Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells

Size: px
Start display at page:

Download "Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells"

Transcription

1 Int J Clin Exp Pathol 2015;8(9): /ISSN: /IJCEP Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells Ning Duan 1*, Xiaojing Hu 2*, Xiaowei Yang 3*, Huiguang Cheng 1, Wentao Zhang 1 1 Department of Orthopaedics, Hong-Hui Hospital, Xi an Jiaotong University College of Medicine, Xi an , Shaanxi Province, People s Republic of China; 2 Department of Orthopaedics, Ninth Hospital of Xi an, Xi an , Shaanxi Province, People s Republic of China; 3 Department of Orthopaedics, Xi an Jiaotong University, Xi an , Shaanxi Province, People s Republic of China. * Equal contributors. Received July 17, 2015; Accepted August 25, 2015; Epub September 1, 2015; Published September 15, 2015 Abstract: MicroRNAs (mirnas) are endogenous, non-coding, small RNAs, which play a critical role in regulating varieties of the biological and pathologic processes. Several reports have indicated that mir-370 acts as a tumor suppressor in varieties of tumors. However, the roles of mir-370 in osteosarcoma have not been reported. In this study, our objective was to explore the biological functions and its molecular mechanism of mir-370 in osteosarcoma cell lines, finding a therapeutic target of osteosarcoma. Our data demonstrated that mir-370 was evidently reduced in osteosarcoma cell lines, whereas FOXM1 expression was markedly increased. Up-regulation of mir-370 suppressed proliferation, arrested cell cycle and induced apoptosis in osteosarcoma cells. Besides, invasion and EMT of osteosarcoma cells was also inhibited by introduction of mir-370. Next, we found that FOXM1 expression was significantly reduced by up-regulation of mir-370. Bioinformatics analysis predicted that the FOXM1 was a potential target gene of mir-370. Luciferase reporter assay further confirmed that mir-370 could directly target the 3 UTR of FOXM1. Overexpression of FOXM1 in osteosarcoma cells transfected with mir-370 mimic partially reversed the effects of mir-370. In conclusion, mir-370 inhibited cell growth and metastasis in osteosarcoma cells by downregulation of FOXM1. Keywords: Osteosarcoma, mir-370, FOXM1, proliferation, invasion, EMT Introduction Osteosarcoma (OS) is the most frequent type of aggressive primary bone tumor and a major cause of tumor death in the pediatric age group because of its fast proliferation and early metastasis [1, 2]. Recently, the cure rate of patients with osteosarcoma is still very low in despite of the flying start in multimodal treatments including surgery, adjuvant chemo- and radiotherapy [3]. In addition, after surgery resection of the primary tumor and intensive chemotherapy, prognosis of patients with OS is also poor due to high risk of local relapse or distant metastasis [4]. However, the exact molecular mechanisms of OS are not clarified yet. Therefore, identification of novel targets for regulation of tumor growth and metastasis is important for the diagnosis, treatment, and prognosis of OS. MicroRNAs (mirnas) are a class of endogenous, small (approximately 22 nucleotides), non-coding RNAs [5], which regulate translation of their target genes by binding to complementary sequences in the 3 UTRs of targeted mrnas. It has been reported that their target genes regulate a series of cell functions including cell proliferation, apoptosis, invasion and differentiation [6, 7]. Increasing reports showed that mirnas are frequently involved in numerous cancers, including colon, lung, breast cancers and OS [8-11]. MiRNAs act as tumor suppressors or oncogenes in OS, which is dependent on the role of their target genes, such as mir-300 [12], mir-196a [13], mir-202 [14], mir-153 [15], mir-195 [16], mir-454 [17] and mir-144 [18]. These outcomes indicated that mirnas are closely related to tumorigenesis, tumor progression and metastasis. In recent years, it has been reported that mir- 370 is decreased and acts as a tumor suppressor in non-small cell lung cancer (NSCLC) and laryngeal squamous cell carcinoma (LSCC) [19, 20], and is increased and acts as an oncogene

2 in prostate cancer and gastric carcinoma [21, 22]. It has been shown that overexpression of mir-370 significantly inhibited cell proliferation and induced cell apoptosis of NSCLC cells by targeting tumor necrosis factor receptor-associated factor 4 (TRAF4) [19]. MiR-370 inhibited cell proliferation in Hep2 cells through downregulation of forkhead box protein M1 (FOXM1) [20], whereas introduction of mir-370 promoted cell proliferation in prostate and gastric cells via suppression of forkhead box protein O1 (FOXO1) [21, 22]. However, the expression and roles of mir-370 in OS remain unclear. In this study, we confirmed frequent downregulation of mir-370 in human OS cell lines. Introduction of mir-370 inhibited cell proliferation arrested cell cycle and induced cell apoptosis of OS cells. Besides, invasion and epithelialto-mesenchymal transition (EMT) of OS cells were suppressed by overexpression of mir Next, we found that FOXM1, a tumor suppressor gene, was the direct target of mir-370 in OS. Restoration of FOXM1 reversed the inhibitory effects of mir-370. Therefore, our outcomes showed that mir-370 and FOXM1 might be promising therapeutic targets in OS. Material and methods Cell culture Osteosarcoma cell lines including HOS, U2OS, SOSP-9607, MG63, 143B, SaOS-2 and one human normal bone cell line hfob cells were obtained from American Type Culture Collection (ATCC, Rockville, MD, USA). These cells were cultured in Dulbecco s modified Eagle medium (DMEM, Gibco Co., New York, USA) supplemented with 10% fetal bovine serum (FBS, Gibco Co., New York, USA), penicillin (100 U/ml) and streptomycin (100 μg/ml) at 37 C in a humidified atmosphere of 5% CO 2 on 0.1% gelatincoated culture flasks. Transient transfection MG63 and U2OS cells were seeded in 6-well plates and incubated for 24 h, then transiently transfected with mir-370 mimic or mir-negative control of mimics (mir-nc) at a final concentration of 50 nm using Lipofectamine 2000 reagent (Invitrogen) following the manufacturer s protocols. mir-370 mimic and mir-nc were purchased from RiboBio (Guangzhou, China). pcdna3. 1-FOXM1 and pcdna3.1 vector were purchased from GeneChem (Shanghai, China). RNA isolation and quantitative real-time polymerase chain reaction (PCR) Total mirna of MG63 and U2OS cells was isolated by Trizol reagent (Invitrogen) following the manufacturer s instruments. Ten microgram RNA was used for gene-specific reverse transcription PCR using one-step RT-PCR kit (Qiagen, Venlo, The Netherlands) following the manufacturer s protocols. Denaturation was performed at 95 C for 5 min, followed at 94 C for 15 s for 30 cycles, and 75 C for 2 min. Small unclear RNA U6 was used to normalize. All realtime experiments were conducted in triplicate. Cell counting kit-8 assay Cell proliferation was detected by the Cell Counting Kit-8 assay (CCK-8, Dojindo, Shanghai, China). Cells ( cells/well) were seeded in 96-well plates overnight. Then, cells were transfected with mir-370 mimic or mir-nc for 24 h. After that, cells were incubated in normal medium containing WST-8 substrate at 37 C for 2 h. Absorbance (450 nm) of the medium was detected using a spectrophotometer by assessing the cell proliferation. Cell cycle analysis Cells were transfected with mir-370 mimic or mir-nc for 24 h. After transfection, Cells were collected by trypsinization, washed with icecold phosphate buffer saline (PBS), and fixed in ice-cold 70% methanol overnight. Then, cells were centrifuged, resuspended in ice-cold PBS, and incubated with RNase (Sigma Chemical Co., USA) for 30 min at 37 C, and then were incubated with propidium iodide (PI; Sigma Chemical Co., USA) at room temperature for 30 min. The analyses of cell cycle distribution were performed by FACScan flow cytometer (BD Biosciences, San Jose, CA, USA). Annexin V-FITC/PI analysis Cells were transfected with mir-370 mimic or mir-nc for 24 h. After transfection, cells were harvested and washed twice in ice-cold PBS and double-stained with Annexin V-FITC and PI by using the Annexin V-FITC Apoptosis Detection Int J Clin Exp Pathol 2015;8(9):

3 Figure 1. The expression of mir-370 in osteosarcoma cell lines. Relative mir-370 level analyzed by RT-PCR in six osteosarcoma cell lines (HOS, U2OS, SOSP-9607, MG63, 143B and SaOS-2) and a human normal bone cell line (hfob) were normalized with U6 snrna. All data are presented as mean ± SEM, n=6. *P<0.05, **P<0.01 vs. hfob. Kit (BD Biosciences) following the manufacturer s protocols. Then, each sample was quantitatively analyzed at 488 nm emission and 570 nm excitation by FACSCalibur flow cytometer (BD Biosciences). Transwell invasion assay To determine the effect of mir-370 on the cell invasion, we used Transwell matrigel invasion assay. Transwell chambers (8-mm pore size; Minipore) precoated with Matrigel (BD Biosciences, Franklin Lakes, NJ) that contained extracellular matrix proteins was used following the manufacturer s protocol. Briefly, cells were transfected with mir-370 mimic or mir-nc. After transfection, cells were suspended in 100 μl serum-free DMEM and seeded on the upper chamber. 600 µl DMEM containing 10% FBS was added to the lower chamber. After 24 h incubation at 37 C in a 5% CO 2 atmosphere, cells on the surface of the upper chamber were removed by cotton swabs and invading cells were fixed in 70% methanol, and then stained with 0.1% crystal violet. Cell invasion was quantified by counting cells on the lower surface using phase contrast microscope (Olympus, Tokyo, Japan). Western blot analysis Cells were harvested and then lysed in RIPA (Beyotime Institute of Biotechnology Jiangsu, China). The protein concentration of cell lysates was quantified by BCA Kit (Beyotime Institute of Biotechnology Jiangsu, China), and equal amounts of proteins were separated by 8% SDS-PAGE, and then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membranes were blocked in 5% nonfat milk at room temperature for 1 h and incubated overnight at 4 C with specific primary antibody respectively: anti-foxm1 (1:1000; Abcam, USA); anti-e-cadherin and anti-n-cadherin (1:1000; Cell Signaling Technology Inc, MA, USA). The membranes were then incubated with a goat anti-rabbit or anti-mouse IgG conjugated to horseradish peroxidase secondary antibody (1:1000; Cell Signaling Technology Inc, MA, USA) for 3 h. The proteins were visualized using ECL reagents (Amersham Biosciences, Sweden). The density of the bands was assessed by the Image J software (USA), and values were normalized to the densitometric values of α-tubulin in each sample. Luciferase reporter assay Cells ( /well) were seeded in 24-well plates and incubated for one day before transfection. pmir-foxm1-3 UTR wild-type or mutant reporter plasmid and prl-sv40 renilla plasmid (Promega, USA) were co-transfected with mir- 370 mimic or mir-nc into cells using Lipofectamine After 24 h, luciferase activity was quantified using the dual-luciferase assay reporter system (Promega, Fitchburg, WI, USA). The relative ratios of firefly to Renilla activity were reported. All experiments were performed in triplicate. Statistical analysis All statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, Inc., USA). Data from each group were expressed as mean ± standard error of the mean (S.E.M.) and statistically analyzed by Student s t test. Differences were considered statistically significant at a P value of <0.05. Results MiR-370 expression was reduced in osteosarcoma cell lines To detect the expression of mir-370 in OS cells, six osteosarcoma cell lines (HOS, U2OS, SOSP- 9607, MG63, 143B and SaOS-2) and hfob, Int J Clin Exp Pathol 2015;8(9):

4 Figure 2. Effects of mir-370 overexpression on cell proliferation, cell cycle and apoptosis in MG63 and U2OS cells. MG63 and U2OS cells were transfected with mir-370 mimic or mir-nc for 24 h. A: The mrna levels of mir-370 in MG63 and U2OS cells were determined by RT-PCR. B: Cell proliferation was assessed by CCK-8 assay. C: Cell cycle was detected by flow cytometry. D: Cell apoptosis was measured by flow cytometric analysis of cells labeled with Annexin-V/PI double staining. All data are presented as mean ± SEM, n=6. ## P<0.01 vs. mir-nc Int J Clin Exp Pathol 2015;8(9):

5 a human normal bone cell line, were used to determine the expression of mir-370 by RT-PCR. Our findings showed that the expression of mir-370 was markedly down-regulated in these six OS cell lines compared to that in hfob cells, as shown in Figure 1. MiR-370 inhibited cell proliferation, induced G1-phase arrest and cell apoptosis in osteosarcoma cells According to the down-regulation of mir-370 in osteosarcoma cells, we considered that mir- 370 could function as a tumor suppressor. Among these OS cell lines, MG63 and U2OS cells were used to study further. We transfected mir-370 mimic into MG63 and U2OS cells. After transfection with mir-370 mimic, the RT-PCR analysis showed that mrna level of mir-370 was significantly up-regulated in mir- 370 mimic group compared to mir-nc group (Figure 2A). These data demonstrated that we efficiently enhanced mir-370 expression in MG63 and U2OS cells. The CCK-8 assays confirmed that introduction of mir-370 dramatically inhibited the proliferation of MG63 and U2OS cells (Figure 2B). Since mir-370 evidently suppressed proliferation of MG63 and U2OS cells, we guessed that mir-370 could block G1-to-S transition in osteosarcoma cells. Next, we used low cytometry to prove this hypothesis. We found that overexpression of mir-370 caused an obvious G1-phase arrest in both MG63 and U2OS cells compared with cells transfected with mir-nc (Figure 2C). Therefore, mir-370 might inhibit the proliferation of osteosarcoma cells by blocking the G1/S cell cycle transition. Furthermore, we also detected the pro-apoptotic effect of mir-370 on MG63 and U2OS cells. Then, the total apoptosis rates of MG63 and U2OS cells were detected by flow cytometry analysis. As shown in Figure 2D, the data showed that the number of apoptotic MG63 and U2OS cells was higher in mir-370 mimic group than that in mir-nc group. Up-regulation of mir-370 suppressed invasion and EMT of osteosarcoma cells To explore the effects of mir-370 on invasion and EMT in osteosarcoma cells, we used Transwell invasion assays to estimate the invasion potential of MG63 and U2OS cells. Our data showed that the invasion potential of osteosarcoma cells was significantly inhibited in mir- 370 mimic group compared to mir-nc group (Figure 3A). Besides, we used Western blotting to confirm the effects of mir-370 mimic on the expressions of EMT markers in MG63 and U2OS cells. Introduction of mir-370 could enhance the expression of epithelial marker E-cadherin, and reduce the expression of mesenchymal marker N-cadherin in MG63 and U2OS cells (Figure 3B). Altogether, our data demonstrated that mir-370 could suppress the invasion and EMT in osteosarcoma cells. mir-370 negatively regulated FOXM1 gene expression by directly targeting its 3 -UTR We used the TargetScan 6.2, a mirna target analysis tool, to investigate the potential target of mir-370. As a result, FOXM1 was a binding target of mir-370 (Figure 4A). Besides, we performed Western blotting to observe the expression of FOXM1 on protein level in MG63 and U2OS cells transfected with mir-370 mimic. Overexpression of mir-370 in MG63 and U2OS cells remarkably decreased the protein level of FOXM1 (Figure 4B). Next, we further demonstrated whether FOXM1 was a direct target of mir-370 by using luciferase reporter assay. Then, the wild-type (WT) FOXM1 3 -UTR was cloned into a luciferase reporter vector and the putative mir-370 binding site in the FOXM1 3 -UTR was mutated. The results showed that overexpression of mir-370 significantly decreased the luciferase activity of pmir-foxm1 3 -UTR WT, whereas mutation of the mir-370-binding site in the FOXM1 3 -UTR abolished the effect of mir-370 (Figure 4C). These results suggested that FOXM1 was directly and negatively regulated by mir-370. Reintroduction of FOXM1 reversed the effects of mir-370 in osteosarcoma cells To confirm whether FOXM1 indeed acted as a direct target of mir-370, we reintroduced FOXM1 into MG63 and U2OS cells transfected with mir-370 mimic to investigate. Reintroduction of FOXM1 could significantly increase the expression of FOXM1 compared with MG63 and U2OS cells transfected with mir-370 mimic and pcdna vector (Figure 5A). Analysis by CCK-8 assay showed that up-regulation of FOXM1 in cells transfected with the mir-370 mimic enhanced the proliferation of osteosarcoma cells (Figure 5B). The Transwell assay showed that reintroduction of FOXM1 significantly reversed the inhibitory effect of the mir- 370 mimic on invasion of osteosarcoma cells Int J Clin Exp Pathol 2015;8(9):

6 Figure 3. The effects of mir-370 on invasion and the expression of EMT-related molecules in MG63 and U2OS cells. A: The invasion of MG63 and U2OS cells transfected with mir-370 mimic or mir-nc was assessed by Transwell assay. B: The expressions of E-cadherin and N-cadherin were determined by Western blotting in MG63 and U2OS cells transfected with mir-370 mimic or mir-nc, respectively. α-tubulin was detected as a loading control. All data are presented as mean ± SEM, n=6. ## P<0.01 vs. mir-nc. (Figure 5C). Furthermore, increased FOXM1 expression decreased E-cadherin expression, and increased N-cadherin expression in MG63 and U2OS cells transfected with mir-370 mimic (Figure 5D). Therefore, the inhibitory effects of mir-370 were reversed by FOXM1 overexpression. Discussion Several reports have indicated that mir-370 functions as a tumor suppressive gene or oncogene and plays a critical role in human cancers. MiR-370 was down-regulated in NSCLC [19] and LSCC [20]. However, Wu et al. reported Int J Clin Exp Pathol 2015;8(9):

7 Figure 4. FOXM1 was a direct target of mir-370. A: Schematic representation of FOXM1 3 UTRs showing putative mirna target site. B: The protein expression of FOXM1 was determined by Western blot in MG63 and U2OS cells transfected with mir-370 mimic or mir-nc. C: The analysis of the relative luciferase activities of FOXM1-WT, FOXM1-MUT in osteosarcoma cells. All data are presented as mean ± SEM, n=6. # P<0.05, ## P<0.01, ### P<0.001 vs. mir-nc. mir-370 was up-regulated in prostate cancer cell lines [21]. MiR-370 was increased in patients with gastric carcinoma [22]. The precise roles of mir-370 in OS remained unclear because of its tumor-suppressing or tumor-promoting function. Therefore, in this study, we were aimed to elucidate the expression and biological functions of mir-370 in OS. Our findings showed that mir-370 was evidently decreased in OS cell lines compared to human normal bone cell line. Based on these results, we guessed that mir-370 might be a potential anti-oncogene in OS. As far as we knew, introduction of mir-370 significantly suppressed cell proliferation, invasion, EMT and induced apoptosis of MG63 and U2OS cells. Our current findings indicated that mir-370 played critical roles in regulation of proliferation, cell cycle, Int J Clin Exp Pathol 2015;8(9):

8 Figure 5. Overexpression of FOXM1 partially rescued mir-370-inhibited cell proliferation, invasion and EMT in osteosarcoma cells. MG63 and U2OS cells were transfected with either mir-370 mimic with or without pcdna-foxm1 vector. A: The protein expression of FOXM1 was determined by Western blot. α-tubulin was detected as a loading control. B: Cell proliferation was assessed by CCK-8 assay. C: The invasion of MG63 and U2OS cells was assessed by Transwell assay. D: The expressions of E-cadherin and N-cadherin were determined by Western blotting in MG63 and U2OS cells, respectively. α-tubulin was detected as a loading control. All data are presented as mean ± SEM, n=6. ## P<0.01, ### P<0.001 vs. mir-370 mimic + pcdna Int J Clin Exp Pathol 2015;8(9):

9 apoptosis, invasion and EMT in OS and might be potential therapeutic target. Next, we explored the exact molecular mechanism of mir-370 in suppressing proliferation, invasion, EMT and inducing apoptosis in OS cells. The real-time PCR, Western blot and luciferase reporter assay demonstrated that FOXM1 was a direct target of mir-370. Importantly, we also showed that up-regulating FOXM1 expression partly reversed the inhibitory effects of mir-370 overexpression on proliferation, invasion and EMT of OS cells. Consequently, we demonstrated that mir-370 played critical roles in the inhibition of proliferation, invasion and EMT in OS cells partially by down-regulating FOXM1 expression. In this study, CCK-8 assays showed that upregulation of mir-370 could evidently suppress the proliferation of MG63 and U2OS cells. Cell cycle analyses also showed that the percentage of cells in the G1-phase was increased and the percentage of cells in the S-phase was decreased in cells transfected with mir-370 mimic compared to cells transfected with mir- NC. Moreover, flow cytometry analysis demonstrated that mir-370 mimic could evidently induced apoptosis of MG63 and U2OS cells compared with mir-nc group. In addition, Transwell assay showed that mir-370 mimic dramatically inhibited the invasion of MG63 and U2OS cells compared with mir-nc group. Furthermore, we determined the change of EMT markers in MG63 and U2OS cells transfected with mir-370 mimic. EMT, characterized by different regulations of epithelial and mesenchymal genes, played important role in the process of tumor metastasis [23], which not only changed cell morphology but also induced cells to acquire essential new functions like migration and invasion. The up-regulation of mesenchymal marker N-cadherin and the down-regulation of epithelial marker E-cadherin were closely related to EMT [24, 25]. Our results showed that up-regulation of mir-370 could markedly suppress invasive ability of OS cells by dramatically up-regulating E-cadherin expression and down-regulating N-cadherin expression, which supported that mir-370 might suppress EMT process to restrain cell invasion and metastasis. FoxM1 is a member of an evolutionarily conserved family of transcription factors characterized by a DNA-binding domain called the Forkhead Box [26-28], and it has been shown to be up-regulated in multiple human cancers, such as cervical cancer [29], bladder cancer [30], breast cancer [31] and acute myeloid leukemia [32]. Overexpression of FOXM1 was found to be associated with aggressive phenotype and poor prognosis in patients with breast cancer [31]. Furthermore, Yang et al. reported that FOXM1 also promotes the EMT of breast cancer cells through stimulating the transcription of Slug [33]. These data strongly indicate that FOXM1 plays an important role in the growth and metastasis of human breast cancer. In this study, our results demonstrated that FOXM1 was a target of mir-370. Besides, restoration of FOXM1 reversed the inhibitory effects of mir-370, suggesting that FOXM1 might play a critical role in progression and metastasis of OS. In conclusion, our data have showed that the level of mir-370 was significantly decreased in OS cells. Introduction of mir-370 inhibited proliferation, invasion, EMT and induced apoptosis of OS cells via directly targeting FOXM1. This novel mir-370/foxm1 axis might provide new insights into the molecular mechanisms underlying progression and metastasis of tumor, and overexpression of mir-370 might be a potential therapeutic target for OS treatment in the future. Disclosure of conflict of interest None. Address correspondence to: Dr. Wentao Zhang, Department of Orthopaedics, Hong-Hui Hospital, Xi an Jiaotong University College of Medicine, 555 Friendship South East Road, Xi an , Shaanxi Province, People s Republic of China. Tel: ; Fax: ; zhangwentaoshanxi@163.com References [1] Yang J and Zhang W. New molecular insights into osteosarcoma targeted therapy. Curr Opin Oncol 2013; 25: [2] Ji F, Zhang H, Wang Y, Li M, Xu W, Kang Y, Wang Z, Wang Z, Cheng P, Tong D, Li C and Tang H. MicroRNA-133a, downregulated in osteosarcoma, suppresses proliferation and promotes apoptosis by targeting Bcl-xL and Mcl-1. Bone 2013; 56: Int J Clin Exp Pathol 2015;8(9):

10 [3] Gougelet A, Pissaloux D, Besse A, Perez J, Duc A, Dutour A, Blay JY and Alberti L. Micro-RNA profiles in osteosarcoma as a predictive tool for ifosfamide response. Int J Cancer 2011; 129: [4] Yao C, Wei JJ, Wang ZY, Ding HM, Li D, Yan SC, Yang YJ and Gu ZP. Perifosine induces cell apoptosis in human osteosarcoma cells: new implication for osteosarcoma therapy? Cell Biochem Biophys 2013; 65: [5] Bartel DP. Micrornas: genomics, biogenesis, mechanism, and function. Cell 2004; 116: [6] Kim VN, Han J and Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 2009; 10: [7] Thomson DW, Bracken CP and Goodall GJ. Experimental strategies for microrna target identification. Nucleic Acids Res 2011; 39: [8] Cai K, Shen F, Cui JH, Yu Y and Pan HQ. Expression of mir-221 in colon cancer correlates with prognosis. Int J Clin Exp Med 2015; 8: [9] Xie X, Liu HT, Mei J, Ding FB, Xiao HB, Hu FQ, Hu R and Wang MS. mir-106a promotes growth and metastasis of non-small cell lung cancer by targeting PTEN. Int J Clin Exp Pathol 2015; 8: [10] Bai Y, Li J, Li J, Liu Y and Zhang B. MiR-615 inhibited cell proliferation and cell cycle of human breast cancer cells by suppressing of AKT2 expression. Int J Clin Exp Med 2015; 8: [11] Ma W, Zhang X, Chai J, Chen P, Ren P and Gong M. Circulating mir-148a is a significant diagnostic and prognostic biomarker for patients with osteosarcoma. Tumour Biol 2014; 35: [12] Xue Z, Zhao J, Niu L, An G, Guo Y and Ni L. Upregulation of mir-300 promotes proliferation and invasion of osteosarcoma by targeting BRD7. PLoS One 2015; 10: e [13] Shang Y, Wang LQ, Guo QY and Shi TL. MicroRNA-196a overexpression promotes cell proliferation and inhibits cell apoptosis through PTEN/Akt/FOXO1 pathway. Int J Clin Exp Pathol 2015; 8: [14] Sun Z, Zhang T, Hong H, Liu Q and Zhang H. mir-202 suppresses proliferation and induces apoptosis of osteosarcoma cells by downregulating Gli2. Mol Cell Biochem 2014; 397: [15] Niu G, Li B, Sun L and An C. MicroRNA-153 inhibits osteosarcoma cells proliferation and invasion by targeting TGF-β2. PLoS One 2015; 10: e [16] Han K, Chen X, Bian N, Ma B, Yang T, Cai C, Fan Q, Zhou Y and Zhao TB. MicroRNA profiling identifies MiR-195 suppresses osteosarcoma cell metastasis by targeting CCND1. Oncotarget 2015; 6: [17] Niu G, Li B, Sun J and Sun L. mir-454 is downregulated in osteosarcomas and suppresses cell proliferation and invasion by directly targeting c-met. Cell Prolif 2015; 48: [18] Wang W, Zhou X and Wei M. MicroRNA-144 suppresses osteosarcoma growth and metastasis by targeting ROCK1 and ROCK2. Oncotarget 2015; 6: [19] Chen T, Gao F, Feng S, Yang T and Chen M. MicroRNA-370 inhibits the progression of nonsmall cell lung cancer by downregulating oncogene TRAF4. Oncol Rep 2015; 34: [20] Yungang W, Xiaoyu L, Pang T, Wenming L and Pan X. mir-370 targeted FoxM1 functions as a tumor suppressor in laryngeal squamous cell carcinoma (LSCC). Biomed Pharmacother 2014; 68: [21] Wu Z, Sun H, Zeng W, He J and Mao X. Upregulation of MircoRNA-370 induces proliferation in human prostate cancer cells by downregulating the transcription factor FOXO1. PLoS One 2012; 7: e [22] Fan C, Liu S, Zhao Y, Han Y, Yang L, Tao G, Li Q and Zhang L. Upregulation of mir-370 contributes to the progression of gastric carcinoma via suppression of FOXO1. Biomed Pharmacother 2013; 67: [23] Gao D, Vahdat LT, Wong S, Chang JC and Mittal V. Microenvironmental regulation of epithelialmesenchymal transitions in cancer. Cancer Res 2012; 19: [24] Kim MA, Lee HS, Lee HE, Kim JH, Yang HK and Kim WH. Prognostic importance of epithelial-mesenchymal transition-related protein expression in gastric carcinoma. Histopathology 2009; 4: [25] Nagathihalli NS and Merchant NB. Srcmediated regulation of E-cadherin and EMT in pancreatic cancer. Front Biosci 2012; 17: [26] Wang Z, Ahmad A, Li Y, Banerjee S, Kong D and Sarkar FH. Forkhead box M1 transcription factor: a novel target for cancer therapy. Cancer Treat Rev 2010; 36: [27] Laoukili J, Kooistra MR, Brás A, Kauw J, Kerkhoven RM, Morrison A, Clevers H and Medema RH. FoxM1 is required for execution of the mitotic programme and chromosome stability. Nat Cell Biol 2005; 7: [28] Laoukili J, Stahl M and Medema RH. FoxM1: at the crossroads of ageing and cancer. Biochim Biophys Acta 2007; 1775: [29] Li XR, Chu HJ, Lv T, Wang L, Kong SF and Dai SZ. mir-342-3p suppresses proliferation, migration and invasion by targeting FOXM1 in human cervical cancer. FEBS Lett 2014; 588: Int J Clin Exp Pathol 2015;8(9):

11 [30] Inoguchi S, Seki N, Chiyomaru T, Ishihara T, Matsushita R, Mataki H, Itesako T, Tatarano S, Yoshino H, Goto Y, Nishikawa R, Nakagawa M and Enokida H. Tumour-suppressive micro- RNA-24-1 inhibits cancer cell proliferation through targeting FOXM1 in bladder cancer. FEBS Lett 2014; 588: [31] Ahn H, Sim J, Abdul R, Chung MS, Paik SS, Oh YH, Park CK and Jang K. Increased expression of forkhead box M1 is associated with aggressive phenotype and poor prognosis in estrogen receptor-positive breast cancer. J Korean Med Sci 2015; 30: [32] Zhang X, Zeng J, Zhou M, Li B, Zhang Y, Huang T, Wang L, Jia J and Chen C. The tumor suppressive role of mirna-370 by targeting FoxM1 in acute myeloid leukemia. Mol Cancer 2012; 11: 56. [33] Yang C, Chen H, Tan G, Gao W, Cheng L, Jiang X, Yu L and Tan Y. FOXM1 promotes the epithelial to mesenchymal transition by stimulating the transcription of Slug in human breast cancer. Cancer Lett 2013; 340: Int J Clin Exp Pathol 2015;8(9):

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4 European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing

More information

LncRNA LET function as a tumor suppressor in breast cancer development

LncRNA LET function as a tumor suppressor in breast cancer development European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1 Human Cell (2017) 30:290 299 DOI 10.1007/s13577-017-0170-1 RESEARCH ARTICLE MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.

More information

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

More information

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

ONCOLOGY LETTERS 15: , 2018

ONCOLOGY LETTERS 15: , 2018 10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN J.W. Ling 1, P.R. Lu 2, Y.B. Zhang 1, S. Jiang 1 and Z.C. Zhang 1 1 Department of Ophthalmology, Third Hospital of Zhangjiagang,

More information

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.

More information

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.

More information

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for

More information

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

MicroRNA-132 inhibits cell growth and metastasis in osteosarcoma cell lines possibly by targeting Sox4

MicroRNA-132 inhibits cell growth and metastasis in osteosarcoma cell lines possibly by targeting Sox4 1672 MicroRNA-132 inhibits cell growth and metastasis in osteosarcoma cell lines possibly by targeting Sox4 YULONG LIU, YE LI, JINGCHEN LIU, YUNTAO WU and QINGSAN ZHU Department of Orthopaedic Surgery,

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2017;10(10):10413-10418 www.ijcep.com /ISSN:1936-2625/IJCEP0058793 Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Chao-Bing

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2016;9(2):2049-2053 www.ijcep.com /ISSN:1936-2625/IJCEP0014841 Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

More information

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.

More information

MiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma

MiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma MiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma Jun Zhang, Wengen Hou, Jinling Jia, Yilei Zhao and Bin Zhao Department of Orthopaedics, The First

More information

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:

More information

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4 Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1

MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1 European Review for Medical and Pharmacological Sciences 2018; 22: 5546-5553 MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1 L.-H. XIA 1, Q.-H. YAN 2, Q.-D. SUN

More information

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D EXPERIMENTAL AND THERAPEUTIC MEDICINE MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D YUPENG REN, GANG SHI, PENG JIANG and QINGKAI MENG Department

More information

Expression and functions of microrna-139 in osteosarcoma.

Expression and functions of microrna-139 in osteosarcoma. Biomedical Research 2017; 28 (22): 9879-9884 ISSN 0970-938X www.biomedres.info Expression and functions of microrna-139 in osteosarcoma. Qi Liao *, Jianghua Ming, Geliang Hu, Yaming Li, Chun Zhang, Yanchao

More information

Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells

Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells Int J Clin Exp Pathol 2018;11(7):3793-3801 www.ijcep.com /ISSN:1936-2625/IJCEP0078547 Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells Lei Wang

More information

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer Sun et al. Journal of Experimental & Clinical Cancer Research (2018) 37:106 https://doi.org/10.1186/s13046-018-0771-x RESEARCH Open Access LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang

More information

microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells

microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells ONCOLOGY LETTERS 16: 3459-3464, 2018 microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells XINFANG SUN, HONGTAO HOU,

More information

Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer

Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer Int J Clin Exp Pathol 2017;10(7):7596-7602 www.ijcep.com /ISSN:1936-2625/IJCEP0053748 Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer Wu-Ran

More information

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906

More information

MiR-329 suppresses osteosarcoma development by downregulating Rab10

MiR-329 suppresses osteosarcoma development by downregulating Rab10 MiR-329 suppresses osteosarcoma development by downregulating Rab10 Wenwei Jiang 1*, Jin Liu 2*, Tianyang Xu 1 and Xiao Yu 3 1 Department of Orthopedics, Shanghai Tenth People s Hospital, Tong Ji University

More information

Regulatory role of microrna184 in osteosarcoma cells

Regulatory role of microrna184 in osteosarcoma cells Regulatory role of microrna184 in osteosarcoma cells G.R. Yin 1,2, Q. Wang 3, X.B. Zhang 2 and S.J. Wang 1 1 Department of Joint Surgery, The Second Hospital of Shandong University, Jinan, China 2 Department

More information

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.

More information

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao

More information

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.

More information

mir-19a promotes invasion and epithelial to mesenchymal transition of bladder cancer cells by targeting RhoB

mir-19a promotes invasion and epithelial to mesenchymal transition of bladder cancer cells by targeting RhoB JBUON 2019; 24(2): 797-804 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE mir-19a promotes invasion and epithelial to mesenchymal transition of

More information

Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable prognosis

Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable prognosis Int J Clin Exp Pathol 2016;9(1):181-185 www.ijcep.com /ISSN:1936-2625/IJCEP0017823 Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable

More information

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,

More information

Long Non-Coding RNA TUG1 Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and Upregulating SOX4 Expression

Long Non-Coding RNA TUG1 Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and Upregulating SOX4 Expression Original Article Yonsei Med J 2018 Mar;59(2):226-235 pissn: 0513-5796 eissn: 1976-2437 Long Non-Coding RNA Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma

Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma Int J Clin Exp Pathol 2017;10(10):10276-10281 www.ijcep.com /ISSN:1936-2625/IJCEP0059849 Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Original Article Ginkgo biloba extract induce cell apoptosis and G0/G1 cycle arrest in gastric cancer cells

Original Article Ginkgo biloba extract induce cell apoptosis and G0/G1 cycle arrest in gastric cancer cells Int J Clin Exp Med 2015;8(11):20977-20982 www.ijcem.com /ISSN:1940-5901/IJCEM0015584 Original Article Ginkgo biloba extract induce cell apoptosis and G0/G1 cycle arrest in gastric cancer cells Yu Bai 1,

More information

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.

More information

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.

More information

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,

More information

Circ_ /PHDLA1 suppresses gastric cancer progression by sponging mir 101 3p.1

Circ_ /PHDLA1 suppresses gastric cancer progression by sponging mir 101 3p.1 https://doi.org/10.1186/s13578-018-0252-0 Cell & Bioscience RESEARCH Open Access Circ_0027599/PHDLA1 suppresses gastric cancer progression by sponging mir 101 3p.1 Liang Wang *, Jingyan Shen and Yushan

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,

More information

RESEARCH ARTICLE. Ginsenoside-Rh2 Inhibits Proliferation and Induces Apoptosis of Human Gastric Cancer SGC-7901 Side Population Cells

RESEARCH ARTICLE. Ginsenoside-Rh2 Inhibits Proliferation and Induces Apoptosis of Human Gastric Cancer SGC-7901 Side Population Cells RESEARCH ARTICLE Ginsenoside-Rh2 Inhibits Proliferation and Induces Apoptosis of Human Gastric Cancer SGC-7901 Side Population Cells Jun Qian 1& *, Jing Li 1&, Jian-Guang Jia 1, Xin Jin 1, Da-Jun Yu 1,

More information

Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway

Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Int J Clin Exp Pathol 2015;8(2):1419-1426 www.ijcep.com /ISSN:1936-2625/IJCEP0004445 Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Ke Yang 1*,

More information

mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5

mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5 ORIGINAL ARTICLE Vol. 43 (6): 1060-1067, November - December, 2017 doi: 10.1590/S1677-5538.IBJU.2016.0595 mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5 Zhi-Gang

More information

GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer

GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 6809-6815 GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer M. LIANG 1, X.-C. LIU 1, T. LIU 2, W.-J. LI 3, J.-G. XIANG 1,

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE

More information

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3

More information

Highly expressed microrna-124 inhibits migration and promotes apoptosis of esophageal cancer cells by degrading PDCD6

Highly expressed microrna-124 inhibits migration and promotes apoptosis of esophageal cancer cells by degrading PDCD6 JBUON 2019; 24(2): 805-812 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Highly expressed microrna-124 inhibits migration and promotes apoptosis

More information

MiR-100 up-regulation enhanced cell autophagy. and apoptosis induced by cisplatin in osteosarcoma by targeting mtor

MiR-100 up-regulation enhanced cell autophagy. and apoptosis induced by cisplatin in osteosarcoma by targeting mtor European Review for Medical and Pharmacological Sciences 2018; 22: 5867-5873 MiR-100 up-regulation enhanced cell autophagy and apoptosis induced by cisplatin in osteosarcoma by targeting mtor Z. YU, N.

More information

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Original Article MiR-29a regulated FOXO3 expression and promoted the cell proliferation of human cervical cancer

Original Article MiR-29a regulated FOXO3 expression and promoted the cell proliferation of human cervical cancer Int J Clin Exp Pathol 2017;10(1):196-205 www.ijcep.com /ISSN:1936-2625/IJCEP0041190 Original Article MiR-29a regulated FOXO3 expression and promoted the cell proliferation of human cervical cancer Xiaoliang

More information

Original Article MicroRNA-140 inhibits tumor progression in nasopharyngeal carcinoma by targeting CXCR4

Original Article MicroRNA-140 inhibits tumor progression in nasopharyngeal carcinoma by targeting CXCR4 Int J Clin Exp Pathol 2017;10(7):7750-7759 www.ijcep.com /ISSN:1936-2625/IJCEP0055294 Original Article MicroRNA-140 inhibits tumor progression in nasopharyngeal carcinoma by targeting CXCR4 Chengyun Yao

More information

Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1

Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1 2148 Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1 Liu Yang 1, Fei Peng 2, Jian Qin 3, Henghua Zhou 4 and Bing Wang 3 1 Department of Gastroenterology,

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

MiRNA-202 impacts proliferation and apoptosis of granulose cells

MiRNA-202 impacts proliferation and apoptosis of granulose cells MiRNA-202 impacts proliferation and apoptosis of granulose cells Liqiong Huang, Bo Zheng*, Yi He Department of Obstetrics and Gynecology, Xianning Central Hospital, The First Affiliated Hospital Of Hubei

More information

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun

More information

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143 European Review for Medical and Pharmacological Sciences 2018; 22: 8343-8352 Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing

More information

MiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2

MiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2 European Review for Medical and Pharmacological Sciences 2017; 21: 4835-4843 MiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2 C. ZHIPING 1,2, T. SHIJUN

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Annals of Oncology Advance Access published January 10, 2005

Annals of Oncology Advance Access published January 10, 2005 Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g

More information

MicroRNA-124 suppresses Slug-mediated lung cancer metastasis

MicroRNA-124 suppresses Slug-mediated lung cancer metastasis European Review for Medical and Pharmacological Sciences 2016; 20: 3802-3811 MicroRNA-124 suppresses Slug-mediated lung cancer metastasis Z. CUI, Y. HU Medical Oncology Department I, General Hospital,

More information

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 ONCOLOGY REPORTS 38: 1977-1984, 2017 mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 Hua Liang, Ruoyu Luo, Xiaoqi Chen, Yuzi Zhao and Aili Tan Department of Obstetrics and Gynecology,

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Int J Clin Exp Pathol 2017;10(4):4363-4369 www.ijcep.com /ISSN:1936-2625/IJCEP0043994 Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Rong-Gang Li 1, Zhuo Gao

More information

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel

More information

Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma

Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma Int J Clin Exp Pathol 2015;8(3):2994-3000 www.ijcep.com /ISSN:1936-2625/IJCEP0005023 Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma

More information

Original Article MiR-15b mediates liver cancer cells proliferation through targeting BCL-2

Original Article MiR-15b mediates liver cancer cells proliferation through targeting BCL-2 Int J Clin Exp Pathol 2015;8(12):15677-15683 www.ijcep.com /ISSN:1936-2625/IJCEP0015837 Original Article MiR-15b mediates liver cancer cells proliferation through targeting BCL-2 Yuping Zhang 1, Feizhou

More information

INTERNATIONAL JOURNAL OF ONCOLOGY 54: , 2019

INTERNATIONAL JOURNAL OF ONCOLOGY 54: , 2019 326 Paclitaxel resistant gastric cancer MGC 803 cells promote epithelial to mesenchymal transition and chemoresistance in paclitaxel sensitive cells via exosomal delivery of mir 155 5p MEI WANG 1,2, RONG

More information

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG

More information

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and

More information

Supporting Information

Supporting Information Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School

More information