Cellular Characteristics of an Asbestos (Chrysotile-B) Resistant Subline of an HTLV-1-Immortalized Human Polyclonal T Cell Line (MT-2)

Size: px
Start display at page:

Download "Cellular Characteristics of an Asbestos (Chrysotile-B) Resistant Subline of an HTLV-1-Immortalized Human Polyclonal T Cell Line (MT-2)"

Transcription

1 Table of Contents Cellular Characteristics of an Asbestos (Chrysotile-B) Resistant Subline of an HTLV-1-Immortalized Human Polyclonal T Cell Line (MT-2) PL-4-5 Takemi Otsuki Takemi Otsuki, Yoshie Miura, Akiko Takata-Tomokuni, Fuminori Hyodoh, Hironobu Katsuyama* Department of Hygiene, Department of Public Health*, Kawasaki Medical School, Japan Introduction There are two common subtypes of pneumoconiosis, silicosis and asbestosis. Patients with silicosis have been exposed to silica and their condition is often complicated by autoimmune disorders such as SLE or SSc (systemic scleroderma) 1-3. Asbestosis patients have been exposed to asbestos (silicates) in such forms as chrystotile and crocidolite, and may develop not only respiratory diseases but also malignant tumors, including lung cancers and malignant mesotheliomas 4-7. We have been focusing our investigations on the immunological abnormalities found in silicosis and have found abnormalities of various molecules in the Fas-mediated apoptotic pathway 8-14 and detected various unique autoantibodies These facts and our findings indicate that silica and silicates affect the human immune system and may cause dysregulation of autoimmunity and reduction of tumor immunity. To explore the immunological cellular and molecular effects of silicates, an HTLV-1 immortalized human polyclonal T cell line, MT-2 19, was employed. Appearance of Apoptosis Following Short and High Dose Exposure Before the long-term and low-dose exposure effects of chrysotile on MT-2 cells could be examined in an in vitro model of human asbestosis from the immunological viewpoint, it was necessary for us to clarify what occurs after short and relatively high-dose exposure to chrysotile in MT-2 cells. Therefore, MT-2 cells were cultured with or without 5 to 5 µg/ml of chrysotile-a (CA) for one to four days and cell growth, the appearance of apoptosis (TUNEL method), activation of caspases 3 and 9, the relative balance of Bcl2 and Bax proteins, the release of cytochrome-c to cytoplasma from mitochondria, activation of the p38 and JNK MAP kinases, which stimulate the apoptotic signal, and production of superoxide were analyzed. As shown in Fig.1, MT-2 cells cultured with CA exhibited growth inhibition (Fig. 1-A), and increases in apoptotic fractions (Fig. 1-B and C) in a dose dependent manner. The appearance of apoptosis was also confirmed by the detection of activated caspase 3 and caspase 9 (Fig 2), which are the typical indicators of activation of the mitochondrial apoptotic pathway. Thereafter, molecular modifications known to take place in the mitochondrial apoptotic pathway were examined by Western blotting. As shown in Fig. 3, cytochrome-c was released from mitochondria (Mi) to cytoplasma (Cy), the relative expression ratio of BAX/Bcl2 increased, and JNK and p38, both known as apoptosis-inducing MAK kinases, were phosphorylated in a dose-dependent manner in MT-2 cells cultured with, 1, and 25 mg/ml of CA.

2 A Cell number (x 1 3 /dish) Cell number B Culture days TUNEL-positive Conc. of Ch rysotile-a (µg/ml) 1 C Apoptotic Fraction (%) Fig. 1 [A] Growth curve of MT-2 cells cultured with various concentrations of chrysotile-a (CA). [B] TUNEL detection of apoptotic cells in MT-2 cells cultured with CA and increase of its fraction in a dose-dependent manner [C].

3 Cell number A B C Activated Caspase Activated Caspase 3 (%) Day 2 Day 3 Caspase 3 Caspase precursor cleaved precursor cleaved Fig. 2 [A] Activation of caspase 3 analyzed by flow cytometry. [B] Increase of activated caspase 3 fraction in dose and time-dependent manners when MT-2 cells were cultured with various concentrations of CA. [C] Activation of caspase 3 and 9 analyzed by Western blotting. Cleaved forms were observed in a dose-dependent manner.

4 1 2 A Cy Mi Cy Mi Cy Mi.5 Cytochrome C 1 25 Relative ratio of cytochrome C (Cy/Mi) B Relative ratio of BAX/Bcl2 Bcl-2 BAX 1 25 C 1 25 Relative ratio of Relative ratio of p-p38/p38 p-jnk/jnk JNK 2 pjnk 3.5 p p-p Fig. 3 Western blotting analysis of mitochondrial apoptotic pathway related molecules. When MT-2 cells were cultured with 25 µg/ml of CA, [A] cytochrome-c release to Cy (cytoplasma) from Mi (mitochondria), [B] increase of the Bax/Bcl2 balance, and [C] phosphorylation of apoptosis-stimulating MAP kinases such as JNK and p38 were observed.

5 A B Cell number O 2 - (hydroethidine) Positive for O 2 - (hydroethidine) (%) Fig. 4 Production of superoxide in MT-2 cells cultured with CA. [A] Production of superoxide was detected by flow cytometry and [B] The cell percentage of positive for O - 2 cells increased in a dose dependent manner.

6 Since cellular environmental stress or cytotoxic chemical substances induce activation of the mitochondrial apoptotic pathway to cause cell death, the role of ROS (reactive oxygen species) is considered a very important factor. Therefore, the production of superoxide was analyzed using flow cytometry As shown in Fig. 4, MT-2 cells cultured with, 1, 25, and 5 µg/ml of CA showed increased production of superoxide in a dose dependent manner. Together with data showing that anti-oxides significantly reduced CA-induced apoptosis in MT-2 cells, these results indicate that MT-2 cells undergo apoptosis via activation of the mitochondrial pathway when cells are exposed to chrysotile for a short time and in high doses. Establishment of an In Vitro T Cell Model For Long-Term and Low Dose Exposure to Asbestos As mentioned above, MT-2 cells proceeded to apoptosis when cultured with 25 to 5 µg/ml of chrysotile for a few days. We considered that if MT-2 cells were continuously exposed to relatively low doses (i.e., 5 or 1 µg/ml) of chrysotile for months to years, these cells might acquire resistance to chrysotileinduced apoptosis. Although the initial cultures of MT-2 cells with 5 or 1 µg/ml of chrysotile-b (CB) only permitted us to change the whole medium and to keep total cell number in their culture dishes, several months later, they gradually started to grow even with low doses of CB. Eight months after starting with low-dose continuous exposure, the exposed subline (MT-2Rst) showed a decrease in the appearance of TUNEL positive fractions when cultured with high doses (25 to 5 µg/ml) of CB when compared with the original MT-2 cells (MT-2Org). In addition, the growth of MT- 2Rst cultured with high doses of CB was not reduced when assayed by WST-1 (Fig. 5A and B). These results indicated that more than eight months exposure to CB induced resistance to chrysotile-induced apoptosis in MT-2 cells. The cellular and molecular biological differences between MT-2Org and MT-2Rst should be analyzed to try to determine the mechanisms involved in the silicate/silica induced dysregulation/reduction of the human immune system. As a first step, cdna microarray analysis was employed to find gene expression differences between these two lines. In Tables 1 and 2, the up- and down-regulated genes are respectively listed in the order of their relative expression ratio (MT-2Org/MT-2Rst) in the gene. Among these genes, there are several genes of interest, such as the chloride channel 5 gene (clcn5), one of the chemokines (scya8), and one of the virus receptors (cxadr) in the upregulated group, and one of the chemokines (scyb13) and the receptor type protein tyrosine phosphatase (ptprn2; this is also an autoantibody found in type I DM patients) in the downregulated group.

7 A Proliferation ratio (% of control) detected by WST-1 assay Concentration of Chrysotile-B (µg/ml) Original Resistant MT-2 cells subline cells B Resistant subline cells (1) Original MT-2 cells TdT(-) control µg/ml Fig. 5 MT-2, showed dose-dependent growth inhibition [A, left] and a dose-dependent increase in TUNEL-positive apoptotic cells [B, upper panel], when cultured with various concentrations of Chrysotile-B (CB) for two days. Ho wever, after continuous exposure to 1 µg/ml of CB for eight months, a CB-resistant subline, which showed no CB-induced growth inhibition [A, right] and the appearance of an apoptotic fraction [B, lower panel], were observed.

8 Table 1 The list of up-regulated genes in the MT-2-Rst line compared with the MT-2-Org line analyzed by cdna microarray Name of genes Ratio: Original/Resistant subline poly(a) polymerase gamma; papolg.91 chloride channel 5; clcn5.124 tolloid-like 2; tll2.162 coxsackie virus and adenovirus receptor; cxadr.179 epoxide hydrolase 1, microsomal (xenobiotic); ephx1.22 small inducible cytokine subfamily a (cys-cys), member 8 (monocyte chemotactic protein 2); scya8.22 chromobox homolog 8; cbx8.28 similar to non-functional folate binding protein loc ebv-induced g protein-coupled receptor 2; ebi2.31 doublecortex; lissencephaly, x-linked (doublecortin); dcx.35 chromosome 2 open reading frame 1; c2orf1.358 nhp2 non-histone chromosome protein 2-like 1 (s. cerevisiae); nhp2l1.378 potassium voltage-gated channel, shaw-related subfamily, member 1; kcnc1.391 mad, mothers against decapentaplegic homolog 3 (drosophila); madh3.412 chromosome 8 open reading frame 1; c8orf1.414 pro2353 predicted protein of hq

9 Name of gene Table 2 The list of downregulated genes in the MT-2-Rst line compared with the MT-2-Org line analyzed by cdna microarray Ratio:Original/Resistant subline small inducible cytokine b subfamily (cys-x-cys motif), member 13 (b-cell chemoattractant); scyb protein tyrosine phosphatase, receptor type, n polypeptide 2; ptprn eukaryotic translation initiation factor 4a, isoform 1; eif4a cgi-143 protein; loc nadh dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (17kd, b17); ndufb ubiquitin-conjugating enzyme e2n (homologous to yeast ubc13); ube2n hypothetical protein xp_5115; loc karyopherin (importin) beta 3; kpnb chaperonin containing tcp1, subunit 4 (delta); cct proteasome (prosome, macropain) subunit, alpha type, 1; psma non-metastatic cells 1 protein; nme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mrna, complete cds; glyceraldehyde-3 phosphate dehydrogenase (EC ) tata box-binding protein-associated factor 2f; taf pituitary tumor-transforming protein 1; pttg h2a histone family, member z; h2afz 2.81 testican 3; hsaj cofilin 1 (non-muscle); cfl ran binding protein 1; ranbp splicing factor, arginine/serine-rich (transformer 2 drosophila homolog) 1; sfrs signal recognition particle 14kd (homologous alu rna binding protein); srp tryptophanyl-trna synthetase; wars fumarate hydratase; fh 2.65 methionyl aminopeptidase 2; metap hypothetical protein flj1156; flj trp-related cation influx channel; trpm transcription elongation factor a (sii), 1; tcea

10 A few more resistant sublines should be established to detect common alterations in gene expression profiles and to investigate the biological roles of the detected genes. In addition, proteomics and transcriptome analyses may lead to the discovery of important molecules involved in the mechanisms of asbestos-induced immune dysfunction. Conclusion A human polyclonal T cell line, MT-2, was sensitive to asbestos-induced apoptosis, and there was significant involvement of the ROS system in the appearance of apoptosis, as has been noted in other reports which confirmed the role of ROS in asbestos-induced cell death in alveolar and mesothelial cells In addition, cellular and molecular biological comparison of MT-2Org and MT-2Rst should provide us with clues to the mechanisms involved in the occurrence of the immune dysregulation found in asbestosis or silicosis patients. Acknowledgement The authors thank Ms Haruko Sakaguchi, Tamayo Hatayama and Satomi Hatada for their skilful technical assistance. This study was supported by a JSPS KAKENHI Grant ( ) and Kawasaki Medical School Project Grants (16-41M and S). References 1. Stratta P, Canavese C, Messuerotti A, Fenoglio I, Fubini B. Silica and renal diseases: no longer a problem in the 21st century? J Nephrol 21;14: Shanklin DR, Smalley DL. The immunopathology of siliconosis. History, clinical presentation, and relation to silicosis and the chemistry of silicon and silicone. Immunol Res 1998;18: Uber CL, McReynolds RA. Immunotoxicology of silica. Crit Rev Toxicol 1982;1: Cugell DW, Kamp DW. Asbestos and the pleura: a review. Chest 24; 125: Boffetta P, Nyberg F. Contribution of environmental factors to cancer risk. Br Med Bull 23;68: Gottschall EB. Occupational and environmental thoracic malignancies. J Thorac Imaging 22;17: Tweedale G. Asbestos and its lethal legacy. Nat Rev Cancer 22;2: Tomokuni A, Aikoh T, Matsuki T, Isozaki Y, Otsuki T, Kita S, Ueki H, Kusaka M, Kishimoto T, Ueki A. Elevated soluble Fas/APO-1 (CD95) levels in silicosis patients without clinical symptoms of autoimmune diseases or malignant tumours. Clin Exp Immunol 1997;11: Otsuki T, Sakaguchi H, Tomokuni A, Aikoh T, Matsuki T, Kawakami Y, Kusaka M, Ueki H, Kita S, Ueki A. Soluble Fas mrna is dominantly expressed in cases with silicosis. Immunol. 1998;94: Otsuki T, Ichihara K, Tomokuni A, Sakaguchi H, Aikoh T, Matsuki T, Isozaki Y, Hyodoh F, Kusaka M, Kita S, Ueki A. Evaluation of cases with silicosis using the parameters related to Fas-mediated apoptosis. Int J Mol Med 1999;4: Tomokuni A, Otsuki T, Isozaki Y, Kita S, Ueki H, Kusaka M, Kishimoto T, Ueki A. Serum levels of soluble Fas ligand in patients with silicosis. Clin Exp Immunol 1999;118: Ma Z, Otsuki T, Tomokuni A, Aikoh T, Matsuki T, Sakaguchi H, Isozaki Y, Hyodoh F, Uehira K, Isoda K, Ueki A. Man-made mineral fibers induce apoptosis of human peripheral blood mononuclear cells similarly to chrysotile B. Int J Mol Med 1999;4: Otsuki T, Sakaguchi H, Tomokuni A, Aikoh T, Matsuki T, Isozaki Y, Hyodoh F, Kawakami Y, Kusaka M, Kita S, Ueki A. Detection of alternatively spliced variant messages of Fas gene and mutational screening of Fas and Fas ligand coding regions in peripheral blood mononuclear cells derived from silicosis patients. Immunol Lett 2;72: Otsuki T, Tomokuni A, Sakaguchi H, Aikoh T, Matsuki T, Isozaki Y, Hyodoh F, Ueki H, Kusaka M, Kita S, Ueki A. Over-expression of the decoy receptor 3 (DcR3) gene in peripheral blood mononuclear cells (PBMC) derived from silicosis patients. Clin Exp Immunol 2;119:323-7.

11 15. Ueki A, Isozaki Y, Tomokuni A, Ueki H, Kusaka M, Tanaka S, Otsuki T, Sakaguchi H, Hyodoh F. Different distribution of HLA class II alleles in anti-topoisomerase I autoantibody responders between silicosis and systemic sclerosis patients, with a common distinct amino acid sequence in the HLA-DQB1 domain. Immunobiol 21;24: Ueki A, Isozaki Y, Tomokuni A, Tanaka S, Otsuki T, Kishimoto T, Kusaka M, Aikoh T, Sakaguchi H, Hydoh F. Autoantibodies detectable in the sera of silicosis patients. The relationship between the anti-topoisomerase I antibody response and HLA-DQB1*42 allele in Japanese silicosis patients. Sci Total Environ 21;27: Ueki A, Isozaki Y, Tomokuni A, Otsuki T, Hydoh F, Sakaguchi H, Tanaka S, Kusaka M. Is the antitopoisomerase I autoantibody response associated with a distinct amino acid sequence in the HLA-DQbeta1 domain? Arthritis Rheum 21;44: Ueki A, Isozaki Y, Tomokuni A, Hatayama T, Ueki H, Kusaka M, Shiwa M, Arikuni H, Takeshita T, Morimoto K. Intramolecular epitope spreading among anti-caspase-8 autoantibodies in patients with silicosis, systemic sclerosis and systemic lupus erythematosus, as well as in healthy individuals. Clin Exp Immunol. 22;129: Miyoshi I, Kubonishi I, Yoshimoto S, Akagi T, Ohtsuki Y, Shiraishi Y, Nagata K, Hinuma Y. Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukaemic T cells. Nature 1981;294: Kamp DW, Panduri V, Weitzman SA, Chandel N. Asbestos-induced alveolar epithelial cell apoptosis: role of mitochondrial dysfunction caused by iron-derived free radicals. Mol Cell Biochem 22; : Apostolou S, Klein JO, Mitsuuchi Y. Shetler JN, Poulikakos PI, Jhanwar SC, Kruger WD, Testa JR. Growth inhibition and induction of apoptosis in mesothelioma cells by selenium and dependence on selenoprotein SEP15 genotype. Oncogene 24; 23: Burmeister B, Schwerdtle T, Poser I, Hoffmann E, Hartwig A, Muller WU, Rettenmeier AW, Seemayer NH et al. Effects of asbestos on initiation of DNA damage, induction of DNA-strand breaks, P53-expression and apoptosis in primary, SV4-transformed and malignant human mesothelial cells. Mutat Res 24; 558: Shukla A, Jung M, Stern M, Fukagawa NK, Taatjes DJ, Sawyer D, Van Houten B, Mossman BT. Asbestos induces mitochondrial DNA damage and dysfunction linked to the development of apoptosis. Am J Physiol Lung Cell Mol Physiol 23; 285:L Panduri V, Weitzman SA, Chandel NS, Kamp DW. Mitochondrial-derived free radicals mediate asbestosinduced alveolar epithelial cell apoptosis. Am J Physiol Lung Cell Mol Physiol 24; 286:L Ramos-Nino ME, Haegens A, Shukla A, Mossman BT. Role of mitogen-activated protein kinases (MAPK) in cell injury and proliferation by environmental particulates. Mol Cell Biochem 22; : Marczynski B, Kraus T, Rozynek P, Schlosser S, Raithel HJ, Baur X. Changes in low molecular weight DNA fragmentation in white blood cells of workers highly exposed to asbestos. Int Arch Occup Environ Health 21; 74: Next

Cytokine alteration and speculated immunological pathophysiology in silicosis and asbestos-related diseases

Cytokine alteration and speculated immunological pathophysiology in silicosis and asbestos-related diseases Environ Health Prev Med (2009) 14:216 222 DOI 10.1007/s12199-008-0063-8 SPECIAL FEATURE Biological effects of fibrous and particulate substances and related areas Cytokine alteration and speculated immunological

More information

Silica exposure and altered regulation of autoimmunity

Silica exposure and altered regulation of autoimmunity Environ Health Prev Med (2014) 19:322 329 DOI 10.1007/s12199-014-0403-9 REVIEW Silica exposure and altered regulation of autoimmunity Suni Lee Hidenori Matsuzaki Naoko Kumagai-Takei Kei Yoshitome Megumi

More information

Disclosures. Pathogenesis of Autoimmunity Normal immune response: 11/5/2011. Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis

Disclosures. Pathogenesis of Autoimmunity Normal immune response: 11/5/2011. Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis Disclosures N. Olsen and T. Aune are co-founders of ArthroChip LLC. Nancy J. Olsen Penn State MS Hershey Medical Center Thomas M. Aune Vanderbilt

More information

Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles

Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles J Occup Health 2005; 47: 61 67 Journal of Occupational Health Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles Ayako UEKI 1, Yumika ISOZAKI

More information

Is soluble CD40 ligand an indicator of immunopathological disturbance in silicosis patients?

Is soluble CD40 ligand an indicator of immunopathological disturbance in silicosis patients? Kawasaki Medical Journal 35(2):129-138,2009 129 Is soluble CD40 ligand an indicator of immunopathological disturbance in silicosis patients? Hiroaki HAYASHI 1, 2), Yasumitsu NISHIMURA 1), Megumi MAEDA

More information

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?

More information

Mechanistic Toxicology

Mechanistic Toxicology SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi

More information

Clinical Laboratory. 14:41:00 Complement Component 3 50 mg/dl Oct-18

Clinical Laboratory. 14:41:00 Complement Component 3 50 mg/dl Oct-18 Clinical Laboratory Procedure Result Units Ref Interval Accession Collected Received Thyroid Peroxidase (TPO) Antibody 5.0 IU/mL [0.0-9.0] 18-289-900139 16-Oct-18 Complement Component 3 50 mg/dl 18-289-900139

More information

Basis and Clinical Applications of Interferon

Basis and Clinical Applications of Interferon Interferon Therapy Basis and Clinical Applications of Interferon JMAJ 47(1): 7 12, 2004 Jiro IMANISHI Professor, Kyoto Prefectural University of Medicine Abstract: Interferon (IFN) is an antiviral substance

More information

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

More information

Clinical Laboratory. 14:42:00 SSA-52 (Ro52) (ENA) Antibody, IgG 1 AU/mL [0-40] Oct-18

Clinical Laboratory. 14:42:00 SSA-52 (Ro52) (ENA) Antibody, IgG 1 AU/mL [0-40] Oct-18 Clinical Laboratory Procedure Result Units Ref Interval Accession Collected Received Rheumatoid Factor

More information

Clinical Laboratory. [None

Clinical Laboratory. [None Clinical Laboratory Procedure Result Units Ref Interval Accession Collected Received Double-Stranded DNA (dsdna) Ab IgG ELISA Detected * [None 18-289-900151 Detected] Double-Stranded DNA (dsdna) Ab IgG

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

Electron Transport Chain and Oxidative phosphorylation

Electron Transport Chain and Oxidative phosphorylation Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Chronic exposure to asbestos enhances TGF-β1 production in the human adult T cell leukemia virus-immortalized T cell line MT-2

Chronic exposure to asbestos enhances TGF-β1 production in the human adult T cell leukemia virus-immortalized T cell line MT-2 2522 Chronic exposure to asbestos enhances TGF-β1 production in the human adult T cell leukemia virus-immortalized T cell line MT-2 MEGUMI MAEDA 1,2, YING CHEN 2,4, HIROAKI HAYASHI 2,3, NAOKO KUMAGAI-TaKEI

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Expression of Fas antigen and Fas ligand in bronchoalveolar lavage from silicosis patients

Expression of Fas antigen and Fas ligand in bronchoalveolar lavage from silicosis patients Research Communication Mediators of Inflammation, 12(4), 209/214 (August 2003) OBJECTIVE: To understand the role of apoptosis through Fas/Fas ligand (FasL) interaction in the pathogenesis of silicosis,

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

Induction of IL-17 production from human peripheral blood CD4 + cells by asbestos exposure

Induction of IL-17 production from human peripheral blood CD4 + cells by asbestos exposure 2024 Induction of IL-17 production from human peripheral blood CD4 + cells by asbestos exposure Megumi Maeda 1,2, Ying Chen 2,3, Suni Lee 2, Naoko Kumagai-Takei 2, Kei Yoshitome 2, Hidenori Matsuzaki 2,

More information

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is ' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various

More information

This student paper was written as an assignment in the graduate course

This student paper was written as an assignment in the graduate course 77:222 Spring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2001) offered

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. Mechanisms of Immune Tolerance ACTIVATION (immunity) SUPPRESSION (tolerance)

More information

Mechanisms of Immune Tolerance

Mechanisms of Immune Tolerance Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. ACTIVATION (immunity) SUPPRESSION (tolerance) Autoimmunity Immunodeficiency

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Under the Radar Screen: How Bugs Trick Our Immune Defenses

Under the Radar Screen: How Bugs Trick Our Immune Defenses Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 8: Apoptosis Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research Myxoma virus Poxvirus Infects rabbits

More information

Review Article Functional Alteration of Natural Killer Cells and Cytotoxic T Lymphocytes upon Asbestos Exposure and in Malignant Mesothelioma Patients

Review Article Functional Alteration of Natural Killer Cells and Cytotoxic T Lymphocytes upon Asbestos Exposure and in Malignant Mesothelioma Patients BioMed Research International Volume 2015, Article ID 238431, 9 pages http://dx.doi.org/10.1155/2015/238431 Review Article Functional Alteration of Natural Killer Cells and Cytotoxic T Lymphocytes upon

More information

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

More information

Polyomaviridae. Spring

Polyomaviridae. Spring Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm

More information

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The

More information

Chapter 9. Cellular Signaling

Chapter 9. Cellular Signaling Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1

More information

Muse Assays for Cell Analysis

Muse Assays for Cell Analysis Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase

More information

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond

More information

RNA Processing in Eukaryotes *

RNA Processing in Eukaryotes * OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

Understanding the mechanisms of asbestos related diseases

Understanding the mechanisms of asbestos related diseases University of Hawai i Cancer Center Understanding the mechanisms of asbestos related diseases Haining Yang, PhD Professor University of Hawai i Cancer Center Marker of exposure: Bilateral pleural plaques

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled

1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions

More information

The Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016

The Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016 The Genetic Epidemiology of Rheumatoid Arthritis Lindsey A. Criswell AURA meeting, 2016 Overview Recent successes in gene identification genome wide association studies (GWAS) clues to etiologic pathways

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases 54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of

More information

Apoptosis Oncogenes. Srbová Martina

Apoptosis Oncogenes. Srbová Martina Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #: For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)

More information

NFκB What is it and What s the deal with radicals?

NFκB What is it and What s the deal with radicals? The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117

More information

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain

More information

The c-jun N-terminal kinase signaling pathway mediates chrysotile asbestos-induced alveolar epithelial cell apoptosis

The c-jun N-terminal kinase signaling pathway mediates chrysotile asbestos-induced alveolar epithelial cell apoptosis 3626 The c-jun N-terminal kinase signaling pathway mediates chrysotile asbestos-induced alveolar epithelial cell apoptosis PENG LI 1*, TIE LIU 2*, DAVID W. KAMP 3, ZIYING LIN 1, YAHONG WANG 1, DONGHONG

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,

More information

Problem Set 8 Key 1 of 8

Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Altered functions of alveolar macrophages and NK cells involved in asbestos-related diseases

Altered functions of alveolar macrophages and NK cells involved in asbestos-related diseases Environ Health Prev Med (2013) 18:198 204 DOI 10.1007/s12199-013-0333-y REVIEW Altered functions of alveolar macrophages and NK cells involved in asbestos-related diseases Yasumitsu Nishimura Megumi Maeda

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage?

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? Questions about cancer What is cancer? Cancer Gil McVean, Department of Statistics, Oxford What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? What are the steps in

More information

Post-translational modifications of proteins in gene regulation under hypoxic conditions

Post-translational modifications of proteins in gene regulation under hypoxic conditions 203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and

More information

Introduction to Cancer Biology

Introduction to Cancer Biology Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.

More information

Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.

Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published

More information

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia

More information

Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Prokaryotes and eukaryotes alter gene expression in response to their changing environment Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

More information

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points. BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which

More information

Environmental factors including drugs. Jyoti Ranjan Parida

Environmental factors including drugs. Jyoti Ranjan Parida Environmental factors including drugs Jyoti Ranjan Parida Scheme of presentation Pathogenesis of autoimmune disease Evidence for environmental influence Environmental factors Proposed -Role of Sunlight

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000). Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18 Introduction to pathology lecture 5/ Cell injury apoptosis Dr H Awad 2017/18 Apoptosis = programmed cell death = cell suicide= individual cell death Apoptosis cell death induced by a tightly regulated

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Autoantibodies in the Idiopathic Inflammatory Myopathies

Autoantibodies in the Idiopathic Inflammatory Myopathies Autoantibodies in the Idiopathic Inflammatory Myopathies Steven R. Ytterberg, M.D. Division of Rheumatology Mayo Clinic Rochester, MN The Myositis Association Annual Conference St. Louis, MO Sept. 25,

More information

Oncolytic virus strategy

Oncolytic virus strategy Oncolytic viruses Oncolytic virus strategy normal tumor NO replication replication survival lysis Oncolytic virus strategy Mechanisms of tumor selectivity of several, some of them naturally, oncolytic

More information

shehab Moh Tarek ... ManarHajeer

shehab Moh Tarek ... ManarHajeer 3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic

More information

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset

More information

Andrea s SI Session PCB Practice Test Test 3

Andrea s SI Session PCB Practice Test Test 3 Practice Test Test 3 READ BEFORE STARTING PRACTICE TEST: Remember to please use this practice test as a tool to measure your knowledge, and DO NOT use it as your only tool to study for the test, since

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES 1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.

More information

BIRKBECK COLLEGE (University of London)

BIRKBECK COLLEGE (University of London) BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

CONTENTS. Preface... xii

CONTENTS. Preface... xii CONTENTS Preface... xii 1. Autocrine Transformation: Cytokine Model... 1 James A. McCubrey, Xiao-Yang Wang, Paul A. Algate, William L. Blalock and Linda S. Steelman Abstract... 1 Cytokine Regulation of

More information

Many properties of minerals are important in their toxicity and carcinogenicity. For example, over a

Many properties of minerals are important in their toxicity and carcinogenicity. For example, over a Summary of JIFSAN meeting presentation Importance of Mineral Type, Form and Dimensions in Carcinogenic Responses Brooke T. Mossman, Department of Pathology and Laboratory Medicine, University of Vermont

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

APRIL is increased in serum of patients with brain glioblastoma multiforme

APRIL is increased in serum of patients with brain glioblastoma multiforme 276 Eur. Cytokine Netw., Vol. 17 n 4, December 06, 276-80 APRIL is increased in serum of patients with brain glioblastoma multiforme Joanna Iłżecka 1, Marek Iłżecki 2 1 Department of Neurology, Medical

More information

Antibodies for Unfolded Protein Response

Antibodies for Unfolded Protein Response Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)

More information

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Supplementary Figure 1. Comparison of RNP IC-mediated NET formation. Quantification of DNA release induced by ICs consisting of SmRNP combined with SLE IgG 961 (n = 10), 1032

More information

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

More information

Apoptosis in chronic hepatitis C

Apoptosis in chronic hepatitis C Apoptosis in chronic hepatitis C Dr med. Anna Parfieniuk-Kowerda Department of Infectious Diseases and Hepatology Medical University of Bialystok Poland APOPTOSIS Apoptosis - type I programmed cell death

More information

p53 and Apoptosis: Master Guardian and Executioner Part 2

p53 and Apoptosis: Master Guardian and Executioner Part 2 p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy

More information

Immune Regulation and Tolerance

Immune Regulation and Tolerance Immune Regulation and Tolerance Immunoregulation: A balance between activation and suppression of effector cells to achieve an efficient immune response without damaging the host. Activation (immunity)

More information

Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series

Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series Cutaneous Immunology: Innate Immune Responses Skin Biology Lecture Series The Immune Response: Innate and Adaptive Components Source: Wolff, Goldsmith, Katz, Gilchrest, Paller, Leffell. Fitzpatrick s Dermatology

More information

The discovery of Bcl-2

The discovery of Bcl-2 The discovery of Bcl-2 Bcl-2: B-cell lymphoma 2 The pro-survival subfamily of Bcl-2 protein family Cloning of Bcl-2 as the oncogene which is deregulated at t(14;18) lymphomas Pioneer works by Tsujimoto

More information

NBCE Mock Board Questions Biochemistry

NBCE Mock Board Questions Biochemistry 1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation

More information