International Summit on Current trends in Mass Spectrometry July 13-15, 2015 New Orleans, Louisiana.

Size: px
Start display at page:

Download "International Summit on Current trends in Mass Spectrometry July 13-15, 2015 New Orleans, Louisiana."

Transcription

1 International Summit on Current trends in Mass Spectrometry July 13-15, 2015 New rleans, Louisiana

2 utline Introduction Duchenne NAFLD Cystic fibrosis Fabry disease Peptidolipids Cholesterol Environmental Preservative Anti-acne drug 2

3 Introduction After dissection, fast freezing at -80 C Tissue is maintained with CT glue µm sections cut with a cryostat ( -20 C) Tissue sections are deposited directly onto a stainless steel plate, a silicon wafer, or a glass plate Dehydrated under vacuum Fixed onto the standard sample holder Blade 12 μm section 3

4 Introduction 4

5 Introduction Very good focus at unit mass resolution optical image: field of view: 700 x 700 µm² field of view: 55 x 55 µm² primary ion: Bi + 3 pixel size 215 nm cholesterol superposition superimposition total ion phosphocholine D. Touboul et al. J. Am. Soc. Mass Spectrom. 2005, 16,

6 Introduction DESI : Roger Webb (Monday morning) Spatial resolution MALDI-TF-TF TF-SIMS 50 µm 400 nm - 2 µm MALDI : Mehran F Moghaddam (Monday Morning) Dehydrated, Dehydrated MeV SIMS Sample : Roger Webb Homogeneous (Monday Afternoon) No fixation matrix coating No matrix Mass range m/z > 200 m/z 1000 Compounds Proteins, Peptides, Lipids, Drugs, Metabolites, Lipids Glycosphingolipi ds Cyclopeptides, Drugs, Metabolites, Elements, Low Energy Analyzer Cs+ SIMS TF-MS/MS : PurushottamTF-MS Chakraborty (Tuesday Morning) 6

7 Introduction DESI : Roger Webb (Monday morning) Spatial resolution MALDI-TF-TF TF-SIMS 50 µm 400 nm - 2 µm MALDI : Mehran F Moghaddam (Monday Morning) Dehydrated, Dehydrated MeV SIMS Sample : Roger Webb Homogeneous (Monday Afternoon) No fixation matrix coating No matrix Mass range m/z > 200 m/z 1000 Lipids Proteins, Glycosphingolipi Peptides, ds Lipids, 20 KeV Compounds Bi 3+ TF-SIMS Cyclopeptides, Drugs, Drugs, Metabolites, Metabolites, Elements, Low Energy Analyzer Cs+ SIMS TF-MS/MS : PurushottamTF-MS Chakraborty (Tuesday Morning) 7

8 Introduction Spatial resolution Sample MALDI-TF-TF TF-SIMS µm 400 nm - 2 µm Dehydrated, Homogeneous matrix coating Dehydrated No fixation No matrix Mass range m/z > 200 m/z 1500 Compounds Proteins, Peptides, Lipids, Drugs, Metabolites, Lipids Glycosphingolipids Cyclopeptides, Drugs, Metabolites, Elements, Analyzer TF-MS/MS TF-MS 8

9 Introduction 9

10 Introduction Fatty acids Glycerophospholipids: P H H N Phosphatidylcholine α-tocopherol (Vit E) H H H H P H X X = H, Na, K, Ca... Sphingomyelin H N P HN Phosphatidylinositol H Cholesterol Triglycerides Diglycerides H 10

11 Introduction 500 µm Microscope optical image = C30:(2-0) mc:73 tc: = C32:(3-0) mc:185 tc: Diglycerides = C34:(3-0) mc:244 tc: Sphingomyelins and cholesterol = C36:(4-0) mc:161 tc: = SM fragment mc:6 tc: = SM fragment mc:7 tc:16129 (mode -) 385 = Cholesterol mc:6 tc:14556 (mode -) 642 = SM fragment mc:7 tc:20513 (mode -) 687 = SM fragment mc:9 tc:26892 (mode -) Vitamin E (mode+) mc:7 tc:12860 Vitamin E (mode -) mc:14 tc:34882 Vitamin E 11

12 Introduction Adipocytes (infiltrates) Damaged area (necrotic tissue) Muscular fibers N. Tahallah, A. Brunelle, S. De La Porte,. Laprévote, J. Lipid Res. 2008, 49,

13 Introduction 1000 µm H&E staining (adjacent sections) 1000 µm Control liver Fatty liver Accumulation of lipids (mainly diacyl- and triacylglycerols) in hepatocytes, The predominant risk factor for NAFLD appears to be insulinresistance related to the metabolic syndrome, n stained sections, lipid vesicles are observed in fatty liver but are not observable in healthy liver, 13

14 Introduction Control liver Fatty liver - steatotic area Intensity per unit area (counts x10 3 ) MAG Vit.E Chol DAG m/z PC Strong decrease of vitamin E signal Detection of triacylglycerols Strong increase of diacylglycerols Intensity per unit area (counts x10 3 ) MAG Chol DAG m/z PC TAG D. Debois et al., Anal. Chem. 2009, 81,

15 Introduction Cholesterol µm 50 Sum of DAG ions C30 DAGs C32 DAGs C34 DAGs C36 DAGs

16 Intensité par unité de surface 3 (coups x 10 ) MAG MAG Cholestérol Introduction 20 DAG C µm Cholestérol 10 DAG C32 DAG C30 DAG C m/z Red = DAG C30 Green = DAG C36 Red = Unsaturated lipids Green = saturated lipids F. Le Naour et al. Plos ne, 4, issue 10, e7408 (1-10) (2009) 16

17 Introduction Usual way Whole mass spectrum (all pixels) Extract ion images Definition of Regions of Interest (RI) from individual ion images RIs Mass spectra Co(anti)-localization of lipids 17

18 Introduction Usual way Whole mass spectrum (all pixels) Extract ion images Definition of Regions of Interest (RI) from individual ion images RIs Mass spectra Co(anti)-localization of lipids Manual process strongly dependant on the operator subjectivity/experience 18

19 Introduction Aim: differentiate by TF-SIMS imaging CF mouse models from WT mices Samples: colon crypts 19

20 Introduction WT C16:1 FA (Lieberkühn glands) CF A B I J C D K L C18:0 FA (Lamina propria) Vit E C18:2 FA (Border) E F M N PI or ST fragment (mucosa) Cholesteryle Sulfate (Border) G H P 3-color overlay 20

21 Introduction WT A CF B C16:1 FA Different distributions of lipids (Lieberkühn C D histological substructures glands) I J between the K L No «clear» differences between CF and WT C18:2 FA samples C18:0 FA (Lamina propria) Vit E (Border) E F Strong inter-individual variations M N PI or ST fragment (mucosa) Cholesteryle Sulfate (Border) G H P 3-color overlay 21

22 Introduction STEP 2 multivariate PCA selection of PCs Principal Componen t Number Percent Variance Captured by PCA Model Eigenvalu e of Cov(X) % Variance Captured by this PC % Variance Captured Total

23 Introduction STEP 3: representing pixels in the space of scores PC1-PC2 plane Epithelial border Lieberkühn Glands Submucosa Lamina propria 23

24 24 Introduction STEP 4: partitioning clustering of PCA 1-4 selected variables 2 clusters 3 clusters 4 clusters 5 clusters

25 25 Introduction STEP 4: partitioning clustering of PCA 1-4 selected variables 2 clusters RESULTS 3 clusters - Well-defined regions of interest (RIs) - Selection of RIs for 7 WT and 6 CF samples allows their comparison by PCA - A Genetic Algorithm analysis of WT and CF samples provides a list of the most discriminating peaks 4 clusters 5 clusters

26 26 Introduction Ion mass (m/z) Ion Species Lipid family [CH 3 4 P].- PE, PC, SM fragment PI [C 4 H 11 N 4 P] - PC, SM fragment CS, ST fragment PI, ST C14:0 carboxylate Fatty Acid C16:0 carboxylate Fatty Acid [Vitamine E H]- VE [TG52:0 H]- TG

27 27 Introduction Lysosomal disease due to a lack of α-d-galactosidase-a (α-gala) of recessive transmission linked to the X chromosome (affects 1 over people) Accumulation of Gb 3 and Ga 2 glycosphingolipids in fluids and tissues H H H H H Structure of a Gb 3 (Trihexosylceramide) : H H H sidic sequence (a-gal/b-gal/b-glu) H H HN H Ga 2 (digalactosylceramide), Gal/Gal sequence Acyl sequence kidney deficiencies, neurological and cardiac evolutive lesions and angiokeratomas

28 28 Introduction Lysosomal disease due to a lack of α-d-galactosidase-a (α-gala) of recessive transmission linked to the X chromosome (affects 1 over people) Accumulation of Gb 3 and Ga 2 glycosphingolipids in fluids and tissues H H H H H Structure of a Gb 3 (Trihexosylceramide) : H H H sidic sequence (a-gal/b-gal/b-glu) H H HN H Ga 2 (digalactosylceramide), Gal/Gal sequence Acyl sequence kidney deficiencies, neurological and cardiac evolutive lesions and angiokeratomas

29 Introduction + Intensity (counts) No treatment of the sample 500x500 µm 2 256x256 pixels Bi 3+ primary ions Acquisition time 30 min Fluence ions.cm -2 Detection of very intense Ga 2 et Gb 3 signals Possible to localize a single species with a micrometer resolution Colocalization with vitamin E, cholesterol and cholesterol sulfate m/z D. Touboul et al., Int. J. Mass Spectrom. 2007, 260,

30 30 Introduction H N N H H N N H H N CH N H H N CH

31 31 Introduction Image size: 500x500 µm² Primary ions: Bi 3+, 25 kev Negative ion mode PIDD: ions.cm -2 Pixel size: 2x2 µm 2 Acquisition time: 30 min

32 32 Introduction

33 33 Introduction Artwork analysis Dogon art Rembrandt Grünewald

34 34 Introduction Temporal cortex

35 Introduction Variation of cholesterol distribution along the cortex (Alzheimer n=6, Controls n=4) A. N. Lazar et al. Acta Neuropathologica, 125, (2013) 35

36 Introduction Polybrominated flame retardants Endocrine disruptive chemicals Imaging of DBDE in organs of dosed rats vs. control ADRENALS ptical images D Dosed Control Cortex Medulla 2 mm E G F H 2 mm A. SeyerJ. Am. Soc. Mass Spectrom. 21, (2010), I 36

37 Introduction Polybrominated flame retardants Endocrine disruptive chemicals Imaging of DBDE in organs of dosed rats vs. control VARIES A Masson staining D Dosed G Control B 2 mm E H 2 mm -Accumulation in some of the numerous corpora lutea -Dependant on the corpus luteum s stage in the estrous cycle (?) 37

38 38 Introduction Used as preservative in eye drops of prostaglandin derivatives and betablockers as first line therapy for glaucoma But it is toxic: Damage of tissues due to oxidative stress Apoptosis

39 39 Introduction

40 40 Introduction CRNEA overlay N. Desbenoit et al. Anal. Bioanal. Chem., 405, (2013)

41 41 Introduction MALDI Imaging

42 42 Introduction TF-SIMS Imaging Drug Sphingomyelin Diglycerides Hair follicle colocalisation of the drug with the diglycerides around the hair follicles

43 43 Introduction Portrait of Nicolaes van Bambeeck Rembrandt van Rijn, 1641 Artwork analysis Rembrandt

44 44 Introduction Artwork analysis Rembrandt m/z 85 Canvas 1 st ground layer 2 nd ground layer Pictural layers Red grain 1500 μm long

45 45 Introduction m/z 85 (resin) 1500 μm long Amino acids m/z 59 (saccharide fragment: starch) Pb + Pb 2+ Pb 3+ Artwork analysis Rembrandt Lipid ions Lead white

46 46 Introduction Artwork analysis Rembrandt STRATIGRAPHY F THE SAMPLE Canvas Resin Umber Lead white Starch Lipid + lead Lake pigment

47 47 Introduction Artwork analysis Rembrandt

48 Introduction Artwork analysis Rembrandt Grunewald For tissue imaging, the micrometer lateral resolution is enough in many cases (SIMS) The mass resolution and mass accuracy should be as high as possible Many organic ions can be identified by their co-localization with specific fragments (SIMS) or by MS/MS (MALDI). Don t forget the gas phase dissociation chemistry! Identification by spectral comparisons with standard compounds is always useful The targeted compounds must be highly concentrated in welldefined areas to be imaged. In biology, the expertise of histologists and/or collaboration with clinicians is mandatory. In SIMS In situ identification by MS/MS is lacking complementarity with MALDI-MSMS. 48

49 49 Grants: Agence Nationale de la Recherche Scientifique (ANR) European Union (FP6 STREP Program) Institut de Chimie des Substances Naturelles (ICSN) Centre National de la Recherche Scientifique (CNRS)

50 50 Alain Brunelle David Touboul Vincent Guérineau Vanessa Petit Post-doc Mario llero Post-doc Nicolas Desbenoit Post-doc Alexandre Seyer PhD Farida Messouaf PhD

Diagnostic des maladies du foie par spectroscopie et imagerie multimodale

Diagnostic des maladies du foie par spectroscopie et imagerie multimodale Diagnostic des maladies du foie par spectroscopie et imagerie multimodale François Le Naour Inserm U1193, Centre HépatoBiliaire, Villejuif Médecine moléculaire et modèles animaux: pathologie hépatique

More information

Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging

Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging Nora Tahallah,* Alain Brunelle,* Sabine De La Porte, and Olivier Laprévote 1, * Laboratoire de

More information

Future Directions: Tissue and Cell Imaging Robert C. Murphy

Future Directions: Tissue and Cell Imaging Robert C. Murphy LIPID MAPS Lipidomics Workshop April 19, 2009 www.lipidmaps.org m/z 806 (16:0a/22:6-PC) [M+H] + Future Directions: Tissue and Cell Imaging Robert C. Murphy 16:0/22:6 PC m/z 806.4 Department of Pharmacology

More information

LOCALISATION, IDENTIFICATION AND SEPARATION OF MOLECULES. Gilles Frache Materials Characterization Day October 14 th 2016

LOCALISATION, IDENTIFICATION AND SEPARATION OF MOLECULES. Gilles Frache Materials Characterization Day October 14 th 2016 LOCALISATION, IDENTIFICATION AND SEPARATION OF MOLECULES Gilles Frache Materials Characterization Day October 14 th 2016 1 MOLECULAR ANALYSES Which focus? LOCALIZATION of molecules by Mass Spectrometry

More information

ToF-SIMS for Biological Research Sample Preparation Techniques

ToF-SIMS for Biological Research Sample Preparation Techniques ToF-SIMS for Biological Research Sample Preparation Techniques Peter Sjövall SP Technical Research Institute of Sweden Borås, Sweden Göteborg Borås SP Technical Research Institute of Sweden www.sp.se Chemistry

More information

The J105 SIMS. A New Instrument for 3-Dimensional Imaging and Analysis. Paul Blenkinsopp, Ionoptika Ltd

The J105 SIMS. A New Instrument for 3-Dimensional Imaging and Analysis. Paul Blenkinsopp, Ionoptika Ltd The J105 SIMS A New Instrument for 3-Dimensional Imaging and Analysis Paul Blenkinsopp, Ionoptika Ltd The J105 SIMS Why a new ToF Mass Spectrometer? The J105 ToF has been designed to allow us to separate

More information

Supporting Information

Supporting Information Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per

More information

Three Dimensional Mapping and Imaging of Neuropeptides and Lipids in Crustacean Brain

Three Dimensional Mapping and Imaging of Neuropeptides and Lipids in Crustacean Brain Three Dimensional Mapping and Imaging of Neuropeptides and Lipids in Crustacean Brain Using the 4800 MALDI TOF/TOF Analyzer Ruibing Chen and Lingjun Li School of Pharmacy and Department of Chemistry, University

More information

Qualitative & Quantitative MS imaging technique for BAK distribution in eye. Stauber Jonathan, PhD CSO ImaBiotech

Qualitative & Quantitative MS imaging technique for BAK distribution in eye. Stauber Jonathan, PhD CSO ImaBiotech Q Qualitative & Quantitative MS imaging technique for BAK distribution in eye Stauber Jonathan, PhD CSO ImaBiotech EBF congress 2012, Bruxelles Q An innovative company with an innovative technology WHAT

More information

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics. Outlines The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

More information

Sequence Identification And Spatial Distribution of Rat Brain Tryptic Peptides Using MALDI Mass Spectrometric Imaging

Sequence Identification And Spatial Distribution of Rat Brain Tryptic Peptides Using MALDI Mass Spectrometric Imaging Sequence Identification And Spatial Distribution of Rat Brain Tryptic Peptides Using MALDI Mass Spectrometric Imaging AB SCIEX MALDI TOF/TOF* Systems Patrick Pribil AB SCIEX, Canada MALDI mass spectrometric

More information

Imaging Mass Microscope

Imaging Mass Microscope Imaging Mass Microscope imscope C146-E220 Introducing the New Era of Imaging Mass Spectrometry Imaging mass spectrometry is a revolutionary new technology. The instrument is a combination of an optical

More information

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Lipids Analysis. Lipids

Lipids Analysis. Lipids Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans

More information

Lipid mapping of colonic mucosa by cluster TOF-SIMS imaging and. multivariate analysis in cftr knockout mice

Lipid mapping of colonic mucosa by cluster TOF-SIMS imaging and. multivariate analysis in cftr knockout mice Lipid mapping of colonic mucosa by cluster TOF-SIMS imaging and multivariate analysis in cftr knockout mice Marc Brulet 1, Alexandre Seyer 1, Aleksander Edelman 2, Alain Brunelle 1, Janine Fritsch 2, Mario

More information

Application Note # MT-91. High Quality MALDI Imaging of Proteins and Peptides in Small Rodent Organ Tissues. Bruker Daltonics.

Application Note # MT-91. High Quality MALDI Imaging of Proteins and Peptides in Small Rodent Organ Tissues. Bruker Daltonics. Bruker Daltonics Application Note # MT-91 18385 Da 6230 Da 7843 Da High Quality MALDI Imaging of Proteins and Peptides in Small Rodent Organ Tissues New developments in MALDI instrumentation, laser technology

More information

[application note] DIRECT TISSUE IMAGING AND CHARACTERIZATION OF PHOSPHOLIPIDS USING A MALDI SYNAPT HDMS SYSTEM

[application note] DIRECT TISSUE IMAGING AND CHARACTERIZATION OF PHOSPHOLIPIDS USING A MALDI SYNAPT HDMS SYSTEM DIRECT TISSUE IMAGING AND CHARACTERIZATION OF PHOSPHOLIPIDS USING A MALDI SYNAPT HDMS SYSTEM Emmanuelle Claude, Marten Snel, Thérèse McKenna, and James Langridge INTRODUCTION The last decade has seen a

More information

Imaging of lipid species by MALDI mass spectrometry

Imaging of lipid species by MALDI mass spectrometry Imaging of lipid species by MALDI mass spectrometry Robert C. Murphy, 1 Joseph A. Hankin, and Robert M. Barkley Department of Pharmacology, MS 8303 University of Colorado Denver, Aurora, CO 80045 Abstract

More information

Lipid Imaging Mass Spectrometry.

Lipid Imaging Mass Spectrometry. Lipid Imaging Mass Spectrometry. NH 2 P H H H H P H H P H N N Advanced Graduate Course in Metabolomics 3-11-2015 Janusz Kabarowski, Dept. of Microbiology, UAB. Matrix-Assisted Laser Desorption/Ionization

More information

MALDI Imaging Drug Imaging Detlev Suckau Head of R&D MALDI Bruker Daltonik GmbH. December 19,

MALDI Imaging Drug Imaging Detlev Suckau Head of R&D MALDI Bruker Daltonik GmbH. December 19, MALDI Imaging Drug Imaging Detlev Suckau Head of R&D MALDI Bruker Daltonik GmbH December 19, 2014 1 The principle of MALDI imaging Spatially resolved mass spectra are recorded Each mass signal represents

More information

Supporting information for: Memory Efficient. Principal Component Analysis for the Dimensionality. Reduction of Large Mass Spectrometry Imaging

Supporting information for: Memory Efficient. Principal Component Analysis for the Dimensionality. Reduction of Large Mass Spectrometry Imaging Supporting information for: Memory Efficient Principal Component Analysis for the Dimensionality Reduction of Large Mass Spectrometry Imaging Datasets Alan M. Race,,, Rory T. Steven,, Andrew D. Palmer,,,

More information

Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry

Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Raúl González-Domínguez * Department of Chemistry, Faculty of Experimental Sciences. University of Huelva, Spain. * Corresponding

More information

Data Independent MALDI Imaging HDMS E for Visualization and Identification of Lipids Directly from a Single Tissue Section

Data Independent MALDI Imaging HDMS E for Visualization and Identification of Lipids Directly from a Single Tissue Section Data Independent MALDI Imaging HDMS E for Visualization and Identification of Lipids Directly from a Single Tissue Section Emmanuelle Claude, Mark Towers, and Kieran Neeson Waters Corporation, Manchester,

More information

Analysis of Triglycerides in Cooking Oils Using MALDI-TOF Mass Spectrometry and Principal Component Analysis

Analysis of Triglycerides in Cooking Oils Using MALDI-TOF Mass Spectrometry and Principal Component Analysis Analysis of Triglycerides in Cooking Oils Using MALDI-TOF Mass Spectrometry and Principal Component Analysis Kevin Cooley Chemistry Supervisor: Kingsley Donkor 1. Abstract Triglycerides are composed of

More information

Molecular pathology with desorption electrospray ionization (DESI) - where we are and where we're going

Molecular pathology with desorption electrospray ionization (DESI) - where we are and where we're going Molecular pathology with desorption electrospray ionization (DESI) - where we are and where we're going Dr. Emrys Jones Waters Users Meeting ASMS 2015 May 30th 2015 Waters Corporation 1 Definition: Seek

More information

LC/MS Method for Comprehensive Analysis of Plasma Lipids

LC/MS Method for Comprehensive Analysis of Plasma Lipids Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,

More information

NAS Workshop on the Industrialization of Biology

NAS Workshop on the Industrialization of Biology High throughput chemical characterization using mass spectrometry NAS Workshop on the Industrialization of Biology Jonathan V. Sweedler University of Illinois Urbana, IL USA May 2014 Funding: DOE, NSF

More information

Utility of neurological smears for intrasurgical brain cancer diagnostics and tumour cell percentage by DESI-MS

Utility of neurological smears for intrasurgical brain cancer diagnostics and tumour cell percentage by DESI-MS Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Utility of neurological smears for intrasurgical brain cancer diagnostics and tumour cell percentage

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Tissue Imaging at Atmospheric Pressure using Desorption Electrospray Ionization (DESI) Mass Spectrometry Justin M. Wiseman, Demian R. Ifa,

More information

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation

More information

Bildgebende Massenspektrometrie Erfolgreiche Anwendungen in der biomedizinischen Forschung. Markus Stoeckli

Bildgebende Massenspektrometrie Erfolgreiche Anwendungen in der biomedizinischen Forschung. Markus Stoeckli Bildgebende Massenspektrometrie Erfolgreiche Anwendungen in der biomedizinischen Forschung Markus Stoeckli MALDI Mass Spectrometric Imaging Principle 2 MALDI MSI Markus Stoeckli September 2014 Comparison

More information

Principles of Shotgun Lipidomics

Principles of Shotgun Lipidomics Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition

More information

Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa)

Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa) Application Note # MT-111 Concise Interpretation of MALDI Imaging Data by Probabilistic Latent Semantic Analysis (plsa) MALDI imaging datasets can be very information-rich, containing hundreds of mass

More information

Using Infrared and Raman Microspectroscopies to Compare Ex Vivo Involved Psoriatic Skin and Normal Human Skin

Using Infrared and Raman Microspectroscopies to Compare Ex Vivo Involved Psoriatic Skin and Normal Human Skin Using Infrared and Raman Microspectroscopies to Compare Ex Vivo Involved Psoriatic Skin and Normal Human Skin Leroy, Marie (Laboratoire d'ingénierie de Surface (LIS)) Lefèvre, Thierry (Groupe de recherche

More information

Hiroya Hidaka *1), Masaki Takiwaki 2), Mine Yamashita 2), Shinya Otsuki 1), Kenji Kawasaki 3), Mitsutoshi Sugano 3) and Takayuki Honda 4)

Hiroya Hidaka *1), Masaki Takiwaki 2), Mine Yamashita 2), Shinya Otsuki 1), Kenji Kawasaki 3), Mitsutoshi Sugano 3) and Takayuki Honda 4) Mild acid hydrolysis of sphingolipids yields lysosphingolipids: a matrix-assisted laser desorption and ionization time-of-flight mass spectrometry study Hiroya Hidaka *1), Masaki Takiwaki 2), Mine Yamashita

More information

Lipidomic and Spatio-Temporal Imaging of Fat by Mass Spectrometry in Mice Duodenum during Lipid Digestion

Lipidomic and Spatio-Temporal Imaging of Fat by Mass Spectrometry in Mice Duodenum during Lipid Digestion Lipidomic and Spatio-Temporal Imaging of Fat by Mass Spectrometry in Mice Duodenum during Lipid Digestion Alexandre Seyer 1, Michela Cantiello 2, Justine Bertrand-Michel 3,Véronique Roques 3, Michel Nauze

More information

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction

More information

Chemical Imaging on Liver Steatosis Using Synchrotron Infrared and ToF-SIMS Microspectroscopies

Chemical Imaging on Liver Steatosis Using Synchrotron Infrared and ToF-SIMS Microspectroscopies Chemical Imaging on Liver Steatosis Using Synchrotron Infrared and ToF-SIMS Microspectroscopies François Le Naour 1,2 *, Marie-Pierre Bralet 2,3,4, Delphine Debois 5, Christophe Sandt 6, Catherine Guettier

More information

Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging.

Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging. Lipid mapping in human dystrophic muscle by cluster-time-of-flight secondary ion mass spectrometry imaging. Nora Tahallah, Alain Brunelle, Sabine De La Porte, Olivier Laprévote To cite this version: Nora

More information

MALDI-IMS (MATRIX-ASSISTED LASER DESORPTION/IONIZATION

MALDI-IMS (MATRIX-ASSISTED LASER DESORPTION/IONIZATION MALDI-IMS (MATRIX-ASSISTED LASER DESORPTION/IONIZATION IMAGING MASS SPECTROMETER) IN TISSUE STUDY YANXIAN CHEN MARCH 8 TH, WEDNESDAY. SEMINAR FOCUSING ON What is MALDI imaging mass spectrometer? How does

More information

Keeping an Eye on Molecular Imaging: Drug Efficacy & Toxicity in Ophthalmology

Keeping an Eye on Molecular Imaging: Drug Efficacy & Toxicity in Ophthalmology Application Note #MSI-11 Keeping an Eye on Molecular Imaging: Drug Efficacy & Toxicity in Ophthalmology Introduction Mass spectrometry Imaging (MSI) applications for ophthalmic drug discovery have recently

More information

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

Desorption Electrospray Ionization Coupled with Ultraviolet Photodissociation for Characterization of Phospholipid Isomers in Tissue Sections

Desorption Electrospray Ionization Coupled with Ultraviolet Photodissociation for Characterization of Phospholipid Isomers in Tissue Sections Desorption Electrospray Ionization Coupled with Ultraviolet Photodissociation for Characterization of Phospholipid Isomers in Tissue Sections Dustin R. Klein, Clara L. Feider, Kyana Y. Garza, John Q. Lin,

More information

Glycerolipid Analysis. LC/MS/MS Analytical Services

Glycerolipid Analysis. LC/MS/MS Analytical Services Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

MASS SPECTROMETRY BASED METABOLOMICS. Pavel Aronov. ABRF2010 Metabolomics Research Group March 21, 2010

MASS SPECTROMETRY BASED METABOLOMICS. Pavel Aronov. ABRF2010 Metabolomics Research Group March 21, 2010 MASS SPECTROMETRY BASED METABOLOMICS Pavel Aronov ABRF2010 Metabolomics Research Group March 21, 2010 Types of Experiments in Metabolomics targeted non targeted Number of analyzed metabolites is limited

More information

Molecular imaging of mouse brain tissue using Cluster Time-of-Flight Secondary Ion Mass Spectrometry

Molecular imaging of mouse brain tissue using Cluster Time-of-Flight Secondary Ion Mass Spectrometry Molecular imaging of mouse brain tissue using Cluster Time-of-Flight Secondary Ion Mass Spectrometry A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty

More information

Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS

Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS Bruker Daltonics Application Note # MT-93/FTMS-38 Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS Introduction Matrix Assisted Laser Desorption Ionization (MALDI)

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

Tissue Profiling by MALDI-Tof MS: Basic Principles From Small Molecules to Proteins

Tissue Profiling by MALDI-Tof MS: Basic Principles From Small Molecules to Proteins Tissue Profiling by MALDI-Tof MS: Basic Principles From Small Molecules to Proteins James Mobley, Ph.D. Proteomics Facility Vanderbilt University Imaging Mass Spectrometry of Thin Tissue Sections To obtain

More information

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,

More information

The use of random projections for the analysis of mass spectrometry imaging data Palmer, Andrew; Bunch, Josephine; Styles, Iain

The use of random projections for the analysis of mass spectrometry imaging data Palmer, Andrew; Bunch, Josephine; Styles, Iain The use of random projections for the analysis of mass spectrometry imaging data Palmer, Andrew; Bunch, Josephine; Styles, Iain DOI: 10.1007/s13361-014-1024-7 Citation for published version (Harvard):

More information

Isolation of pure cell populations from healthy and

Isolation of pure cell populations from healthy and Direct Analysis of Laser Capture Microdissected Cells by MALDI Mass Spectrometry Baogang J. Xu and Richard M. Caprioli Department of Chemistry, Vanderbilt University, Nashville, Tennessee, USA Melinda

More information

The detergent-solubilized and gel filtration purified rhodopsin was partitioned against

The detergent-solubilized and gel filtration purified rhodopsin was partitioned against Supplement Jastrzebska et al. Materials and Methods The detergent-solubilized and gel filtration purified rhodopsin was partitioned against H 2 O/MeOH/CHCl 3, and the bottom layer was removed, dried down,

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed

More information

Mass spectrometry imaging. What does MS imaging offer?

Mass spectrometry imaging. What does MS imaging offer? BMG 744 Mass spectrometry imaging Stephen Barnes, PhD With sincere acknowledgments to David Stella, PhD and Kyle A. Floyd, MS, former students in the Barnes Laboratory (2005 2012) and Kevin Schey, PhD,

More information

Mass spectrometry Technologies in Lipid chemistry

Mass spectrometry Technologies in Lipid chemistry Mass spectrometry Technologies in Lipid chemistry Rabah Soliymani University Of Helsinki Protein Chemistry Unit Biomedicum Helsinki Rabah.soliymani@helsinki.fi Complex_&_dynamic_mixtures (few copies to

More information

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,

More information

Application Note # MT-94 Direct Read-out of Thin Layer Chromatography (TLC) using MALDI-TOF

Application Note # MT-94 Direct Read-out of Thin Layer Chromatography (TLC) using MALDI-TOF Bruker Daltonics Application Note # MT-94 Direct Read-out of Thin Layer Chromatography (TLC) using MALDI-TOF Thin Layer Chromatography (TLC) is broadly established to separate, characterize and quantify

More information

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced

More information

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823

More information

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

SYNAPT G2-S High Definition MS (HDMS) System

SYNAPT G2-S High Definition MS (HDMS) System SYNAPT G2-S High Definition MS (HDMS) System High performance, versatility, and workflow efficiency of your MS system all play a crucial role in your ability to successfully reach your scientific and business

More information

Fats, Cholesterol, and Hormones

Fats, Cholesterol, and Hormones Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols

More information

MASS SPECTROMETRY IN METABOLOMICS

MASS SPECTROMETRY IN METABOLOMICS For personal use only. Please do not reuse or reproduce without the author s permission MASS SPECTRMETRY IN METABLMICS Pavel Aronov Stanford Mass Spectrometry Users Meeting August 21, 2008 rigin of Metabolomics

More information

Discrimination of Human Astrocytoma Subtypes by Lipid Analysis Using Desorption Electrospray Ionization Imaging Mass Spectrometry

Discrimination of Human Astrocytoma Subtypes by Lipid Analysis Using Desorption Electrospray Ionization Imaging Mass Spectrometry Discrimination of Human Astrocytoma Subtypes by Lipid Analysis Using Desorption Electrospray Ionization Imaging Mass Spectrometry L. S. Eberlin, A. L. Dill, A. J. Golby, K. L. Ligon, J. M. Wiseman, R.

More information

Nafith Abu Tarboush DDS, MSc, PhD

Nafith Abu Tarboush DDS, MSc, PhD Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in

More information

LC/MS/MS SOLUTIONS FOR LIPIDOMICS. Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS

LC/MS/MS SOLUTIONS FOR LIPIDOMICS. Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS LC/MS/MS SOLUTIONS FOR LIPIDOMICS Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS Lipids play a key role in many biological processes, such as the formation of cell membranes and signaling

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Phospholipids Metabolism

Phospholipids Metabolism Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester

More information

Technical Note # TN-31 Redefining MALDI-TOF/TOF Performance

Technical Note # TN-31 Redefining MALDI-TOF/TOF Performance Bruker Daltonics Technical Note # TN-31 Redefining MALDI-TOF/TOF Performance The new ultraflextreme exceeds all current expectations of MALDI-TOF/TOF technology: A proprietary khz smartbeam-ii TM MALDI

More information

MCQS ON LIPIDS. Dr. RUCHIKA YADU

MCQS ON LIPIDS. Dr. RUCHIKA YADU MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL

More information

Bioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation

Bioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation Bioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation Louis-Félix Nothias,,, Mélissa Nothias-Esposito,, # Ricardo da Silva,, Mingxun Wang,,,

More information

Metabolite identification in metabolomics: Database and interpretation of MSMS spectra

Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu utline Introduction Putative

More information

Anatomy & Physiology I. Macromolecules

Anatomy & Physiology I. Macromolecules Anatomy & Physiology I Macromolecules Many molecules in the human body are very large, consisting of hundreds or even thousands of atoms. These are called macromolecules. Four types of macromolecules are

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Classification, functions and structure

Classification, functions and structure Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids

More information

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind

More information

Surface and Interface Analysis. C60 ToF-SIMS imaging of frozen hydrated HeLa cells. Journal: Surface and Interface Analysis

Surface and Interface Analysis. C60 ToF-SIMS imaging of frozen hydrated HeLa cells. Journal: Surface and Interface Analysis Surface and Interface Analysis C ToF-SIMS imaging of frozen hydrated HeLa cells Journal: Surface and Interface Analysis Manuscript ID: Draft Wiley - Manuscript type: SIMS proceedings paper Date Submitted

More information

Lipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures

Lipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures Lipid Analysis Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th 2005 Introduction to lipid structures Fatty acids Acylglycerols Glycerophospholipids Sterols Strategies involved in lipid

More information

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1 Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species

More information

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel

More information

Choosing the metabolomics platform

Choosing the metabolomics platform Choosing the metabolomics platform Stephen Barnes, PhD Department of Pharmacology & Toxicology University of Alabama at Birmingham sbarnes@uab.edu Challenges Unlike DNA, RNA and proteins, the metabolome

More information

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid

More information

The study of phospholipids in single cells using an integrated microfluidic device

The study of phospholipids in single cells using an integrated microfluidic device Supporting Information: The study of phospholipids in single cells using an integrated microfluidic device combined with matrix-assisted laser desorption/ionization mass spectrometry Weiyi Xie,, Dan Gao,

More information

IDENTIFICATION AND IMAGING DIFFERENT LIPID SPECIES WITHIN PHASE-SEPARATED MODEL MEMBRANES BY INTEGRATION OF TOF-SIMS AND PRINCIPAL COMPONENT ANALYSIS

IDENTIFICATION AND IMAGING DIFFERENT LIPID SPECIES WITHIN PHASE-SEPARATED MODEL MEMBRANES BY INTEGRATION OF TOF-SIMS AND PRINCIPAL COMPONENT ANALYSIS 2010 Bita Vaezian IDENTIFICATION AND IMAGING DIFFERENT LIPID SPECIES WITHIN PHASE-SEPARATED MODEL MEMBRANES BY INTEGRATION OF TOF-SIMS AND PRINCIPAL COMPONENT ANALYSIS BY BITA VAEZIAN THESIS Submitted

More information

MS-IMS (MALDI-IMAGING)?

MS-IMS (MALDI-IMAGING)? MS-IMS (MALDI-IMAGING)? Protein Chemistry/Proteomics and Peptide Synthesis and Array Unit Biomedicum Helsinki and Haartman Institute E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem)

More information

Supplementary Information

Supplementary Information Supplementary Information Molecular imaging of brain localization of liposomes in mice using MALDI mass spectrometry Annabelle Fülöp 1,2, Denis A. Sammour 1,2, Katrin Erich 1,2, Johanna von Gerichten 4,

More information

Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS

Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Alexei Belenky CASSS, Meritage Resort, Napa 2008 Outline Role of lipid analysis in drug discovery and disease diagnostics Analytical tools and

More information

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.

More information

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2. BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal

More information

Supporting Information. Evolution of atomically precise silver clusters to superlattices

Supporting Information. Evolution of atomically precise silver clusters to superlattices Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2012. Supporting Information for Part. Part. Sys. Charact., DOI: 10.1002/ppsc.((please add manuscript number)) Evolution of atomically

More information

Imaging of Freeze-Fractured Cells with in Situ Fluorescence and Time-of-Flight Secondary Ion Mass Spectrometry

Imaging of Freeze-Fractured Cells with in Situ Fluorescence and Time-of-Flight Secondary Ion Mass Spectrometry Anal. Chem. 2002, 74, 4011-4019 Imaging of Freeze-Fractured Cells with in Situ Fluorescence and Time-of-Flight Secondary Ion Mass Spectrometry Thomas P. Roddy, Donald M. Cannon, Jr., Chad A. Meserole,

More information

INTRODUCTION TO MALDI IMAGING

INTRODUCTION TO MALDI IMAGING INTRODUCTION TO MALDI IMAGING Marten F. Snel, Emmanuelle Claude, Thérèse McKenna, and James I. Langridge Waters Corporation, Manchester, UK INT RODUCTION The last few years have seen a rapid increase in

More information

General Biochemistry-1 BCH 202

General Biochemistry-1 BCH 202 General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:

More information

Bruker Daltonics. autoflex III smartbeam. The Standard in MALDI-TOF Performance MALDI-TOF/TOF. think forward

Bruker Daltonics. autoflex III smartbeam. The Standard in MALDI-TOF Performance MALDI-TOF/TOF. think forward Bruker Daltonics autoflex III smartbeam The Standard in MALDI-TOF Performance think forward MALDI-TOF/TOF Designed for a Routine High Level of Performance The autoflex III smartbeam brings the power of

More information

Essential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer

Essential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer Application Note: 367 Essential Lipidomics Experiments using the LTQ rbitrap Hybrid Mass Spectrometer Thomas Moehring 1, Michaela Scigelova 2, Christer S. Ejsing 3, Dominik Schwudke 3, Andrej Shevchenko

More information

Proteomic Biomarker Discovery in Breast Cancer

Proteomic Biomarker Discovery in Breast Cancer Proteomic Biomarker Discovery in Breast Cancer Rob Baxter Laboratory for Cellular and Diagnostic Proteomics Kolling Institute, University of Sydney, Royal North Shore Hospital robert.baxter@sydney.edu.au

More information