International Summit on Current trends in Mass Spectrometry July 13-15, 2015 New Orleans, Louisiana.
|
|
- Tracey Bryan
- 5 years ago
- Views:
Transcription
1 International Summit on Current trends in Mass Spectrometry July 13-15, 2015 New rleans, Louisiana
2 utline Introduction Duchenne NAFLD Cystic fibrosis Fabry disease Peptidolipids Cholesterol Environmental Preservative Anti-acne drug 2
3 Introduction After dissection, fast freezing at -80 C Tissue is maintained with CT glue µm sections cut with a cryostat ( -20 C) Tissue sections are deposited directly onto a stainless steel plate, a silicon wafer, or a glass plate Dehydrated under vacuum Fixed onto the standard sample holder Blade 12 μm section 3
4 Introduction 4
5 Introduction Very good focus at unit mass resolution optical image: field of view: 700 x 700 µm² field of view: 55 x 55 µm² primary ion: Bi + 3 pixel size 215 nm cholesterol superposition superimposition total ion phosphocholine D. Touboul et al. J. Am. Soc. Mass Spectrom. 2005, 16,
6 Introduction DESI : Roger Webb (Monday morning) Spatial resolution MALDI-TF-TF TF-SIMS 50 µm 400 nm - 2 µm MALDI : Mehran F Moghaddam (Monday Morning) Dehydrated, Dehydrated MeV SIMS Sample : Roger Webb Homogeneous (Monday Afternoon) No fixation matrix coating No matrix Mass range m/z > 200 m/z 1000 Compounds Proteins, Peptides, Lipids, Drugs, Metabolites, Lipids Glycosphingolipi ds Cyclopeptides, Drugs, Metabolites, Elements, Low Energy Analyzer Cs+ SIMS TF-MS/MS : PurushottamTF-MS Chakraborty (Tuesday Morning) 6
7 Introduction DESI : Roger Webb (Monday morning) Spatial resolution MALDI-TF-TF TF-SIMS 50 µm 400 nm - 2 µm MALDI : Mehran F Moghaddam (Monday Morning) Dehydrated, Dehydrated MeV SIMS Sample : Roger Webb Homogeneous (Monday Afternoon) No fixation matrix coating No matrix Mass range m/z > 200 m/z 1000 Lipids Proteins, Glycosphingolipi Peptides, ds Lipids, 20 KeV Compounds Bi 3+ TF-SIMS Cyclopeptides, Drugs, Drugs, Metabolites, Metabolites, Elements, Low Energy Analyzer Cs+ SIMS TF-MS/MS : PurushottamTF-MS Chakraborty (Tuesday Morning) 7
8 Introduction Spatial resolution Sample MALDI-TF-TF TF-SIMS µm 400 nm - 2 µm Dehydrated, Homogeneous matrix coating Dehydrated No fixation No matrix Mass range m/z > 200 m/z 1500 Compounds Proteins, Peptides, Lipids, Drugs, Metabolites, Lipids Glycosphingolipids Cyclopeptides, Drugs, Metabolites, Elements, Analyzer TF-MS/MS TF-MS 8
9 Introduction 9
10 Introduction Fatty acids Glycerophospholipids: P H H N Phosphatidylcholine α-tocopherol (Vit E) H H H H P H X X = H, Na, K, Ca... Sphingomyelin H N P HN Phosphatidylinositol H Cholesterol Triglycerides Diglycerides H 10
11 Introduction 500 µm Microscope optical image = C30:(2-0) mc:73 tc: = C32:(3-0) mc:185 tc: Diglycerides = C34:(3-0) mc:244 tc: Sphingomyelins and cholesterol = C36:(4-0) mc:161 tc: = SM fragment mc:6 tc: = SM fragment mc:7 tc:16129 (mode -) 385 = Cholesterol mc:6 tc:14556 (mode -) 642 = SM fragment mc:7 tc:20513 (mode -) 687 = SM fragment mc:9 tc:26892 (mode -) Vitamin E (mode+) mc:7 tc:12860 Vitamin E (mode -) mc:14 tc:34882 Vitamin E 11
12 Introduction Adipocytes (infiltrates) Damaged area (necrotic tissue) Muscular fibers N. Tahallah, A. Brunelle, S. De La Porte,. Laprévote, J. Lipid Res. 2008, 49,
13 Introduction 1000 µm H&E staining (adjacent sections) 1000 µm Control liver Fatty liver Accumulation of lipids (mainly diacyl- and triacylglycerols) in hepatocytes, The predominant risk factor for NAFLD appears to be insulinresistance related to the metabolic syndrome, n stained sections, lipid vesicles are observed in fatty liver but are not observable in healthy liver, 13
14 Introduction Control liver Fatty liver - steatotic area Intensity per unit area (counts x10 3 ) MAG Vit.E Chol DAG m/z PC Strong decrease of vitamin E signal Detection of triacylglycerols Strong increase of diacylglycerols Intensity per unit area (counts x10 3 ) MAG Chol DAG m/z PC TAG D. Debois et al., Anal. Chem. 2009, 81,
15 Introduction Cholesterol µm 50 Sum of DAG ions C30 DAGs C32 DAGs C34 DAGs C36 DAGs
16 Intensité par unité de surface 3 (coups x 10 ) MAG MAG Cholestérol Introduction 20 DAG C µm Cholestérol 10 DAG C32 DAG C30 DAG C m/z Red = DAG C30 Green = DAG C36 Red = Unsaturated lipids Green = saturated lipids F. Le Naour et al. Plos ne, 4, issue 10, e7408 (1-10) (2009) 16
17 Introduction Usual way Whole mass spectrum (all pixels) Extract ion images Definition of Regions of Interest (RI) from individual ion images RIs Mass spectra Co(anti)-localization of lipids 17
18 Introduction Usual way Whole mass spectrum (all pixels) Extract ion images Definition of Regions of Interest (RI) from individual ion images RIs Mass spectra Co(anti)-localization of lipids Manual process strongly dependant on the operator subjectivity/experience 18
19 Introduction Aim: differentiate by TF-SIMS imaging CF mouse models from WT mices Samples: colon crypts 19
20 Introduction WT C16:1 FA (Lieberkühn glands) CF A B I J C D K L C18:0 FA (Lamina propria) Vit E C18:2 FA (Border) E F M N PI or ST fragment (mucosa) Cholesteryle Sulfate (Border) G H P 3-color overlay 20
21 Introduction WT A CF B C16:1 FA Different distributions of lipids (Lieberkühn C D histological substructures glands) I J between the K L No «clear» differences between CF and WT C18:2 FA samples C18:0 FA (Lamina propria) Vit E (Border) E F Strong inter-individual variations M N PI or ST fragment (mucosa) Cholesteryle Sulfate (Border) G H P 3-color overlay 21
22 Introduction STEP 2 multivariate PCA selection of PCs Principal Componen t Number Percent Variance Captured by PCA Model Eigenvalu e of Cov(X) % Variance Captured by this PC % Variance Captured Total
23 Introduction STEP 3: representing pixels in the space of scores PC1-PC2 plane Epithelial border Lieberkühn Glands Submucosa Lamina propria 23
24 24 Introduction STEP 4: partitioning clustering of PCA 1-4 selected variables 2 clusters 3 clusters 4 clusters 5 clusters
25 25 Introduction STEP 4: partitioning clustering of PCA 1-4 selected variables 2 clusters RESULTS 3 clusters - Well-defined regions of interest (RIs) - Selection of RIs for 7 WT and 6 CF samples allows their comparison by PCA - A Genetic Algorithm analysis of WT and CF samples provides a list of the most discriminating peaks 4 clusters 5 clusters
26 26 Introduction Ion mass (m/z) Ion Species Lipid family [CH 3 4 P].- PE, PC, SM fragment PI [C 4 H 11 N 4 P] - PC, SM fragment CS, ST fragment PI, ST C14:0 carboxylate Fatty Acid C16:0 carboxylate Fatty Acid [Vitamine E H]- VE [TG52:0 H]- TG
27 27 Introduction Lysosomal disease due to a lack of α-d-galactosidase-a (α-gala) of recessive transmission linked to the X chromosome (affects 1 over people) Accumulation of Gb 3 and Ga 2 glycosphingolipids in fluids and tissues H H H H H Structure of a Gb 3 (Trihexosylceramide) : H H H sidic sequence (a-gal/b-gal/b-glu) H H HN H Ga 2 (digalactosylceramide), Gal/Gal sequence Acyl sequence kidney deficiencies, neurological and cardiac evolutive lesions and angiokeratomas
28 28 Introduction Lysosomal disease due to a lack of α-d-galactosidase-a (α-gala) of recessive transmission linked to the X chromosome (affects 1 over people) Accumulation of Gb 3 and Ga 2 glycosphingolipids in fluids and tissues H H H H H Structure of a Gb 3 (Trihexosylceramide) : H H H sidic sequence (a-gal/b-gal/b-glu) H H HN H Ga 2 (digalactosylceramide), Gal/Gal sequence Acyl sequence kidney deficiencies, neurological and cardiac evolutive lesions and angiokeratomas
29 Introduction + Intensity (counts) No treatment of the sample 500x500 µm 2 256x256 pixels Bi 3+ primary ions Acquisition time 30 min Fluence ions.cm -2 Detection of very intense Ga 2 et Gb 3 signals Possible to localize a single species with a micrometer resolution Colocalization with vitamin E, cholesterol and cholesterol sulfate m/z D. Touboul et al., Int. J. Mass Spectrom. 2007, 260,
30 30 Introduction H N N H H N N H H N CH N H H N CH
31 31 Introduction Image size: 500x500 µm² Primary ions: Bi 3+, 25 kev Negative ion mode PIDD: ions.cm -2 Pixel size: 2x2 µm 2 Acquisition time: 30 min
32 32 Introduction
33 33 Introduction Artwork analysis Dogon art Rembrandt Grünewald
34 34 Introduction Temporal cortex
35 Introduction Variation of cholesterol distribution along the cortex (Alzheimer n=6, Controls n=4) A. N. Lazar et al. Acta Neuropathologica, 125, (2013) 35
36 Introduction Polybrominated flame retardants Endocrine disruptive chemicals Imaging of DBDE in organs of dosed rats vs. control ADRENALS ptical images D Dosed Control Cortex Medulla 2 mm E G F H 2 mm A. SeyerJ. Am. Soc. Mass Spectrom. 21, (2010), I 36
37 Introduction Polybrominated flame retardants Endocrine disruptive chemicals Imaging of DBDE in organs of dosed rats vs. control VARIES A Masson staining D Dosed G Control B 2 mm E H 2 mm -Accumulation in some of the numerous corpora lutea -Dependant on the corpus luteum s stage in the estrous cycle (?) 37
38 38 Introduction Used as preservative in eye drops of prostaglandin derivatives and betablockers as first line therapy for glaucoma But it is toxic: Damage of tissues due to oxidative stress Apoptosis
39 39 Introduction
40 40 Introduction CRNEA overlay N. Desbenoit et al. Anal. Bioanal. Chem., 405, (2013)
41 41 Introduction MALDI Imaging
42 42 Introduction TF-SIMS Imaging Drug Sphingomyelin Diglycerides Hair follicle colocalisation of the drug with the diglycerides around the hair follicles
43 43 Introduction Portrait of Nicolaes van Bambeeck Rembrandt van Rijn, 1641 Artwork analysis Rembrandt
44 44 Introduction Artwork analysis Rembrandt m/z 85 Canvas 1 st ground layer 2 nd ground layer Pictural layers Red grain 1500 μm long
45 45 Introduction m/z 85 (resin) 1500 μm long Amino acids m/z 59 (saccharide fragment: starch) Pb + Pb 2+ Pb 3+ Artwork analysis Rembrandt Lipid ions Lead white
46 46 Introduction Artwork analysis Rembrandt STRATIGRAPHY F THE SAMPLE Canvas Resin Umber Lead white Starch Lipid + lead Lake pigment
47 47 Introduction Artwork analysis Rembrandt
48 Introduction Artwork analysis Rembrandt Grunewald For tissue imaging, the micrometer lateral resolution is enough in many cases (SIMS) The mass resolution and mass accuracy should be as high as possible Many organic ions can be identified by their co-localization with specific fragments (SIMS) or by MS/MS (MALDI). Don t forget the gas phase dissociation chemistry! Identification by spectral comparisons with standard compounds is always useful The targeted compounds must be highly concentrated in welldefined areas to be imaged. In biology, the expertise of histologists and/or collaboration with clinicians is mandatory. In SIMS In situ identification by MS/MS is lacking complementarity with MALDI-MSMS. 48
49 49 Grants: Agence Nationale de la Recherche Scientifique (ANR) European Union (FP6 STREP Program) Institut de Chimie des Substances Naturelles (ICSN) Centre National de la Recherche Scientifique (CNRS)
50 50 Alain Brunelle David Touboul Vincent Guérineau Vanessa Petit Post-doc Mario llero Post-doc Nicolas Desbenoit Post-doc Alexandre Seyer PhD Farida Messouaf PhD
Diagnostic des maladies du foie par spectroscopie et imagerie multimodale
Diagnostic des maladies du foie par spectroscopie et imagerie multimodale François Le Naour Inserm U1193, Centre HépatoBiliaire, Villejuif Médecine moléculaire et modèles animaux: pathologie hépatique
More informationLipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging
Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging Nora Tahallah,* Alain Brunelle,* Sabine De La Porte, and Olivier Laprévote 1, * Laboratoire de
More informationFuture Directions: Tissue and Cell Imaging Robert C. Murphy
LIPID MAPS Lipidomics Workshop April 19, 2009 www.lipidmaps.org m/z 806 (16:0a/22:6-PC) [M+H] + Future Directions: Tissue and Cell Imaging Robert C. Murphy 16:0/22:6 PC m/z 806.4 Department of Pharmacology
More informationLOCALISATION, IDENTIFICATION AND SEPARATION OF MOLECULES. Gilles Frache Materials Characterization Day October 14 th 2016
LOCALISATION, IDENTIFICATION AND SEPARATION OF MOLECULES Gilles Frache Materials Characterization Day October 14 th 2016 1 MOLECULAR ANALYSES Which focus? LOCALIZATION of molecules by Mass Spectrometry
More informationToF-SIMS for Biological Research Sample Preparation Techniques
ToF-SIMS for Biological Research Sample Preparation Techniques Peter Sjövall SP Technical Research Institute of Sweden Borås, Sweden Göteborg Borås SP Technical Research Institute of Sweden www.sp.se Chemistry
More informationThe J105 SIMS. A New Instrument for 3-Dimensional Imaging and Analysis. Paul Blenkinsopp, Ionoptika Ltd
The J105 SIMS A New Instrument for 3-Dimensional Imaging and Analysis Paul Blenkinsopp, Ionoptika Ltd The J105 SIMS Why a new ToF Mass Spectrometer? The J105 ToF has been designed to allow us to separate
More informationSupporting Information
Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per
More informationThree Dimensional Mapping and Imaging of Neuropeptides and Lipids in Crustacean Brain
Three Dimensional Mapping and Imaging of Neuropeptides and Lipids in Crustacean Brain Using the 4800 MALDI TOF/TOF Analyzer Ruibing Chen and Lingjun Li School of Pharmacy and Department of Chemistry, University
More informationQualitative & Quantitative MS imaging technique for BAK distribution in eye. Stauber Jonathan, PhD CSO ImaBiotech
Q Qualitative & Quantitative MS imaging technique for BAK distribution in eye Stauber Jonathan, PhD CSO ImaBiotech EBF congress 2012, Bruxelles Q An innovative company with an innovative technology WHAT
More informationThe use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
More informationSequence Identification And Spatial Distribution of Rat Brain Tryptic Peptides Using MALDI Mass Spectrometric Imaging
Sequence Identification And Spatial Distribution of Rat Brain Tryptic Peptides Using MALDI Mass Spectrometric Imaging AB SCIEX MALDI TOF/TOF* Systems Patrick Pribil AB SCIEX, Canada MALDI mass spectrometric
More informationImaging Mass Microscope
Imaging Mass Microscope imscope C146-E220 Introducing the New Era of Imaging Mass Spectrometry Imaging mass spectrometry is a revolutionary new technology. The instrument is a combination of an optical
More informationMass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationLipids Analysis. Lipids
Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans
More informationLipid mapping of colonic mucosa by cluster TOF-SIMS imaging and. multivariate analysis in cftr knockout mice
Lipid mapping of colonic mucosa by cluster TOF-SIMS imaging and multivariate analysis in cftr knockout mice Marc Brulet 1, Alexandre Seyer 1, Aleksander Edelman 2, Alain Brunelle 1, Janine Fritsch 2, Mario
More informationApplication Note # MT-91. High Quality MALDI Imaging of Proteins and Peptides in Small Rodent Organ Tissues. Bruker Daltonics.
Bruker Daltonics Application Note # MT-91 18385 Da 6230 Da 7843 Da High Quality MALDI Imaging of Proteins and Peptides in Small Rodent Organ Tissues New developments in MALDI instrumentation, laser technology
More information[application note] DIRECT TISSUE IMAGING AND CHARACTERIZATION OF PHOSPHOLIPIDS USING A MALDI SYNAPT HDMS SYSTEM
DIRECT TISSUE IMAGING AND CHARACTERIZATION OF PHOSPHOLIPIDS USING A MALDI SYNAPT HDMS SYSTEM Emmanuelle Claude, Marten Snel, Thérèse McKenna, and James Langridge INTRODUCTION The last decade has seen a
More informationImaging of lipid species by MALDI mass spectrometry
Imaging of lipid species by MALDI mass spectrometry Robert C. Murphy, 1 Joseph A. Hankin, and Robert M. Barkley Department of Pharmacology, MS 8303 University of Colorado Denver, Aurora, CO 80045 Abstract
More informationLipid Imaging Mass Spectrometry.
Lipid Imaging Mass Spectrometry. NH 2 P H H H H P H H P H N N Advanced Graduate Course in Metabolomics 3-11-2015 Janusz Kabarowski, Dept. of Microbiology, UAB. Matrix-Assisted Laser Desorption/Ionization
More informationMALDI Imaging Drug Imaging Detlev Suckau Head of R&D MALDI Bruker Daltonik GmbH. December 19,
MALDI Imaging Drug Imaging Detlev Suckau Head of R&D MALDI Bruker Daltonik GmbH December 19, 2014 1 The principle of MALDI imaging Spatially resolved mass spectra are recorded Each mass signal represents
More informationSupporting information for: Memory Efficient. Principal Component Analysis for the Dimensionality. Reduction of Large Mass Spectrometry Imaging
Supporting information for: Memory Efficient Principal Component Analysis for the Dimensionality Reduction of Large Mass Spectrometry Imaging Datasets Alan M. Race,,, Rory T. Steven,, Andrew D. Palmer,,,
More informationMetabolomic fingerprinting of serum samples by direct infusion mass spectrometry
Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Raúl González-Domínguez * Department of Chemistry, Faculty of Experimental Sciences. University of Huelva, Spain. * Corresponding
More informationData Independent MALDI Imaging HDMS E for Visualization and Identification of Lipids Directly from a Single Tissue Section
Data Independent MALDI Imaging HDMS E for Visualization and Identification of Lipids Directly from a Single Tissue Section Emmanuelle Claude, Mark Towers, and Kieran Neeson Waters Corporation, Manchester,
More informationAnalysis of Triglycerides in Cooking Oils Using MALDI-TOF Mass Spectrometry and Principal Component Analysis
Analysis of Triglycerides in Cooking Oils Using MALDI-TOF Mass Spectrometry and Principal Component Analysis Kevin Cooley Chemistry Supervisor: Kingsley Donkor 1. Abstract Triglycerides are composed of
More informationMolecular pathology with desorption electrospray ionization (DESI) - where we are and where we're going
Molecular pathology with desorption electrospray ionization (DESI) - where we are and where we're going Dr. Emrys Jones Waters Users Meeting ASMS 2015 May 30th 2015 Waters Corporation 1 Definition: Seek
More informationLC/MS Method for Comprehensive Analysis of Plasma Lipids
Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,
More informationNAS Workshop on the Industrialization of Biology
High throughput chemical characterization using mass spectrometry NAS Workshop on the Industrialization of Biology Jonathan V. Sweedler University of Illinois Urbana, IL USA May 2014 Funding: DOE, NSF
More informationUtility of neurological smears for intrasurgical brain cancer diagnostics and tumour cell percentage by DESI-MS
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Utility of neurological smears for intrasurgical brain cancer diagnostics and tumour cell percentage
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Tissue Imaging at Atmospheric Pressure using Desorption Electrospray Ionization (DESI) Mass Spectrometry Justin M. Wiseman, Demian R. Ifa,
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationBildgebende Massenspektrometrie Erfolgreiche Anwendungen in der biomedizinischen Forschung. Markus Stoeckli
Bildgebende Massenspektrometrie Erfolgreiche Anwendungen in der biomedizinischen Forschung Markus Stoeckli MALDI Mass Spectrometric Imaging Principle 2 MALDI MSI Markus Stoeckli September 2014 Comparison
More informationPrinciples of Shotgun Lipidomics
Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition
More informationApplication Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa)
Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa) MALDI imaging datasets can be very information-rich, containing hundreds of mass
More informationUsing Infrared and Raman Microspectroscopies to Compare Ex Vivo Involved Psoriatic Skin and Normal Human Skin
Using Infrared and Raman Microspectroscopies to Compare Ex Vivo Involved Psoriatic Skin and Normal Human Skin Leroy, Marie (Laboratoire d'ingénierie de Surface (LIS)) Lefèvre, Thierry (Groupe de recherche
More informationHiroya Hidaka *1), Masaki Takiwaki 2), Mine Yamashita 2), Shinya Otsuki 1), Kenji Kawasaki 3), Mitsutoshi Sugano 3) and Takayuki Honda 4)
Mild acid hydrolysis of sphingolipids yields lysosphingolipids: a matrix-assisted laser desorption and ionization time-of-flight mass spectrometry study Hiroya Hidaka *1), Masaki Takiwaki 2), Mine Yamashita
More informationLipidomic and Spatio-Temporal Imaging of Fat by Mass Spectrometry in Mice Duodenum during Lipid Digestion
Lipidomic and Spatio-Temporal Imaging of Fat by Mass Spectrometry in Mice Duodenum during Lipid Digestion Alexandre Seyer 1, Michela Cantiello 2, Justine Bertrand-Michel 3,Véronique Roques 3, Michel Nauze
More informationImpact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
More informationChemical Imaging on Liver Steatosis Using Synchrotron Infrared and ToF-SIMS Microspectroscopies
Chemical Imaging on Liver Steatosis Using Synchrotron Infrared and ToF-SIMS Microspectroscopies François Le Naour 1,2 *, Marie-Pierre Bralet 2,3,4, Delphine Debois 5, Christophe Sandt 6, Catherine Guettier
More informationLipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging.
Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging. Nora Tahallah, Alain Brunelle, Sabine De La Porte, Olivier Laprévote To cite this version: Nora
More informationMALDI-IMS (MATRIX-ASSISTED LASER DESORPTION/IONIZATION
MALDI-IMS (MATRIX-ASSISTED LASER DESORPTION/IONIZATION IMAGING MASS SPECTROMETER) IN TISSUE STUDY YANXIAN CHEN MARCH 8 TH, WEDNESDAY. SEMINAR FOCUSING ON What is MALDI imaging mass spectrometer? How does
More informationKeeping an Eye on Molecular Imaging: Drug Efficacy & Toxicity in Ophthalmology
Application Note #MSI-11 Keeping an Eye on Molecular Imaging: Drug Efficacy & Toxicity in Ophthalmology Introduction Mass spectrometry Imaging (MSI) applications for ophthalmic drug discovery have recently
More informationSelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics
ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationDesorption Electrospray Ionization Coupled with Ultraviolet Photodissociation for Characterization of Phospholipid Isomers in Tissue Sections
Desorption Electrospray Ionization Coupled with Ultraviolet Photodissociation for Characterization of Phospholipid Isomers in Tissue Sections Dustin R. Klein, Clara L. Feider, Kyana Y. Garza, John Q. Lin,
More informationGlycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
More informationWeek 3 The Pancreas: Pancreatic ph buffering:
Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions
More informationMASS SPECTROMETRY BASED METABOLOMICS. Pavel Aronov. ABRF2010 Metabolomics Research Group March 21, 2010
MASS SPECTROMETRY BASED METABOLOMICS Pavel Aronov ABRF2010 Metabolomics Research Group March 21, 2010 Types of Experiments in Metabolomics targeted non targeted Number of analyzed metabolites is limited
More informationMolecular imaging of mouse brain tissue using Cluster Time-of-Flight Secondary Ion Mass Spectrometry
Molecular imaging of mouse brain tissue using Cluster Time-of-Flight Secondary Ion Mass Spectrometry A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty
More informationSmall Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS
Bruker Daltonics Application Note # MT-93/FTMS-38 Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS Introduction Matrix Assisted Laser Desorption Ionization (MALDI)
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationTissue Profiling by MALDI-Tof MS: Basic Principles From Small Molecules to Proteins
Tissue Profiling by MALDI-Tof MS: Basic Principles From Small Molecules to Proteins James Mobley, Ph.D. Proteomics Facility Vanderbilt University Imaging Mass Spectrometry of Thin Tissue Sections To obtain
More informationComprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease
Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,
More informationThe use of random projections for the analysis of mass spectrometry imaging data Palmer, Andrew; Bunch, Josephine; Styles, Iain
The use of random projections for the analysis of mass spectrometry imaging data Palmer, Andrew; Bunch, Josephine; Styles, Iain DOI: 10.1007/s13361-014-1024-7 Citation for published version (Harvard):
More informationIsolation of pure cell populations from healthy and
Direct Analysis of Laser Capture Microdissected Cells by MALDI Mass Spectrometry Baogang J. Xu and Richard M. Caprioli Department of Chemistry, Vanderbilt University, Nashville, Tennessee, USA Melinda
More informationThe detergent-solubilized and gel filtration purified rhodopsin was partitioned against
Supplement Jastrzebska et al. Materials and Methods The detergent-solubilized and gel filtration purified rhodopsin was partitioned against H 2 O/MeOH/CHCl 3, and the bottom layer was removed, dried down,
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed
More informationMass spectrometry imaging. What does MS imaging offer?
BMG 744 Mass spectrometry imaging Stephen Barnes, PhD With sincere acknowledgments to David Stella, PhD and Kyle A. Floyd, MS, former students in the Barnes Laboratory (2005 2012) and Kevin Schey, PhD,
More informationMass spectrometry Technologies in Lipid chemistry
Mass spectrometry Technologies in Lipid chemistry Rabah Soliymani University Of Helsinki Protein Chemistry Unit Biomedicum Helsinki Rabah.soliymani@helsinki.fi Complex_&_dynamic_mixtures (few copies to
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationApplication Note # MT-94 Direct Read-out of Thin Layer Chromatography (TLC) using MALDI-TOF
Bruker Daltonics Application Note # MT-94 Direct Read-out of Thin Layer Chromatography (TLC) using MALDI-TOF Thin Layer Chromatography (TLC) is broadly established to separate, characterize and quantify
More informationChem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols
Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced
More informationEnrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents
Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationSYNAPT G2-S High Definition MS (HDMS) System
SYNAPT G2-S High Definition MS (HDMS) System High performance, versatility, and workflow efficiency of your MS system all play a crucial role in your ability to successfully reach your scientific and business
More informationFats, Cholesterol, and Hormones
Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols
More informationMASS SPECTROMETRY IN METABOLOMICS
For personal use only. Please do not reuse or reproduce without the author s permission MASS SPECTRMETRY IN METABLMICS Pavel Aronov Stanford Mass Spectrometry Users Meeting August 21, 2008 rigin of Metabolomics
More informationDiscrimination of Human Astrocytoma Subtypes by Lipid Analysis Using Desorption Electrospray Ionization Imaging Mass Spectrometry
Discrimination of Human Astrocytoma Subtypes by Lipid Analysis Using Desorption Electrospray Ionization Imaging Mass Spectrometry L. S. Eberlin, A. L. Dill, A. J. Golby, K. L. Ligon, J. M. Wiseman, R.
More informationNafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in
More informationLC/MS/MS SOLUTIONS FOR LIPIDOMICS. Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS
LC/MS/MS SOLUTIONS FOR LIPIDOMICS Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS Lipids play a key role in many biological processes, such as the formation of cell membranes and signaling
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationTechnical Note # TN-31 Redefining MALDI-TOF/TOF Performance
Bruker Daltonics Technical Note # TN-31 Redefining MALDI-TOF/TOF Performance The new ultraflextreme exceeds all current expectations of MALDI-TOF/TOF technology: A proprietary khz smartbeam-ii TM MALDI
More informationMCQS ON LIPIDS. Dr. RUCHIKA YADU
MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL
More informationBioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation
Bioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation Louis-Félix Nothias,,, Mélissa Nothias-Esposito,, # Ricardo da Silva,, Mingxun Wang,,,
More informationMetabolite identification in metabolomics: Database and interpretation of MSMS spectra
Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu utline Introduction Putative
More informationAnatomy & Physiology I. Macromolecules
Anatomy & Physiology I Macromolecules Many molecules in the human body are very large, consisting of hundreds or even thousands of atoms. These are called macromolecules. Four types of macromolecules are
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationClassification, functions and structure
Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids
More informationWelcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI
Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind
More informationSurface and Interface Analysis. C60 ToF-SIMS imaging of frozen hydrated HeLa cells. Journal: Surface and Interface Analysis
Surface and Interface Analysis C ToF-SIMS imaging of frozen hydrated HeLa cells Journal: Surface and Interface Analysis Manuscript ID: Draft Wiley - Manuscript type: SIMS proceedings paper Date Submitted
More informationLipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures
Lipid Analysis Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th 2005 Introduction to lipid structures Fatty acids Acylglycerols Glycerophospholipids Sterols Strategies involved in lipid
More informationPoly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
More informationOverview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer
Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel
More informationChoosing the metabolomics platform
Choosing the metabolomics platform Stephen Barnes, PhD Department of Pharmacology & Toxicology University of Alabama at Birmingham sbarnes@uab.edu Challenges Unlike DNA, RNA and proteins, the metabolome
More informationComprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer
B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid
More informationThe study of phospholipids in single cells using an integrated microfluidic device
Supporting Information: The study of phospholipids in single cells using an integrated microfluidic device combined with matrix-assisted laser desorption/ionization mass spectrometry Weiyi Xie,, Dan Gao,
More informationIDENTIFICATION AND IMAGING DIFFERENT LIPID SPECIES WITHIN PHASE-SEPARATED MODEL MEMBRANES BY INTEGRATION OF TOF-SIMS AND PRINCIPAL COMPONENT ANALYSIS
2010 Bita Vaezian IDENTIFICATION AND IMAGING DIFFERENT LIPID SPECIES WITHIN PHASE-SEPARATED MODEL MEMBRANES BY INTEGRATION OF TOF-SIMS AND PRINCIPAL COMPONENT ANALYSIS BY BITA VAEZIAN THESIS Submitted
More informationMS-IMS (MALDI-IMAGING)?
MS-IMS (MALDI-IMAGING)? Protein Chemistry/Proteomics and Peptide Synthesis and Array Unit Biomedicum Helsinki and Haartman Institute E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem)
More informationSupplementary Information
Supplementary Information Molecular imaging of brain localization of liposomes in mice using MALDI mass spectrometry Annabelle Fülöp 1,2, Denis A. Sammour 1,2, Katrin Erich 1,2, Johanna von Gerichten 4,
More informationQuantitation of Sphingolipids in Tissue Extracts by LC/MS/MS
Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Alexei Belenky CASSS, Meritage Resort, Napa 2008 Outline Role of lipid analysis in drug discovery and disease diagnostics Analytical tools and
More informationLipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair
Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.
More informationChapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.
BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal
More informationSupporting Information. Evolution of atomically precise silver clusters to superlattices
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2012. Supporting Information for Part. Part. Sys. Charact., DOI: 10.1002/ppsc.((please add manuscript number)) Evolution of atomically
More informationImaging of Freeze-Fractured Cells with in Situ Fluorescence and Time-of-Flight Secondary Ion Mass Spectrometry
Anal. Chem. 2002, 74, 4011-4019 Imaging of Freeze-Fractured Cells with in Situ Fluorescence and Time-of-Flight Secondary Ion Mass Spectrometry Thomas P. Roddy, Donald M. Cannon, Jr., Chad A. Meserole,
More informationINTRODUCTION TO MALDI IMAGING
INTRODUCTION TO MALDI IMAGING Marten F. Snel, Emmanuelle Claude, Thérèse McKenna, and James I. Langridge Waters Corporation, Manchester, UK INT RODUCTION The last few years have seen a rapid increase in
More informationGeneral Biochemistry-1 BCH 202
General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:
More informationBruker Daltonics. autoflex III smartbeam. The Standard in MALDI-TOF Performance MALDI-TOF/TOF. think forward
Bruker Daltonics autoflex III smartbeam The Standard in MALDI-TOF Performance think forward MALDI-TOF/TOF Designed for a Routine High Level of Performance The autoflex III smartbeam brings the power of
More informationEssential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer
Application Note: 367 Essential Lipidomics Experiments using the LTQ rbitrap Hybrid Mass Spectrometer Thomas Moehring 1, Michaela Scigelova 2, Christer S. Ejsing 3, Dominik Schwudke 3, Andrej Shevchenko
More informationProteomic Biomarker Discovery in Breast Cancer
Proteomic Biomarker Discovery in Breast Cancer Rob Baxter Laboratory for Cellular and Diagnostic Proteomics Kolling Institute, University of Sydney, Royal North Shore Hospital robert.baxter@sydney.edu.au
More information