Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

VSL#3 sachets were refrigerated (4 C) and treatments were prepared daily using new sachets.

Supplementary Materials and Methods VSL#3 administration VSL#3 sachets were refrigerated (4 C) and treatments were prepared daily using new sachets. Rats were placed into individual cages daily between

Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.

Table S1 Differentially expressed genes showing > 2 fold changes and p

Biomarkers for Hypothesis Testing

Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

Post-translational modifications of proteins in gene regulation under hypoxic conditions

203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and

Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1 Supplementary Figure Legends Figure S1. Determination of SIRT1 K

Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.

Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary

COGNITIVE SCIENCE 107A

COGNITIVE SCIENCE 107A Neurotransmitters Jaime A. Pineda, Ph.D. Exocytosis ~20 Amino Acids Used for Protein Synthesis Non-essential (Our bodies can make them) Alanine (A) Arginine (R) Asparagine (N) Aspartate

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct

Genetic Contributors to Alcohol Use and Misuse in Young People

Genetic Contributors to Alcohol Use and Misuse in Young People Marianne BM van den Bree Professor of Psychological Medicine Institute of Psychological Medicine and Clinical Neurosciences MRC Centre for

Functional Cell-Based Assays

2017 Page 1/8 Axxam S.p.A. (Italy) offers functional cell-based assays for protein targets of relevance to drug discovery research, including challenging targets such as multi subunit ion channels and

Karam Darwish. Saleh Fayez AL-jbour. Diala

1 Karam Darwish Saleh Fayez AL-jbour Diala Neurotransmitters Note: anything written with the italic font and present between brackets is from the slides. A neurotransmitter is a chemical substance that

Cornstarch

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

AVAILABLE BIOMARKER ASSAYS

AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

Principles of Genetics and Molecular Biology

Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

Advanced Neurotransmitters & Neuroglia

Advanced Neurotransmitters & Neuroglia Otsuka Pharmaceutical Development & Commercialization, Inc. 2017 Otsuka Pharmaceutical Development & Commercialization, Inc., Rockville, MD Lundbeck, LLC. February

Mitochondria and ATP Synthesis

Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy

Supporting Information

Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng

Neurobiology of Addiction

Neurobiology of Addiction Domenic A. Ciraulo, MD Director of Alcohol Pharmacotherapy Research Center for Addiction Medicine Department of Psychiatry Massachusetts General Hospital Disclosure Neither I

PETER L. LUTZ. Red-eared slider Trachemys scripta elegans

www.carleton.ca/~kbstorey PETER L. LUTZ Red-eared slider Trachemys scripta elegans Lutz PL, Storey KB. 1997. Handbook of Physiology (Dantzler WH, ed) Oxford Univ. Press, Vol. 2, pp. 1479-1522. 1 Relative

Cell Signaling part 2

15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

Mechanistic Toxicology

SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi

Oxidation and Methylation in Human Brain: Implications for vaccines

Oxidation and Methylation in Human Brain: Implications for vaccines 1 Life can be viewed through the perspective of oxidation and reduction, which involves the loss and gain of electrons, respectively.

NBCE Mock Board Questions Biochemistry

1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

Cognitive and Behavioral Phenotypes: SNPs of Interest

Cognitive and Behavioral Phenotypes: SNPs of Interest Chr Apolipoprotein E (APOE) 19 Trait Associated with the Alzheimer s Disease, Cognitive Function SNP Position 1,2,5,6,7, 11,20,23, 24,30,34,35 coded_a

Protein carbonylation: a marker of oxidative stress damage

Protein carbonylation: a marker of oxidative stress damage ITN-TREATMENT Metabolic Dysfunctions associated with Pharmacological Treatment of Schizophrenia TREATMENT Protein carbonyl formation: Metal-Catalyzed

Proteasomes. When Death Comes a Knock n. Warren Gallagher Chem412, Spring 2001

Proteasomes When Death Comes a Knock n Warren Gallagher Chem412, Spring 2001 I. Introduction Introduction The central dogma Genetic information is used to make proteins. DNA RNA Proteins Proteins are the

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):

Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron

Neurotransmitter Systems III Neurochemistry. Reading: BCP Chapter 6

Neurotransmitter Systems III Neurochemistry Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER

PETER PAZMANY CATHOLIC UNIVERSITY SEMMELWEIS UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAZMANY

Biochemistry of neurotransmitters. Dr. Mamoun Ahram Neuroscience 2015

Biochemistry of neurotransmitters Dr. Mamoun Ahram Neuroscience 2015 References This lecture Mark s Basic Medical Biochemistry, 4 th ed, pp. 908-918 http://what-whenhow.com/neuroscience/neurotransmitters-theneuron-part-1/

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

NEUROBIOLOGY ALCOHOLISM

NEUROBIOLOGY ALCOHOLISM THERE HAS BEEN A MAJOR THEORETICAL SHIFT IN MEDICATION DEVELOPMENT IN ALCOHOLISM Driven by animal models of intermittent ethanol administration followed by termination, then access

Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease

Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Paul Sutton CR(UK) Clinical Research Training Fellow Chester Colorectal Research Disclosures Holder of CR(UK)

Characterisation of neurons derived from a cortical human neural stem cell. line CTX0E16

Characterisation of neurons derived from a cortical human neural stem cell line CTX0E16 Greg W. Anderson 1 *, P. J. Michael Deans 1 *, Ruth D. T. Taylor 2, Ding Chen 1, Pooja Raval 1, Harrison Lowder 1,

Maturity-onset diabetes of the young (MODY) is a heterogeneous group

Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the

Review of Neurochemistry

Review of Neurochemistry UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY PBL MBBS YEAR III SEMINAR VJ Temple 1 CEREBRAL METABOLISM What are some

Citric acid cycle and respiratory chain. Pavla Balínová

Citric acid cycle and respiratory chain Pavla Balínová Mitochondria Structure of mitochondria: Outer membrane Inner membrane (folded) Matrix space (mtdna, ribosomes, enzymes of CAC, β-oxidation of FA,

Chapter 9. Cellular Signaling

Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The

number Done by Corrected by Doctor Nayef Karadsheh

number 11 Done by حسام أبو عوض Corrected by Moayyad Al-Shafei Doctor Nayef Karadsheh 1 P a g e General Regulatory Aspects in Metabolism: We can divide all pathways in metabolism to catabolicand anabolic.

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B

Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein

MITOCHONDRIA LECTURES OVERVIEW

1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

Neuropharmacology NOTES

Neuropharmacology NOTES Contents Topic Page # Lecture 1- Intro to Neurochemical Transmission & Neuromodulation 2 Lecture 2- Serotonin & Noradrenaline 7 Lecture 3- Acetylcholine & Dopamine 14 Lecture 4-

1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled

Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions

Supplementary Figure 1

Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

Signal Transduction Cascades

Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,

Electron Transport Chain and Oxidative phosphorylation

Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly

Biologic Oxidation BIOMEDICAL IMPORTAN

Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron

Coenzymes, vitamins and trace elements 209. Petr Tůma Eva Samcová

Coenzymes, vitamins and trace elements 209 Petr Tůma Eva Samcová History and nomenclature of enzymes 1810, Gay-Lussac made an experiment with yeats alter saccharide to ethanol and CO 2 Fermentation From

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity

Supplemental Table 1 Age and gender-specific cut-points used for MHO.

Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123

Scantron Instructions

BIOLOGY 1A MIDTERM # 1 February 17 th, 2012 NAME SECTION # DISCUSSION GSI 1. Sit every other seat and sit by section number. Place all books and paper on the floor. Turn off all phones, pagers, etc. and

Synapses and Neurotransmitters.

Synapses and Neurotransmitters Loai.physiology@yahoo.com Communication Between Neurons Synapse: A specialized site of contact, and transmission of information between a neuron and an effector cell Anterior

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

Fatty acids synthesis

Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

Cellular Neurobiology / BIPN 140

SECOND MIDTERM EXAMINATION Fall, 2015 GENERAL INSTRUCTIONS 1. Please write your name on ALL 6 pages. 2. Please answer each question IN THE SPACE ALLOTTED. 1) /10 pts 2) /10 pts 3) /15 pts 4) /15 pts 5)

Developing a clinically feasible personalized medicine approach to pediatric

Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott

Chapter 10. 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation)

Chapter 10 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation) 1 Fueling Processes Respiration 1 Most respiration involves use of an electron transport chain As electrons pass through the electron

Oxidative Phosphorylation

Oxidative Phosphorylation Energy from Reduced Fuels Is Used to Synthesize ATP in Animals Carbohydrates, lipids, and amino acids are the main reduced fuels for the cell. Electrons from reduced fuels are

INTERACTION DRUG BODY

INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

An excess dietary vitamin E concentration does not influence Nrf2 signaling in the liver of rats fed either soybean oil or salmon oil

Eder et al. Nutrition & Metabolism (2017) 14:71 DOI 10.1186/s12986-017-0225-z RESEARCH Open Access An excess dietary vitamin E concentration does not influence Nrf2 signaling in the liver of rats fed either

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

2. You will need a Scantron and a pencil for this exam.

Exam III Chemistry 306 Fall 2009 Roper Name Exam Number Instructions: 1. Please turn in your chapter 21 and 23 homework. 2. You will need a Scantron and a pencil for this exam. 3. Please bring your backpacks

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

بسم هللا الرحمن الرحيم

بسم هللا الرحمن الرحيم -Please refer to the slides from (4-20) -Slides (4, 5) -Oxidative phosphorylation consists of 2 parts: 1.electron transport chain (series of electron transport proteins much filled

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group

PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (

2. (12 pts) Given the following metabolic pathway (as it occurs in the cell):

Answer Sheet 1 (Gold) 1. (1 pt) Write your exam ID (A) in the blank at the upper right of your answer sheet. 2. (12 pts) Given the following metabolic pathway (as it occurs in the cell): a. Would you expect

Biochemistry of Neurotransmitters. Dr. Diala Abu-Hassan CNS

Biochemistry of Neurotransmitters Dr. Diala Abu-Hassan CNS References Mark s Basic Medical Biochemistry, 4 th ed, pp. 908-918 http://what-whenhow.com/neuroscience/neurotransmitters-theneuron-part-1/ What

NutraHacker. Complete Gene Mutation Report for Customer: 4c72ce3a-1fff-4f58-981c-b4946d512e3b. Instructions:

NutraHacker Complete Gene Mutation Report for Customer: 4c72ce3a-1fff-4f58-981c-b4946d512e3b Instructions: NutraHacker reports mutations (single nucleotide polymorphisms) in this uploaded genome. Genes

Mohammad Tarek. Wahab Al-tekreeti Tamer Barakat. Faisal Mohammad

15 Mohammad Tarek Wahab Al-tekreeti Tamer Barakat Faisal Mohammad Things to remember Types of synapse: Neuron types and neurotransmitters When it happens between an axon and dendrites it is called axodendritic

number Done by Corrected by Doctor Nafeth Abu Tarboush

number 8 Done by Ali Yaghi Corrected by Mamoon Mohamad Alqtamin Doctor Nafeth Abu Tarboush 0 P a g e Oxidative phosphorylation Oxidative phosphorylation has 3 major aspects: 1. It involves flow of electrons

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

LIST OF FIGURES AND TABLES

ii LIST OF FIGURES AND TABLES GENERAL INTRODUCTION Fig. 1 Effect of Pb on antioxidant enzymes and cofactors leading to inactivation of enzyme activity Fig. 2 Rationale between Pb exposures among low SES

Moh Tarek + Faisal Massad. Tala Saleh ... Naif

19 Moh Tarek + Faisal Massad Tala Saleh... Naif Last lecture we ve talked about the main antioxidant system which are the enzymes found in our body, mainly: 1. Glutathione peroxidase 2. Super oxide dismutase(sod)

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

Name Animal source Vendor Cat # Dilutions

Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)

Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh

Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%

Omar Ismail. Dana Almanzalji. Faisal Mohammad

11 Omar Ismail Dana Almanzalji Faisal Mohammad Neuronal classification: Neurons are responsible for transmitting the action potential to the brain. The speed at which the action potential is transmitted

Heme-based CO sensors. CooA. Cystathionine b-synthase (CBS)

Heme-based CO sensors CooA Cystathionine b-synthase (CBS) 1 Carbon monoxide (CO): Simple! Heme Fe(II) complex, Metal complex NO, H 2 S : Complicated! Heme iron complex, Protein modification, Other molecules

Redox regulated transcription factors

Redox regulated transcription factors, MD PhD Division of Biochemistry Medical Biochemistry and Biophysics Karolinska Institutet Stockholm, Sweden Elias.Arner@ki.se Redox regulation A process of regulated

Chapter-5 Respiration in Plants Very Short Answers Questions: 1. Different substrates get oxidized during respiration. How does respiratory quotient (RQ) indicate which type of substrate i.e. carbohydrate,

Myokines, Exercise, Metabolism. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph

Myokines, Exercise, Metabolism ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview: Why? Evolutionary perspective How? Myokines: what they are and what they do Exercise and physiology Energy restriction

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The

ROLE OF ASTROGLIAL α7 NICOTINIC ACETYLCHOLINE RECEPTORS IN NEUROINFLAMMATION AND OXIDATIVE STRESS. Thesis presented. Hiral B.

ROLE OF ASTROGLIAL α7 NICOTINIC ACETYLCHOLINE RECEPTORS IN NEUROINFLAMMATION AND OXIDATIVE STRESS Thesis presented By Hiral B. Patel To The Bouve Graduate School of Health Sciences in Partial Fulfillment