Titanium Dioxide Nanoparticles Induce Matrix Metalloprotease 1 in Human Pulmonary Fibroblasts Partly via an Interleukin-1b Dependent Mechanism

Transcription

1 Titanium Dioxide Nanoparticles Induce Matrix Metalloprotease 1 in Human Pulmonary Fibroblasts Partly via an Interleukin-1b Dependent Mechanism Lucie Armand 1,2, Maylis Dagouassat 1,2, Esther Belade 1,2, Angélique Simon-Deckers 1,2, Sabine Le Gouvello 1,2,3, Chantal Tharabat 1, Corinne Duprez 3, Pascal Andujar 1,2,4, Jean-Claude Pairon 1,2,4, Jorge Boczkowski 1,2,4,5, and Sophie Lanone 1,2,4 1 Inserm U955, Créteil; 2 Université Paris Est, Faculté de médecine, Créteil; 3 AP-HP, Hôpital Henri Mondor, Service d Immunologie Biologique, Créteil; 4 Centre Hospitalier Intercommunal, Service de pneumologie et pathologie professionnelle, Créteil; and 5 AP-HP, Hôpital Henri Mondor, Service de Physiologie Explorations Fonctionnelles, Créteil, France Exposure to titanium dioxide (TiO 2 ) nanoparticles (NPs) is associated with lung remodeling, but the underlying mechanisms are unknown. Matrix metalloprotease (MMP)-1 is an important actor in matrix homeostasis and could therefore participate in TiO 2 NP effects. Our aim was to evaluate the effects of TiO 2 NPs on MMP-1 expression and activity in lung pulmonary fibroblasts and to understand the underlying mechanisms and assess the importance of the physicochemical characteristics of the particles in these effects. Human pulmonary fibroblasts (MRC-5 cell line and primary cells) were exposed to 10 or 100 mg/cm 2 TiO 2 (two anatases, two anatase/rutile mix, one rutile NP, and one micrometric) and carbon black (CB) NPs for 6 to 48 hours. We examined cell viability, MMP-1 expression and activity, and the implication of oxidative stress, transforming growth factor (TGF)-b, extracellular MMP inducer, and IL-1b in MMP-1 expression. All TiO 2 NPs induced MMP-1 (mrna and protein expression), repression of procollagen-1, and a-actin expression, but only the two anatase/rutile mix induced MMP-1 activity. Micrometric TiO 2 had smaller effects than TiO 2 NPs, and CB NPs did not induce MMP-1. MMP-1 induction by TiO 2 NPs was not related to TGF-b, oxidative stress, or EMPRIN expression but was related to IL-1b expression, which partly drives MMP-1 induction by two TiO 2 NPs (one anatase/rutile mix and the rutile one). Taken together, our results show that TiO 2 NPs are potent inducers and regulators of MMP-1 expression and activity, partly via an IL-1b dependent mechanism. This may explain TiO 2 lung remodeling effects. Keywords: matrix metalloprotease-1; nanoparticles; titanium dioxide; carbon black; interleukin-1 b Titanium dioxide (TiO 2 ) nanoparticles (NPs) are among the most abundantly produced NPs (1). Because of their optical, photocatalytic, and self-cleaning properties, TiO 2 NPs are used in a wide range of commercially available products, such as paints, pigments, and cosmetics (see for inventory). Pulmonary occupational exposure to an aerosol of TiO 2 NPs can occur during the synthesis or the manufacturing of these materials. This route of exposure has been shown to induce an inflammatory response (increased bronchoalveolar lavage [BAL] cellularity and increased BAL and total lung cytokine content[2]whencomparedwithunexposedanimals)andtoexacerbate preexisting asthma in mice (3). Moreover, exposure to TiO 2 NPs is associated with the development of lung tumors in rats (Received in original form March 12, 2012 and in revised form November 15, 2012) Correspondence and requests for reprints should be addressed to Sophie Lanone, Ph.D., Unité Inserm 955, Equipe 4, Faculté de Médecine de Créteil, 8, rue du Général Sarrail, Créteil, France. sophie.lanone@inserm.fr This article has an online supplement, which is accessible from this issue s table of contents at Am J Respir Cell Mol Biol Vol 48, Iss. 3, pp , Mar 2013 Copyright ª 2013 by the American Thoracic Society Originally Published in Press as DOI: /rcmb OC on December 13, 2012 Internet address: chronically exposed (4) and matrix-remodeling effects, such as the development of emphysema-like alterations (5). The underlying mechanisms of this last effect have not been described, although its functional consequences could be important. Matrix metalloproteases (MMPs) and their inhibitors (tissue inhibitor of matrix metalloprotease [TIMP]) are important actors of matrix homeostasis. In the lung, overexpression of interstitial collagenase MMP-1 in alveolar epithelial cells has been shown to be involved in the loss of alveolar integrity in pulmonary emphysema (6, 7). Studies using diesel particulate matter demonstrated an up-regulation of MMP-1 expression and activity in human alveolar epithelial cells (8) and in human bronchial epithelia (9). MMP-1 is a highly regulated protein (10); its expression and activity are regulated at the transcriptional and posttranslational levels by different mechanisms, such as oxidants (11), transforming growth factor (TGF)-b (12), extracellular matrix metalloprotease inducer (EMMPRIN) (13), and IL-1b (14). MMP-1 up-regulation after exposure to TiO 2 NPs could be a mechanism explaining, at least in part, the emphysema-like effects of TiO 2 NPs in the lung tissue. However, no data are available in the literature examining the effect of TiO 2 NPs on MMP-1 expression and activity. We therefore set up a study aimed to evaluate the effects of TiO 2 NPsatconcentrationsrelevant to occupational exposure on MMP-1 expression and activity in human lung pulmonary fibroblasts (MRC5 cell line and primary culture). The rationale of this was that pulmonary fibroblasts are key cells in lung matrix homeostasis (15 17), TiO 2 NPs can reach pulmonary interstitium and be in contact with fibroblasts (18 21), and TiO 2 NPs can induce an oxidative stress and the overexpression of IL-1b, two known inducers of MMP-1 (2, 22 25). Finally, because the physico-chemical characteristics of NPs (e.g., chemical composition, size, crystal phase, or shape) could be important determinants of NPs biological effects (26), we used five different TiO 2 NPs (size, crystal phase, shape effects) and compared their effects with those of carbon black (CB) (chemical composition effect) NPs and a micron-size TiO 2 particle (size effect). MATERIALS AND METHODS Please refer to the online supplement for more detailed methods. Particle Characterization We investigated TiO 2 NPs with two main crystal phases (anatase [A] and rutile [R]), different dimensions (10 75 nm diameter), and different forms (spherical and fibrous needle ). The combination of these different parameters resulted in five different TiO 2 NPs, named A10 (spherical anatase; mean diameter, 10 nm), A15 (spherical anatase; mean diameter, 15 nm), A/R high (spherical anatase with high rutile content; mean diameter, nm), A/R low (spherical anatase with low rutile content; mean diameter, nm), and Rneedle (pure rutile with fibrous shape). To investigate the existence of a nano effect we analyzed a micrometric TiO 2 particle (mean diameter, 200 nm), and to test the existence of a NP

2 Armand, Dagouassat, Belade, et al.: TiO 2 Nanoparticles Induce MMP chemical nature effect we investigated a carbon black (CB) NPs (mean diameter, 13 nm). Different suppliers (Sigma Aldrich [St. Louis, MO] and Nanoamor [Houston, TX]) were chosen for the two small anatase NPs (A10 and A15) and for the two A/R ones. NPs were characterized as powders and in solution as follows. Particle shape was observed using transmission electron microscopy (TEM), and specific surface area was measured using Brunauer-Emmett-Teller adsorption isotherms of nitrogen using a Flowsorb 2300 (Micromeritics, Norcross, GA). Suspension agglomeration state and zeta potential were measured by photon correlation spectroscopy. Both parameters were determined using a Zetasizer 3000HS (Malvern, Worcestershire, UK) equipped with a MPT-1 ph titrator. NP endotoxin content was examined using the Amebocyte Lysate assay (Limulus, Lonza, Switzerland). Cells We used a lung fetal fibroblastic cell line: the MRC-5 cell line (ATCC, Manassas, VA) and human primary lung fibroblasts derived from patients undergoing lung surgery for removal of a primary lung tumor. All experiments were performed on the MRC-5 cell line, and the most significant results (cell viability, MMP-1, a-actin, procollagen-1 a1, and IL-1b mrna expression) have been validated on lung primary fibroblast. Cells were exposed to 10 to 100 mg/cm 2 (equivalent to mg/ml), concentrations calculated by Gangwal and colleagues to be similar to predicted lung surface area concentrations based on inhalation exposure to nanoparticles in an occupational setting over the course of a full working lifetime (27). Optical and TEM Microscopy Cells were exposed for 48 hours to the particles at 10 mg/cm 2 and fixed with usual techniques. Cell Viability Mitochondrial activity was measured using the WST-1 assay (Roche Diagnostics, France), and cell number was assessed by quantifying DNA content as described (28). Quantification of Reactive Oxygen Species Production Because reactive oxygen species (ROS) production is often proposed as a key mechanism of action for NPs (29, 30), we addressed the issue of ROS generation directly by particles (plasmid PhiX174 RF1) and secondarily to cellular reaction (2-7 dichlorodihydrofluorescein diacetate dye). Quantification of mrna and Protein Expression mrna expression was assessed using RT-qPCR, and Western blot, immunofluorescence, and ELISA (for IL-1b) assays were used for protein detection. The sequences of primers used are indicated in Table 1, and antibodies are listed in Table 2. Quantification of MMP-1 Activity MMP-1 activity was assessed using the Human Active MMP-1 Fluorescent Assay (R&D Systems, Minneapolis, MN). Statistical Analysis Data were expressed as means 6 SEM and were analyzed with Graph- Pad Prism 4.0 software (GraphPad, La Jolla, CA). Comparisons between multiple groups were performed by using Kruskall-Wallis nonparametric ANOVA test followed, when a difference was detected, by two-by-two comparisons with the Mann-Whitney s U test. All comparisons were realized with Bonferonni s correction for multiple comparisons. P values, 0.05 were considered significant. RESULTS Particle Characterization The particles characteristics are presented in Table 3. All particles, except micrometric TiO 2, presented a surface area (which represents the real surface, as opposed to the apparent surface [31]) greater than 15 m 2 /g, the highest value being obtained for TABLE 1. PRIMERS USED FOR REAL-TIME QUANTITATIVE POLYMERASE CHAIN REACTION Name Genbank Accession Number Sequences (59 39) Product Size (bp) SF3A1 NM_ Forward: GCAGGATAAGACGGAATGGAAACTGA 179 NM_ Reverse: TAGTAAGCCAGTGAGTTGGAATCTTTG MMP-1 NM_ Forward: ACTGCCAAATGGGCTTGAAG 92 Reverse: GTCCCTGAACAGCCCAGTACTT a-actin NM_ Forward: CCTGTGAAGCAGCTCCAGCTA 175 NM_ Reverse: TTTTGTCCCATTCCCACCAT Procollagen-1 a1 NM_ Forward: CCAGAAGAACTGGTACATCAGCAA 95 Reverse: CGCCATACTCGAACTGGAATC MMP-2 NM_ Forward: GCGGCGGTCACAGCTACTT 96 NM_ Reverse: AGTCGGATTTGATGCTTCCAA TIMP-1 NM_ Forward: AGACCTACACTGTTGGCTGTGAG 130 Reverse: GACTGGAAGCCCTTTTCAGAG HO-1 NM_ Forward: TTCTTCACCTTCCCCAACATTG 164 Reverse: CAGCTCCTGCAACTCCTCAAA NOX-1 NM_ Forward: GGCTCCAAACCACCTCTTGA 90 NM_ Reverse: ACATTCAGCCCTAACCAAACAAC NOX-2 NM_ Forward: CCAGTGAAGATGTGTTCAGCTATGA 169 Reverse: AACCACTCAAAGGCATGTGTGT NOX-3 NM_ Forward:CCCTGGAAACACGGATGAGT 237 Reverse: GTCCACAGAAGAACACGCCAAT NOX-4 NM_ Forward:CCATCTAGTCAAGACTCCGAAATTC 98 NM_ Reverse: GATTCCTCAAATGGACTTCCAAA NM_ NOX-5 NM_ Forward: CGGCCCCCTTTTTTTCACTA 144 Reverse: GCCTTGGGACCGAATGTG TGF-b NM_ Forward: GGCCTTTCCTGCTTCTCATG 153 Reverse: GGTCCTTGCGGAAGTCAATG IL-1b NM_ Forward: GACTCACAGCAAAAAAGCTTGGT 187 Reverse: TCAACACGCAGGACAGGTACA Definition of abbreviations: HO-1¼ heme oxygenase 1; MMP-1 ¼ matrix metalloprotease-1; MMP-2 ¼ matrix metalloprotease-2; NOX-1 ¼ NADPH oxidase 1; NOX-2 ¼ NADPH oxidase 2; NOX-3 ¼ NADPH oxidase 3; NOX-4 ¼ NADPH oxidase 4; NOX-5 ¼ NADPH oxidase 5; SF3A1 ¼ splicing factor 3A subunit 1; TGF-b¼ transforming growth factor b; TIMP-1 ¼ tissue inhibitor of matrix metalloprotease 1.

3 356 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL TABLE 2. ANTIBODIES USED FOR WESTERN BLOT AND IMMUNOFLUORESCENCE Protein Final Concentration (mg/ml) Supplier Supplier Reference MMP R&D MAB901 HO-1 1 Enzo life sciences HC3001 Smad 2 1 Cell Signaling 3103 Smad 2P 1 Cell Signaling 3108 Smad 3 1 Cell Signaling 9513 Smad 3P 1 Cell Signaling 9520 Smad 7 1 R&D Systems MAB2029 Emmprin 0.5 BD Pharmingen Caspase-1 1 Cell Signaling 2225 IkB-a 1 Cell Signaling 9247 b-actin 1 Sigma-Aldrich A5316 CB FW2 NPs. For all suspensions, the zeta potential, which evaluates the aggregation status of the particles, was lower than j20j mv, a commonly admitted limit above which the suspension is stable (32), indicating that the suspensions could be agglomerated. This was confirmed by the measurement of hydrodynamic diameter, with values obtained between 715 and 1,073 nm, demonstrating the agglomeration of all particles. Endotoxin levels were below the detection limit for all particles (data not shown). TEM observations confirmed the particles shape (Figure 1): spherical for all but Rneedle ones. Cell Morphology and Uptake of Particles by Cells To assess cell morphology as well as whether or not cells internalized the different particles, we performed optical and TEM observations. Optical microscopy observation of cells exposed to 10 mg/cm 2 particles for 48 hours revealed no change in cell morphology (Figure 2). All particles formed agglomerates that appeared colocalized with the cells. TEM observations confirmed the absence of modification of cell morphology (Figure 3) and showed the internalization of aggregated NPs in the cytoplasm of exposed fibroblasts. Particles were never observed inside the nucleus. Cell Viability No diminution of cell viability was observed after exposure of fibroblasts to TiO 2 NPs (see Figure E1 in the online supplement and data not shown). Similar results were obtained after exposure to micrometric TiO 2. By contrast, exposure to FW2 resulted in a significant decrease of cell viability whatever the time point and concentration studied (Figure E1 and data not shown). MMP-1 Expression and Activity The effects of the different particles on MMP-1 expression (mrna, protein) and activity were assessed by qrt-pcr, Western blot, immunofluorescence, and fluorokine assay. Because collagen and a-actin are important markers of fibroblasts activation (33), their mrna expression levels were quantified by qrt-pcr. The five TiO 2 NPs induced a significant dose-dependent increase in MMP-1 mrna expression 48 hours after the initial exposure (Figures 4A and 4B) but not at earlier time points (data not shown). Rneedle TiO 2 NPs had the most significant effect (Figure 4). The intracellular protein content analysis revealed a modulation of pro MMP-1 expression, following the same pattern as mrna expression (Figures 4C 4E). This was also confirmed by immunofluorescence experiments (Figure 4F). However, analysis of MMP-1 activity showed that only A/R high and, to a lesser extent, A/R low TiO 2 NPs induced a significant effect (Figure 4G). Micrometric TiO 2 also induced MMP-1 mrna and protein expression, although the values were lower than those observed with TiO 2 NPs at the highest dose (100 mg/cm 2 ; P, 0.01). Micrometric TiO 2 also induced MMP-1 activity but to a lesser extent than both A/R NP. FW2 NPs had no effect on MMP-1 expression (mrna, protein) or activity (Figure 4). The expression of MMP-2 and TIMP-1 was not modified by any particle exposure (data not shown). Modulation of MMP-1 expression by TiO 2 particles was mirrored by a significant dose-dependent decrease in procollagen-1 a1 and a-actin mrna expression (Figure 5). These effects were present 24 hours after the initial exposure (Figures 5A and 5C), and Rneedle TiO 2 NPs had the most significant effect. No effect of FW2 was observed. Because it is known that signaling pathways may differ between cell lines and primary cells (34), the relevance of data obtained on MRC-5 cells were confirmed on human primary lung fibroblasts. Indeed, similar results (expression of MMP-1, procollagen-1 a1, and a-actin) were obtained after exposure of primary lung fibroblasts to the different particles (Figure 6 and data not shown) in the absence of cytotoxicity (Figure E2A and 2B and data not shown). Overall, these results indicate that TiO 2 NPs are potent MMP-1 inducers, particularly when their crystal phase is rutile (pure or mixed with anatase). Underlying Mechanism of MMP-1 Induction MMP-1 is a highly regulated MMP (10). We next investigated molecular mechanisms involved in MMP-1 induction by TiO 2 NPs, focusing on repressor (TGF-b pathway) or activator pathways (ROS, EMMPRIN, and IL-1b) (11 14). TGF-b pathway. TGF-b is a repressor of MMP-1 transcription (11). We hypothesized that TiO 2 NPs could down-regulate TGF-b expression and/or its downstream signaling pathway (Smad 2 and 3 as activators and Smad 7 as repressor), resulting in MMP-1 induction. TABLE 3. PHYSICOCHEMICAL CHARACTERISTICS OF NANOPARTICLES Particle Composition Supplier Crystal Phase Shape Dimensions (nm) Surface Area (m 2 /g)* Zeta Potential (mv) Hydrodynamic Diameter (nm) FW2 CB Evonik Spherical , Micro TiO 2 Accros Organics Anatase Spherical A10 TiO 2 Nanoamor Anatase Spherical , A15 TiO 2 Sigma Aldrich Anatase Spherical A/R high TiO 2 Sigma Aldrich 65% Anatase/35% rutile Spherical A/R low TiO 2 Nanoamor 80% Anatase/20% rutile Spherical , Rneedle TiO 2 Nanoamor Rutile Needle-like Definition of abbreviations: CB ¼ carbon black. * Assessed with the Brunauer-Emmett-Teller method. y Assessed with photon correlation spectroscopy method.

4 Armand, Dagouassat, Belade, et al.: TiO 2 Nanoparticles Induce MMP Figure 1. Representative transmission electronic microscopy images of the different particles. Scale bar corresponds to 50 nm. A10 ¼ spherical anatase with mean diameter of 10 nm; A15 ¼ spherical anatase with mean diameter of 15 nm; A/R high ¼ spherical anatase with high rutile content and mean diameter of nm; A/R low ¼ spherical anatase with low rutile content and mean diameter of nm; Micro ¼ micrometric; Rneedle ¼ pure rutile with fibrous shape. No decrease in TGF-b mrna or protein expression was detected at any time point and particle exposure (data not shown). Moreover, neither activation of two Smad effectors (Smad 2 and 3) nor expression of Smad repressor (Smad 7) in response to TGF-b was modified by particle exposure (Figure E3 and data not shown). Taken together, these results strongly suggest that MMP-1 induction by TiO 2 NPs was not related to modulation of TGF-b expression or that of its downstream signaling pathway. ROS. MMP-1 expression is known to be under the control of ROS production (35, 36). Moreover, ROS production is proposed to be an essential underlying mechanism of NP biological effects (37). It was therefore crucial to evaluate the implication of ROS in MMP-1 induction by TiO 2 NPs. Accordingly, we investigated if TiO 2 NPs induced ROS and/or modulated the expression of pro- and antioxidants systems (namely NOX and HO-1) in fibroblasts. Finally, we used the antioxidant NAC to assess the role of oxidants in MMP-1 induction by TiO 2 NPs. All particles generated similar ROS levels, as assessed by the induction of comparable levels of free radical injury to the plasmid phi X174 RF1 DNA (data not shown). No intracellular production of ROS, measured by 2,7 -dichlorofluorescin oxidation, was observed in response to particle exposure at any time point studied (Figure E4A). This absence of oxidative stress induction was confirmed by the absence of the antioxidant HO-1 mrna and protein induction whatever the particle used (Figure E4B). Moreover, the mrna levels of the prooxidant system NOX were quantified. NOX-1, -2, and -3 mrna expression was below the detection limit. mrna expression of NOX-4 and -5 was measurable but was not induced by incubation of lung fibroblasts with particles as compared with unexposed fibroblasts (data not shown). Finally, pretreatment of cells with the antioxidant NAC did not prevent the induction of MMP-1 expression by particles (data not shown), thus ruling out the participation of an oxidative stress in this phenomenon. EMMPRIN expression. EMMPRIN has been described to induce MMP in general and MMP-1 in particular (38, 39). EMMPRIN expression was not modified by fibroblasts exposure to any particle as compared with unexposed cells (Figure E5 and data not shown). IL-1b pathway. IL-1b is a central mediator of inflammation and can activate the production of MMP-1 by various types of cells (14). IL-1b mrna expression was significantly increased by all TiO 2 NPs (100 mg/cm 2 ; P, 0.05 versus Control condition) after 48 hours of exposure (Figures 7A and 7B). Induction of IL-1b mrna by TiO 2 NPs was confirmed at the protein level as soon as 24 hours after the initial exposure (Figure 7C). Neither micrometric TiO 2 nor FW2 induced such a modification of IL-1b mrna expression, but a significant increase in IL-1b protein expression was observed in response to micrometric TiO 2 particles (Figure 7C). Data on IL-1b mrna were confirmed in lung primary fibroblasts (Figure E2C). A role for IL-1b in MMP-1 expression was observed for A/R high and Rneedle TiO 2 NPs because the mrna expression levels of MMP-1 was significantly decreased in the presence of IL-1Ra as compared with cells treated only with NPs (Figure 7D). Finally, because IL-1b is part of the inflammasome pathway (40), we assessed whether downstream elements of inflammasome pathway (namely caspase-1 and NF-kB) were implicated in MMP-1 induction. No modification of caspase-1 expression was observed at any time point and with any particle used (Figure E6A and data not shown). However, a decreased expression of Ik-Ba, as a footprint of the activation of NF-kB pathway, was observed after exposure of fibroblasts to A15 and Rneedle TiO 2 NPs and to FW2 NPs (Figure E6B and data not shown). DISCUSSION Taken together, our results show that the five TiO 2 NPs examined, at concentrations relevant to occupational lifetime exposure, were

5 358 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL Figure 2. Representative optical microscopy images of MRC-5 cells exposed for 48 hours to 10 mm/cm 2 of the different particles. Scale bar corresponds to 20 mm. potent inducers of MMP-1 expression in lung pulmonary fibroblasts, partly via an IL-1b dependent mechanism. However, MMP-1 activity was only induced by NPs presenting a mixed A/R crystal phase. All TiO 2 particles induced a significant increase in MMP-1 mrna and protein expression, which was even higher for NPs than for micrometric TiO 2 particles. This suggests that size (micro versus nano) and chemical composition (carbon versus titanium) are important physico-chemical characteristics determining MMP-1 induction. Among TiO 2 NPs, two other physicochemical characteristics were unique to the two NPs that also significantly increased MMP-1 activity in lung fibroblasts: their small surface area and their mixed A/R crystal phase. These results appear opposite to the often-proposed paradigm showing a good correlation between a high particle surface area and a high toxicity of NPs (41 45), although several studies failed to demonstrate such a relationship (46 49). This paradigm has been proposed concerning toxicity parameters (e.g., cell viability, genotoxicity, and production of inflammatory mediators) and not actors of matrix homeostasis such as MMP-1 and thus could explain its inadequacy to our results. Only A/R TiO 2 NPs were able to induce MMP-1 activity, whereas pure anatase or rutile were not. The anatase crystal phase was initially proposed as the most reactive one because of its photocatalytic properties Figure 3. Representative transmission electronic microscopy images of MRC-5 cells exposed for 48 hours to 10 mm/cm 2 of different particles. Scale bar corresponds to 10 mm.

6 Armand, Dagouassat, Belade, et al.: TiO 2 Nanoparticles Induce MMP Figure 4. Matrix metalloprotease (MMP)-1 expression after particle exposure in MRC-5 cells. mrna expression after 24-hour (A) and 48 hour (B) exposure assessed by RT-qPCR. (C) Representative Western blot of MMP-1 after 48-hour exposure. Quantification of protein expression after 24-hour (D) and 48-hour (E) exposure assessed by Western blot. (F) Immunofluorescence images of MRC-5 fibroblasts exposed to 10 mm/cm 2 of the different particles for 48 hours. (G) MMP-1 activity measured by enzyme activity assay after 48-hour exposure. *P, 0.05 versus Control and FW2. # P, 0.05 versus Control, FW2, and Micro (n ¼ 4). Bar graphs represent means 6 SEM. Light-checkered bar graph: 10mg/cm 2. Thick-checkered bar graph: 100 mg/cm 2.

7 360 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL Figure 5. Procollagen-1 a1 anda-actin mrna expression in MRC-5 cells exposed to the different particles. Procollagen-1 a1 expression after 24-hour (A) and 48-hour (B) exposure. a-actin expression after 24-hour (C) and 48-hour(D) exposure. Large open asterisks: P, 0.05 versus Control. *P, 0.05 versus Control and FW2. # P, 0.05 versus Control, FW2, and Micro (n ¼ 5). Bar graphs represent means 6 SEM. Lightcheckered bar graph: 10mg/cm 2. Thick-checkered bar graph: 100 mg/cm 2. (22). However, recent studies demonstrate that the effects on cell viability (the proinflammatory response of the A/R mixed crystal phase) can be higher than those of rutile (22, 50) or anatase alone (51). These results are in agreement with ours and may be related to a synergistic effect due to the coexistence of anatase and rutile particles, as has been suggested to justify the high photocatalytic efficiency of such type of powder (51). An important issue of our study is that we reasoned in terms of equal mass dose, although ideally one would like to use equal numbers of particles, particularly when comparing size effects of micro- versus nano-particles. However, such an approach would assume that particles all disaggregate into singlet, which does not seem to be the case in our study as assessed by TEM observations and dynamic light scattering measurements. Taken together, our results strongly suggest that size, chemical nature, and surface area are the most relevant physico-chemical parameters to consider for determining MMP-1 mrna and protein induction with an additional role of crystal phase when considering MMP-1 activity. Because we reasoned in terms of lifetime occupational exposure and gave that in one dosing to cells, further studies are needed to evaluate the occurrence of the phenomenon described here in the context of lower and repeated exposures. The molecular mechanisms underlying the modulation of MMP s expression by TiO 2 NPs have been poorly investigated, and to the best of our knowledge no study has specifically investigated MMP-1. We addressed this issue by analyzing transcriptional and posttranscriptional known modulators of MMP-1: the TGF-b pathway, ROS production, EMMPRIN expression, and the IL-1b pathway. Because TGF-b is a major profibrotic cytokine, inducing collagen and a-actin expression (15, 52) and repressing MMP-1 transcription (53), we hypothesized that its signaling pathway could be down-regulated by TiO 2 NPs. However, we were unable to demonstrate any modulation of TGF-b Figure 6. MMP-1, procollagen-1 a1, and a-actin mrna expression in lung primary fibroblasts exposed for 48 hours to 10 mg/cm 2 of the different particles. (A) MMP-1 mrna expression after 48-hour exposure to 10 mg/cm 2 particles. (B) Procollagen-1 a-1 mrna expression after 48-hour exposure to 10 mg/cm 2 particles. (C) a-actin mrna expression after 48-hour exposure to 10 mg/cm 2 particles. *P, 0.05 versus Control and FW2 (n ¼ 3). Bar graphs represent means 6 SEM.

8 Armand, Dagouassat, Belade, et al.: TiO 2 Nanoparticles Induce MMP Figure 7. Involvement of IL-1b pathway after exposure of MRC-5 cells to the different particles. IL-1b expression after 24 hour (A) and 48 hour (B) exposure to 100 mg/cm 2 of the different particles. IL-1b protein expression after 6, 24, or 48 hours (C). MMP-1 mrna expression in presence of IL-1Ra in MRC-5 cells (D). Values are expressed as the ratio of MMP-1 mrna in the presence of IL-1 Ra to that in absence of IL-1 Ra after a 48-hour exposure to 100 mg/cm 2 particles. *P, 0.05 versus Control and FW2. # P, 0.05 versus Control, FW2, and Micro. x P, 0.05 versus without IL-1 Ra condition (n ¼ 5). Bar graphs represent means 6 SEM. Light-checkered bar graph: 10 mg/cm 2. Thick-checkered bar graph: 100 mg/cm 2. signaling pathway by TiO 2 NPs in our experimental settings. This is in line with data from Churg and colleagues (54) demonstrating that ultrafine TiO 2 particles are poor inducers of profibrogenic mediators such as PDGF-b, TGF-a, and TGF-b. Another mechanism that could underline MMP-1 induction is the induction of an oxidative stress because it is often proposed as a key mechanism of action for NPs (29, 30), although some studies also show that TiO 2 NPs induce no or only very mild oxidative stress (51, 55 58). In agreement with these latter results, no oxidative stress was observable in our experimental setting. In some studies, the absence of intracellular ROS production was associated with an absence of alteration of cell viability, as observed in our study (57, 58). However, because CB NPs induced a significant decrease in cell viability, without any ROS production inside the cells, a direct relationship between cytotoxic and oxidative effects can be questioned. Another protein that could have been involved in the effects of TiO 2 NPs is EMMPRIN (38, 59, 60). However, no modulation of EMMPRIN expression was observed in our samples. Such results are in line with those of Braundmeier and colleagues (61), who showed that the stimulation of MMP by cytokines occurred without any changes in EMMPRIN expression. Similar results were described by Xiang and colleagues, showing that IL-1b up-regulated the levels of MMP-1 and -2 but did not alter the expression of EMMPRIN (62). Braundmeier and colleagues (61) demonstrated that the inhibitory effects of TGF-b involved a reduction in EMMPRIN mrna levels. Taken together, these results are in agreement with ours and suggest that MMP-1 expression might be induced by IL-1b and EMM- PRIN via two different signal pathways. Although no strict correlation was observed between MMP-1 (mrna and protein) and IL-1b induction, our results obtained with IL-1Ra suggest that MMP-1 (mrna) induction by TiO 2 NPs was at least partially mediated by IL-1b (especially for A/R high and Rneedle TiO 2 NPs). A few studies have shown that IL-1b production can be activated after TiO 2 NP exposure (2, 24, 25). These studies demonstrated that IL-1b induction by TiO 2 was dependent on the activation of NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome. Although we were not able to measure any modification of caspase-1 activation, a constituent of NLRP3 and activator of IL-1b production, the implication of NLRP3 in MMP-1 induction by TiO 2 NPs deserves further investigation. We observed a dissociation between MMP-1 expression (mrna and protein) and its activity. Indeed, all TiO 2 NPs induced similar increase in MMP-1 expression, but only A/R high and A/R low NPs induced a significant increase in its activity. The apparent discordant results suggest that TiO 2 NPs not only act at the transcriptional level but also at the posttranslational level on MMP-1. This could be particularly true for A/R high NPs because they induced the highest MMP-1 activity, although they are not the most potent NPs to induce MMP-1 protein. As for other MMP, pro MMP-1 can be cleaved by other proteases, such as MMP, trypsin, or cathepsin G (10). In our study, MMP-2 expression was not modified by TiO 2 NP exposure. However, we cannot rule out a role for the other proteases. The same is true for ROS, which not only activate MMP-1 transcription but also participate in its activation (10). However, because no intracellular ROS production or activation of pro-oxidant systems were observed, it seems unlikely that such a ROS-mediated activation of pro MMP-1 occurred in our experimental settings. Li and colleagues provided evidence that, in primary human bronchial epithelial cells, the ERK/b-arrestin signaling pathway is critical for diesel particles evoked up-regulation in MMP-1 protein and activity (9). Such a signaling pathway could be involved in our study because TiO 2 NPs have been shown to activate ERK/MAPK pathway in human neutrophils (63). Finally, TiO 2 has been shown to induce urokinase-type plasminogen activator activity in BAL fluid of mice exposed intratracheally (64). Because urokinase-type plasminogen activator activation results in the formation of plasmin, an activator of MMP-1 expression, this pathway could be activated in our experimental settings and should therefore deserve further studies. Modulation of MMP-1 expression and activity by TiO 2 NPs was accompanied by a down-regulation of a-actin and collagen mrna expression, suggesting the activation of the exposedfibroblasts, which could participate in the matrix-remodeling effects of TiO 2 NPs. Some evidence of matrix remodeling in response to TiO 2 has been given in a study by Churg and

9 362 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL colleagues, who demonstrate connective tissue breakdown in rat lungs as determined by the appearance of desmosin and hydroxyprolin in lavage fluid after particles instillation (65). These results are in accordance with our data because hydroxyprolin is the degradation product of collagen, the substrate of MMP-1 (10). Studies on the regulation of human MMP-1 gene cannot readily be complemented by studies in mice or rats because rodents do not have a valid ortholog of this gene (9, 66). However, given the implication of MMP-1 in tissue remodeling and repair during development, in inflammation, and in the invasion, migration, and metastasis of malignantly transformed cells, our findings suggest that exposure to TiO 2 NPs could result in such tissue remodeling. This is true for the two TiO 2 NPs that induced MMP-1 activity but also for the others that induced only its overexpression at the mrna and protein levels. Indeed, intracellular localization of MMP-1 (without any assessment of its activity) has been associated with resistance to apoptosis (67). Moreover, in a more complex in vivo environment, neighbor cells could produce various factors that could activate the proenzyme stocked inside fibroblasts. In conclusion, we demonstrated that TiO 2 NPs are potent inducers of MMP-1 expression, partly via an IL-1b dependent mechanism. Size, chemical nature, surface area, and a mixed anatase/rutile crystal phase are the most relevant physico-chemical parameters to consider in these effects. Considering the role of MMP-1 in matrix remodeling, these results are particularly relevant to the understanding of TiO 2 lung remodeling effects. Author disclosures are available with the text of this article at Acknowledgments: The authorsthank Nathalie HerlinandAurélie Habert from the Atomic Energy Commission (Laboratoire Francis Perrin) for support in nanoparticle characterization and François Berehar and Catherine Poillet for help in the RT-qPCR experiments. References 1. Baan RA. Carcinogenic hazards from inhaled carbon black, titanium dioxide, and talc not containing asbestos or asbestiform fibers: recent evaluations by an iarc monographs working group. Inhal Toxicol 2007;19: Yazdi AS, Guarda G, Riteau N, Drexler SK, Tardivel A, Couillin I, Tschopp J. Nanoparticles activate the nlr pyrin domain containing 3 (NLRP3) inflammasome and cause pulmonary inflammation through release of IL-1alpha and IL-1beta. Proc Natl Acad Sci USA 2010;107: Hussain S, Vanoirbeek JA, Luyts K, De Vooght V, Verbeken E, Thomassen LC, Martens JA, Dinsdale D, Boland S, Marano F, et al. Lung exposure to nanoparticles modulates an asthmatic response in a mouse model of asthma. Eur Respir J 2011;37: Mohr U, Ernst H, Roller M, Pott F. Pulmonary tumor types induced in wistar rats of the so-called 19-dust study. Exp Toxicol Pathol 2006; 58: Chen HW, Su SF, Chien CT, Lin WH, Yu SL, Chou CC, Chen JJ, Yang PC. Titanium dioxide nanoparticles induce emphysema-like lung injury in mice. FASEB J 2006;20: Dalal S, Imai K, Mercer B, Okada Y, Chada K, D Armiento J. A role for collagenase (matrix metalloproteinase-1) in pulmonary emphysema. Chest 2000;117:227S 228S. 7. Mercer B, Kolesnikova N, Sonett J, D Armiento J. Extracellular regulated kinase/mitogen activated protein kinase is up-regulated in pulmonary emphysema and mediates matrix metalloproteinase-1 induction by cigarette smoke. JBiolChem2004;279: Amara N, Bachoual R, Desmard M, Golda S, Guichard C, Lanone S, Aubier M, Ogier-Denis E, Boczkowski J. Diesel exhaust particles induce matrix metalloprotease-1 in human lung epithelial cells via a NADP(H) oxidase/nox4 redox-dependent mechanism. Am J Physiol Lung Cell Mol Physiol 2007;293:L170 L Li J, Ghio AJ, Cho SH, Brinckerhoff CE, Simon SA, Liedtke W. Diesel exhaust particles activate the matrix-metalloproteinase-1 gene in human bronchial epithelia in a beta-arrestin-dependent manner via activation of ras. Environ Health Perspect 2009;117: Pardo A, Selman M. MMP-1: the elder of the family. Int J Biochem Cell Biol 2005;37: Brenneisen P, Brivaba K, Wlaschek M, Wenk J, Scharffetter-Kochanek K. Hydrogen peroxide (H 2 O 2 ) increases the steady-state mrna levels of collagenase/mmp-1 in human dermal fibroblasts. Free Radic Biol Med 1997;22: Chen H, Li D, Saldeen T, Mehta JL. TGF-beta 1 attenuates myocardial ischemia-reperfusion injury via inhibition of upregulation of MMP-1. Am J Physiol Heart Circ Physiol 2003;284:H1612 H Huet E, Gabison EE, Mourah S, Menashi S. Role of emmprin/cd147 in tissue remodeling. Connect Tissue Res 2008;49: Raymond L, Eck S, Mollmark J, Hays E, Tomek I, Kantor S, Elliott S, Vincenti M. Interleukin-1 beta induction of matrix metalloproteinase-1 transcription in chondrocytes requires ERK-dependent activation of CCAAT enhancer-binding protein-beta. J Cell Physiol 2006;207: Araya J, Nishimura SL. Fibrogenic reactions in lung disease. Annu Rev Pathol 2010;5: Hardie WD, Glasser SW, Hagood JS. Emerging concepts in the pathogenesis of lung fibrosis. Am J Pathol 2009;175: Wilson MS, Wynn TA. Pulmonary fibrosis: pathogenesis, etiology and regulation. Mucosal Immunol 2009;2: Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Lunts A, Kreyling W, Cox C. Extrapulmonary translocation of ultrafine carbon particles following whole-body inhalation exposure of rats. J Toxicol Environ Health 2002;65: MacNee W, Li X, Gilmour PS, Donaldson K. Systemic effect of particulate air pollution. Inhal Toxicol 2000;12: Kreyling W. Deposition, retention, and clearance of ultrafine particles. BIA-Workshop, Ultrafine Aerosols at Workplaces Rossi EM, Pylkannen L, Koivisto AJ, Vippola M, Jensen KA, Miettinen M, Sirola K, Nykasenoja H, Karisola P, Stjernvall T, et al. Airway exposure to silica-coated TiO2 nanoparticles induces pulmonary neutrophilia in mice. Toxicol Sci 2010;113: Sayes CM, Wahi R, Kurian PA, Liu Y, West JL, Ausman KD, Warheit DB, Colvin VL. Correlating nanoscale titania structure with toxicity: A cytotoxicity and inflammatory response study with human dermal fibroblasts and human lung epithelial cells. Toxicol Sci 2006;92: Hussain S, Boland S, Baeza-Squiban A, Hamel R, Thomassen LC, Martens JA, Billon-Galland MA, Fleury-Feith J, Moisan F, Pairon JC, et al. Oxidative stress and proinflammatory effects of carbon black and titanium dioxide nanoparticles: role of particle surface area and internalized amount. Toxicology 2009;260: Winter M, Beer HD, Hornung V, Kramer U, Schins RP, Forster I. Activation of the inflammasome by amorphous silica and tio(2) nanoparticles in murine dendritic cells. Nanotoxicology Morishige T, Yoshioka Y, Tanabe A, Yao X, Tsunoda S-i, Tsutsumi Y, Mukai Y, Okada N, Nakagawa S. Titanium dioxide induces different levels of IL-1[beta] production dependent on its particle characteristics through caspase-1 activation mediated by reactive oxygen species and Cathepsin B. Biochem Biophys Res Commun 2010;392: Oberdörster G. Safety assessment for nanotechnology and nanomedicine: concepts of nanotoxicology. J Intern Med 2010;267: Gangwal S, Brown JS, Wang A, Houck KA, Dix DJ, Kavlock RJ, Hubal EA. Informing selection of nanomaterial concentrations for toxcast in vitro testing based on occupational exposure potential. Environ Health Perspect 2012;119: TabetL,BussyC,AmaraN,SetyanA,GrodetA,RossiMJ,PaironJC, Boczkowski J, Lanone S. Adverse effects of industrial multiwalled carbon nanotubes on human pulmonary cells. J Toxicol Environ Health A 2009; 72: Fenoglio I, Tomatis M, Lison D, Muller J, Fonseca A, Nagy JB, Fubini B. Reactivity of carbon nanotubes: Free radical generation or scavenging activity? Free Radic Biol Med 2006;40: Garza KM, Soto KF, Murr LE. Cytotoxicity and reactive oxygen species generation from aggregated carbon and carbonaceous nanoparticulate materials. Int J Nanomedicine 2008;3: Johnston HJ, Hutchison GR, Christensen FM, Peters S, Hankin S, Aschberger K, Stone V. A critical review of the biological mechanisms underlying the in vivo and in vitro toxicity of carbon nanotubes: the contribution of physico-chemical characteristics. Nanotoxicology 2010;4: Mehnert W, Mader K. Solid lipid nanoparticles: production, characterization and applications. Adv Drug Deliv Rev 2001;47:

10 Armand, Dagouassat, Belade, et al.: TiO 2 Nanoparticles Induce MMP Wynn T. Cellular and molecular mechanisms of fibrosis. J Pathol 2008; 214: Pan C, Kumar C, Bohl S, Klingmueller U, Mann M. Comparative proteomic phenotyping of cell lines and primary cells to assess preservation of cell type-specific functions. Mol Cell Proteomics 2009;8: Greenlee KJ, Werb Z, Kheradmand F. Matrix metalloproteinases in lung: multiple, multifarious, and multifaceted. Physiol Rev 2007;87: Lu Y, Wahl LM. Oxidative stress augments the production of matrix metalloproteinase-1, cyclooxygenase-2, and prostaglandin E2 through enhancement of NF-kappa B activity in lipopolysaccharide-activated human primary monocytes. J Immunol 2005;175: Li JJe, Muralikrishnan S, Ng C-T, Yung L-YL, Bay B-H. Nanoparticleinduced pulmonary toxicity. Exp Biol Med 2010;235: Gabison EE, Huet E, Baudouin C, Menashi S. Direct epithelial-stromal interaction in corneal wound healing: role of emmprin/cd147 in MMPs induction and beyond. Prog Retin Eye Res 2009;28: Kanekura T, Chen X, Kanzaki T. Basigin (cd147) is expressed on melanoma cells and induces tumor cell invasion by stimulating production of matrix metalloproteinases by fibroblasts. Int J Cancer 2002;99: Guarda G, So A. Regulation of inflammasome activity. Immunology 2010;130: Wittmaack K. In search of the most relevant parameter for quantifying lung inflammatory response to nanoparticle exposure: particle number, surface area, or what? Environ Health Perspect 2007;115: Brown DM, Wilson MR, MacNee W, Stone V, Donaldson K. Sizedependent proinflammatory effects of ultrafine polystyrene particles: a role for surface area and oxidative stress in the enhanced activity of ultrafines. Toxicol Appl Pharmacol 2001;175: Elder A, Gelein R, Finkelstein JN, Driscoll KE, Harkema J, Oberdorster G. Effects of subchronically inhaled carbon black in three species: I. Retention kinetics, lung inflammation, and histopathology. Toxicol Sci 2005;88: MacNee W, Donaldson K. Mechanism of lung injury caused by PM10 and ultrafine particles with special reference to COPD. Eur Respir J Suppl 2003;40:47s 51s. 45. Stoeger T, Reinhard C, Takenaka S, Schroeppel A, Karg E, Ritter B, Heyder J, Schulz H. Instillation of six different ultrafine carbon particles indicates a surface area threshold dose for acute lung inflammation in mice. Environ Health Perspect 2006;114: Kroll A, Dierker C, Rommel C, Hahn D, Wohlleben W, Schulze-Isfort C, Gobbert C, Voetz M, Hardinghaus F, Schnekenburger J. Cytotoxicity screening of 23 engineered nanomaterials using a test matrix of ten cell lines and three different assays. Part Fibre Toxicol 2011;8: Lanone S, Rogerieux F, Geys J, Dupont A, Maillot-Maréchal E, Boczkowski J, Lacroix G, Hoet PH. Comparative toxicity of 24 manufactured nanoparticles in human alveolar epithelial and macrophage cell lines. Part Fibre Toxicol 2009;6: Soto K, Garza KM, Murr LE. Cytotoxic effects of aggregated nanomaterials. Acta Biomater 2007;3: Warheit DB, Webb TR, Sayes CM, Colvin VL, Reed KL. Pulmonary instillation studies with nanoscale TiO2 rods and dots in rats: toxicity is not dependent upon particle size and surface area. Toxicol Sci 2006;91: Warheit DB, Webb TR, Reed KL, Frerichs S, Sayes CM. Pulmonary toxicity study in rats with three forms of ultrafine-tio2 particles: differential responses related to surface properties. Toxicology 2007;230: Gerloff K, Fenoglio I, Carella E, Kolling J, Albrecht C, Boots AW, Forster I, Schins RP. Distinctive toxicity of TiO(2) rutile/anatase mixed phase nanoparticles on caco-2 cells. Chem Res Toxicol 2012; 25: Verrecchia F, Mauviel A. Transforming growth factor-beta and fibrosis. World J Gastroenterol 2007;13: White LA, Mitchell TI, Brinckerhoff CE. Transforming growth factor beta inhibitory element in the rabbit matrix metalloproteinase-1 (collagenase-1) gene functions as a repressor of constitutive transcription. Biochim Biophys Acta 2000;1490: Churg A, Gilks B, Dai J. Induction of fibrogenic mediators by fine and ultrafine titanium dioxide in rat tracheal explants. Am J Physiol 1999; 277:L975 L Horie M, Nishio K, Fujita K, Kato H, Endoh S, Suzuki M, Nakamura A, Miyauchi A, Kinugasa S, Yamamoto K, et al. Cellular responses by stable and uniform ultrafine titanium dioxide particles in culturemedium dispersions when secondary particle size was 100 nm or less. Toxicol In Vitro 2010;24: Fujita K, Horie M, Kato H, Endoh S, Suzuki M, Nakamura A, Miyauchi A, Yamamoto K, Kinugasa S, Nishio K, et al. Effects of ultrafine TiO2 particles on gene expression profile in human keratinocytes without illumination: involvement of extracellular matrix and cell adhesion. Toxicol Lett 2009;191: Xia T, Kovochich M, Brant J, Hotze M, Sempf J, Oberley T, Sioutas C, Yeh JI, Wiesner MR, Nel AE. Comparison of the abilities of ambient and manufactured nanoparticles to induce cellular toxicity according to an oxidative stress paradigm. Nano Lett 2006;6: Wan R, Mo Y, Zhang X, Chien S, Tollerud DJ, Zhang Q. Matrix metalloproteinase-2 and -9 are induced differently by metal nanoparticles in human monocytes: the role of oxidative stress and protein tyrosine kinase activation. Toxicol Appl Pharmacol 2008;233: Yurchenko V, Constant S, Bukrinsky M. Dealing with the family: Cd147 interactions with cyclophilins. Immunology 2006;117: Bao W, Min D, Twigg SM, Shackel NA, Warner FJ, Yue DK, McLennan SV. Monocyte cd147 is induced by advanced glycation end products and high glucose concentration: possible role in diabetic complications. Am J Physiol Cell Physiol 2010;299:C1212 C Braundmeier AG, Nowak RA. Cytokines regulate matrix metalloproteinases in human uterine endometrial fibroblast cells through a mechanism that does not involve increases in extracellular matrix metalloproteinase inducer. Am J Reprod Immunol 2006;56: Xiang J, Li C, Dong W, Cao Z, Liu L. Expression of matrix metalloproteinase- 1, matrix metalloproteinase-2 and extracellular metalloproteinase inducer in human periodontal ligament cells stimulated with interleukin-1 beta. J Periodontal Res 2009;44: Goncalves DM, Chiasson S, Girard D. Activation of human neutrophils by titanium dioxide (TiO2) nanoparticles. Toxicol In Vitro 2010;24: Lardot CG, Huaux FA, Broeckaert FR, Declerck PJ, Delos M, Fubini B, Lison DF. Role of urokinase in the fibrogenic response of the lung to mineral particles. Am J Respir Crit Care Med 1998;157: Churg A, Zay K, Li K. Mechanisms of mineral dust-induced emphysema. Environ Health Perspect 1997;105: Brinckerhoff CE, Matrisian LM. Matrix metalloproteinases: a tail of a frog that became a prince. Nat Rev Mol Cell Biol 2002;3: Limb GA, Matter K, Murphy G, Cambrey AD, Bishop PN, Morris GE, Khaw PT. Matrix metalloproteinase-1 associates with intracellular organelles and confers resistance to lamin a/c degradation during apoptosis. Am J Pathol 2005;166: