Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Size: px
Start display at page:

Download "Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T"

Transcription

1 Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h and apoptosis was analyzed by annexin V staining as described in Materials and Methods. All experiments have been repeated three times, data shown are mean values + SD (p<., *p<.). (B) Proteins were isolated from the indicated cells, western blots were done using indicated antibodies. Supplemental Figure Various prostate cancer cells were treated with the indicated doses of Docetaxel or Cisplatin for 4 hours and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit as described in Materials and Methods. All experiments have been repeated three times, data shown are mean values + SD. Supplemental Figure 3 (A) Proteins were isolated from the indicated cell lines, western blots were done using indicated antibodies. (B) WPE-NA cells were transfected with negative control or anti-mir-5, anti-mir-3 inhibitors. 4h after transfection, cells were treated with 4 nm Docetaxel for 4h. Apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. All experiments have been repeated three times, data shown are mean values + SD (*p<.5). Supplemental Figure 4 WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4 hours. Total RNA was isolated from the cells and real-time PCR analysis was performed as described in Materials and Methods. (A) WPE-NB6 cells. (B) WPE-NA cells. Data shown are mean values + SD from two independent experiments, (*p<.5, p<.). Supplemental Figure 5 (A) Empty vector transfected or Bcl-w stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. (B) Empty vector transfected or EF6 stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. (C) Negative control mirna or mir-5 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured

2 by annexin V staining. (D) Negative control mirna or mir-3 stable expressing WPE- NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. The experiments have been repeated three times, data shown are mean values + SD (p<., *p<.). Supplemental Figure 6 (A) Empty vector transfected or three independent clones of Bcl-w stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (B) Empty vector transfected or three independent clones of EF6 stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (C) Negative control mirna or three independent clones of mir-5 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (D) Negative control mirna or three independent clones of mir-3 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. The experiments have been repeated three times, data shown are mean values + SD (*p<.5, p<., *p<.).

3 Table mirnas that are differentially expressed between WPE-NA and WPE-NB6 cells mirna Ratio (WPE- NB6/WPE- NA) % of Increase (+) or Decrease (-) mir-7a mir-3a-5p mir mir mir mir mir mir-6a mir mir

4 RWPE- WPE- NB NB4 NB6 kd NA NB6 * Bcl-xL 3. Mcl XIAP 5. Bid 5. Bax Tubulin 59. Bhatnagar, et al. Supplemental Figure

5 Absorbance 45 nm RWPE- NB4 NB 4 Cisplatin (μg/ml) C. D. Absorbance 45 nm Rv Du45 PC-3 4 Cisplatin (μg/ml) Absorbance 45 nm RWPE- NB4 NB 4 Absorbance 45 nm Rv Du45 PC-3 4 Docetaxel (nm) Docetaxel (nm) Bhatnagar, et al. Supplemental Figure

6 Bcl-w EF6 Tubulin kd Absorbance 45 nm NC Inhi mir-5 Inhi mir-3 Inhi * * Control Docetaxel Bhatnagar, et al. Supplemental Figure 3

7 Relative mirna levels mir-3 mir-5 * Ctr Cisplatin Docetaxel Relative mirna levels mir-3 mir-5 Ctr Cisplatin Docetaxel Bhatnagar, et al. Supplemental Figure 4

8 5 4 3 Vec Bcl-w * Vec EF6 C. D mir NC mir-5 * mir NC mir-3 Ctr Cisplatin Docetaxel Ctr Cisplatin Docetaxel Bhatnagar, et al. Supplemental Figure 5

9 Absorbance 45 nm Vec Bcl-w. Bcl-w. Bcl-w.3 * * Absorbance 45 nm Vec EF6. EF6. EF6.3 * C. Absorbance 45 nm NC mir-5. mir-5. mir-5.3 D. Absorbance 45 nm NC mir-3. mir-3. mir-3.3 * * Bhatnagar, et al. Supplemental Figure 6

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Insight into cancer research from discovery to validation

Insight into cancer research from discovery to validation Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript. Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The

More information

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat synovial cells Zhen Li 1,2,3,4, Xiaofu Li 4, Yi Wang 4, Qingjun Wei 1,2,3,* 1 Orthopaedic Department, the First Affiliated Hospital of Guangxi

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1 Human Cell (2017) 30:290 299 DOI 10.1007/s13577-017-0170-1 RESEARCH ARTICLE MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033 AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

BCL-W has a fundamental role in B cell survival and lymphomagenesis.

BCL-W has a fundamental role in B cell survival and lymphomagenesis. Thomas Jefferson University Jefferson Digital Commons Department of Cancer Biology Faculty Papers Department of Cancer Biology 2-1-2017 BCL-W has a fundamental role in B cell survival and lymphomagenesis.

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

W81XWH The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

W81XWH The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer AD (Leave blank) Award Number : TITLE: W81XWH-08-1-0605 The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer PRINCIPAL INVESTIGATOR : Mohammad Saleem Bhat CONTRACTING ORGANIZATION:

More information

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer 1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

MiR-136 triggers apoptosis in human gastric cancer cells by targeting AEG-1 and BCL2

MiR-136 triggers apoptosis in human gastric cancer cells by targeting AEG-1 and BCL2 European Review for Medical and Pharmacological Sciences 2018; 22: 7251-7256 MiR-136 triggers apoptosis in human gastric cancer cells by targeting AEG-1 and BCL2 L. YU 1,2, G.-Q. ZHOU 2, D.-C. LI 1 1 Department

More information

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya

More information

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1. A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells

Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells Int J Clin Exp Pathol 2017;10(9):10127-10133 www.ijcep.com /ISSN:1936-2625/IJCEP0057301 Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells Zhi-Ping Cai,

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Supporting Information. Structure-based Lead Optimization and Biological Evaluation of BAX Direct Activators as Novel Potential Anticancer Agents

Supporting Information. Structure-based Lead Optimization and Biological Evaluation of BAX Direct Activators as Novel Potential Anticancer Agents Supporting Information Structure-based Lead Optimization and Biological Evaluation of BAX Direct Activators as Novel Potential Anticancer Agents Mariano Stornaiuolo, 1 * Giuseppe La Regina, 2 Sara Passacantilli,

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

The involvement of Bcl-2 family proteins in AKT-regulated cell survival in cisplatin resistant epithelial ovarian cancer

The involvement of Bcl-2 family proteins in AKT-regulated cell survival in cisplatin resistant epithelial ovarian cancer /, 2017, Vol. 8, (No. 1), pp: 1354-1368 The involvement of Bcl-2 family proteins in AKT-regulated cell survival in cisplatin resistant epithelial ovarian cancer Yan Dai 1, Shiguang Jin 2,3, Xueping Li

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

TITLE: Role of Merlin in the Growth and Transformation of Arachnoidal Cells

TITLE: Role of Merlin in the Growth and Transformation of Arachnoidal Cells AD Award Number: W81XWH-06-01-0221 TITLE: Role of Merlin in the Growth and Transformation of Arachnoidal Cells PRINCIPAL INVESTIGATOR: Anita Lal CONTRACTING ORGANIZATION: University of California San Francisco,

More information