Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
|
|
- Karin Ferguson
- 5 years ago
- Views:
Transcription
1 Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h and apoptosis was analyzed by annexin V staining as described in Materials and Methods. All experiments have been repeated three times, data shown are mean values + SD (p<., *p<.). (B) Proteins were isolated from the indicated cells, western blots were done using indicated antibodies. Supplemental Figure Various prostate cancer cells were treated with the indicated doses of Docetaxel or Cisplatin for 4 hours and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit as described in Materials and Methods. All experiments have been repeated three times, data shown are mean values + SD. Supplemental Figure 3 (A) Proteins were isolated from the indicated cell lines, western blots were done using indicated antibodies. (B) WPE-NA cells were transfected with negative control or anti-mir-5, anti-mir-3 inhibitors. 4h after transfection, cells were treated with 4 nm Docetaxel for 4h. Apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. All experiments have been repeated three times, data shown are mean values + SD (*p<.5). Supplemental Figure 4 WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4 hours. Total RNA was isolated from the cells and real-time PCR analysis was performed as described in Materials and Methods. (A) WPE-NB6 cells. (B) WPE-NA cells. Data shown are mean values + SD from two independent experiments, (*p<.5, p<.). Supplemental Figure 5 (A) Empty vector transfected or Bcl-w stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. (B) Empty vector transfected or EF6 stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. (C) Negative control mirna or mir-5 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured
2 by annexin V staining. (D) Negative control mirna or mir-3 stable expressing WPE- NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was measured by annexin V staining. The experiments have been repeated three times, data shown are mean values + SD (p<., *p<.). Supplemental Figure 6 (A) Empty vector transfected or three independent clones of Bcl-w stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (B) Empty vector transfected or three independent clones of EF6 stable expressing WPE-NA cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (C) Negative control mirna or three independent clones of mir-5 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. (D) Negative control mirna or three independent clones of mir-3 stable expressing WPE-NB6 cells were treated with 4 nm of Docetaxel or 4 μg/ml of Cisplatin for 4h, and apoptosis was analyzed using the Cell Death Detection Elisa PLUS kit. The experiments have been repeated three times, data shown are mean values + SD (*p<.5, p<., *p<.).
3 Table mirnas that are differentially expressed between WPE-NA and WPE-NB6 cells mirna Ratio (WPE- NB6/WPE- NA) % of Increase (+) or Decrease (-) mir-7a mir-3a-5p mir mir mir mir mir mir-6a mir mir
4 RWPE- WPE- NB NB4 NB6 kd NA NB6 * Bcl-xL 3. Mcl XIAP 5. Bid 5. Bax Tubulin 59. Bhatnagar, et al. Supplemental Figure
5 Absorbance 45 nm RWPE- NB4 NB 4 Cisplatin (μg/ml) C. D. Absorbance 45 nm Rv Du45 PC-3 4 Cisplatin (μg/ml) Absorbance 45 nm RWPE- NB4 NB 4 Absorbance 45 nm Rv Du45 PC-3 4 Docetaxel (nm) Docetaxel (nm) Bhatnagar, et al. Supplemental Figure
6 Bcl-w EF6 Tubulin kd Absorbance 45 nm NC Inhi mir-5 Inhi mir-3 Inhi * * Control Docetaxel Bhatnagar, et al. Supplemental Figure 3
7 Relative mirna levels mir-3 mir-5 * Ctr Cisplatin Docetaxel Relative mirna levels mir-3 mir-5 Ctr Cisplatin Docetaxel Bhatnagar, et al. Supplemental Figure 4
8 5 4 3 Vec Bcl-w * Vec EF6 C. D mir NC mir-5 * mir NC mir-3 Ctr Cisplatin Docetaxel Ctr Cisplatin Docetaxel Bhatnagar, et al. Supplemental Figure 5
9 Absorbance 45 nm Vec Bcl-w. Bcl-w. Bcl-w.3 * * Absorbance 45 nm Vec EF6. EF6. EF6.3 * C. Absorbance 45 nm NC mir-5. mir-5. mir-5.3 D. Absorbance 45 nm NC mir-3. mir-3. mir-3.3 * * Bhatnagar, et al. Supplemental Figure 6
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationResearch progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationInsight into cancer research from discovery to validation
Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationMechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells
Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat synovial cells Zhen Li 1,2,3,4, Xiaofu Li 4, Yi Wang 4, Qingjun Wei 1,2,3,* 1 Orthopaedic Department, the First Affiliated Hospital of Guangxi
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationMicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1
Human Cell (2017) 30:290 299 DOI 10.1007/s13577-017-0170-1 RESEARCH ARTICLE MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
More informationTitle: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients
Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationinjected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationFigure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationCONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033
AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationFig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.
Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
More informationCAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
More informationBCL-W has a fundamental role in B cell survival and lymphomagenesis.
Thomas Jefferson University Jefferson Digital Commons Department of Cancer Biology Faculty Papers Department of Cancer Biology 2-1-2017 BCL-W has a fundamental role in B cell survival and lymphomagenesis.
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationCAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationW81XWH The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
AD (Leave blank) Award Number : TITLE: W81XWH-08-1-0605 The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer PRINCIPAL INVESTIGATOR : Mohammad Saleem Bhat CONTRACTING ORGANIZATION:
More informationSUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationSupplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
More informationAn Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival
An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationMiR-136 triggers apoptosis in human gastric cancer cells by targeting AEG-1 and BCL2
European Review for Medical and Pharmacological Sciences 2018; 22: 7251-7256 MiR-136 triggers apoptosis in human gastric cancer cells by targeting AEG-1 and BCL2 L. YU 1,2, G.-Q. ZHOU 2, D.-C. LI 1 1 Department
More informationTitle page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
More information% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.
A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationThe pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas
Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationOriginal Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells
Int J Clin Exp Pathol 2017;10(9):10127-10133 www.ijcep.com /ISSN:1936-2625/IJCEP0057301 Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells Zhi-Ping Cai,
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationP. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationDOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
More informationSupporting Information. Structure-based Lead Optimization and Biological Evaluation of BAX Direct Activators as Novel Potential Anticancer Agents
Supporting Information Structure-based Lead Optimization and Biological Evaluation of BAX Direct Activators as Novel Potential Anticancer Agents Mariano Stornaiuolo, 1 * Giuseppe La Regina, 2 Sara Passacantilli,
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSupplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
More informationLong non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis
https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationThe involvement of Bcl-2 family proteins in AKT-regulated cell survival in cisplatin resistant epithelial ovarian cancer
/, 2017, Vol. 8, (No. 1), pp: 1354-1368 The involvement of Bcl-2 family proteins in AKT-regulated cell survival in cisplatin resistant epithelial ovarian cancer Yan Dai 1, Shiguang Jin 2,3, Xueping Li
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationTITLE: Role of Merlin in the Growth and Transformation of Arachnoidal Cells
AD Award Number: W81XWH-06-01-0221 TITLE: Role of Merlin in the Growth and Transformation of Arachnoidal Cells PRINCIPAL INVESTIGATOR: Anita Lal CONTRACTING ORGANIZATION: University of California San Francisco,
More information