP. Patients with imaging and/ or clinical findings suggestive of chronic pancreatitis or pancreatic cancer are excluded. After obtaining informed consent, each patient is enrolled into the study following admission or transfer to our center, and is prospectively followed until hospital discharge. The study has been conducted in three separate time periods, with consecutive enrollment of patients starting in June 2003 until January Pertinent demographic, laboratory, and radiological data were prospectively recorded. Outside hospital medical records of transferred patients were reviewed. Diagnosis and etiology of AP, development of local 5432 August 7, 2017 Volume 23 Issue 29

191 Gougol A et al. Isolated RF vs other forms of OF complications, type and duration of OF, and other clinical outcomes including need for nutritional support, admission to the ICU, and length of stay were recorded. Need for nutritional support refers to inability to tolerate oral feeding and includes enteral tube feedings and/or parenteral nutrition. Length of stay refers to overall length of stay from the time of admission to discharge, which includes duration of stay in outside hospitals for transferred patients. For patients with RF, fractional excretion of sodium (FENa) was calculated as [(Urine Na/Serum Na)/(Urine Cr/Serum Cr) 100], when these values were available. Need for and duration of hemodialysis, and development of chronic kidney disease at 3 mo were recorded. For patients with respiratory failure, need for and duration of intubation, and need for tracheostomy were recorded. Definition and classification of organ failure Patients who developed OF were classified into: isolated RF, respiratory failure, cardiovascular failure, or multiple OF (2 or more organs). OF was defined as a score of 2 or more for one of these organ systems using the modified Marshall scoring system. RF is defined by a serum creatinine of 1.9 mg/dl or higher, respiratory failure is defined by a PaO2/FiO2 of 201 or less, and cardiovascular failure is defined by a systolic blood pressure < 90 mmhg that is not fluid responsive [8]. Statistical analysis Data regarding demographics, comorbidities, etiology of AP, and clinical outcomes were stratified and compared with respect to development and type of OF. Initially, patients with isolated OF were compared with those with no OF and those with multiple OF. Then, patients with isolated RF were compared to those with other types of isolated OF. Next, we attempted a multivariate logistic regression model to determine predictors of organ failure subtypes (which was coded as a dichotomous variable: patients with isolated renal failure were coded 0 and those with isolated pulmonary failure 1 ). Patient characteristics with a P-value < 0.25 in univariate analysis were included in multivariate model. A stepwise forward and backwards elimination method were attempted to find a final parsimonious model. Additionally, absence of collinearity was confirmed using pre-specified variance inflation factor of 5. Normality in continuous data was evaluated utilizing Kolmogorov-Smirnov test. Mean ± SD or median with interquartile range were used for continuous variables and counts with percentages for categorical variables. Differences in clinical outcomes following development of isolated RF in comparison to other forms of OF, were determined using t-test and Mann-Whitney U tests for continues variables, and Pearson s chi-square test for categorical variables. All tests were two-tailed and a P-value 0.05 was considered statistically significant. Analyses were performed using SPSS (IBM SPSS Statistics for Windows, Version Armonk, NY: IBM Corp), and Stata (StataCorp Stata Statistical Software: Release 13. College Station, TX: StataCorp LP). The statistical review of the study was performed by a biomedical statistician. RESULTS A total of 500 patients with AP were studied. Figure 1 shows the patient cohort distribution according to development of OF, duration, and specific organ(s) involved.. One hundred and eleven patients developed persistent OF: 43 (38.7%) developed isolated OF and 68 (61.3%) developed multiple OF. The mean age for patients with persistent OF was 54.2 years, and 75 (67.6%) were male. Table 1 summarizes the characteristics of all AP patients, comparing patients with isolated, multiple, and no persistent OF. Overall, the three groups were comparable in age, gender, race, etiology of AP, and pre-existing chronic illnesses. Table 2 shows the differences in severity predictors, imaging findings, interventions, and clinical outcomes among AP patients with isolated, multiple, and no persistent OF. As expected, SIRS criteria were more common in patients with OF than those with no persistent OF. Need for admission to the ICU (100% vs 83.7%, P = 0.001), and median length of ICU stay (18.5 d vs 6 d, P < 0.001), were higher in patients with multiple OF than isolated OF. Patients with multiple OF were more likely to have infected pancreatic necrosis (38.9%), extrapancreatic infections (44.1%), and longer median total hospital stay (37 d), than those with isolated OF. Twenty two of 68 patients with multiple OF (32.4%) died, while none of the patients with isolated OF or no persistent OF died (P < 0.001). Isolated renal failure compared to renal failure as part of multiple organ failure In total, 17 patients developed isolated RF while 65 patients had RF as part of multiple OF. The majority of patients with multiple OF had RF (96%). Among those with isolated RF, only 2 (11.8%) patients required the initiation of hemodialysis compared to 36 (55.4%) of patients with RF as part of multiple OF (P = 0.001). The FENa, when available, was less than 2% for most patients in both groups (66.7% of isolated RF and 88.9% of RF as part of multiple OF, P = 0.17). Length of stay was significantly shorter in patients with isolated RF compared to those with multiple OF (19 d vs 38 d, P = 0.001). There was no difference in the development of chronic kidney diseases between both groups (16.7% of isolated RF patients vs 26.2% of multiple OF patients, P = 0.496). None of the patients with isolated RF required prolonged hemodialysis after discharge, while 55.2% of those with RF as part of multiple OF did (P = 0.001). None of the patients with IRF died, while 22 (33.9%) of those with RF as part of multiple OF died (P = 0.005) August 7, 2017 Volume 23 Issue 29

192 Gougol A et al. Isolated RF vs other forms of OF AP n = 500 No OF n = 371 OF n = 129 Persistent OF n = 111 Transient OF n = 18 MOF n = 68 IOF n = 43 Including RF n = 65 Including respiratory failure n = 66 Including cardiovascular n = 39 IRF n = 17 Isolated respiratory failure n = 25 Isolated cardiovascular failure n = 1 Figure 1 Patient cohort flowchart based on development of organ failure, duration, and specific organ(s) involved. Table 1 Characteristics among patients with isolated organ failure, multiple organ failure, and no persistent organ failure IOF MOF P value No OF P value n = 43 n = 68 n = 389 Mean age ± SD 50.7 (18.5) 56.4 (15.4) ± Male 29 (67.4) 46 (67.6) (45.8) Caucasian 39 (90.7) 61 (89.7) (88.4) 0.66 Median BMI (IQR) 28.8 ( ) 32.2 ( ) ( ) 0.27 Transfers 35 (81.4) 61 (89.7) (43.2) < First episode of AP 35 (81.4) 58 (85.3) (59.9) Etiology Biliary 17 (39.5) 35 (51.5) (37) 0.03 Alcoholic 12 (27.9) 8 (11.8) 51 (13.1) Idiopathic 4 (9.3) 9 (13.2) 77 (19.8) Hypertriglyceridemia 4 (9.3) 9 (13.2) 26 (6.7) Post-ERCP 2 (4.7) 3 (4.4) 63 (16.2) Other 4 (9.3) 4 (5.9) 28 (7.2) Comorbidities Pre-existing heart failure 0 2 (2.9) (2.3) 0.31 Pre-existing renal failure 1 (2.3) 4 (5.9) (2.1) 0.9 Pre-existing respiratory disorder 2 (4.7) 1 (1.5) (4.1) 0.87 Values presented as mean ± SD or n (%). P values: 1 st column reflects comparison of IOF to MOF, and 2 nd column reflects comparison of IOF to no OF. IOF: Isolated organ failure; MOF: Multiple organ failure; OF: Organ failure; AP: Acute pancreatitis; BMI: Body mass index; IQR: Interquartile range; ERCP: Endoscopic retrograde cholangiopancreatography. Isolated renal failure compared to isolated respiratory failure Overall, 43 developed isolated OF: 17 (15.3%) RF, 25 (21.6%) had respiratory failure, and 1 (0.9%) patient had cardiovascular failure. Thus, cardiovascular failure was not included in further analysis. No differences in demographics, etiology of AP, systemic inflammatory response syndrome scores, or development of pancreatic necrosis were present between isolated RF and isolated respiratory failure. Patients with isolated 5434 August 7, 2017 Volume 23 Issue 29

193 Gougol A et al. Isolated RF vs other forms of OF Table 2 Severity predictors, imaging findings, and clinical outcomes among acute pancreatitis patients with isolated organ failure, multi-organ failure, and no persistent organ failure n (%) IOF MOF P value No OF P value n = 43 n = 68 n = 389 SIRS score on admission 2 23 (53.5) 45 (66.2) (27.5) < SIRS score at 48 h of admission 2 26 (60.5) 52 (76.5) (21.6) < Mean IVF the first 24 h in liters (SD) 4.38 (1.98) 5.04 (1.79) (1.5) 0.23 ICU admission 36 (83.7) 68 (100) (12.9) < Median ICU LOS in days (IQR) 6 (2-14.4) 18.5 (10-35) < < Need for nutritional support 38 (88.4) 58 (85.3) (20.6) < Pancreatic necrosis 1 28/39 (71.8) 45/54 (83.3) /251 (31.9) < Infected necrosis 1 5/39 (12.8) 21/54 (38.9) /164 (6.7) 0.2 Need for drainage or debridement 13 (30.2) 38 (55.9) (8) < Extra-pancreatic infections 8 (18.6) 30 (44.1) (6.9) Median LOS in days (IQR) 20 (16-32) 37 (25-53) < (4-9) < Mortality 0 22 (32.4) < Denominators reflect number of patients with available contrast-enhanced computed tomography scan. P values: 1 st column reflects comparison of IOF to MOF, and 2 nd column reflects comparison of IOF to OF. AP: Acute pancreatitis; IOF: Isolated organ failure; MOF: Multi-organ failure; OF: Organ failure; SIRS: Systemic inflammatory response syndrome; IVF: Intravenous fluids; ICU: Intensive care unit; LOS: Length of stay; IQR: Interquartile range. Table 3 Demographics and clinical outcomes in severe acute pancreatitis patients with isolated renal failure and isolated respiratory failure n (%) Isolated renal failure Isolated respiratory failure P value n = 17 n = 25 Male 13 (76.5) 16 (64) 0.39 Mean ± SD 56.1 (18.2) 47.1 (18.6) 0.13 Mean BMI (SD) 32 (7.3) 28.5 (4.8) 0.06 Biliary etiology 6 (35.3) 11 (44) 0.57 ICU admission 10 (58.8) 25 (100) < Mean ICU LOS in days (SD) 2.4 (3.1) 15.7 (12.7) < Need for nutritional support 13 (76.5) 24 (96) 0.01 Pancreatic necrosis 11 (64.7) 16 (64) 0.8 Need for drainage or debridement 5 (29.4) 7 (28) 0.92 Median LOS (IQR) 19 (15-28) 22 (16-35) 0.31 Mortality 0 0 SD: Standard deviation; BMI: Body mass index; ICU: Intensive care unit; LOS: Length of stay; IQR: interquartile range. RF were less likely to require nutritional support (76.5% vs 96%, P = 0.01), had lower requirement for ICU admission (58.8% vs 100%, P = 0.001), and had shorter mean ICU stay (2.4 d vs 15.7 d, P = 0.001), compared to isolated respiratory failure. There were no statistically significant differences in the development of pancreatic necrosis, need for pancreatic drainage or debridement, or overall length of hospital stay between the two groups. None of the patients with isolated RF or isolated respiratory failure died (Table 3). In a multivariate logistic regression model after controlling for other factors, length of ICU stay was statistically shorter in patients with isolated RF compared to those with isolated pulmonary failure (P = 0.032). Table 4 summarizes the specific clinical parameters of each of the 17 patients with isolated RF. DISCUSSION Prior studies have reported the clinical outcomes including hospital stay and mortality for SAP patients who developed acute RF [6,7,9,10]. Comparison across those studies has been difficult due to heterogeneity of the patient populations, varying definitions of acute RF and AP severity, and different end-points. However, no prior study has focused on AP patients with isolated RF and the clinical outcomes of this subgroup are not known. One retrospective study from Europe of 563 patients with AP found that 79 (14%) developed acute RF, and that this group had an overall 10-fold increase in mortality (75% vs 7%, P < 0.001). However, the majority of patients with RF (96%) actually had multiple OF, and outcomes of AP patients with isolated RF were not reported [7]. Another cross-sectional study from China included 228 patients with SAP and found that the overall incidence of acute RF is 18%. This study showed that underlying chronic kidney disease, hypoxemia, and abdominal compartment syndrome, were independent factors for development of acute RF in those patients [6]. Again, the unique characteristics of patients with isolated RF were not evaluated. To our knowledge, this is the first study to evaluate the clinical outcomes of SAP patients with isolated RF August 7, 2017 Volume 23 Issue 29

194 Gougol A et al. Isolated RF vs other forms of OF Table 4 Specific clinical parameters of patients with isolated renal failure Patient Age Gender Etiology Comorbidity PNec Peak Cr Dialysis Dialysis at DC Dialysis indication ICU LOS 1 50 M Post-ERCP Cirrhosis No 2.9 No NA NA No M HTG None No 2.6 No NA NA No M Idiopathic Diabetes Yes 2 No NA NA Yes M Biliary Diabetes Yes 3.8 No NA NA No M Alcohol Cirrhosis Yes 4.1 No NA NA Yes F Biliary None Yes 2.2 No NA NA No M Alcohol None Yes 3.6 No NA NA No F Biliary Diabetes Yes 1.9 No NA NA Yes M Other None Yes 2 No NA NA No F Alcohol None No 2.5 No NA NA Yes M Biliary None No 4 No NA NA Yes M Other None Yes 7.8 Yes No Hyperkalemia, Yes 30 volume overload M HTG Diabetes Yes 6.6 No NA NA Yes M Biliary COPD, Diabetes No 3.3 No NA NA Yes F Post-ERCP Cholangiocarcinoma No 2.9 No NA NA No M Biliary None Yes 14.6 Yes No Hyperkalemia Yes M HTG COPD Yes 4.1 No NA NA Yes 11 M: Male; F: Female; ERCP: Endoscopic retrograde cholangiopancreatography; HTG: Hypertriglyceridemia; COPD: Chronic obstructive pulmonary disease; PNec: Pancreatic necrosis; Cr: Creatinine; DC: Discharge; NA: Not applicable; ICU: Intensive care unit; LOS: Length of stay. In our prospectively enrolled cohort of AP patients admitted or transferred to a major tertiary medical center, the overall incidence of acute RF in patients with SAP was 74% but only 15% developed isolated RF. The majority of patients with RF, whether isolated or as part of multiple OF, had a FENa of less than 2% which is consistent with a pre-renal etiology of kidney injury. When RF is part of multiple OF, namely respiratory and/or cardiovascular failure, there is a statistically significant association with increased need for hemodialysis (55%), median length of hospital stay (38 d), and death (34%). In patients with isolated RF, only 12% required hemodialysis, their median length of hospital stay was 19 days, and importantly none of those patients died. As only 1 patient developed isolated cardiovascular failure in our cohort, the isolated OF comparison focused on RF vs respiratory failure. Despite absence of differences in baseline characteristics between both groups, patients with isolated RF were significantly less likely to require nutritional support (77% vs 96%), require ICU admission (59% vs 100%), and had shorter mean ICU stay (2.4 d vs 15.7 d), compared to isolated respiratory failure. The explanation for the excess in need for ICU care in patients with isolated respiratory failure is mostly related to the need for mechanical ventilation which none of the isolated RF would have necessarily required. There were no significant differences in the development of pancreatic necrosis, need for pancreatic drainage or debridement, or overall length of hospital stay between the two groups. The mechanisms of acute RF development in AP patients are not well studied and the resulting renal injury is likely multifactorial. Proposed mechanisms include hypoxemia-driven injury to the renal tubular epithelial cells [11], impairment of renal microcirculation due to released pancreatic amylase [12], release of apoptotic molecules including cytokines from the inflamed pancreas leading to renal cellular injury [13], and abdominal compartment syndrome that may develop in patients with SAP and lead to decreased renal perfusion pressure causing ischemic injury [14]. Accordingly, the favorable outcomes of patients with isolated RF, as shown in this study, could be a reflection of milder renal injury due to absence of hypoxemia when there is no associated respiratory failure. Furthermore, an intact cardiovascular response likely minimizes the degree of renal hypoperfusion that one would otherwise expect when renal injury and cardiovascular collapse are present simultaneously. Moreover, in contrast to isolated respiratory failure, isolated RF in the setting of AP could represent a milder reversible form of organ failure. This may have implications on the amount and timing of intravenous fluid resuscitation as excess fluid may lead to pulmonary edema and respiratory failure, while adequate properly timed hydration may correct RF. The main limitation of our study is the observational design and therefore inability to determine the mechanistic roles of isolated RF on outcomes of SAP patients. Also, as the study is conducted in a tertiary referral center, our findings may not be representative of the community setting of all comers with AP, but rather a sicker group of patients. The major strengths of the study are the prospective method of patient enrollment, large sample size, and inclusion of all AP patients regardless of disease etiology. In summary, our study shows that approximately 15% of patients with SAP develop isolated RF. This subgroup seems to have an overall better prognosis and less protracted clinical course compared to patients with isolated respiratory failure and multiple 5436 August 7, 2017 Volume 23 Issue 29

195 Gougol A et al. Isolated RF vs other forms of OF OF. These results can be useful in allocating healthcare resources and counseling patients. We propose that isolated RF might be weighed less in risk predictive modeling of AP. COMMENTS Background About 20% of patients with acute pancreatitis have severe disease as evident by the development of persistent organ failure, which could be isolated or involve multiple organ systems. Research frontiers Acute renal failure in the setting of multiple organ failure has been shown to be associated with worse clinical outcomes in patient with severe acute pancreatitis. However, the specific clinical outcomes of patients who develop isolated renal failure are not well characterized. Innovations and breakthroughs This study shows that approximately 15% of patients with severe acute pancreatitis develop isolated renal failure. This subgroup seems to have an overall better prognosis and less protracted clinical course compared to patients with isolated respiratory failure and multiple organ failure. Applications Understanding the relatively less negative impact of isolated renal failure on clinical outcomes of patients with severe acute pancreatitis is important to allocate healthcare resources and counsel patients. They also propose that isolated renal failure might be weighed less in risk predictive modeling of acute pancreatitis. Peer-review This interesting article studies the association between subtypes of organ failure outcomes after acute pancreatitis in a large cohort of patients from a tertiary hospital. The study is well written and performed. REFERENCES 1 Peery AF, Crockett SD, Barritt AS, Dellon ES, Eluri S, Gangarosa LM, Jensen ET, Lund JL, Pasricha S, Runge T, Schmidt M, Shaheen NJ, Sandler RS. Burden of Gastrointestinal, Liver, and Pancreatic Diseases in the United States. Gastroenterology 2015; 149: e3 [PMID: DOI: /j.gastro ] 2 Yadav D, Lowenfels AB. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] 3 Banks PA, Bollen TL, Dervenis C, Gooszen HG, Johnson CD, Sarr MG, Tsiotos GG, Vege SS; Acute Pancreatitis Classification Working Group. Classification of acute pancreatitis--2012: revision of the Atlanta classification and definitions by international consensus. Gut 2013; 62: [PMID: DOI: /gutjnl ] 4 Mounzer R, Langmead CJ, Wu BU, Evans AC, Bishehsari F, Muddana V, Singh VK, Slivka A, Whitcomb DC, Yadav D, Banks PA, Papachristou GI. Comparison of existing clinical scoring systems to predict persistent organ failure in patients with acute pancreatitis. Gastroenterology 2012; 142: ; quiz e15-e16 [PMID: DOI: /j.gastro ] 5 Nawaz H, Mounzer R, Yadav D, Yabes JG, Slivka A, Whitcomb DC, Papachristou GI. Revised Atlanta and determinant-based classification: application in a prospective cohort of acute pancreatitis patients. Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ] 6 Li H, Qian Z, Liu Z, Liu X, Han X, Kang H. Risk factors and outcome of acute renal failure in patients with severe acute pancreatitis. J Crit Care 2010; 25: [PMID: DOI: /j.jcrc ] 7 Kes P, Vucicević Z, Ratković-Gusić I, Fotivec A. Acute renal failure complicating severe acute pancreatitis. Ren Fail 1996; 18: [PMID: ] 8 Marshall JC, Cook DJ, Christou NV, Bernard GR, Sprung CL, Sibbald WJ. Multiple organ dysfunction score: a reliable descriptor of a complex clinical outcome. Crit Care Med 1995; 23: [PMID: ] 9 Herrera Gutiérrez ME, Seller Pérez G, de La Rubia De Gracia C, Chaparro Sánchez MJ, Nacle López B. [Acute renal failure profile and prognostic value in severe acute pancreatitis]. Med Clin (Barc) 2000; 115: [PMID: DOI: / S (00) ] 10 Zhou J, Li Y, Tang Y, Liu F, Yu S, Zhang L, Zeng X, Zhao Y, Fu P. Effect of acute kidney injury on mortality and hospital stay in patient with severe acute pancreatitis. Nephrology (Carlton) 2015; 20: [PMID: DOI: /nep.12439] 11 Basnakian AG, Kaushal GP, Shah SV. Apoptotic pathways of oxidative damage to renal tubular epithelial cells. Antioxid Redox Signal 2002; 4: [PMID: DOI: / ] 12 Nishiwaki H, Ko I, Hiura A, Ha SS, Satake K, Sowa M. Renal microcirculation in experimental acute pancreatitis of dogs. Ren Fail 1993; 15: [PMID: ] 13 Malmstrøm ML, Hansen MB, Andersen AM, Ersbøll AK, Nielsen OH, Jørgensen LN, Novovic S. Cytokines and organ failure in acute pancreatitis: inflammatory response in acute pancreatitis. Pancreas 2012; 41: [PMID: DOI: / MPA.0b013e ] 14 Al-Bahrani AZ, Abid GH, Holt A, McCloy RF, Benson J, Eddleston J, Ammori BJ. Clinical relevance of intra-abdominal hypertension in patients with severe acute pancreatitis. Pancreas 2008; 36: [PMID: DOI: /mpa.0b013e318149f5bf] P- Reviewer: Ikeura T, Stocco G S- Editor: Qi Y L- Editor: A E- Editor: Li D 5437 August 7, 2017 Volume 23 Issue 29

196 Submit a Manuscript: DOI: /wjg.v23.i World J Gastroenterol 2017 August 7; 23(29): ISSN (print) ISSN (online) Laparoscopic ultrasonography as an alternative to intraoperative cholangiography during laparoscopic cholecystectomy SYSTEMATIC REVIEW Alexandra Dili, Claude Bertrand Alexandra Dili, Claude Bertrand, Unit of Digestive, Endocrine and General Surgery, Department of Surgery, University Hospital - Godinne, Université catholique de Louvain, CHU UCL Namur, 5530 Yvoir, Belgium Author contributions: Both authors equally contributed to this paper with conception and design of the study, literature review and analysis, drafting and critical revision and editing, and final approval of the final version. Conflict-of-interest statement: No potential conflicts of interest. Data sharing statement: These data were extracted from the referenced articles and are already in the public domain. Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: licenses/by-nc/4.0/ Manuscript source: Invited manuscript Correspondence to: Dr. Claude Bertrand, Unit of Digestive, Endocrine and General Surgery, Department of Surgery, University Hospital - Godinne, Université catholique de Louvain, CHU UCL Namur, Av. Docteur G. Thérasse 1, 5530 Yvoir, Belgium. cl.bertrand@uclouvain.be Telephone: Fax: Received: January 30, 2017 Peer-review started: February 8, 2017 First decision: March 3, 2017 Revised: April 8, 2017 Accepted: June 19, 2017 Article in press: June 19, 2017 Published online: August 7, 2017 Abstract AIM To assess the role of laparoscopic ultrasound (LUS) as a substitute for intraoperative cholangiography (IOC) during cholecystectomy. METHODS We present a MEDLINE and PubMed literature search, having used the key-words laparoscopic intraoperative ultrasound and laparoscopic cholecystectomy. All relevant English language publications from 2000 to 2016 were identified, with data extracted for the role of LUS in the anatomical delineation of the biliary tract, detection of common bile duct stones (CBDS), prevention or early detection of biliary duct injury (BDI), and incidental findings during laparoscopic cholecystectomy. Data for the role of LUS vs IOC in complex situations (i.e., inflammatory disease/fibrosis) were specifically analyzed. RESULTS We report data from eighteen reports, 13 prospective non-randomized trials, 5 retrospective trials, and two meta-analyses assessing diagnostic accuracy, with one analysis also assessing costs, duration of the examination, and anatomical mapping. Overall, LUS was shown to provide highly sensitive mapping of the extra-pancreatic biliary anatomy in 92%-100% of patients, with more difficulty encountered in delineation of the intra-pancreatic segment of the biliary tract (73.8%-98%). Identification of vascular and biliary variations has been documented in two studies. Although inflammatory disease hampered accuracy, LUS was still advantageous vs IOC in patients with obscured anatomy. LUS can be performed before any dissection and repeated at will to guide the surgeon especially when hilar mapping is difficult due to fibrosis and inflammation. In two studies LUS prevented conversion in 91% of patients with difficult scenarios. Considering 5438 August 7, 2017 Volume 23 Issue 29

197 Dili A et al. Laparoscopic ultrasonography and cholecystectomy CBDS detection, LUS sensitivity and specificity were 76%-100% and 96.2%-100%, respectively. LUS allowed the diagnosis/treatment of incidental findings of adjacent organs. No valuable data for BDI prevention or detection could be retrieved, even if no BDI was documented in the reports analyzed. Literature analysis proved LUS as a safe, quick, non-irradiating, costeffective technique, which is comparatively well known although largely under-utilized, probably due to the perception of a difficult learning curve. CONCLUSION We highlight the advantages and limitations of laparoscopic ultrasound during cholecystectomy, and underline its value in difficult scenarios when the anatomy is obscured. Key words: intraoperative ultrasound; laparoscopic cholecystectomy; bile duct injury; choledocolithiasis; biliary anomalies The Author(s) Published by Baishideng Publishing Group Inc. All rights reserved. Core tip: Laparoscopic ultrasound (LUS) during cholecystectomy allows a non-invasive study of the biliary tract, with an excellent ability to detect common bile duct stones and identify anatomy. Unlike intraoperative cholangiography, LUS can be performed before Calot s triangle dissection, which facilitates the mapping of biliary and hilar structures during difficult scenarios such as severe inflammation and fibrosis. Cheap, quick, and non-irradiating LUS can be repeated at will during the operation. Adjacent organs can also be examined, allowing incidental findings. Our review of the recent literature highlights the advantages of LUS, despite its underuse, particularly in difficult cholecystectomies when the anatomy is obscured. Dili A, Bertrand C. Laparoscopic ultrasonography as an alternative to intraoperative cholangiography during laparoscopic cholecystectomy. World J Gastroenterol 2017; 23(29): Available from: URL: v23/i29/5438.htm DOI: i INTRODUCTION The last few decades have seen the increased adoption of minimally invasive surgery in various abdominal procedures. A drawback of this laparoscopic approach is the inability of the surgeon to palpate abdominal organs. This loss of tactile feedback, combined with technical difficulties and an extensive learning curve, may collectively explain the slow uptake of laparoscopic surgery in the field of hepatic-biliarypancreatic surgery (HPB) [1]. Cholecystectomy (LC) is the most common HPB operation and possibly represents the first widely accepted gold standard laparoscopic approach [2]. LC is a relatively easy and safe operation, as long as the biliary duct is adequately mapped. Indeed, delineation and meticulous evaluation of the biliary tract is critical for the detection of common bile duct stones (CBDS), and for the prevention of bile duct injury (BDI). Over the past few decades the advantages of LC vs the open procedure have been widely acknowledged, but with one glaring blemish, the higher rate of BDI [3], despite a recent report describing a rate of BDI of 0.08% [4]. During LC the main cause of BDI is poor visibility of the biliary tract (71%-97% of patients) and inadequate surgical skills [5,6]. In order to clarify biliary anatomy during LC, different techniques have been proposed. These include intraoperative cholangiography (IOC), cholecystocholangiography, dye cholangiography, light cholangiography, passive infrared cholangiography, near-infrared fluorescence cholangiography, hyperspectral cholangiography, and laparoscopic ultrasound (LUS) [7]. Of these techniques, IOC is the most commonly used to determine bile duct anatomy and to diagnose CBDS. There has been much debate as to whether this examination helps to prevent, or improve the early detection of BDI. This controversy is of considerable importance to the patient, and their treatment [6], with uncertainty as to whether IOC should be routinely or more sparingly used [8-11]. The routine implementation of IOC poses several challenges. Practically, these include the need for dissection before IOC, which may be technically difficult (in acute or chronic inflammatory disease), together with cannulation of a short, thin, or tortuous cystic duct [12], and the risk of avulsion during cannulation of an inflamed cystic duct [13]. Additionally, IOC lengthens the procedure time [14] and increases costs, imposes a learning curve in terms of correctly interpreting images [5], and exposes the medical team and patient to ionizing radiation, even if this seems to be negligible concern for the adult population [15]. Soon after the outset of LC use, authors proposed that LUS be used to substitute for the lack of tactile palpation during laparoscopy, such that the surgeon could identify subsurface structures. Prior to 2000, multiple reports emphasized the benefits of LUS, and its efficacy in assessing CBDS and anatomy during LC [16-35]. Compared to IOC, LUS is described as less invasive, faster, cheaper, with no adverse events, and can be repeatedly used during the operation with no risk of irradiation, which is clearly preferable for pregnant or young patients. Nevertheless, despite these positives, the routine use of LUS during LC is virtually nonexistent compared to IOC, with only 1% of surgeons using this technique [36]. This report aims to review the role of LUS as a substitute for IOC for the anatomical delineation of the biliary tract, anatomical evaluation during acute 5439 August 7, 2017 Volume 23 Issue 29

198 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Table 1 Results of PubMed review Author Year Type of study Number of patients Surgeon Routine LUS use Detailed anatomical description CBDS report Specific aims of the study other than LUS efficacy Tranter 2001 PNR 367 Several + Poor + Biffl 2001 PNR 248 Several + No + CBDI Halpin 2002 PNR 380 Single + Yes + Comparison with IOC Catheline 2002 PNR 900 ni + No + Comparison with IOC Tranter 2003 PNR 135 Several + No + Comparison with IOC, measurement of duct diameter Onders 2005 PNR 105 Single - No + Perry 2007 PNR 236 Single + Poor + Comparison with IOC Machi 2007 PNR 200 Several + Poor + Cost Hakamada 2008 RSS 299 Several 1 Yes + Educational program Machi 2009 RMS 1352 Several + No + Hublet 2009 PNR 269 Single + Poor + Li 2009 PRN 103 Several + Yes + Hashimoto 2010 RMS 220 Several + Yes 2 - CBDI Pfluke 2011 RSS 50 Several + Yes + Nasu 2012 PNR 71 ni + Poor + Kothari 2013 PNR 253 Several + Poor - Comparison with trans-abdominal US in obese patients Gwinn 2013 PNR 44 Several + Poor - Impact of inflammatory disease Shaaban 2014 RSS 70 Single - No + Meta-analysis Aziz 2014 MA Jamal 2015 MA 1 Since instigation as part of an educational program ; 2 Focus on cystic duct-cbd junction. RSS: retrospective single center study; RMS: retrospective multicenter study; PNR: prospective non-randomized study; MA: meta-analysis; ni: no information; CBDS: common bile duct stones; LUS: laparoscopic ultrasound; IOC: intraoperative cholangiography. cholecystitis, CBDS detection, the prevention or early detection of BDI, and incidental findings during LC. MATERIALS AND METHODS A literature search of the PubMed and MEDLINE database was performed using the following keywords: intraoperative laparoscopic ultrasound and laparoscopic cholecystectomy. Overall, only English-language publications published between January 2000 and December 2016 were considered. All studies that contained material relevant to the topic were reviewed. RESULTS From 2000 to 2016, no randomized controlled trials were conducted. Eighteen reports were identified, 13 were prospective non-randomized trials, and 5 were retrospective trials. Two meta-analyses were found, one assessing the diagnostic accuracy of LUS in detecting CBDS vs IOC [37], and a second, analyzing CBDS detection, together with costs, time taken for the examination, and ability to identify anatomical landmarks [38]. Table 1 shows the published studies, together with their respective methodologies and principal evaluated variables. LUS and anatomy During LC, an appreciation of bile duct and vascular anatomy is mandatory in order to perform fine dissection and prevent bile duct and vascular injuries. Indeed, errors whereby surgeons fix anatomical structures incorrectly, especially when the anatomy is obscured or where there is an anatomical variation, is the most common cause of injury [39]. The two structures that are most commonly misidentified as the cystic duct (neither of which are particularly rare) are the common bile duct, and an aberrant right hepatic duct that drains the posterolateral sector of the liver. Izuishi et al [40] reported multi-slice-computed cholangiography of 113 patients and documented that a posterior inferior duct joined the common hepatic duct directly (parallel to the cystic duct) in 6% of patients, whereas a posterior segmental duct directly joined either the common bile duct in 7% of patients, or cystic duct in 1% of cases. An overall rate of anatomical variation of 16% was documented, which underlines the importance of accurately identifying all structures during LC. In a larger cohort study, anatomical variations of the bile duct were analyzed in 1094 direct cholangiograms by Yoshida et al [41]. The relative position of the right anterior (A), right posterior (P), right (R), left (L), and cystic ducts were documented. Arborizing patterns revealed that 67.7% were normal (i.e., RL, a normal bile duct convergence), whereas 17.7%, 8%, and 6%, demonstrated APL (i.e., trifurcation), A-PL (i.e., low implantation of the right anterior duct), and P-AL (i.e., low implantation of the right posterior duct), respectively. Cystic duct anomalies occurred in 1.6% of patients, the most frequent being the pattern (0.5%) in which the cystic duct merges with lower branch of the posterolateral 5440 August 7, 2017 Volume 23 Issue 29

199 Dili A et al. Laparoscopic ultrasonography and cholecystectomy A C PV GB HA CHD B D CHD HA PV CHD CD PV Figure 1 Laparoscopic ultrasonography: technique. Transversal approach - A: Through the liver; B: directly on the hepatoduodenal pedicle. Longitudinal approach - C: through the liver; D: directly on the hepatoduodenal pedicle (isotonic solution s irrigation that improves acoustic coupling). CD: cystic duct junction with the the common bile duct; CHD: common hepatic duct; HA: hepatic artery; PV: portal vein; GB: gallbladder with macrolithiasis. segmental duct. This pattern has to be recognized correctly by the surgeon during LC in order to avoid misidentification and subsequent injury of the right posterior segmental duct. LUS with the color Doppler application and transverse scanning generates the characteristic Mickey Mouse appearance of the CBD, portal vein, and common hepatic artery [22]. Occasionally, a prominent cystic duct that is parallel to the CBD can be identified in a four tube sign [23]. Hashimoto et al [42] studied the efficacy of LUS in identifying the cystic-common bile duct junction and found that LUS was inaccurate in 6% of patients, predominantly when the diameter of the CBD was less than 5 mm. In longitudinal scanning, LUS provides excellent anatomical information (Figure 1). In order to complete a thorough examination of the biliary tract, the surgeon has to identify the biliary convergence with the left and right sectorial branches through the liver. Sequentially, the branch of the anterior right sector (direct extension of the CBD) is identified, followed by the posterior right sector duct. Then the gallbladder bed is visualized, followed by the walls of the gallbladder, then the trangential hepatic vein. This is a branch of the middle hepatic vein, tangential to the gallbladder bed, which is present in 15.38% of patients. When injured, this vein can provoke serious bleeding, mostly in cirrhotic patients [43-45]. A Doppler LUS is performed to identify the vascular anatomy and hepatic blood flux. The hepatoduodenal ligament is irrigated with an isotonic solution that improves acoustic coupling between the screened surface and probe. This permits analyses of the CBD (its integrity and diameter), the cystic duct, the junction between the cystic duct and the CBD, and the common hepatic duct and its intra-pancreatic portion (Figure 2). Other interesting anatomical findings include vascular variation or injuries [46], or even lymph nodes. An advantage of LUS is that it can be used before or after dissection of the Calot s triangle, and, since it is not time consuming, can be repeated as needed. In the literature, 7 authors used LUS prior to dissection, and 7 after (table 2). As shown in table 2, LUS can be performed before or after dissection, according to perioperative findings, or before dissection to identify anatomy and systematically afterwards to confirm the correct dissection and absence of any injury. Considering the cystic duct-cbd junction, which is one of the most critical parts of the dissection, Hashimoto et al [42], in a retrospective multicenter trial, reports an improved identification rate (of 98%) after dissection of the Calot s triangle compared to 84% when LUS is completed before dissection. It is interesting to note that use of LUS at the end of the operation could be used to confirm the integrity of the common bile duct after clipping and transection of the cystic duct. A review of the literature shows that most authors 5441 August 7, 2017 Volume 23 Issue 29

200 Dili A et al. Laparoscopic ultrasonography and cholecystectomy RAD A B LHD-emergence C LHD-rex RPD D E F CHD PV CBDS 3.5 mms CD CBDpre-papillary stones G CBD H CBD PD PH CD Figure 2 Laparoscopic ultrasonography: bile duct anatomy. A-C: Biliary convergence anatomy; D-F: Classical cystic duct junction with common bile ducts stones; G and H: Intra-pancreatic bile duct. RAD: right anterior sector duct; RPD: right posterior sector duct; LHD: left hepatic duct; LHD-rex: left hepatic duct at Rex recessus; CBDS: common bile duct stones; CD (E): cystic duct; CHD: common hepatic duct; CBD: common bile duct; CD (G): cystic duct with low implantation in the common bile duct; PD: pancreatic duct; PH: pancreatic head. describe how to analyze the biliary tract, but very few provide details of the success with which each portion of the CBD is identified, which is essential in performing a safe LC. Table 3 provides data for the rates of complete observation and the ability of LUS to identify duct segments. According to these data, the rate of complete observation of the biliary tract with LUS ranged from 92%-100%, with very few reports providing an accurate rate of identification of each biliary duct segment. Complete anatomic analyses are reported in only four manuscripts [13,47-49], with vascular identification and/or variation in three [47,48,50]. Anatomic vascular and/or biliary variations have been described such as a foreshortened cystic duct in 14% of patients in a retrospective single center trial reported by Pfluke [47] ), atypical cystic-bile duct junctions [51], aberrant hepatic ducts [47,51], or an accessory right hepatic artery [47]. Even if LUS imaging of the CBD provides excellent accuracy (Table 3), visualization of the intra-pancreatic portion appears to be more challenging, with rates of complete delineation ranging from 73% to 100% [12,13,47-49]. In a meta-analysis performed by Jamal et al [38] there was no significant difference between IOC and LUS in identifying the extra-pancreatic CBD, but IOC appeared to be more efficient in delineating the intrapancreatic CBD. Other authors report discontinuous mapping of the biliary tract. In a prospective nonrandomized trial, Halpin et al [13] reports discontinuous screening of the middle and/or distal CBD in 10% of patients. This agrees with other studies reporting rates of discontinuous mapping of the CBD of 4%-17% [20,52]. In Halpin s experience, this did not translate into increased false negatives with LUS. LUS and acute or chronic inflammatory disease A major impediment to the conclusion of LC is the inability to identify, with surety, the location of the 5442 August 7, 2017 Volume 23 Issue 29

201 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Table 2 laparoscopic ultrasound performed pre- or postdissection Author Year No. of patients LUS predissection LUS postdissection Tranter Biffl Catheline Halpin Tranter Onders Machi Perry According to the situation Hakamada /- After if necessary Hublet Li Machi /- After if necessary Hashimoto Pfluke Nasu Gwinn Kothari Shaaban LUS: laparoscopic ultrasound. extra-hepatic bile duct and to assess its relationship with the gallbladder when the hepatoduodenal anatomy is obscured. Cholangitis or previous pancreatitis may render access to the biliary tract difficult. In such cases the risk of major bile duct and/or vascular injury is substantial, even for the most adept HPB surgeon. IOC is not possible without dissection. In such hazardous situations, LUS can be a valuable adjunct and can be performed before dissection, and repeated as needed to guide the surgeon. Many authors report their experience of LUS in scenarios of inflammatory disease (Table 4). Gwinn et al [53], in a prospective non randomized trial, reports a rate of 100% complete biliary tract analysis even with acute inflammation. In that study, LUS was critical in performing LC during acute cholecystitis in all 44 patients whose anatomy was obscured by acute or chronic cholecystitis, with a rate of 34.1% of gangrenous cholecystitis, but no mention of the fibrotic percentage. During the operation, for all cases, LUS was used to identify with precision the anatomy of the cystic duct, CBD, and the cystic duct-cbd junction. Indeed LUS was considered to be a crucial tool in avoiding conversion in 91% of patients [53], with no BDIs observed. It seems that even when complete visualization of the biliary tract is difficult to achieve because of inflammatory disease or fibrosis, the most important dissection targets (cystic duct, CBD, and the cystic duct-cbd junction) can still be finely identified. Machi et al [54], in a multicenter study that included 1352 patients, reported a feasibility rate for LUS of 98%, even with 20.90% of cases presenting with inflammatory disease. In their report, LUS proved to be remarkably valuable, given that mapping of the biliary tract avoided conversion in 5.9% of patients with anatomy obscured due to Mirizzi s syndrome, acute or chronic cholecystitis, or pancreatitis. Even though no comment was made in this report considering the particularly difficult situation of fibrosis, 79.1% of patients were considered to be in a state of chronic cholecystitis. Biffl et al [55] in a prospective non-randomized study showed that LUS provided an excellent guide for dissection as its routine use during acute cholecystitis allowed operations to be completed with lower conversion rates than seen with patients operated on without LUS (P = 0.09). According to these data, LUS seems to play an essential role in mapping the biliary and hilar trunk when the anatomy is obscured such as in the fibrotic or inflammatory state. The possibility of identifying the anatomy before and/or during dissection could be one of this technique s most valuable aspects. Conversely, other authors have suggested that inflammation may hinder LUS analysis [51]. For example, Hakamada et al [48], in a retrospective single center study, reported a high analysis rate for the complete biliary tract in LC for cholecystolithiasis, which then fell according to the severity of inflammation, while preserving an excellent feasibility rate of 100%. LUS and biliary duct injury BDI is a dreaded complication during cholecystectomy. The incidence of BDI during LC remains at 0.3%-0.6% [3], with a trend suggesting its diminution as surgical experience and expertise is acquired [4]. BDI combined with vascular injury is observed in 12% of patients, which may negatively impact treatment and recovery [56]. BDIs are best prevented by fine dissection using different techniques as recommended for simple vs more complex LC cases [57,58]. Described by Strasberg et al [28] in 1995, the critical view of safety (CVS), a systematic dissection that skeletonizes the Calot s triangle and delineates the relationship of anatomic structures, has been suggested to play a protective role against BD1 [59-61]. A drop in BDIs following the implementation of CVS as a dissection principle during LC was documented by Yamashita et al [62] in a Japanese report. Despite this evidence, CVS still appears to be underutilized by surgeons in current practice [36], and may even be insufficient in terms of minimizing CBDI. Further, major CBDIs continue to occur, even for surgical teams that have adopted CVS as a standard dissection technique as reported by de Reuver et al [63]. In 1996, Birth et al [18] reported a 100% recognition rate of BDIs using LUS in an experimental animal study without blinding (i.e., surgeons knew that BDIs were present). These data may therefore be biased and should be interpreted with caution. Data for LUS and the prevention or detection of BDIs are sparse. Across the studies reviewed (Table 1), no BDIs were reported with only 2 studies emphasizing the importance of combining CVS and LUS [12,47]. However, delineation of the CBD, the 5443 August 7, 2017 Volume 23 Issue 29

202 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Table 3 Identification of biliary anatomy and variations Author Year No. of Patients Complete observation Intrahepatic BD Bifurcation CHD CBD CD-CBD junction Intrapancreatic BD Vascular visualization Biliary anomalies Foreshortened cystic duct (< 1 cm) Abnormal cystic duct anatomy Aberrant vascular anatomy Tranter % 92% 99% Halpin % 95% 94% Tranter % Machi % Perry % 98.5% 6.40% Hakamada % 100% %-97.1% %-99.4% %-100% %-98.3% %-100% 2 Hublet % Li % % 73.8% Machi % Hashimoto % 3 Pfluke % 100% 100% 98% 98% 40% 14% 8% 16% 4 Gwinn % 1 Not influenced by inflammation; 2 Influenced by inflammation; 3 Junction not identified when CBD < 5 mm; 4 Accessory RHA (right hepatic artery) 8%, replaced RHA 6%, anterior cystic artery 2%. CHD: common hepatic duct; CBD: common bile duct. possibility to repeat LUS during the procedure either before or after dissection, and the ability of LUS to detect aberrant vascular anatomy [47] may collectively play a role in preventing bile duct and vascular injuries. As an example, using LUS, Hublet et al [12] identified a stenosing clip placed too close to the junction between the CBD and CD, in a patient with a normal IOC. This underlines the fact that CBDI can still occur after IOC. Thanks to LUS performed at the very end of the operation, a diagnosis of CBD stenosis was made with subsequent repair, avoiding potential major postoperative complications. LUS and common bile duct stones The presence or absence of CBDS can be predicted to some extent using preoperative criteria, but these fail to reach 100% accuracy [64,65]. Catheline et al [20], in a retrospective trial published in 1999, reported a perioperative CBDS detection rate of 9%. In this group of patients, 30% manifested no preoperative risk factors. Olsen et al [24], in a prospective non randomized study, recorded 12% of patients as having CBDS, even after preoperative clearance by endoscopic retrograde cholangiopancreatography (ERCP). Thanks to LUS, CBDS can be identified early during the procedure, which gives the operating room personnel time to set up the required CBDS exploration equipment. The sensitivity and specificity provided by LUS in detecting CBDS is very good (Table 5). In 2003, Tranter et al [66], in a prospective non randomized study, reported specificity and sensitivity rates of 96% and 100%, respectively, compared to sensitivity and specificity rates of 86% and 99% in IOC. In another prospective non randomized study, Li et al [49] also observed higher sensitivity rates for LUS vs IOC (82.1% vs 75%), and an equal specificity rate of 98.7%. A meta-analysis of the literature performed by Jamal et al [38] confirmed a sensitivity and sensitivity rate for LUS that was superior to IOC (0.90 and 0.99 for LUS vs 0.87 and 0.98 for IOC, respectively), with heterogeneity found to be insignificant. In agreement with this observation, Aziz et al [37], in another meta-analysis, suggested that LUS is very accurate in detecting CBDS (pooled sensitivity of 0.87, and specificity of 1.00) vs IOC (pooled sensitivity of 0.87, and specificity of 0.99). The measurement of CBD diameter was performed and reported in several studies [13,66-68]. In 2001, Tranter et al [68] observed that when dealing with a thin CBD (< 5 mm) there should be no concern regarding CBDS. In these circumstances, LUS could be an excellent negative predictor. Two years later, the same author reported [66] that for CBDs of between 6-10 mm in diameter, there was a large overlap between ducts with or without stones; 85% of ducts > 10 mm in width contained stones. Considering sludge, defined as small areas (< 1 mm) of mobile echogenic material without acoustic shadowing, their clinical significance remains debatable, with some studies suggesting that sludge is related with acute pancreatitis [69,70] or cholangitis [71]. LUS appears to be more accurate in these diagnoses than IOC. Halpin et al [13], in 5444 August 7, 2017 Volume 23 Issue 29

203 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Table 4 Reports of laparoscopic ultrasound used during acute or chronic cholecystitis Author Year No. of patients Inflammatory disease % Comments Biffl Catheline Onders Machi Perry LUS considered extremely valuable in 5.5% Hakamada % with severe inflammatory disease during 2 nd period of study Machi LUS considered extremely valuable in 5.9% Pfluke Gwinn LUS: laparoscopic ultrasound. Table 5 Common bile duct stones identification Author Year No. of patients Sensitivity % Specificity % Criteria to evaluate CBS LUS accuracy IOC ERCP/surgical exploration Follow-up Tranter Selective + + Biffl ni Halpin Selective + + Catheline Systematic Tranter Systematic Onders Selective + Perry Selective + Machi Selective + + Hakamada Selective Machi Hublet Selective + Li Selective + + Pfluke Selective Nasu Selective Shaaban No Selective or systematic, according to center. ni: No information; LUS: laparoscopic ultrasound; IOC: intraoperative cholangiography; ERCP: endoscopic retrograde cholangiopancreatography. a prospective non randomized study, detected 14% of patients with sludge in the LUS group, but no diagnoses were made for the IOC group. This allowed the surgeon to proceed to a non-invasive treatment, such as saline flush via the cystic duct combined with glucagon injection. On the other hand, Halpin s experience was that 62% of patients with sludge underwent no treatment, with no adverse events. Other authors also adopted a wait and see approach to sludge with good results [51]. The high detection rate of LUS agrees with reports observing a high accuracy of detection of microlithiasis by echoendoscopic examination [72]. In IOC, a higher number of false positive examinations may be due to micro-bubbles [73] or Oddi s contractions. These drawbacks are not applicable to LUS. In LUS, only exceptional false positive examinations have been reported due to confusing pancreatic head micro-calcifications with CBDS [54]. To conclude, this literature review suggests that LUS is, at the very least, equivalent to IOC in terms of detecting choledocholithiasis, and may be more specific, leading to fewer negative explorations. It is important to note that LUS and IOC may be complementary, as combining the 2 techniques maximizes the intraoperative detection of CBDS, with a sensitivity rate of 95% and a specificity rate of 98% [73,49]. LUS and incidental findings LUS has the benefit of substituting for the lack of tactile palpation during LC, and allows scanning of other organs such that additional underlying pathology can be identified. Liver abscesses or tumors, suspicious lesions in the gallbladder wall, or diverticulum of the common bile duct can be detected [25]. In 1995, in a prospective non randomized study, Stiegmann et al [19] reported the LUS identification of a large hilar lymph node, from which a frozen section was used to diagnose gallbladder carcinoma. In the series published after 2000 (Table 6), Hublet et al [12], in a prospective non randomized study, reported the diagnosis of one case with hemobilia (which could have been interpreted as a filling defect in IOC imaging), 1 pancreatic pseudocyst, 1 case of IPMN, 1 pancreas divisum, and 1 patient with microcalcifications of the head of the pancreas. Other authors report the identification of gallbladder polyps [74], Mirizzi syndrome [50], lobar atrophy/hypertrophy, or rotational anomalies of the liver [54]. In a prospective non randomized study published in 2007, Machi et al [51] diagnosed cystic or solid tumors of the liver or 5445 August 7, 2017 Volume 23 Issue 29

204 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Table 6 Incidental findings Author Year No. of patients examined using LUS Incidental findings Machi Cystic or solid tumors of the liver or pancreas in 31 patients; 14 biopsies and aspirations, 6 radiofrequency ablations Perry Atrophic/hypertrophic or rotational anomalies or the liver, Mirizzi syndrome, vascular anomalies Hakamada Polyps Hublet hemobilia, 1 pancreatic pseudocyst, 1 IPMT, 1 pancreas divisum, 1 micro-calcification of the pancreatic head, 1 liver abscess, 1 liver tumor Machi Atrophic/hypertrophic or rotational anomalies or the liver, Mirizzi syndrome, vascular anomalies Gwinn hepatic rotation anomalies Kothari Polyps. Improved visualization of gallbladder walls in obese patient compared to trans-abdominal US LUS: laparoscopic ultrasound. pancreas during systematic examination via LUS. Thus, LUS permitted the surgeon to proceed to biopsy or aspiration, and even radiofrequency ablation of tumors in 6 cases. Even if it remains unclear as to whether these tumors were incidental perioperative findings, or were diagnosed during the preoperative workup, LUS permitted localization of the disease, biopsy, and even treatment. Speed of the process LUS can be completed more rapidly than IOC [38,48,73,75]. Catheline et al [73], in a prospective non randomized study, reports a LUS duration of 9.8 min vs 17.6 min for IOC. Further, in order to perform IOC, a radiological device, together with a technician capable of operating the device are needed. While surgical experience in using LUS seemed to significantly influence the operating time for cholecystolithiasis [48], Halpin et al [13] observed no differences when dealing with acute cholecystitis. Learning curve The number of LUS examinations performed as part of the learning curve varied in reports [13,48,67], with a broad agreement that the learning curve was greater than for IOC. What seems to be evident from the literature review is that surgeons that take the time and effort to perform LUS, not only become very efficient and accurate in their diagnoses, but also modify their practice. These surgeons use IOC more selectively and rarely [12,50]. Given that the accuracy of LUS improves with the expertise of the operator, standardization of the examination is essential. Costs In 2016, Sun et al [76] evaluated the cost effectiveness of LUS, IOC for the investigation of silent CBDS during LC. The authors concluded that LUS is a more costeffective strategy than IOC. DISCUSSION During laparoscopic cholecystectomy, mapping of the dissection targets such as the common bile duct, cystic duct, and hilar vascular structures, is crucial for safely completing the operation. While careful dissection avoids injury, this may be difficult to achieve in the presence of fibrosis or extensive inflammation, or when there is an aberrant biliary anatomy (and/or a very short cystic duct). The debate is ongoing as to whether an analysis of the hilar anatomy during cholecystectomy may help to prevent injury and postoperative complications. Many surgeons perform no analyses given that the proposed gold standard technique (IOC) has its own drawbacks including irradiation of the patient and the surgical team, dissection of the Calot s triangle to identify the cystic duct, and cannulation of the cystic duct which may cause avulsion or perforation. IOC is also considered to be expensive and time-consuming. On the other hand, LUS, which has a long history of use (> 30 years), allows a quick, repeatable, highly successful, non-irradiating, and non-invasive study of the biliary tract. In difficult scenarios, when anatomical structures are obscured, such as during inflammation or fibrosis, LUS can be pivotal to the success of the procedure, and is easily performed before the dissection in order to guide the surgeon. With the added advantage of re-use on demand during the operation as it is neither time-consuming nor expensive. Indeed, LUS provides an excellent analysis of the CBD, even if it would appear to be less accurate than IOC in the study of the intra-pancreatic segment of the bile duct. Considering aberrant biliary anatomy, such as a cystic duct originating from the right posterior sector, very few authors provide detailed anatomical descriptions. More results for the precise anatomical evaluation, segment by segment, are warranted. Nevertheless, it seems that, in experienced hands, LUS can provide a precisely mapped biliary duct. When analyzing the cystic-common bile duct junction, a short cystic duct, or even Mirizzi s syndrome, LUS might be effective in clarifying the anatomy and even preventing conversion. While no precise data concerning the prevention of BDIs were reported, the ability to delineate anatomy may have a protective role as no BDIs were described 5446 August 7, 2017 Volume 23 Issue 29

205 Dili A et al. Laparoscopic ultrasonography and cholecystectomy in the reviewed series, even when patients with acute or chronic inflammatory disease were included. The ability of LUS to detect CBDS and sludge is at least as good, if not better than IOC, and provides fewer false positive examinations. Moreover, LUS contributes to a complete examination of the adjacent organs, which allows for diagnoses of incidental pathology. Finally, the use of LUS is not exclusive. IOC can be of importance in many situations. Consequently, any surgeon should be able to use both techniques, which are complementary in detecting common bile duct stones. Further, the advantages of LUS have led to the authors using this technique as a first line procedure. A limitation of this review is that it is based on a relatively small number of non-randomized trials, with a limited number of patients, with heterogeneous, non standardized criteria in terms of anatomical analysis. Unfortunately, no specific data could be found for the hazardous situation of fibrosis, which is instead necessarily included in a broader difficult category. To conclude, a large panel of techniques has been described that clarify anatomy during laparoscopic cholecystectomy. However, of these techniques, LUS would appear to be the most suitable as it provides the greatest number of advantages and can be used during other types of operation. LUS is also, probably, the most cost-effective, which is an essential quality in an era of financial constraints. The principal hurdle for the adoption of LUS as a standard imaging technique of the CBD during LC appears to be the reticence of surgeons, probably because of its supposed lengthy learning curve. However, as ultrasound and laparoscopy become standard techniques in modern surgery, most surgical trainees and junior surgeons will be exposed to them, and will be more inclined to include them in their skill set. In this fashion, we envisage that the reluctance to use LUS will become obsolete. Moreover, surgeons should consider that implementation of LUS during LC could serve as a valuable exercise to gain familiarity with a technique that should prove useful for multiple operations. COMMENTS Background The detection of common bile duct stones and bile duct injury prevention remain hot topics in laparoscopic cholecystectomy, more so now that the laparoscopic approach is standardly used, even in difficult cases with acute or chronic inflammation and fibrosis. As a companion technique, intraoperative cholangiography (IOC) is usually proposed as the gold standard analysis method. Laparoscopic ultrasonography (LUS) is much less evaluated. Research frontiers LUS during cholecystectomy is a well-known technique described from more than 30 years ago. However as less than 1% of surgeons seem to adopt it probably due to its supposed longer learning curve. The specific benefits and the performance of the technique has to be been evaluated. Innovations and breakthroughs All manuscripts concerning the performance of LUS during laparoscopic cholecystectomy from the year 2000 were reviewed by the authors with a view to the performance of anatomical mapping, even with background inflammation. Applications This review confirmed the clinical benefits of LUS during cholecystectomy, especially in difficult situations. Compared to IOC, LUS remains under-used. Greater uptake of this technique by young surgeons, backed by large-scale studies to confirm its clinical impact, should help to eliminate the discrepancy between use and value. Peer-review In this review the authors present a critical analysis of the literature, from the year 2000, for the use of LUS during cholecystectomy and its performance in mapping the anatomy of the bile duct, detecting common bile duct stones, and preventing bile duct injury. A particular emphasis has been placed on complex inflammatory situations. REFERENCES 1 Wong-Lun-Hing EM, Lodewick TM, Stoot JH, Bemelmans MH, Olde Damink SW, Dejong CH, van Dam RM. A survey in the hepatopancreatobiliary community on ways to enhance patient recovery. HPB (Oxford) 2012; 14: [PMID: DOI: /j x] 2 Gallstones and laparoscopic cholecystectomy. NIH Consensus Development Panel on Gallstones and Laparoscopic Cholecystectomy. Surg Endosc 1993; 7: [PMID: DOI: /BF ] 3 Hogan NM, Dorcaratto D, Hogan AM, Nasirawan F, McEntee P, Maguire D, Geoghegan J, Traynor O, Winter DC, Hoti E. Iatrogenic common bile duct injuries: Increasing complexity in the laparoscopic era: A prospective cohort study. Int J Surg 2016; 33 Pt A: [PMID: DOI: /j.ijsu ] 4 Halbert C, Pagkratis S, Yang J, Meng Z, Altieri MS, Parikh P, Pryor A, Talamini M, Telem DA. Beyond the learning curve: incidence of bile duct injuries following laparoscopic cholecystectomy normalize to open in the modern era. Surg Endosc 2016; 30: [PMID: DOI: /s ] 5 Way LW, Stewart L, Gantert W, Liu K, Lee CM, Whang K, Hunter JG. Causes and prevention of laparoscopic bile duct injuries: analysis of 252 cases from a human factors and cognitive psychology perspective. Ann Surg 2003; 237: [PMID: DOI: /01.SLA E9] 6 Connor S, Garden OJ. Bile duct injury in the era of laparoscopic cholecystectomy. Br J Surg 2006; 93: [PMID: DOI: /bjs.5266] 7 Buddingh KT, Nieuwenhuijs VB, van Buuren L, Hulscher JB, de Jong JS, van Dam GM. Intraoperative assessment of biliary anatomy for prevention of bile duct injury: a review of current and future patient safety interventions. Surg Endosc 2011; 25: [PMID: DOI: /s ] 8 Sajid MS, Leaver C, Haider Z, Worthington T, Karanjia N, Singh KK. Routine on-table cholangiography during cholecystectomy: a systematic review. Ann R Coll Surg Engl 2012; 94: [PMID: DOI: / X ] 9 Slim K, Martin G. Does routine intra-operative cholangiography reduce the risk of biliary injury during laparoscopic cholecystectomy? An evidence-based approach. J Visc Surg 2013; 150: [PMID: DOI: /j.jviscsurg ] 10 Ford JA, Soop M, Du J, Loveday BP, Rodgers M. Systematic review of intraoperative cholangiography in cholecystectomy. Br J Surg 2012; 99: [PMID: DOI: /bjs.7809] 11 Sheffield KM, Han Y, Kuo YF, Townsend CM, Goodwin JS, Riall TS. Variation in the use of intraoperative cholangiography during cholecystectomy. J Am Coll Surg 2012; 214: ; discussion [PMID: DOI: /j.jamcollsurg ] 12 Hublet A, Dili A, Lemaire J, Mansvelt B, Molle G, Bertrand C. Laparoscopic ultrasonography as a good alternative to intraoperative cholangiography (IOC) during laparoscopic cholecystectomy: results of prospective study. Acta Chir Belg 5447 August 7, 2017 Volume 23 Issue 29

206 Dili A et al. Laparoscopic ultrasonography and cholecystectomy 2009; 109: [PMID: DOI: / ] 13 Halpin VJ, Dunnegan D, Soper NJ. Laparoscopic intracorporeal ultrasound versus fluoroscopic intraoperative cholangiography: after the learning curve. Surg Endosc 2002; 16: [PMID: DOI: /s ] 14 El Shallaly G, Seow C, Sharp C, Mughrabi A, Nassar AH. Intraoperative cholangiography time in laparoscopic cholecystectomy: timing the radiographer. Surg Endosc 2005; 19: [PMID: DOI: /s z] 15 Karthikesalingam A, Markar SR, Weerakkody R, Walsh SR, Carroll N, Praseedom RK. Radiation exposure during laparoscopic cholecystectomy with routine intraoperative cholangiography. Surg Endosc 2009; 23: [PMID: DOI: / s ] 16 Falcone RA, Fegelman EJ, Nussbaum MS, Brown DL, Bebbe TM, Merhar GL, Johannigman JA, Luchette FA, Davis K, Hurst JM. A prospective comparison of laparoscopic ultrasound vs intraoperative cholangiogram during laparoscopic cholecystectomy. Surg Endosc 1999; 13: [PMID: DOI: / s ] 17 Birth M, Roblick U, Brugmans F, Weiser HF, Bruch HP. Laparoscopic ultrasonography reliably visualizes bile-duct injuries - a blind randomized porcine study. Langenbecks Arch Surg 1999; 384: [PMID: DOI: /s ] 18 Birth M, Carroll BJ, Delinikolas K, Eichler M, Weiser H. Recognition of laparoscopic bile duct injuries by intraoperative ultrasonography. Surg Endosc 1996; 10: [PMID: DOI: /BF ] 19 Stiegmann GV, Soper NJ, Filipi CJ, McIntyre RC, Callery MP, Cordova JF. Laparoscopic ultrasonography as compared with static or dynamic cholangiography at laparoscopic cholecystectomy. A prospective multicenter trial. Surg Endosc 1995; 9: [PMID: DOI: /BF ] 20 Catheline J, Rizk N, Champault G. A comparison of laparoscopic ultrasound versus cholangiography in the evaluation of the biliary tree during laparoscopic cholecystectomy. Eur J Ultrasound 1999; 10: 1-9 [PMID: DOI: /S (99) ] 21 Wu JS, Dunnegan DL, Soper NJ. The utility of intracorporeal ultrasonography for screening of the bile duct during laparoscopic cholecystectomy. J Gastrointest Surg 1998; 2: [PMID: DOI: /S X(98) ] 22 Rijna H, Eijsbouts QA, Barkhof F, de Brauw LM, Cuesta MA. Assessment of the biliary tract by ultrasonography and cholangiography during laparoscopic cholecystectomy: a prospective study. Eur J Ultrasound 1999; 9: [PMID: DOI: /S (99)00018-X] 23 Siperstein A, Pearl J, Macho J, Hansen P, Gitomirsky A, Rogers S. Comparison of laparoscopic ultrasonography and fluorocholangiography in 300 patients undergoing laparoscopic cholecystectomy. Surg Endosc 1999; 13: [PMID: DOI: /s ] 24 Olsen AK, Bjerkeset OA. Laparoscopic ultrasound (LUS) in gastrointestinal surgery. Eur J Ultrasound 1999; 10: [PMID: DOI: /S (99) ] 25 Ohtani T, Kawai C, Shirai Y, Kawakami K, Yoshida K, Hatakeyama K. Intraoperative ultrasonography versus cholangiography during laparoscopic cholecystectomy: a prospective comparative study. J Am Coll Surg 1997; 185: [PMID: DOI: /S (97) ] 26 Soper NJ. Intraoperative detection: intraoperative cholangiography vs. intraoperative ultrasonography. J Gastrointest Surg 2000; 4: [PMID: DOI: /S X(00) ] 27 Santambrogio R, Montorsi M, Bianchi P, Opocher E, Verga M, Panzera M, Cosentino F. Common bile duct exploration and laparoscopic cholecystectomy: role of intraoperative ultrasonography. J Am Coll Surg 1997; 185: [PMID: DOI: /S (97) ] 28 Strasberg SM, Herti M, Soper NJ. An analysis of the problem of biliary injury during laparoscopic cholecystectomy. J AM Coll Surg 1995; 180: [PMID: ] 29 Machi J. Accuracy of intraoperative ultrasound and cholangiography. Surg Endosc 1996; 10: [PMID: DOI: /BF ] 30 Kelly SB, Remedios D, Lau WY, Li AK. Laparoscopic ultrasonography during laparoscopic cholecystectomy. Surg Endosc 1997; 11: [PMID: DOI: /s ] 31 Röthlin MA, Schöb O, Schlumpf R, Largiadèr F. Laparoscopic ultrasonography during cholecystectomy. Br J Surg 1996; 83: [PMID: DOI: /bjs ] 32 Tomonaga T, Filipi CJ, Lowham A, Martinez T. Laparoscopic intracorporeal ultrasound cystic duct length measurement: a new technique to prevent common bile duct injuries. Surg Endosc 1999; 13: [PMID: DOI: /s ] 33 Kubota K, Bandai Y, Sano K, Teruya M, Ishizaki Y, Makuuchi M. Appraisal of intraoperative ultrasonography during laparoscopic cholecystectomy. Surgery 1995; 118: [PMID: DOI: /S (05) ] 34 Barteau JA, Castro D, Arregui ME, Tetik C. A comparison of intraoperative ultrasound versus cholangiography in the evaluation of the common bile duct during laparoscopic cholecystectomy. Surg Endosc 1995; 9: [PMID: DOI: / BF ] 35 Santambrogio R, Bianchi P, Opocher E, Mantovani A, Schubert L, Ghelma F, Panzera M, Verga M, Spina GP. Intraoperative ultrasonography (IOUS) during laparoscopic cholecystectomy. Surg Endosc 1996; 10: [PMID: DOI: / BF ] 36 Daly SC, Deziel DJ, Li X, Thaqi M, Millikan KW, Myers JA, Bonomo S, Luu MB. Current practices in biliary surgery: Do we practice what we teach? Surg Endosc 2016; 30: [PMID: DOI: /s ] 37 Aziz O, Ashrafian H, Jones C, Harling L, Kumar S, Garas G, Holme T, Darzi A, Zacharakis E, Athanasiou T. Laparoscopic ultrasonography versus intra-operative cholangiogram for the detection of common bile duct stones during laparoscopic cholecystectomy: a meta-analysis of diagnostic accuracy. Int J Surg 2014; 12: [PMID: DOI: /j.ijsu ] 38 Jamal KN, Smith H, Ratnasingham K, Siddiqui MR, McLachlan G, Belgaumkar AP. Meta-analysis of the diagnostic accuracy of laparoscopic ultrasonography and intraoperative cholangiography in detection of common bile duct stones. Ann R Coll Surg Engl 2016; 98: [PMID: DOI: / rcsann ] 39 Babel N, Sakpal SV, Paragi P, Wellen J, Feldman S, Chamberlain RS. Iatrogenic bile duct injury associated with anomalies of the right hepatic sectoral ducts: a misunderstood and underappreciated problem. HPB Surg 2009; 2009: [PMID: DOI: /2009/153269] 40 Izuishi K, Toyama Y, Nakano S, Goda F, Usuki H, Masaki T, Maeta H. Preoperative assessment of the aberrant bile duct using multislice computed tomography cholangiography. Am J Surg 2005; 189: [PMID: DOI: / j.amjsurg ] 41 Yoshida J, Chijiiwa K, Yamaguchi K, Yokohata K, Tanaka M. Practical classification of the branching types of the biliary tree: an analysis of 1,094 consecutive direct cholangiograms. J Am Coll Surg 1996; 182: [PMID: ] 42 Hashimoto M, Matsuda M, Watanabe G. Intraoperative ultrasonography for reducing bile duct injury during laparoscopic cholecystectomy. Hepatogastroenterology 2010; 57: [PMID: ] 43 Shen BY, Li HW, Chen M, Zheng MH, Zang L, Jiang SM, Li JW, Jiang Y. Color Doppler ultrasonographic assessment of the risk of injury to major branch of the middle hepatic vein during laparoscopic cholecystectomy. Hepatobiliary Pancreat Dis Int 2003; 2: [PMID: ] 44 Yau HM, Lee KT, Kao EL, Chuang HY, Chou SH, Huang MF August 7, 2017 Volume 23 Issue 29

207 Dili A et al. Laparoscopic ultrasonography and cholecystectomy Color Doppler ultrasound detection and classification of the tangential hepatic vein before laparoscopic cholecystectomy. Surg Endosc 2005; 19: [PMID: DOI: / s y] 45 Misawa T, Koike M, Suzuki K, Unemura Y, Murai R, Yoshida K, Kobayashi S, Yamazaki Y. Ultrasonographic assessment of the risk of injury to branches of the middle hepatic vein during laparoscopic cholecystectomy. Am J Surg 1999; 178: [PMID: DOI: /S (99) ] 46 Birth M, Lossin P, Brugmans F, Weiser HF. Vascular injuries within the hepatoduodenal ligament: recognition by laparoscopic color Doppler ultrasound. Surg Endosc 2000; 14: [PMID: DOI: /s ] 47 Pfluke JM, Bowers SP. Laparoscopic intraoperative biliary ultrasonography: findings during laparoscopic cholecystectomy for acute disease. J Laparoendosc Adv Surg Tech A 2011; 21: [PMID: DOI: /lap ] 48 Hakamada K, Narumi S, Toyoki Y, Nara M, Oohashi M, Miura T, Jin H, Yoshihara S, Sugai M, Sasaki M. Intraoperative ultrasound as an educational guide for laparoscopic biliary surgery. World J Gastroenterol 2008; 14: [PMID: DOI: /wjg ] 49 Li JW, Feng B, Wu L, Wang ML, Lu AG, Zang L, Mao ZH, Dong F, Zheng MH. Intraoperative cholangiography in combination with laparoscopic ultrasonography for the detection of occult choledocholithiasis. Med Sci Monit 2009; 15: MT126-MT130 [PMID: ] 50 Perry KA, Myers JA, Deziel DJ. Laparoscopic ultrasound as the primary method for bile duct imaging during cholecystectomy. Surg Endosc 2008; 22: [PMID: DOI: / s ] 51 Machi J, Oishi AJ, Tajiri T, Murayama KM, Furumoto NL, Oishi RH. Routine laparoscopic ultrasound can significantly reduce the need for selective intraoperative cholangiography during cholecystectomy. Surg Endosc 2007; 21: [PMID: DOI: /s y] 52 Catheline JM, Turner R, Rizk N, Barrat C, Buenos P, Champault G. Evaluation of the biliary tree during laparoscopic cholecystectomy: laparoscopic ultrasound versus intraoperative cholangiography: a prospective study of 150 cases. Surg Laparosc Endosc 1998; 8: [PMID: DOI: / ] 53 Gwinn EC, Daly S, Deziel DJ. The use of laparoscopic ultrasound in difficult cholecystectomy cases significantly decreases morbidity. Surgery 2013; 154: ; discussion [PMID: DOI: /j.surg ] 54 Machi J, Johnson JO, Deziel DJ, Soper NJ, Berber E, Siperstein A, Hata M, Patel A, Singh K, Arregui ME. The routine use of laparoscopic ultrasound decreases bile duct injury: a multicenter study. Surg Endosc 2009; 23: [PMID: DOI: /s x] 55 Biffl WL, Moore EE, Offner PJ, Franciose RJ, Burch JM. Routine intraoperative laparoscopic ultrasonography with selective cholangiography reduces bile duct complications during laparoscopic cholecystectomy. J Am Coll Surg 2001; 193: [PMID: DOI: /S (01) ] 56 Deziel DJ. Complications of cholecystectomy. Incidence, clinical manifestations, and diagnosis. Surg Clin North Am 1994; 74: [PMID: ] 57 Zha Y, Chen XR, Luo D, Jin Y. The prevention of major bile duct injures in laparoscopic cholecystectomy: the experience with 13,000 patients in a single center. Surg Laparosc Endosc Percutan Tech 2010; 20: [PMID: DOI: / SLE.0b013e efb] 58 Hori T, Oike F, Furuyama H, Machimoto T, Kadokawa Y, Hata T, Kato S, Yasukawa D, Aisu Y, Sasaki M, Kimura Y, Takamatsu Y, Naito M, Nakauchi M, Tanaka T, Gunji D, Nakamura K, Sato K, Mizuno M, Iida T, Yagi S, Uemoto S, Yoshimura T. Protocol for laparoscopic cholecystectomy: Is it rocket science? World J Gastroenterol 2016; 22: [PMID: DOI: /wjg.v22.i ] 59 Avgerinos C, Kelgiorgi D, Touloumis Z, Baltatzi L, Dervenis C. One thousand laparoscopic cholecystectomies in a single surgical unit using the critical view of safety technique. J Gastrointest Surg 2009; 13: [PMID: DOI: / s ] 60 Sanjay P, Fulke JL, Exon DJ. Critical view of safety as an alternative to routine intraoperative cholangiography during laparoscopic cholecystectomy for acute biliary pathology. J Gastrointest Surg 2010; 14: [PMID: DOI: / s ] 61 Strasberg SM, Brunt LM. Rationale and use of the critical view of safety in laparoscopic cholecystectomy. J Am Coll Surg 2010; 211: [PMID: DOI: /j.jamcollsurg ] 62 Yamashita Y, Kimura T, Matsumoto S. A safe laparoscopic cholecystectomy depends upon the establishment of a critical view of safety. Surg Today 2010; 40: [PMID: DOI: /s z] 63 de Reuver PR, Rauws EA, Bruno MJ, Lameris JS, Busch OR, van Gulik TM, Gouma DJ. Survival in bile duct injury patients after laparoscopic cholecystectomy: a multidisciplinary approach of gastroenterologists, radiologists, and surgeons. Surgery 2007; 142: 1-9 [PMID: DOI: /j.surg ] 64 Sherman JL, Shi EW, Ranasinghe NE, Sivasankaran MT, Prigoff JG, Divino CM. Validation and improvement of a proposed scoring system to detect retained common bile duct stones in gallstone pancreatitis. Surgery 2015; 157: [PMID: DOI: /j.surg ] 65 Yang MH, Chen TH, Wang SE, Tsai YF, Su CH, Wu CW, Lui WY, Shyr YM. Biochemical predictors for absence of common bile duct stones in patients undergoing laparoscopic cholecystectomy. Surg Endosc 2008; 22: [PMID: DOI: / s ] 66 Tranter SE, Thompson MH. A prospective single-blinded controlled study comparing laparoscopic ultrasound of the common bile duct with operative cholangiography. Surg Endosc 2003; 17: [PMID: DOI: /s x] 67 Shaaban H, Welch A, Rao S. Laparoscopic ultrasound for the diagnosis of choledocholithiasis: quick, safe, and effective. Surg Laparosc Endosc Percutan Tech 2014; 24: [PMID: DOI: /SLE.0b013e31828fa907] 68 Tranter SE, Thompson MH. Potential of laparoscopic ultrasonography as an alternative to operative cholangiography in the detection of bile duct stones. Br J Surg 2001; 88: [PMID: DOI: /j x] 69 Lee SP, Nicholls JF, Park HZ. Biliary sludge as a cause of acute pancreatitis. N Engl J Med 1992; 326: [PMID: DOI: /NEJM ] 70 Santambrogio R, Bianchi P, Opocher E, Verga M, Montorsi M. Prevalence and laparoscopic ultrasound patterns of choledocholithiasis and biliary sludge during cholecystectomy. Surg Laparosc Endosc Percutan Tech 1999; 9: [PMID: DOI: / ] 71 Grier JF, Cohen SW, Grafton WD, Gholson CF. Acute suppurative cholangitis associated with choledochal sludge. Am J Gastroenterol 1994; 89: [PMID: ] 72 Mirbagheri SA, Mohamadnejad M, Nasiri J, Vahid AA, Ghadimi R, Malekzadeh R. Prospective evaluation of endoscopic ultrasonography in the diagnosis of biliary microlithiasis in patients with normal transabdominal ultrasonography. J Gastrointest Surg 2005; 9: [PMID: DOI: /j.gassur ] 73 Catheline JM, Turner R, Paries J. Laparoscopic ultrasonography is a complement to cholangiography for the detection of choledocholithiasis at laparoscopic cholecystectomy. Br J Surg 2002; 89: [PMID: DOI: / j x] 74 Kothari SN, Obinwanne KM, Baker MT, Mathiason MA, Kallies KJ. A prospective, blinded comparison of laparoscopic ultrasound with transabdominal ultrasound for the detection of gallbladder pathology in morbidly obese patients. J Am Coll Surg 2013; 216: August 7, 2017 Volume 23 Issue 29

208 Dili A et al. Laparoscopic ultrasonography and cholecystectomy [PMID: DOI: /j.jamcollsurg ] 75 Nasu M, Yoshimura S, Uomori T, Takehara K, Tanaka R, Miyano S, Machida M, Kitabatake T, Fujisawa M, Kojima K. The efficacy of intraoperative ultrasonography during laparoscopic cholecystectomy. Hepatogastroenterology 2012; 59: [PMID: ] 76 Sun SX, Kulaylat AN, Hollenbeak CS, Soybel DI. Cost-effective Decisions in Detecting Silent Common Bile Duct Gallstones During Laparoscopic Cholecystectomy. Ann Surg 2016; 263: [PMID: DOI: /SLA ] P- Reviewer: Chang YC, Kanat BH, Paduani GF S- Editor: Gong ZM L- Editor: A E- Editor: Li D 5450 August 7, 2017 Volume 23 Issue 29

209 Published by Baishideng Publishing Group Inc 7901 Stoneridge Drive, Suite 501, Pleasanton, CA 94588, USA Telephone: Fax: Help Desk: I S S N Baishideng Publishing Group Inc. All rights reserved.