Critical review. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver
|
|
- Rosamond Dickerson
- 5 years ago
- Views:
Transcription
1 SPOTLIGHT Critical review SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver Jay D. Horton, 1,2 Joseph L. Goldstein, 1 and Michael S. Brown 1 1 Department of Molecular Genetics, and 2 Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas, USA Address correspondence to: Jay D. Horton, Department of Molecular Genetics, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Room L5.238, Dallas, Texas , USA. Phone: (214) ; Fax: (214) ; jay.horton@utsouthwestern.edu. J. Clin. Invest. 109: (2002). DOI: /JCI Lipid homeostasis in vertebrate cells is regulated by a family of membrane-bound transcription factors designated sterol regulatory element binding proteins (SREBPs). SREBPs directly activate the expression of more than 30 genes dedicated to the synthesis and uptake of cholesterol, fatty acids, triglycerides, and phospholipids, as well as the NADPH cofactor required to synthesize these molecules (1 4). In the liver, three SREBPs regulate the production of lipids for export into the plasma as lipoproteins and into the bile as micelles. The complex, interdigitated roles of these three SREBPs have been dissected through the study of ten different lines of gene-manipulated mice. These studies form the subject of this review. SREBPs: activation through proteolytic processing SREBPs belong to the basic helix-loop-helix leucine zipper (bhlh-zip) family of transcription factors, but they differ from other bhlh-zip proteins in that they are synthesized as inactive precursors bound to the endoplasmic reticulum (ER) (1, 5). Each SREBP precursor of about 1150 amino acids is organized into three domains: (a) an NH 2 -terminal domain of about 480 amino acids that contains the bhlh-zip region for binding DNA; (b) two hydrophobic transmembrane spanning segments interrupted by a short loop of about 30 amino acids that projects into the lumen of the ER; and (c) a COOH-terminal domain of about 590 amino acids that performs the essential regulatory function described below. In order to reach the nucleus and act as a transcription factor, the NH 2 -terminal domain of each SREBP must be released from the membrane proteolytically (Figure 1). Three proteins required for SREBP processing have been delineated in cultured cells, using the tools of somatic cell genetics (see ref. 5 for review). One is an escort protein designated SREBP cleavage activating protein (SCAP). The other two are proteases, designated Site-1 protease (S1P) and Site-2 protease (S2P). Newly synthesized SREBP is inserted into the membranes of the ER, where its COOH-terminal regulatory domain binds to the COOH-terminal domain of SCAP (Figure 1). SCAP is both an escort for SREBPs and a sensor of sterols. When cells become depleted in cholesterol, SCAP escorts the SREBP from the ER to the Golgi apparatus, where the two proteases reside. In the Golgi apparatus, S1P, a membrane-bound serine protease, cleaves the SREBP in the luminal loop between its two membrane-spanning segments, dividing the SREBP molecule in half (Figure 1). The NH 2 -terminal bhlh- Zip domain is then released from the membrane via a second cleavage mediated by S2P, a membrane-bound zinc metalloproteinase. The NH 2 -terminal domain, designated nuclear SREBP (nsrebp), translocates to the nucleus, where it activates transcription by binding to nonpalindromic sterol response elements (SREs) in the promoter/enhancer regions of multiple target genes. When the cholesterol content of cells rises, SCAP senses the excess cholesterol through its membranous sterol-sensing domain, changing its conformation in such a way that the SCAP/SREBP complex is no longer incorporated into ER transport vesicles. The net result is that SREBPs lose their access to S1P and S2P in the Golgi apparatus, so their bhlh-zip domains cannot be released from the ER membrane, and the transcription of target genes ceases (1, 5). The biophysical mechanism by which SCAP senses sterol levels in the ER membrane and regulates its movement to the Golgi apparatus is not yet understood. Elucidating this mechanism will be fundamental to understanding the molecular basis of cholesterol feedback inhibition of gene expression. SREBPs: two genes, three proteins The mammalian genome encodes three SREBP isoforms, designated SREBP-1a, SREBP-1c, and SREBP-2. SREBP-2 is encoded by a gene on human chromosome 22q13. Both SREBP-1a and -1c are derived from a single gene on human chromosome 17p11.2 through the use of alternative transcription start sites that produce alternate forms of exon 1, designated 1a and 1c (1). SREBP-1a is a potent activator of all SREBP-responsive genes, including those that mediate the synthesis of cholesterol, fatty acids, and triglycerides. High-level transcriptional activation is dependent on exon 1a, which encodes a longer acidic transactivation segment than does the first exon of SREBP-1c. The roles of SREBP-1c and SREBP-2 are more restricted than that of SREBP-1a. SREBP-1c preferentially enhances transcription of genes required for fatty acid synthesis but not cholesterol syn- The Journal of Clinical Investigation May 2002 Volume 109 Number
2 NADPH, which is consumed at multiple stages in these lipid biosynthetic pathways (8) (Figure 2). Figure 1 Model for the sterol-mediated proteolytic release of SREBPs from membranes. SCAP is a sensor of sterols and an escort of SREBPs. When cells are depleted of sterols, SCAP transports SREBPs from the ER to the Golgi apparatus, where two proteases, Site-1 protease (S1P) and Site-2 protease (S2P), act sequentially to release the NH 2-terminal bhlh-zip domain from the membrane. The bhlh-zip domain enters the nucleus and binds to a sterol response element (SRE) in the enhancer/promoter region of target genes, activating their transcription. When cellular cholesterol rises, the SCAP/SREBP complex is no longer incorporated into ER transport vesicles, SREBPs no longer reach the Golgi apparatus, and the bhlh-zip domain cannot be released from the membrane. As a result, transcription of all target genes declines. Reprinted from ref. 5 with permission. thesis. Like SREBP-1a, SREBP-2 has a long transcriptional activation domain, but it preferentially activates cholesterol synthesis (1). SREBP-1a and SREBP-2 are the predominant isoforms of SREBP in most cultured cell lines, whereas SREBP-1c and SREBP-2 predominate in the liver and most other intact tissues (6). When expressed at higher than physiologic levels, each of the three SREBP isoforms can activate all enzymes indicated in Figure 2, which shows the biosynthetic pathways used to generate cholesterol and fatty acids. However, at normal levels of expression, SREBP-1c favors the fatty acid biosynthetic pathway and SREBP-2 favors cholesterologenesis. SREBP- 2 responsive genes in the cholesterol biosynthetic pathway include those for the enzymes HMG-CoA synthase, HMG-CoA reductase, farnesyl diphosphate synthase, and squalene synthase. SREBP-1c responsive genes include those for ATP citrate lyase (which produces acetyl-coa) and acetyl-coa carboxylase and fatty acid synthase (which together produce palmitate [C16:0]). Other SREBP-1c target genes encode a ratelimiting enzyme of the fatty acid elongase complex, which converts palmitate to stearate (C18:0) (ref. 7); stearoyl-coa desaturase, which converts stearate to oleate (C18:1); and glycerol-3-phosphate acyltransferase, the first committed enzyme in triglyceride and phospholipid synthesis (3). Finally, SREBP-1c and SREBP-2 activate three genes required to generate Knockout and transgenic mice Ten different genetically manipulated mouse models that either lack or overexpress a single component of the SREBP pathway have been generated in the last 6 years (9 16). The key molecular and metabolic alterations observed in these mice are summarized in Table 1. Knockout mice that lack all nsrebps die early in embryonic development. For instance, a germline deletion of S1p, which prevents the processing of all SREBP isoforms, results in death before day 4 of development (15, 17). Germline deletion of Srebp2 leads to 100% lethality at a later stage of embryonic development than does deletion of S1p (embryonic day 7 8). In contrast, germline deletion of Srebp1, which eliminates both the 1a and the 1c transcripts, leads to partial lethality, in that about 15 45% of Srebp1 / mice survive (13). The surviving homozygotes manifest elevated levels of SREBP-2 mrna and protein (Table 1), which presumably compensates for the loss of SREBP-1a and -1c. When the SREBP-1c transcript is selectively eliminated, no embryonic lethality is observed, suggesting that the partial embryonic lethality in the Srebp1 / mice is due to the loss of the SREBP-1a transcript (16). To bypass embryonic lethality, we have produced mice in which all SREBP function can be disrupted in adulthood through induction of Cre recombinase. For this purpose, loxp recombination sites were inserted into genomic regions that flank crucial exons in the Scap or S1p genes (so-called floxed alleles) (14, 15). Mice homozygous for the floxed gene and heterozygous for a Cre recombinase transgene, which is under control of an IFN-inducible promoter (MX1-Cre), can be induced to delete Scap or S1p by stimulating IFN expression. Thus, following injection with polyinosinic acid polycytidylic acid, a double-stranded RNA that provokes antiviral responses, the Cre recombinase is produced in liver and disrupts the floxed gene by recombination between the loxp sites. Cre-mediated disruption of Scap or S1p dramatically reduces nsrebp-1 and nsrebp-2 levels in liver and diminishes expression of all SREBP target genes in both the cholesterol and the fatty acid synthetic pathways (Table 1). As a result, the rates of synthesis of cholesterol and fatty acids fall by 70 80% in Scap- and S1p-deficient livers. In cultured cells, the processing of SREBP is inhibited by sterols, and the sensor for this inhibition is SCAP (5). To learn whether SCAP performs the same function in liver, we have produced transgenic mice that express a mutant SCAP with a single amino acid substitution in the sterol-sensing domain (D443N) (12). Studies in tissue culture show that SCAP(D443N) is resistant to inhibition by sterols. Cells that express a single copy of this mutant gene overproduce cholesterol (18). Transgenic mice that express this mutant version of SCAP in the liver exhibit a similar phenotype (12). These livers manifest elevated levels of nsrebp-1 and nsrebp-2, owing to constitutive SREBP processing, which is not suppressed when the animals are fed a cholesterol-rich 1126 The Journal of Clinical Investigation May 2002 Volume 109 Number 9
3 Table 1 Alterations in hepatic lipid metabolism in gene-manipulated mice overexpressing or lacking SREBPs Genetic Amount of Expression of Lipid Liver Plasma manipulation nsrebps target genes synthesis content levels HMGR FAS LDLR Chol FA Chol TG Chol TG Fold difference relative to values in wild-type mice Transgenic mice SREBP-1a (9, 11) 1a SREBP-1c (10, 11) 1c n.c. 4 n.c. n.c. 4 n.c. 4 n.c. 0.6 SREBP-2 (11) n.c. 0.5 SCAP (D443N) (12) 1a, 1c, Liver-specific knockout mice SCAP (14) 1a, 1c, S1P (15) 1a, 1c, n.c Germline knockout mice SREBP-1a & 1c (13) 1a, 1c, n.c SREBP-1c (16) 1a, 1c, n.c n.c SREBP-2 (13) Embryonic lethal S1P (15, 17) Embryonic lethal HMGR, HMG-CoA reductase; FAS, fatty acid synthase; LDLR, LDL receptor; Chol, cholesterol; TG, triglycerides; n.c., no change. diet. nsrebp-1 and -2 increase the expression of all SREBP target genes shown in Figure 2, thus stimulating cholesterol and fatty acid synthesis and causing a marked accumulation of hepatic cholesterol and triglycerides (Table 1). This transgenic model provides strong in vivo evidence that SCAP activity is normally under partial inhibition by endogenous sterols, which keeps the synthesis of cholesterol and fatty acids in a partially repressed state in the liver. Function of individual SREBP isoforms in vivo To study the functions of individual SREBPs in the liver, we have produced transgenic mice that overexpress truncated versions of SREBPs (nsrebps) that terminate prior to the membrane attachment domain. These nsrebps enter the nucleus directly, bypassing the sterol-regulated cleavage step. By studying each nsrebp isoform separately, we could determine their distinct activating properties, albeit when overexpressed at nonphysiologic levels. Overexpression of nsrebp-1c in the liver of transgenic mice produces a triglyceride-enriched fatty liver with no increase in cholesterol (10). mrnas for fatty acid synthetic enzymes and rates of fatty acid synthesis are elevated fourfold in this tissue, whereas the mrnas for cholesterol synthetic enzymes and the rate of cholesterol synthesis are not increased (8). Conversely, overexpression of nsrebp-2 in the liver increases the mrnas encoding all cholesterol biosynthetic enzymes; the most dramatic is a 75-fold increase in HMG-CoA reductase mrna (11). mrnas for fatty acid synthesis enzymes are increased to a lesser extent, consistent with the in vivo observation that the rate of cholesterol synthesis increases 28-fold in these transgenic nsrebp-2 livers, while fatty acid synthesis increases only fourfold. This increase in cholesterol synthesis is even more remarkable when one considers the extent of cholesterol overload in this tissue, which would ordinarily reduce SREBP processing and essentially abolish cholesterol synthesis (Table 1). We have also studied the consequences of overexpressing SREBP-1a, which is expressed only at low levels in the livers of adult mice, rats, hamsters, and humans (6). nsrebp-1a transgenic mice develop a massive fatty liver engorged with both cholesterol and triglycerides (9), with heightened expression of genes controlling cholesterol biosynthesis and, still more dramatically, fatty acid synthesis (Table 1). The preferential activation of fatty acid synthesis (26-fold increase) relative to cholesterol synthesis (fivefold increase) explains the greater accumulation of triglycerides in their livers. The relative representation of the various fatty acids accumulating in this tissue is also unusual. Transgenic nsrebp-1a livers contain about 65% oleate (C18:1), markedly higher levels than the 15 20% found in typical wild-type livers (8) a result of the induction of fatty acid elongase and stearoyl-coa desaturase-1 (7). Considered together, the overexpression studies indicate that both SREBP-1 isoforms show a relative preference for activating fatty acid synthesis, whereas SREBP-2 favors cholesterol. The phenotype of animals lacking the Srebp1 gene, which encodes both the SREBP-1a and -1c transcripts, also supports the notion of distinct hepatic functions for SREBP-1 and SREBP-2 (13). Most homozygous SREBP-1 knockout mice die in utero. The surviving Srebp1 / mice show reduced synthesis of fatty acids, owing to reduced expression of mrnas for fatty acid synthetic enzymes (Table 1). Hepatic nsrebp-2 levels increase in these mice, presumably in compensation for the loss of nsrebp-1. As a result, transcription of cholesterol biosynthetic genes increases, producing a threefold increase in hepatic cholesterol synthesis (Table 1). The studies in genetically manipulated mice clearly show that, as in cultured cells, SCAP and S1P are The Journal of Clinical Investigation May 2002 Volume 109 Number
4 Figure 2 Genes regulated by SREBPs. The diagram shows the major metabolic intermediates in the pathways for synthesis of cholesterol, fatty acids, and triglycerides. In vivo, SREBP-2 preferentially activates genes of cholesterol metabolism, whereas SREBP-1c preferentially activates genes of fatty acid and triglyceride metabolism. DHCR, 7-dehydrocholesterol reductase; FPP, farnesyl diphosphate; GPP, geranylgeranyl pyrophosphate synthase; CYP51, lanosterol 14α-demethylase; G6PD, glucose-6-phosphate dehydrogenase; PGDH, 6-phosphogluconate dehydrogenase; GPAT, glycerol-3-phosphate acyltransferase. required for normal SREBP processing in the liver. SCAP, acting through its sterol-sensing domain, mediates feedback regulation of cholesterol synthesis. The SREBPs play related but distinct roles: SREBP-1c, the predominant SREBP-1 isoform in adult liver, preferentially activates genes required for fatty acid synthesis, while SREBP-2 preferentially activates the LDL receptor gene and various genes required for cholesterol synthesis. SREBP-1a and SREBP-2, but not SREBP-1c, are required for normal embryogenesis. Transcriptional regulation of SREBP genes Regulation of SREBPs occurs at two levels transcriptional and posttranscriptional. The posttranscriptional regulation discussed above involves the sterol-mediated suppression of SREBP cleavage, which results from sterol-mediated suppression of the movement of the SCAP/SREBP complex from the ER to the Golgi apparatus (Figure 1). This form of regulation is manifest not only in cultured cells (1), but also in the livers of rodents fed cholesterol-enriched diets (19). The transcriptional regulation of the SREBPs is more complex. SREBP-1c and SREBP-2 are subject to distinct forms of transcriptional regulation, whereas SREBP-1a appears to be constitutively expressed at low levels in liver and most other tissues of adult animals (6). One mechanism of regulation shared by SREBP-1c and SREBP-2 involves a feed-forward regulation mediated by SREs present in the enhancer/promoters of each gene (20, 21). Through this feed-forward loop, nsrebps activate the transcription of their own genes. In contrast, when nsrebps decline, as in Scap or S1p knockout mice, there is a secondary decline in the mrnas encoding SREBP-1c and SREBP-2 (14, 15). Three factors selectively regulate the transcription of SREBP-1c: liver X-activated receptors (LXRs), insulin, and glucagon. LXRα and LXRβ, nuclear receptors that form heterodimers with retinoid X receptors, are activated by a variety of sterols, including oxysterol intermediates that form during cholesterol biosynthesis (22 24). An LXR-binding site in the SREBP-1c promoter activates SREBP-1c transcription in the presence of LXR agonists (23). The functional significance of LXR-mediated SREBP-1c regulation has been confirmed in two animal models. Mice that lack both LXRα and LXRβ express reduced levels of SREBP-1c and its lipogenic target enzymes in liver and respond relatively weakly to treatment with a synthetic LXR agonist (23). Because a similar blunted response is found in mice that lack SREBP-1c, it appears that LXR increases fatty acid synthesis largely by inducing SREBP-1c (16). LXR-mediated activation of SREBP-1c transcription provides a mechanism for the cell to induce the synthesis of oleate when sterols are in excess (23). Oleate is the preferred fatty acid for the synthesis of cholesteryl esters, which are necessary for both the transport and the storage of cholesterol. LXR-mediated regulation of SREBP-1c appears also to be one mechanism by which unsaturated fatty acids suppress SREBP-1c transcription and thus fatty acid synthesis. Rodents fed diets enriched in polyunsaturated fatty acids manifest reduced SREBP-1c mrna expression and low rates of lipogenesis in liver (25). In vitro, unsaturated fatty acids competitively block LXR 1128 The Journal of Clinical Investigation May 2002 Volume 109 Number 9
5 activation of SREBP-1c expression by antagonizing the activation of LXR by its endogenous ligands (26). In addition to LXR-mediated transcriptional inhibition, polyunsaturated fatty acids lower SREBP-1c levels by accelerating degradation of its mrna (27). These combined effects may contribute to the longrecognized ability of polyunsaturated fatty acids to lower plasma triglyceride levels. SREBP-1c and the insulin/glucagon ratio The liver is the organ responsible for the conversion of excess carbohydrates to fatty acids to be stored as triglycerides or burned in muscle. A classic action of insulin is to stimulate fatty acid synthesis in liver during times of carbohydrate excess. The action of insulin is opposed by glucagon, which acts by raising camp. Multiple lines of evidence suggest that insulin s stimulatory effect on fatty acid synthesis is mediated by an increase in SREBP-1c. In isolated rat hepatocytes, insulin treatment increases the amount of mrna for SREBP-1c in parallel with the mrnas of its target genes (28, 29). The induction of the target genes can be blocked if a dominant negative form of SREBP-1c is expressed (30). Conversely, incubating primary hepatocytes with glucagon or dibutyryl camp decreases the mrnas for SREBP-1c and its associated lipogenic target genes (30, 31). In vivo, the total amount of SREBP-1c in liver and adipose tissue is reduced by fasting, which suppresses insulin and increases glucagon levels, and is elevated by refeeding (32, 33). The levels of mrna for SREBP-1c target genes parallel the changes in SREBP-1c expression. Similarly, SREBP-1c mrna levels fall when rats are treated with streptozotocin, which abolishes insulin secretion, and rise after insulin injection (29). Overexpression of nsrebp-1c in livers of transgenic mice prevents the reduction in lipogenic mrnas that normally follows a fall in plasma insulin levels (32). Conversely, in livers of Scap knockout mice that lack all nsrebps in the liver (14) or knockout mice lacking either nsrebp-1c (16) or both SREBP-1 isoforms (34), there is a marked decrease in the insulin-induced stimulation of lipogenic gene expression that normally occurs after fasting/refeeding. It should be noted that insulin and glucagon also exert a posttranslational control of fatty acid synthesis though changes in the phosphorylation and activation of acetyl-coa carboxylase. The posttranslational regulation of fatty acid synthesis persists in transgenic mice that overexpress nsrebp-1c (10). In these mice, the rates of fatty acid synthesis, as measured by [ 3 H]water incorporation, decline after fasting even though the levels of the lipogenic mrnas remain high (our unpublished observations). Taken together, the above evidence suggests that SREBP-1c mediates insulin s lipogenic actions in liver. Recent in vitro and in vivo studies involving adenoviral gene transfer suggest that SREBP-1c may also contribute to the regulation of glucose uptake and glucose synthesis. When overexpressed in hepatocytes, nsrebp-1c induces expression of glucokinase, a key enzyme in glucose utilization. It also suppresses phosphoenolpyruvate carboxykinase, a key gluconeogenic enzyme (35, 36). SREBPs in disease Many individuals with obesity and insulin resistance also have fatty livers, one of the most commonly encountered liver abnormalities in the US (37). A subset of individuals with fatty liver go on to develop fibrosis, cirrhosis, and liver failure. Evidence indicates that the fatty liver of insulin resistance is caused by SREBP-1c, which is elevated in response to the high insulin levels. Thus, SREBP-1c levels are elevated in the fatty livers of obese (ob/ob) mice with insulin resistance and hyperinsulinemia caused by leptin deficiency (38, 39). Despite the presence of insulin resistance in peripheral tissues, insulin continues to activate SREBP-1c transcription and cleavage in the livers of these insulin-resistant mice. The elevated nsrebp-1c increases lipogenic gene expression, enhances fatty acid synthesis, and accelerates triglyceride accumulation (31, 39). These metabolic abnormalities are reversed with the administration of leptin, which corrects the insulin resistance and lowers the insulin levels (38). Metformin, a biguanide drug used to treat insulinresistant diabetes, reduces hepatic nsrebp-1 levels and dramatically lowers the lipid accumulation in livers of insulin-resistant ob/ob mice (40). Metformin stimulates AMP-activated protein kinase (AMPK), an enzyme that inhibits lipid synthesis through phosphorylation and inactivation of key lipogenic enzymes (41). In rat hepatocytes, metformin-induced activation of AMPK also leads to decreased mrna expression of SREBP-1c and its lipogenic target genes (41), but the basis of this effect is not understood. The incidence of coronary artery disease increases with increasing plasma LDL-cholesterol levels, which in turn are inversely proportional to the levels of hepatic LDL receptors. SREBPs stimulate LDL receptor expression, but they also enhance lipid synthesis (1), so their net effect on plasma lipoprotein levels depends on a balance between opposing effects. In mice, the plasma levels of lipoproteins tend to fall when SREBPs are either overexpressed or underexpressed. In transgenic mice that overexpress nsrebps in liver, plasma cholesterol and triglycerides are generally lower than in control mice (Table 1), even though these mice massively overproduce fatty acids, cholesterol, or both. Hepatocytes of nsrebp-1a transgenic mice overproduce VLDL, but these particles are rapidly removed through the action of LDL receptors, and they do not accumulate in the plasma. Indeed, some nascent VLDL particles are degraded even before secretion by a process that is mediated by LDL receptors (42). The high levels of nsrebp-1a in these animals support continued expression of the LDL receptor, even in cells whose cholesterol concentration is elevated. In LDL receptor deficient mice carrying the nsrebp-1a transgene, plasma cholesterol and triglyceride levels rise tenfold (43). Mice that lack all SREBPs in liver as a result of disruption of Scap or S1p also manifest lower plasma cholesterol and triglyceride levels (Table 1). In these mice, hepatic cholesterol and triglyceride synthesis is markedly reduced, and this likely causes a decrease in VLDL production and secretion. LDL receptor mrna and LDL clearance from plasma is also significantly The Journal of Clinical Investigation May 2002 Volume 109 Number
6 reduced in these mice, but the reduction in LDL clearance is less than the overall reduction in VLDL secretion, the net result being a decrease in plasma lipid levels (15). However, because humans and mice differ substantially with regard to LDL receptor expression, LDL levels, and other aspects of lipoprotein metabolism, it is difficult to predict whether human plasma lipids will rise or fall when the SREBP pathway is blocked or activated. SREBPs in liver: unanswered questions The studies of SREBPs in liver have exposed a complex regulatory system whose individual parts are coming into focus. Major unanswered questions relate to the ways in which the transcriptional and posttranscriptional controls on SREBP activity are integrated so as to permit independent regulation of cholesterol and fatty acid synthesis in specific nutritional states. A few clues regarding these integration mechanisms are discussed below. Whereas cholesterol synthesis depends almost entirely on SREBPs, fatty acid synthesis is only partially dependent on these proteins. This has been shown most clearly in cultured nonhepatic cells such as Chinese hamster ovary cells. In the absence of SREBP processing, as when the Site-2 protease is defective, the levels of mrnas encoding cholesterol biosynthetic enzymes and the rates of cholesterol synthesis decline nearly to undetectable levels, whereas the rate of fatty acid synthesis is reduced by only 30% (44). Under these conditions, transcription of the fatty acid biosynthetic genes must be maintained by factors other than SREBPs. In liver, the gene encoding fatty acid synthase (FASN) can be activated transcriptionally by upstream stimulatory factor, which acts in concert with SREBPs (45). The FASN promoter also contains an LXR element that permits a low-level response to LXR ligands even when SREBPs are suppressed (46). These two transcription factors may help to maintain fatty acid synthesis in liver when nsrebp-1c is low. Another mechanism of differential regulation is seen in the ability of cholesterol to block the processing of SREBP-2, but not SREBP-1, under certain metabolic conditions. This differential regulation has been studied most thoroughly in cultured cells such as human embryonic kidney (HEK-293) cells. When these cells are incubated in the absence of fatty acids and cholesterol, the addition of sterols blocks processing of SREBP-2, but not SREBP-1, which is largely produced as SREBP-1a in these cells (47). Inhibition of SREBP-1 processing requires an unsaturated fatty acid, such as oleate or arachidonate, in addition to sterols (47). In the absence of fatty acids and in the presence of sterols, SCAP may be able to carry SREBP-1 proteins, but not SREBP-2, to the Golgi apparatus. Further studies are necessary to document this apparent independent regulation of SREBP-1 and SREBP-2 processing and to determine its mechanism. Acknowledgments Support for the research cited from the authors laboratories was provided by grants from the NIH (HL ), the Moss Heart Foundation, the Keck Foundation, and the Perot Family Foundation. J.D. Horton is a Pew Scholar in the Biomedical Sciences and is the recipient of an Established Investigator Grant from the American Heart Association and a Research Scholar Award from the American Digestive Health Industry. 1. Brown, M.S., and Goldstein, J.L The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell. 89: Horton, J.D., and Shimomura, I Sterol regulatory element-binding proteins: activators of cholesterol and fatty acid biosynthesis. Curr. Opin. Lipidol. 10: Edwards, P.A., Tabor, D., Kast, H.R., and Venkateswaran, A Regulation of gene expression by SREBP and SCAP. Biochim. Biophys. Acta. 1529: Sakakura, Y., et al Sterol regulatory element-binding proteins induce an entire pathway of cholesterol synthesis. Biochem. Biophys. Res. Comm. 286: Goldstein, J.L., Rawson, R.B., and Brown, M.S Mutant mammalian cells as tools to delineate the sterol regulatory element-binding protein pathway for feedback regulation of lipid synthesis. Arch. Biochem. Biophys. 397: Shimomura, I., Shimano, H., Horton, J.D., Goldstein, J.L., and Brown, M.S Differential expression of exons 1a and 1c in mrnas for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J. Clin. Invest. 99: Moon, Y.-A., Shah, N.A., Mohapatra, S., Warrington, J.A., and Horton, J.D Identification of a mammalian long chain fatty acyl elongase regulated by sterol regulatory element-binding proteins. J. Biol. Chem. 276: Shimomura, I., Shimano, H., Korn, B.S., Bashmakov, Y., and Horton, J.D Nuclear sterol regulatory element binding proteins activate genes responsible for entire program of unsaturated fatty acid biosynthesis in transgenic mouse liver. J. Biol. Chem. 273: Shimano, H., et al Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J. Clin. Invest. 98: Shimano, H., et al Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J. Clin. Invest. 99: Horton, J.D., et al Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J. Clin. Invest. 101: Korn, B.S., et al Blunted feedback suppression of SREBP processing by dietary cholesterol in transgenic mice expressing sterol-resistant SCAP(D443N). J. Clin. Invest. 102: Shimano, H., et al Elevated levels of SREBP-2 and cholesterol synthesis in livers of mice homozygous for a targeted disruption of the SREBP-1 gene. J. Clin. Invest. 100: Matsuda, M., et al SREBP cleavage-activating protein (SCAP) is required for increased lipid synthesis in liver induced by cholesterol deprivation and insulin elevation. Genes Dev. 15: Yang, J., et al Decreased lipid synthesis in livers of mice with disrupted Site-1 protease gene. Proc. Natl. Acad. Sci. USA. 98: Liang, G., et al Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J. Biol. Chem. 277: Mitchell, K.J., et al Functional analysis of secreted and transmembrane proteins critical to mouse development. Nat. Genet. 28: Hua, X., Nohturfft, A., Goldstein, J.L., and Brown, M.S Sterol resistance in CHO cells traced to point mutation in SREBP cleavage activating protein (SCAP). Cell. 87: Shimomura, I., et al Cholesterol feeding reduces nuclear forms of sterol regulatory element binding proteins in hamster liver. Proc. Natl. Acad. Sci. USA. 94: Sato, R., et al Sterol-dependent transcriptional regulation of sterol regulatory element-binding protein-2. J. Biol. Chem. 271: Amemiya-Kudo, M., et al Promoter analysis of the mouse sterol regulatory element-binding protein-1c gene. J. Biol. Chem. 275: Janowski, B.A., et al Structural requirements of ligands for the oxysterol liver X receptors LXRα and LXRβ. Proc. Natl. Acad. Sci. USA. 96: Repa, J.J., et al Regulation of mouse sterol regulatory elementbinding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRα and LXRβ. Genes Dev. 14: DeBose-Boyd, R.A., Ou, J., Goldstein, J.L., and Brown, M.S Expres The Journal of Clinical Investigation May 2002 Volume 109 Number 9
7 sion of sterol regulatory element-binding protein 1c (SREBP-1c) mrna in rat hepatoma cells requires endogenous LXR ligands. Proc. Natl. Acad. Sci. USA. 98: Xu, J., Nakamura, M.T., Cho, H.P., and Clarke, S.D Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. J. Biol. Chem. 274: Ou, J., et al Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand-dependent activation of the LXR. Proc. Natl. Acad. Sci. USA. 98: Xu, J., Teran-Garcia, M., Park, J.H.Y., Nakamura, M.T., and Clarke, S.D Polyunsaturated fatty acids suppress hepatic sterol regulatory element-binding protein-1 expression by accelerating transcript decay. J. Biol. Chem. 276: Foretz, M., Guichard, C., Ferre, P., and Foufelle, F Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc. Natl. Acad. Sci. USA. 96: Shimomura, I., et al Insulin selectively increases SREBP-1c mrna in livers of rats with streptozotocin-induced diabetes. Proc. Natl. Acad. Sci. USA. 96: Foretz, M., et al ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol. Cell. Biol. 19: Shimomura, I., et al Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol. Cell. 6: Horton, J.D., Bashmakov, Y., Shimomura, I., and Shimano, H Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc. Natl. Acad. Sci. USA. 95: Kim, J.B., et al Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J. Clin. Invest. 101: Shimano, H., et al Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J. Biol. Chem. 274: Becard, D., et al Adenovirus-mediated overexpression of sterol regulatory element binding protein-1c mimics insulin effects on hepatic gene expression and glucose homeostasis in diabetic mice. Diabetes. 50: Chakravarty, K., et al Sterol regulatory element-binding protein- 1c mimics the negative effect of insulin on phosphoenolpyruvate carboxykinase (GTP) gene transcription. J. Biol. Chem. 276: Marchesini, G., et al Nonalcoholic fatty liver disease. Diabetes. 50: Shimomura, I., Hammer, R.E., Ikemoto, S., Brown, M.S., and Goldstein, J.L Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature. 401: Shimomura, I., Bashmakov, Y., and Horton, J.D Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. J. Biol. Chem. 274: Lin, H.Z., et al Metformin reverses fatty liver disease in obese, leptin-deficient mice. Nat. Med. 6: Zhou, G., et al Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 108: DOI: /JCI Gillian-Daniel, D.L., Bates, P.W., Tebon, A., and Attie, A.D Endoplasmic reticulum localization of the low density lipoprotein receptor mediates pre-secretory degradation of apolipoprotein B. Proc. Natl. Acad. Sci. USA. 99: Horton, J.D., Shimano, H., Hamilton, R.L., Brown, M.S., and Goldstein, J.L Disruption of LDL receptor gene in transgenic SREBP-1a mice unmasks hyperlipidemia resulting from production of lipid-rich VLDL. J. Clin. Invest. 103: Pai, J., Guryev, O., Brown, M.S., and Goldstein, J.L Differential stimulation of cholesterol and unsaturated fatty acid biosynthesis in cells expressing individual nuclear sterol regulatory element binding proteins. J. Biol. Chem. 273: Latasa, M.-J., Moon, Y.S., Kim, K.-H., and Sul, H.S Nutritional regulation of the fatty acid synthase promoter in vivo: sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element. Proc. Natl. Acad. Sci. USA. 97: Joseph, S.B., et al Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by LXRs. J. Biol. Chem. 277: Hannah, V.C., Ou, J., Luong, A., Goldstein, J.L., and Brown, M.S Unsaturated fatty acids down-regulate SREBP isoforms 1a and 1c by two mechanisms in HEK-293 cells. J. Biol. Chem. 276: The Journal of Clinical Investigation May 2002 Volume 109 Number
The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis
Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationFATTY ACID SYNTHESIS
FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationChapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance
Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance Mengwei Zang Abstract Humans with obesity and type 2 diabetes exhibit the classic triad of hyperinsulinemia, hyperglycemia,
More informationSterol regulatory element-binding proteins (SREBPs) are a
Expression of sterol regulatory element-binding protein 1c (SREBP-1c) mrna in rat hepatoma cells requires endogenous LXR ligands Russell A. DeBose-Boyd*, Jiafu Ou*, Joseph L. Goldstein, and Michael S.
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationAbstract. Introduction
Activation of Cholesterol Synthesis in Preference to Fatty Acid Synthesis in Liver and Adipose Tissue of Transgenic Mice Overproducing Sterol Regulatory Element-binding Protein-2 Jay D. Horton,* Iichiro
More informationIs it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationSrebp2: A Master Regulator of Sterol and Fatty Acid Synthesis
Srebp2: A Master Regulator of Sterol and Fatty Acid Synthesis Blair B. Madison Division of Gastroenterology, Washington University School of Medicine, Saint Louis, MO 63110. Corresponding Author: Blair
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationDistinct roles of insulin and liver X receptor in the induction and cleavage of sterol regulatory elementbinding
Distinct roles of insulin and liver X receptor in the induction and cleavage of sterol regulatory elementbinding protein-1c Bronwyn D. Hegarty*, Alexandre Bobard*, Isabelle Hainault, Pascal Ferré, Pascale
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationMCB130 Midterm. GSI s Name:
1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationCARBOHYDRATE METABOLISM 1
CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2
More information5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM
5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM Introduction: Variety of hormones and other molecules regulate the carbohydrates metabolism. Some of these have already been cited in previous sections.
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationSchoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins
Research article Schoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins Luke J. Engelking, 1 Guosheng Liang, 1 Robert E. Hammer, 2 Kiyosumi Takaishi,
More informationObesity frequently leads to insulin-resistance that, in turn, produces
Bifurcation of insulin signaling pathway in rat liver: mtorc1 required for stimulation of lipogenesis, but not inhibition of gluconeogenesis Shijie Li, Michael S. Brown 1, and Joseph L. Goldstein 1 Department
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationMembrane Lipids & Cholesterol Metabolism
Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationLeen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationTHE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals
Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationPrint: ISSN Online: ISSN
Review Article Interplay between Cholesterol, SREBPs, MicroRNA-33 in Dyslipidemia Abdul Hafeez Kandhro Abdul Hafeez Kandhro, Healthcare Molecular & Diagnostic Laboratory, Hyderabad, Pakistan, Email of
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More information7.06 Cell Biology EXAM #3 April 24, 2003
7.06 Spring 2003 Exam 3 Name 1 of 8 7.06 Cell Biology EXAM #3 April 24, 2003 This is an open book exam, and you are allowed access to books and notes. Please write your answers to the questions in the
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationBlunted Feedback Suppression of SREBP Processing by Dietary Cholesterol in Transgenic Mice Expressing Sterol-Resistant SCAP(D443N)
Blunted Feedback Suppression of SREBP Processing by Dietary Cholesterol in Transgenic Mice Expressing Sterol-Resistant SCAP(D443N) Bobby S. Korn,* Iichiro Shimomura,* Yuriy Bashmakov,* Robert E. Hammer,
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationCholesterol: from feeding to gene regulation
Genes Nutr (2007) 2:181 193 DOI 10.1007/s12263-007-0049-y REVIEW Cholesterol: from feeding to gene regulation C. Martini Æ V. Pallottini Received: 21 July 2006 / Accepted: 16 November 2006 / Published
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationCentral role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver.
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 8-3-2004 Central role for liver X receptor in insulin-mediated activation
More informationMetabolic integration and Regulation
Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview
More informationFatty acid synthase (FAS) plays a central role in de novo
Nutritional regulation of the fatty acid synthase promoter in vivo: Sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element Maria-Jesus Latasa,
More informationnumber Done by Corrected by Doctor Nayef Karadsheh
number 13 Done by Asma Karameh Corrected by Saad hayek Doctor Nayef Karadsheh Gluconeogenesis This lecture covers gluconeogenesis with aspects of: 1) Introduction to glucose distribution through tissues.
More informationUNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS An Overview WHAT IS HOMEOSTASIS? Homeostasis
More informationMultiple choice: Circle the best answer on this exam. There are 12 multiple choice questions, each question is worth 3 points.
CHEM 4420 Exam 4 Spring 2015 Dr. Stone Page 1 of 6 Name Use complete sentences when requested. There are 120 possible points on this exam. Therefore there are 20 bonus points. Multiple choice: Circle the
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationTranscriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes
Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes Michiyo Amemiya-Kudo,* Hitoshi Shimano, 1, Alyssa H. Hasty,* Naoya Yahagi,*
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More informationProtein Sensors for Membrane Sterols
Leading Edge Review Protein Sensors for Membrane Sterols Joseph L. Goldstein, 1, * Russell A. DeBose-Boyd, 1 and Michael S. Brown 1, * 1 Department of Molecular Genetics, University of Texas Southwestern
More informationBIOL2171 ANU TCA CYCLE
TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationMILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
More informationCombined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes
Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes Jay D. Horton*, Nila A. Shah, Janet A. Warrington, Norma N. Anderson*, Sahng
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationMolecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting
Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Question No. 1 of 10 Question 1. Which of the following statements about the nucleus is correct? Question #01 A. The
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationFatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116
Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as
More informationLipid Metabolism in Familial Hypercholesterolemia
Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently
More informationSterol regulatory element binding protein-1c (SREBP-1c) (1),
Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing liganddependent activation of the LXR Jiafu Ou*, Hua Tu, Bei Shan, Alvin
More informationWhat systems are involved in homeostatic regulation (give an example)?
1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS (Diabetes Mellitus Part 1): An Overview
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationTHE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM
J. Cell Set. Suppl. 3, 131-137 (1985) Printed in Great Britain The Company of Biologists Limited 1985 131 THE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM JO SEPH L. G O L D S T E
More informationBiosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015
Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 The major site of acetoacetate and 3-hydorxybutyrate production is the liver. They are preferred substrates for myocardiocytes
More informationBio 366: Biological Chemistry II Test #1, 100 points (7 pages)
Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the
More informationCholesterol feedback: from Schoenheimerʼs bottle to Scapʼs MELADL
Cholesterol feedback: from Schoenheimerʼs bottle to Scapʼs MELADL Michael S. Brown 1 and Joseph L. Goldstein 1 Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas,
More information18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin
18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function
More informationIn glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic
Glycolysis 1 In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic glycolysis. If this pyruvate is converted instead
More informationAN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.
AN ABSTRACT OF THE DISSERTATION OF Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. Title: Polyunsaturated Fatty Acid Synthesis and Type 2 Diabetes Complications Abstract
More informationChapt. 10 Cell Biology and Biochemistry. The cell: Student Learning Outcomes: Describe basic features of typical human cell
Chapt. 10 Cell Biology and Biochemistry Cell Chapt. 10 Cell Biology and Biochemistry The cell: Lipid bilayer membrane Student Learning Outcomes: Describe basic features of typical human cell Integral transport
More informationGeneral Principles of Endocrine Physiology
General Principles of Endocrine Physiology By Dr. Isabel S.S. Hwang Department of Physiology Faculty of Medicine University of Hong Kong The major human endocrine glands Endocrine glands and hormones
More informationREGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25
REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationJay D. Horton, Iichiro Shimomura, Shinji Ikemoto **, Yuriy Bashmakov, and Robert E. Hammer
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 38, Issue of September 19, pp. 36652 36660, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Overexpression
More informationDual functions of Insig proteins in cholesterol homeostasis
Dong et al. Lipids in Health and Disease 2012, 11:173 REVIEW Dual functions of Insig proteins in cholesterol homeostasis Xiao-Ying Dong 1,2, Sheng-Qiu Tang 2 and Jin-Ding Chen 1* Open Access Abstract The
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationCHE 242 Exam 3 Practice Questions
CHE 242 Exam 3 Practice Questions Glucose metabolism 1. Below is depicted glucose catabolism. Indicate on the pathways the following: A) which reaction(s) of glycolysis are irreversible B) where energy
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationCHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
More information