MiR-329 suppresses osteosarcoma development by downregulating Rab10
|
|
- Scarlett Chambers
- 5 years ago
- Views:
Transcription
1 MiR-329 suppresses osteosarcoma development by downregulating Rab10 Wenwei Jiang 1*, Jin Liu 2*, Tianyang Xu 1 and Xiao Yu 3 1 Department of Orthopedics, Shanghai Tenth People s Hospital, Tong Ji University School of Medicine, China 2 Department of Orthopedics, Wuxi Taihu Hospital, China 3 Department of Orthopedics, Suzhou Municipal Hospital of Nanjing Medical University, China Correspondence X. Yu, Department of Orthopedics, Suzhou Municipal Hospital of Nanjing Medical University, 26 DaoQian Street, Suzhou , China Fax: Tel: @139.com *These authors contributed equally to this work. (Received 30 June 2016, revised 18 July 2016, accepted 24 July 2016, available online 19 August 2016) MiR-329 has been proved to be a tumor suppressor gene in various malignancies, however, its role in osteosarcoma remains elusive. We found that mir- 329 is remarkably downregulated in osteosarcoma tissues and relates to advanced stages. MiR-329 is able to inhibit osteosarcoma cell proliferation, promote apoptosis, and induce G0/G1 cell cycle arrest. In addition, mir-329 also suppresses wound-healing and migration ability of osteosarcoma cells and inhibits tumorigenicity in vivo. Rab10 was identified as a target of mir- 329 in osteosarcoma and mediates its biofunction. These findings may shed light to the understanding of tumor development in osteosarcoma. Keywords: growth; migration; mir-329; osteosarcoma; Rab10 doi: / Edited by Tamas Dalmay Osteosarcoma (OS) is the second most common primary malignant bone tumor and leads to a large number of cancer-related deaths in children and young adults (median age of diagnosis: 18 years) [1]. It represents the third highest cause of cancer-related death in this age group [2]. The development of combination treatment with neoadjuvant chemotherapy and radical surgery has significantly increased the survival rates from 20 to 75% [3,4]. However, even after curative resection of primary tumors, a considerable number of patients still experience distant metastases or local recurrence [5]. The clinical prognosis of these metastatic or recurrent patients is extremely poor. Thus, discovery of new biomarkers and effective therapeutic targets for OS are crucial. MiRNA are a class of small regulatory RNA molecules, that obstruct the translation of mrna by binding to the 3 0 -UTR of the corresponding mrna [6]. Compelling studies have proved that mirna take part in most tumor biological processes such as metastasis, cell proliferation, differentiation, and apoptosis [7,8]. Indeed, aberrant mirna expression has been found in OS, which has been shown to contribute to cancer development and metastasis by inhibiting tumor suppressor genes or promoting oncogene expression [9,10]. For example, mir-144 suppresses OS progression by directly downregulating ROCK1 and ROCK2 expression [11], overexpression of mir-542-5p promotes the proliferation of OS by targeting HUWE1 [12]. Abnormal mir-329 expression in tumor tissues, such as glioma [13], neuroblastoma [14], and gastric cancer [15], suggests that mir-329 is significant in cancer pathogenesis and progression. However, whether mir- 329 plays a role in OS development is still elusive. In this study, we analyzed mir-329 expression in OS tissues and investigated its effects on OS development. Abbreviations NC, negative control; OS, osteosarcoma; qrt-pcr, quantitative real-time PCR; UTR, 3 0 -untranslated regions; WST, water-soluble tetrazolium salt. 2973
2 MiR-329 suppresses osteosarcoma W. Jiang et al. Materials and methods Tissue specimens and cell culture The clinical research protocol was approved by the Ethical Committee of Shanghai Tenth People s Hospital, Tong Ji University School of Medicine. A total of 62 sets of osteosarcoma and adjacent nontumor tissues were obtained from patients who underwent curative surgery at Shanghai Tenth People s Hospital between January 2011 and December None of the patients had received chemotherapy prior to surgery. For the use of clinical materials for research purposes, prior patient consent was obtained. Tissues were harvested freshly after samples dissection, snap-frozen in liquid nitrogen, and finally preserved at 80 C. The normal human osteoblast cell line hfob 1.19, and OS cell lines 143B, HOS, Saos-2, U2OS, and MG-63 were purchased from American Type Culture Collection (Manassas, VA, USA). The five OS cell lines and hfob 1.19 cells were cultured in RPMI 1640 supplemented with 10% FBS, 100 UmL 1 penicillin, and 100 mgml 1 streptomycin at 37 C in a humidified incubator containing 5% CO 2. Quantitative real-time PCR (qpcr) Total RNA was isolated from tissue samples and cell lines using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer s instructions. cdna was synthesized with 1ug RNA using reverse transcription kit (Toyobo, Osaka, Japan). SYBR Green reagent (Applied Biosystems, Foster City, CA, USA) was used for qrt- PCR to analysis mrna expression. U6 small nuclear RNA was used as an endogenous control for mir-329 normalization. Relative expression ratios of mir-329 in each paired tumor cancer to normal tissue sample were calculated using the 2 DDCt method. MiR-329 and U6 primers were purchased from GenePharma (Shanghai, China). The PCR primers designed for Rab10: 5 0 -CAAGGGAGCATG GTATTAGGTTT-3 0 (forward) and 5 0 -CTAACGTGAGG AACGCCTTTT-3 0 (reverse); for GAPDH: 5 0 -GACCTGA CCTGCCGTCTAG -3 0 (forward) and 5 0 -GTAGCCCAGG ATGCCCTTGA -3 0 (reverse). Transient transfection MiR-329 mimics (dsrna oligonucleotides), negative control (NC), mir-329 inhibitor, and inhibitor negative control were purchased from GenePharma (Shanghai, China). Cells in logarithmic growth phase were trypsinized, counted, and seeded in six-well plates to ensure 50% cell confluence on the next day for transfection. Oligonucleotide transfection was performed using Lipofectamine 2000 Reagent (Invitrogen). Transfection efficiency was calculated by qrt-pcr. Cell proliferation assay At 24 h post transfection with mir-329 mimics/inhibitors or control oligonucleotides, cells were seeded into 96-well plates ( cells/well) and cell proliferation was documented every 24 h for 4 days. Cell proliferation was measured by the colorimetric water-soluble tetrazolium salt (WST) assay with a Cell Counting Kit-8 according to the manufacturer s instructions (Dojindo, Kumamoto, Japan). Absorbance was measured at 450 nm with a MicroplateAutoreader (Bio-Rad, Hercules, CA, USA). All experiments were performed in triplicate. Colony formation assay and soft agar colony formation assay For colony formation assay, cells were seeded into six-well plates with cells/well in 4 ml culture medium which was replaced every 3 4 days and incubated for 10 days. The number of colonies was counted using a phase-contrast microscope at a magnification of 49 after staining with 0.5% crystal violet solution. We counted the colonies which containing at least 50 cells. The experiments were independently triplicated. For soft agar colony formation assay, mirna mimic/inhibitor-transfected MG-63/143B cells were resuspended with 0.3% soft agar (A9045; Sigma Aldrich, St. Louis, MO, USA) in RPMI 1640 containing 10% FBS and layered on 0.6% solidified agar in RPMI 1640 containing 10% FBS in six-well plates ( cells/well) 24 h post transfection. The plates were incubated for 2 weeks. Colonies were photographed using a phase-contrast microscope at a magnification of 109. Apoptosis and cell cycle analysis For cell cycle analysis, cells were transfected with mir-329 mimics or mir-329 inhibitors and their controls, then cells were harvested 48 h post transfection and finally we performed the flow cytometry using the AnnexinV/PI doublestaining kit (BD Biosciences, San Jose, MA, USA) according to the manufacturer s instructions. All assays were repeated at least three times. For cell cycle analysis, cells were first fixed using 70% ethanol and stored at 4 C overnight. After that, the fixed cells were washed with PBS, treated with 2 ll of RNase A (50 lgml 1 ), and stained with 20 ll of Propidium Iodide (50 lgml 1 )at37 C for 30 min in dark. Cell cycle distribution was analyzed using FACSCaliber (BD Bioscience). Wound-healing assay and cell migration assay Cells were seeded in six-well plates and allowed to reach confluence. Wounds were scratched on the monolayer of cells using 20-mL pipette tips. Cells were rinsed with PBS 2974
3 W. Jiang et al. MiR-329 suppresses osteosarcoma and cultured in RPMI 1640 without calf serum. Wound closure was observed at 0 and 48 h, and photographed under a microscope. For cell migration assay, transfected cells ( ) in serum-free medium were added to the top chamber and incubated at 37 C in a humidified incubator containing 5% CO 2 according to the manufacturer s protocols. Medium containing 10% FBS was added to the lower chamber as a chemoattractant. After 24 h of culturing, cells that invaded the lower chamber were stained with 0.5% crystal violet and subsequently counted in five different areas under an inverted microscope. Lentiviral transfection for stable expression cells Lentiviral vectors expressing mir-329 and scrambled RNA were purchased from GenePharma. Lentivirus transfection was performed according to the manufacturer s instruction to establish the stable mir-329-expressing MG-63 cells. The control was constructed similarly without inserted cdna. Tumor xenograft model and tumorigenicity assay All animal studies complied with protocols approved by the Committee on Animal Care in Tong Ji University School of Medicine. LV-miR-NC or LV-miR-329 cells were injected subcutaneously into the flanks of mice ( cells per animal). Tumor size was measured externally every 7 days using a caliper, and tumor volume was estimated using the equation: length (mm) 9 width 2 (mm) Five mice were used for each group. The mice were sacrificed after 4 weeks, and all tumor grafts were harvested and examined histologically. Luciferase reporter assay The 3 0 -UTR of Rab10 was amplified by PCR using cdna from MG-63 cells and cloned into Hind III-MluI sites of the pmir-report mirna expression reporter vector (Applied Biosystems). The mutant Rab UTR was constructed to mutate three intermittent sites complementary to the mir-329 seed-region. The mir-329 mimics or control and luciferase reporter vector were cotransfected into MG-63 cells. Luciferase activity was measured after 48 h using the Dual luciferase reporter assay system (Promega, Madison, WI, USA). Renilla luciferase activity was normalized to that of firefly luciferase. Experiments were repeated at least three times. Western blot Rab10 protein levels were detected according to standard immunoblot protocols, using mouse anti-human Rab10 antibody (1 : 1000; Abcam, Cambridge, MA, USA) and monoclonal anti-gapdh (1 : 5000; Abcam) antibody. Statistical analysis The relationship between mir-329 expression and clinicopathologic features was investigated using Pearson X 2 test. Student t test was used to analyze the difference between two groups and one-way ANOVA for more than two groups. Statistical analysis was performed using SPSS 16.0 software (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered significant, and P < 0.01 was considered highly significant. Results MiR-329 is downregulated in OS patients and correlates with tumor size and Enneking stage In order to investigate the mir-329 expression level in OS, we performed quantitative real-time PCR (qrt- PCR) in tumor tissues and matched nontumor tissues from 62 OS patients. MiR-329 expression was significantly downregulated in tumor tissues compared with the nontumor tissues (Fig. 1A,B). In addition, five OS cell lines also displayed lower levels of mir-329 than the normal human osteoblastic cell line, hfob1.19 (Fig. 1C). Given the remarkable downregulation of mir-329 in OS, we carried on to study the correlation between mir-329 expression and clinicopathologic characteristics of OS patients. All the cases were divided into two groups based on relative expression level: the mir-329 high-expression group (n = 28) and the mir-329 lowexpression group (n = 34). We found that mir-329 low-expression group had inclinations toward larger tumor size (P = 0.011) and more advanced Enneking stage (P = 0.039). However, no relationship was observed between mir-329 expression level and gender, age, tumor grade, histological type, or distant metastasis (Table 1). MiR-329 suppresses OS cell proliferation in vitro In order to explore the function of mir-329 in OS cell lines, MG-63 cells, low mir-329 expressing cells, were transfected with mir-329 mimics or negative control (NC). On the other hand, 143B cells, high mir-329 expressing cells, were transfected with mir-329 inhibitors or NC. Then, we utilized CCK8 analysis and colony formation assay to evaluate the effect of mir-329 expression on cell proliferation. As indicated in Fig. 2A,B,C, mir-329 mimics markedly inhibited cell growth, while mir-329 inhibitors significantly induced cell growth induction (P < 0.01). We also confirmed these observations in soft agar colony formation assays. The size of colonies of MG-63 cells transfected with mir-329 mimics was smaller than that of controls 2975
4 MiR-329 suppresses osteosarcoma W. Jiang et al. Fig. 1. mir-329 is significantly downregulated in tissues and cell lines. (A) mir-329 expression level in surgical samplesfrom 62 OS tissues and adjacent nontumorous tissues. Data are shown using 2 DCT values. U6 snrna was used for normalization. (B) Relative expression of mir-329 in 62 OS surgical specimens. Results are shown as DDCT values. (C) mir-329 expression level in five OS cell lines compared with hfob1.19. **P < Table 1. Association between mir-329 expression and clinicopathologic factors of osteosarcoma patients. Variables Number of cases mir-329 immunostaining High (n = 28) Low (n = 34) Gender Male Female Age (years) < Tumor grade Low High Anatomic location Tibia/femur Elsewhere Tumor size 8 cm >8 cm Enneking stage I II III Histological type Osteoblastic Fibroblastic Chondroblastic Telangiectatic Others Distant metastasis Absent Present P (P < 0.01, Fig. 2D,E) and 143B cells transfected with inhibitors showed opposite results (P < 0.01, Fig. 2D,E). MiR-329 promotes apoptosis of OS cells and induces G0/G1 cell cycle arrest Flow cytometry analysis was performed to clarify the mechanism of mir-329-mediated cell growth inhibition. MiR-329 mimics increased the apoptotic rate comparing to the control group (P < 0.01, Fig. 3A,B) and mir-329 inhibitor decreased it (P < 0.01, Fig. 3A, B). Moreover, flow cytometry analysis revealed that mir-329 overexpression leads to an increased percentage of cells in the G0/G1 phase (P < 0.05, Fig. 3C,D), alone with a decrease in G2/M-phase cells (P < 0.01, Fig. 3C,D). We also observed the opposite results in mir-329 inhibitor-transfected 143B cells when compared with the negative control cells (P < 0.05, Fig. 3C,D), which suggesting that this mirna induces G0/G1 arrest. MiR-329 inhibits wound-healing and migration ability of OS cells To investigate the effect of mir-329 on motility, we performed wound-healing assays. We observed that mir-329 re-expression suppressed the wound-healing ability of MG-63 cells to a significant extent after 48 h (P < 0.01, Fig. 4A,B). Conversely, the distance 2976
5 W. Jiang et al. MiR-329 suppresses osteosarcoma Fig. 2. mir-329 suppresses OS cell proliferation in vitro. (A) MG-63 cells were transfected with mir-329 mimics or NC mimics, 143B cells were transfected with mir-329 inhibitor or NC control, and cell viability determined with the CCK-8 assay. (B C) Representative photographs (B) and quantitative analysis (C) of plate colony formation of OS cells transfected with mir-329 mimics or mir-329 inhibitors. (D E) Representative photographs (D) and dimension analysis (E) of soft agar colony formation of OS cells transfected with mir-329 mimics or mir-329 inhibitors. **P < between wound edges of 143B cells was markedly shorter when endogenous mir-329 was silenced with specific inhibitors (P < 0.01, Fig. 4C,D). To investigate the influence of mir-329 on migration, we next performed transwell migration assays. Similarly, the migration assays showed that upregulation of mir-329 led to significantly decreased migration ability of MG-63 cells, whereas silencing of mir- 329 induced a marked increase in 143B cell migration (P < 0.01, Fig. 4E,F). MiR-329 inhibits tumorigenicity in vivo We have demonstrated that mir-329 suppresses proliferation in vitro, therefore we continued to investigate if mir-329 has any impact upon tumorigenicity in vivo. Lentivirus-mediated MG-63/miR-329 and MG- 63/miR-NC stably transfected cell lines were obtained and injected into 4-week-old male nude mice subcutaneously, and tumor growth was assessed for 4 weeks. Tumors grew slower (Fig. 5A) and were significantly 2977
6 MiR-329 suppresses osteosarcoma W. Jiang et al. Fig. 3. mir-329 induces cell apoptosis and G0/G1 cell cycle arrest. (A, B) The percentage of apoptotic cells transfected with mir-329 mimics or inhibitors or their controls. (C, D) The percentage of G0/G1, S, G2/M cells transfected with mir-329 mimics or inhibitors or their controls. *P < 0.05, **P < smaller (P < 0.01, Fig. 5B,C) in the MG-63/LV-miR- 329 group than those in the MG-63/LV-miR-NC group. We also found that Ki-67 staining was lower in MG-63/LV-miR-329 tumor samples compared with that in MG-63/LV-miR-NC tumor samples (P < 0.01, Fig. 5D,E). The above mentioned results demonstrated that mir-329 inhibits tumorigenicity in vivo. Rab10 is the target of mir-329 in OS In order to get a better understanding of the mechanism of mir-329 in OS, we went on to identify its downstream target. Rab10 stood out as a promising candidate after software prediction. We found mir- 329 was able to degrade Rab10 mrna and lead to a decreased Rab10 protein level (Fig. 6A,B), which strengthened our hypothesis. Furthermore, we showed that mir-329 mimics decreased the activity of the luciferase reporter harboring wild-type Rab UTR, but not that with mutant Rab UTR (Fig. 6C,D). On the contrary anti-mir-329 increased the luciferase activity of wild-type Luc-Rab10, but had no effect on the mutant (Fig. 6C,E). Next, we examined biofunction of Rab10 in OS, and discovered that knocking down Rab10 inhibited cell growth and migration (Fig. 7), which was very similar with the effect of overexpressing mir-329. The aforementioned data prove that Rab10 is the target of mir-329 and mediates its biofunction in OS. Discussion mir-329 is located on 14q32.31 and is reported to be downregulated in several types of tumor [16,17], however, its expression level in OS is still unknown. In the present study, we, for the first time, show 2978
7 W. Jiang et al. MiR-329 suppresses osteosarcoma Fig. 4. mir-329 suppresses OS cell wound healing and migration in vitro. (A) A representative image of wound-healing assay for MG-63 cells transfected with mir-329 mimics or NC mimics. (B) The distances between wound edges of MG- 63 cells transfected with mir-329 mimics or NC mimics at 0 and 48 h. (C) A representative image of wound-healing assay for 143B cells transfected with mir- 329 inhibitor or NC control. (D) The distances between wound edges of 143 cells transfected with mir-329 inhibitor or NC control at 0 and 48 h. (E) Transwell assay. Photographs show cells that traveled through the micropore membrane. (F) Histograms showed the numbers of migration cells. **P < Fig. 5. mir-329 inhibitstumorigenicity and proliferation in vivo. (A) Photograph of tumors harvested from LV-miR-NC and LVmiR-329 cells in nude mice. (B) Growth kinetics of tumors in nude mice. Tumor diameters were measured every 7 days. (C) The average weight of tumors in nude mice. (D) Photographs of immunohistochemisty analysis of Ki-67 in tumor samples from nude mice (2009). (E) Representative proliferative index of tumors in LV-miR-329 and LV-miR-NC nude mice. *p < 0.05, **p < that mir-329 is significantly downregulated in OS tissues and its low expression relates to large tumor size and advanced Enneking stage. To elucidate the mechanism of such abnormal expression, we discover that mir-329 suppresses OS cell proliferation and migration by targeting Rab10, which may shed light to the understanding of tumor development in OS. 2979
8 MiR-329 suppresses osteosarcoma W. Jiang et al. Fig. 6. Rab10 is the target of mir-329. (A, B) Rab10 mrna and protein level after transfected with mir-329 mimics or inhibitor. (C) Scheme of the mir-329- binding sites in Rab UTR. Rab10-mut represents the Rab UTR with mutational mir-329 binding sites. (D, E) Luciferase reporter activity after transfected with mir-329 mimics or inhibitor in wild-type Rab UTR or mutant Rab UTR reporter. **p < Fig. 7. Knocking down Rab10 inhibits OS cell proliferation and migration. (A) Rab10 was knocked down in OS cells and cell viability was determined by CCK-8 assay. (B) A representative image of migration assay for OS cells transfected with Rab10 shrna or controls. (C) Quantitative analysis of migration OS cells transfected with Rab10 shrna or controls. **p < Relevant studies demonstrate that mir-329, as an oncogene, suppresses tumor development mainly by inhibiting tumor cell proliferation and migration [14 16]. In consistent to these reports, we found that mir- 329 inhibits OS cell proliferation, promotes apoptosis and induces G0/G1 cell cycle arrest. In addition, mir- 329 is also able to suppress wound-healing and migration ability of OS cells and inhibit tumorigenicity in vivo. These finding may justify its low expression and clinical association we discovered. In order to further elucidate the mechanism, we carried on to identify the putative target of mir-329 in OS. Using predicting software, we found a promising target, Rab10 (RAB10, member RAS oncogene family). Rab10 belongs to the RAS superfamily of small GTPases. Given the remarkable role of RAS superfamily plays in tumor development, we hypothesized that Rab10 might be a plausible target of mir-329 and mediate its biological function. Our further experiment corroborates that Rab10 is a direct target of 2980
9 W. Jiang et al. MiR-329 suppresses osteosarcoma mir-329 and its degradation leads to tumor progression in OS. In summary, we demonstrate that mir-329 is downregulated in OS and relates to advanced stage; also, mir-329 suppresses tumor cell proliferation and migration by targeting Rab10. Further studies are required to clarify the effect of other mir-329 targets in OS and if any synergic relationship exists. However, taking into consideration of the significant effect of mir-329, mir-329 itself and its target are potential biomarkers for novel OS management. Author contributions WJ and XY conceived and designed the experiments; WJ and JL performed the experiments; JL and TX analyzed the data; WJ and XY wrote the paper. References 1 Ottaviani G and Jaffe N (2009) The epidemiology of osteosarcoma. Cancer Treat Res 152, Dass CR, Ek ET, Contreras KG and Choong PF (2006) A novel orthotopic murine model provides insights into cellular and molecular characteristics contributing to human osteosarcoma. Clin Exp Metastasis 23, Bacci G, Ferrari S, Bertoni F, Ruggieri P, Picci P, Longhi A, Casadei R, Fabbri N, Forni C, Versari M et al. (2000) Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an 16 updated report. J Clin Oncol 18, Rytting M, Pearson P, Raymond AK, Ayala A, Murray J, Yasko AW, Johnson M and Jaffe N (2000) Osteosarcoma in preadolescent patients. Clin Orthop Relat Res 373, Sakamoto A and Iwamoto Y (2008) Current status and perspectives regarding the treatment of osteo-sarcoma: chemotherapy. Rev Recent Clin Trials 3, Mei Q, Li X, Guo M, Fu X and Han W (2014) The mirna network: micro-regulator of cell signaling in cancer. Expert Rev Anticancer Ther 14, Calin GA and Croce CM (2006) MicroRNA signatures in human cancers. Nat Rev Cancer 6, Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA et al. (2005) MicroRNA expression profiles classify human cancers. Nature 435, Jones KB, Salah Z, Del Mare S, Galasso M, Gaudio E, Nuovo GJ, Lovat F, LeBlanc K, Palatini J, Randall RL et al. (2012) mirna signatures associate with pathogenesis and progression of osteosarcoma. Cancer Res 72, Gougelet A, Pissaloux D, Besse A, Perez J, Duc A, Dutour A, Blay JY and Alberti L (2011) Micro-RNA profiles in osteosarcoma as a predictive tool for ifosfamide response. Int J Cancer 129, Wang W, Zhou X and Wei M (2015) MicroRNA-144 suppresses osteosarcoma growth and metastasis by targeting ROCK1 and ROCK2. Oncotarget 6, Cheng DD, Yu T, Hu T, Yao M, Fan CY and Yang QC (2015) MiR-542-5p is a negative prognostic factor and promotes osteosarcoma tumorigenesis by targeting HUWE1. Oncotarget 6, Xiao B, Tan L, He B, Liu Z and Xu R (2013) MiRNA- 329 targeting E2F1 inhibits cell proliferation in glioma cells. J Transl Med 11, Yang H, Li Q, Zhao W, Yuan D, Zhao H and Zhou Y (2014) mir-329 suppresses the growth and motility of neuroblastoma by targeting KDM1A. FEBS Lett 588, Li Z, Yu X, Wang Y, Shen J, Wu WK, Liang J and Feng F (2015) By downregulating TIAM1 expression, microrna-329 suppresses gastric cancer invasion and growth. Oncotarget 6, Zhou J, Li W, Guo J, Li G, Chen F and Zhou J (2016) Downregulation of mir-329 promotes cell invasion by regulating BRD4 and predicts poor prognosis in hepatocellular carcinoma. Tumour Biol 37, Liu DZ, Ander BP, Tian Y, Stamova B, Jickling GC, Davis RR and Sharp FR (2012) Integrated analysis of mrna and microrna expression in mature neurons, neural progenitor cells and neuroblastoma cells. Gene 495,
Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma
Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for
More informationDecreased expression of mir-490-3p in osteosarcoma and its clinical significance
European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,
More informationMir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More information95% CI: , P=0.037).
Biomedical Research 2017; 28 (21): 9248-9252 Reduced expression level of mir-205 predicts poor prognosis in Qiang Yang 1*#, Peng Sun 2#, Haotian Feng 1, Xin Li 1, Jianmin Li 1 1 Department of Orthopedics,
More informationmir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells
European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationLong noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer
European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationmir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression
EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationEffect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63
68 Chin J Cancer Res 22(1):68-72, 2010 www.springerlink.com Original Article Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 Jing-Wei Wang 1, Yi Liu 2, Hai-mei Tian 2, Wei
More informationArgininosuccinate synthetase 1 suppression and arginine restriction inhibit cell
Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell migration in gastric cancer cell lines Yan-Shen Shan 1, Hui-Ping Hsu 1, Ming-Derg Lai 2,3, Meng-Chi Yen 2,4, Wei-Ching Chen
More informationExpression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.
More informationCircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
More informationEffect of lncrna LET on proliferation and invasion of osteosarcoma cells
European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of
More informationOriginal Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells
Int J Clin Exp Pathol 2015;8(9):10250-10260 www.ijcep.com /ISSN:1936-2625/IJCEP0013027 Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells Ning
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationMiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma
European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationHigh levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma
European Review for Medical and Pharmacological Sciences 2018; 22: 7640-7645 High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma X.-H.
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationMicroRNA-145 inhibits tumour growth and metastasis in osteosarcoma by targeting cyclin-dependent kinase, CDK6
European Review for Medical and Pharmacological Sciences 2016; 20: 5117-5125 MicroRNA-145 inhibits tumour growth and metastasis in osteosarcoma by targeting cyclin-dependent kinase, CDK6 Y. LI 1, J. LIU
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationMir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma
European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.
More informationmicrorna 181 promotes prostate cancer cell proliferation by regulating DAX 1 expression
1296 microrna 181 promotes prostate cancer cell proliferation by regulating DAX 1 expression SHI JUN TONG *, JUN LIU *, XIANG WANG and LIAN XI QU Department of Urologic Surgery, Huashan Hospital Affiliated
More informationLong noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4
European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationmir-542-3p suppresses colorectal cancer progression through targeting survivin
Original Article mir-542-3p suppresses colorectal cancer progression through targeting survivin Chunxiang Ye 1 *, Guanjun Yue 2 *, Zhanlong Shen 1, Bo Wang 1, Yang Yang 1, Tao Li 1, Shuqiang Mao 1, Kewei
More informationCircular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.
More informationKDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel
KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel R. Wei and J.-P. Zang Department of Respiratory Medicine, People s Hospital of Zhengzhou, Zhengzhou, China
More informationExpression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological staging of the cancer
European Review for Medical and Pharmacological Sciences 2016; 20: 1283-1287 Expression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological
More informationLong noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma
JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis
More informationMicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D
EXPERIMENTAL AND THERAPEUTIC MEDICINE MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D YUPENG REN, GANG SHI, PENG JIANG and QINGKAI MENG Department
More informationOriginal Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer
Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,
More informationUp-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis
European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationKnockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma
Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationLing Xu, Wei-Qi Dai, Xuan-Fu Xu, Fan Wang, Lei He, Chuan-Yong Guo*
DOI:http://dx.doi.org/10.7314/APJCP.2012.13.7.3203 RESEARCH ARTICLE Effects of Multiple-target Anti-microRNA Antisense Oligodeoxyribonucleotides on Proliferation and Migration of Gastric Cancer Cells Ling
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationOriginal Article Low-expression of mir-7 promotes cell proliferation and exhibits prognostic value in osteosarcoma patients
Int J Clin Exp Pathol 2017;10(8):9035-9041 www.ijcep.com /ISSN:1936-2625/IJCEP0021883 Original Article Low-expression of mir-7 promotes cell proliferation and exhibits prognostic value in osteosarcoma
More informationA549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
More informationmir-19a promotes colorectal cancer proliferation and migration by targeting TIA1
Liu et al. Molecular Cancer (2017) 16:53 DOI 10.1186/s12943-017-0625-8 RESEARCH Open Access mir-19a promotes colorectal cancer proliferation and migration by targeting TIA1 Yanqing Liu 1, Rui Liu 2, Fei
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationExpression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.
More informationmicrorna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells
ONCOLOGY LETTERS 16: 3459-3464, 2018 microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells XINFANG SUN, HONGTAO HOU,
More informationExpression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.
More informationOriginal Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells
Int J Clin Exp Pathol 2018;11(7):3793-3801 www.ijcep.com /ISSN:1936-2625/IJCEP0078547 Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells Lei Wang
More informationmir-132 inhibits lung cancer cell migration and invasion by targeting SOX4
Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationMicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway
INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE
More informationMicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma
MicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma Lei Shen 1", Peng Wang 2", Jili Yang 3", Xiaotao Li 4 * 1 Department of Anatomy, Qiqihar Medical School,
More informationmir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5
ORIGINAL ARTICLE Vol. 43 (6): 1060-1067, November - December, 2017 doi: 10.1590/S1677-5538.IBJU.2016.0595 mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5 Zhi-Gang
More informationOriginal Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
Int J Clin Exp Pathol 2015;8(3):2994-3000 www.ijcep.com /ISSN:1936-2625/IJCEP0005023 Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
More informationAssociation between downexpression of mir-1301 and poor prognosis in patients with glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.
More informationLong non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis
https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,
More informationDownregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1
2148 Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1 Liu Yang 1, Fei Peng 2, Jian Qin 3, Henghua Zhou 4 and Bing Wang 3 1 Department of Gastroenterology,
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationIncreased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma
Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital
More informationLong non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143
European Review for Medical and Pharmacological Sciences 2018; 22: 8343-8352 Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression
More informationmir 491 5p inhibits osteosarcoma cell proliferation by targeting PKM2
ONCOLOGY LETTERS mir 491 5p inhibits osteosarcoma cell proliferation by targeting PKM2 TING CHEN 1, YUYANG LI 2, WENLIANG CAO 1 and YADONG LIU 3 1 Department of Orthopedics, Shengjing Hospital of China
More informationOriginal Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17
Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao
More informationmir-101, downregulated in retinoblastoma, functions as a tumor suppressor in human retinoblastoma cells by targeting EZH2
ONCOLOGY REPORTS 32: 261-269, 2014 mir-101, downregulated in retinoblastoma, functions as a tumor suppressor in human retinoblastoma cells by targeting EZH2 QIONG LEI 1, FENGMEI SHEN 1, JIE WU 1, WEISHAN
More informationmir-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2
mir-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2 P. Wang 1, H.Y. Lv 2, D.M. Zhou 1 and E.N. Zhang 1 1 Department of Oncology, the Yantaishan Hospital, Yantai,
More informationmir-187 inhibits the growth of cervical cancer cells by targeting FGF9
ONCOLOGY REPORTS 38: 1977-1984, 2017 mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 Hua Liang, Ruoyu Luo, Xiaoqi Chen, Yuzi Zhao and Aili Tan Department of Obstetrics and Gynecology,
More informationOverexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients
European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG
More informationOriginal Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
More informationResearch Communication
IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min
More informationReduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis
Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital
More informationMicroRNA-146b acts as a potential tumor suppressor in human prostate cancer
JBUON 2016; 21(2): 434-443 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE MicroRNA-146b acts as a potential tumor suppressor in human prostate
More informationCH Cho *, J Yu, WKK Wu 1,2
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Identification of pathogenic micrornas in Helicobacter pylori-associated gastric cancer using a combined approach of animal study and clinical sample
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationMiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma
MiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma Jun Zhang, Wengen Hou, Jinling Jia, Yilei Zhao and Bin Zhao Department of Orthopaedics, The First
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationOriginal Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma
Int J Clin Exp Pathol 2016;9(6):6506-6510 www.ijcep.com /ISSN:1936-2625/IJCEP0024531 Original Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma Zhihong
More informationRegulatory role of microrna184 in osteosarcoma cells
Regulatory role of microrna184 in osteosarcoma cells G.R. Yin 1,2, Q. Wang 3, X.B. Zhang 2 and S.J. Wang 1 1 Department of Joint Surgery, The Second Hospital of Shandong University, Jinan, China 2 Department
More informationOriginal Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer
Int J Clin Exp Pathol 2017;10(7):7596-7602 www.ijcep.com /ISSN:1936-2625/IJCEP0053748 Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer Wu-Ran
More informationMicroRNA-338-3p inhibits glucocorticoidinduced osteoclast formation through RANKL targeting
MicroRNA-338-3p inhibits glucocorticoidinduced osteoclast formation through RANKL targeting X.H. Zhang 1 *, G.L. Geng 2 *, B. Su 1, C.P. Liang 1, F. Wang 1 and J.C. Bao 3 1 Department of Physical Therapy,
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationONCOLOGY LETTERS 15: , 2018
10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN
More informationmir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN
mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN J.W. Ling 1, P.R. Lu 2, Y.B. Zhang 1, S. Jiang 1 and Z.C. Zhang 1 1 Department of Ophthalmology, Third Hospital of Zhangjiagang,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationmir-125a-5p expression is associated with the age of breast cancer patients
mir-125a-5p expression is associated with the age of breast cancer patients H. He 1 *, F. Xu 2 *, W. Huang 1, S.Y. Luo 1, Y.T. Lin 1, G.H. Zhang 1, Q. Du 1 and R.H. Duan 1 1 The State Key Laboratory of
More informationHigh Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10621 RESEARCH ARTICLE High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas Yao-Wu Wang 1, Chun-Li Yin 2, Hong-Yi Zhang
More informationLncRNA LET function as a tumor suppressor in breast cancer development
European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.
More informationSilencing Dicer expression enhances cellular proliferative and invasive capacities in human tongue squamous cell carcinoma
ONCOLOGY REPORTS 31: 867-873, 2014 Silencing Dicer expression enhances cellular proliferative and invasive capacities in human tongue squamous cell carcinoma SHUGUANG ZENG 1*, JING YANG 1*, JIANJIANG ZHAO
More informationEffects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells
Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and
More informationResearch on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism.
Biomedical Research 2017; 28 (14): 6350-6354 ISSN 0970-938X www.biomedres.info Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationA polymorphism site in the pre mir 34a coding region reduces mir 34a expression and promotes osteosarcoma cell proliferation and migration
2912 A polymorphism site in the pre mir 34a coding region reduces mir 34a expression and promotes osteosarcoma cell proliferation and migration HONGLIN LV 1, JINGFANG PEI 1, HONGTAO LIU 1, HAIYAN WANG
More informationLong noncoding RNA AFAP1 AS1 enhances cell proliferation and invasion in osteosarcoma through regulating mir p/TCF4 β catenin signaling
MOLECULAR MEDICINE REPORTS Long noncoding RNA AFAP1 AS1 enhances cell proliferation and invasion in osteosarcoma through regulating mir 4695 5p/TCF4 β catenin signaling RONGRUI LI 1*, SHICHEN LIU 2*, YAO
More informationLncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p
European Review for Medical and Pharmacological Sciences 2018; 22: 6838-6844 LncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p H.-X. CUI, M.-Y. ZHANG, K. LIU,
More informationLong Non-Coding RNA TUG1 Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and Upregulating SOX4 Expression
Original Article Yonsei Med J 2018 Mar;59(2):226-235 pissn: 0513-5796 eissn: 1976-2437 Long Non-Coding RNA Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and
More information