s -1 (A) and (B) 2 s 1 in WT, riq1, and the riq1 mutant complemented by
|
|
- Clinton Davis
- 5 years ago
- Views:
Transcription
1 A s -1 B s -1 Supplemental Figure 1. The NPQ Phenotype in riq Mutants Was Complemented by Introduction of RIQ Genes. (A) and (B) 2 s 1 in, riq1, and the riq1 mutant complemented by the RIQ1 gene (A), and in, riq2, and the riq2 mutant complemented by the RIQ2 gene (B). After 30 min of dark adaptation, AL was applied for 5 min (white boxes); this was followed by a 4-min dark period for relaxation of qe (black boxes). Data are means ± SD (n = 3). 1
2 260 s Supplemental Figure 2. Reduced NPQ Was Observed in riq Mtuants Under Red Light.. 2 s 1 riq1 riq2 and riq1 riq2. n 2
3 (kda) riq1 riq2 riq1 riq2 riq1 riq2 riq1 riq2 (kda) Supplemental Figure 3. Similar Signals of RIQ1 Were Detected Using Two Types of Antibodies. Immunodetection of RIQ1 in and in riq mutants using two types of antibodies that recognized the predicted mature form of the RIQ1 sequence (left) and 14 amino acid residues of the RIQ1 sequence lane. Molecular weight markers are shown next to the panels. 3
4 A B Supplemental Figure 4. Linear Electron Transport Activity Was Similar in and riq Mutants. (A) and (B) Light-intensity dependence of ETR (A) and 1-qL (B) in, riq1, riq2, and riq1 riq2. Data are means ± SD (n = 4). 4
5 Supplemental Figure 5. Proton Motive Force Was Normally Formed in riq Mutants. ECS (electrochromic shift) signals were monitored in leaves of, pgr5, riq1, riq2, and riq1 riq2. After 2 s 1 for 5 min, a dark pulse (1 s) was applied to record the light-dark change of the signal by using Dual PAM. ECS t represents the total size of the proton motive force (pmf) formed in the light. pmf thylakoid membrane. ECS t was normalized against ECS ST, namely the ECS change induced by a single turn-over flash; this change depends on the charge separation of the photosystems. Data are means ± SD (n = 3). **P 5
6 1/8 1/4 1/2 riq1 riq2 riq1 riq2 curt1a npq4 RIQ1 RIQ2 CURT1A Lhcb1 Lhcb2 Lhcb3 Lhcb4 (CP29) Lhcb5 (CP26) Lhcb6 (CP24) PsbD PsbO PsbS PsaA Cyt f AtpF LHCII PSII PSI Cyt b 6 f CF 0 of ATPase Supplemental Figure 6. Accumulation of Major Thylakoid Proteins Was Unaffected in riq Mutants. Immunodetection of various thylakoid proteins. A chloroplast membrane protein extract corresponding to 2 6
7 Supplemental Figure 7. Xanthophyll Cycle Was Normally Operated in riq Mutants. Carotenoids were extracted from leaves of, riq1, riq2, curt1a, riq1 curt1a, and riq2 curt1a before or 2 s 1 for 5 min and then analyzed by HPLC. V; violaxanthin, A; antheraxanthin, Z; zeaxanthin. De-epoxidation state (DEPS) was calculated as (0.5*A +Z)/(V+A+Z). Data are means ± SD (n = 3). **P 7
8 CP43 - D2 D1 - LHCII - (kda) 50 - State1 riq1 riq2 stn7 State2 riq1 riq2 stn7 pthr 25 - CBB 15 - Supplemental Figure 8. riq Mutants. riq1 riq2 stn7 8
9 A B riq1 9
10 C riq2 D riq1 riq2 10
11 E F riq1 G riq2 H riq1 riq2 Supplemental Figure 9. Additional Electron Micrographs of Chloroplasts of and riq Mutants. (A) to (D) Chloroplast ultrastructures of (A), riq1 (B), riq2 (C), and riq1 riq2 (D), taken from the same samples as shown in ones of (A), riq1 (B), riq2 (C), and riq1 riq2 (D) in Figure 7, respectively. Bars (E) to (H) Magnified images of thylakoid ultrastructures of (E), riq1 (F), riq2 (G), and riq1 riq2 (H), as defined by the dotted squares in Figures 7 (A) to (D) 11
12 A CURT1A(AT4G01150) curt1a 123 ATG 200 bp TAG B curt1a CURT1A Actin1 C curt1a curt1a + CURT1A-HA HA D s CURT1A Cyt f Supplemental Figure 10. A Novel Allele of curt1a Mutant. (A) Schematic structural models of CURT1A. Black and gray boxes represent UTR and cording regions of curt1a (SK24234) is indicated. (B) CURT1A transcripts in and curt1a. Actin1 (AT2G37620) mrna was detected as a control. (C) Immunodetection of CURT1A in, curt1a, and its complementation line, which was generated by the introduction of CURT1A (D) curt1a, and its complementation line, as measured at photons m 2 s 1 n = 3) 12
13 A B riq1 13
14 C riq2 D curt1a 14
15 E riq1 curt1a F riq2 curt1a * * 15
16 G H riq1 I riq2 J curt1a K riq1 curt1a L riq1 curt1a M riq2 curt1a N riq2 curt1a 16
17 Supplemental Figure 11. Additional Electron Micrographs of Chloroplasts of and riq and curt1a Mutants. (A) to (F) Chloroplast ultrastructures of (A), riq1 (B), riq2 (C), curt1a (D), riq1 curt1a (E), and riq2 curt1a (F), taken from the same samples as shown in ones of (A), riq1 (B), riq2 (C), curt1a (D), riq1 curt1a (E), and riq2 curt1a (F) (F), abnormally aggregated thylakoids and wavy envelopes are indicated by black and white arrowheads, respectively. Unusual holes in the stroma (reflecting dents in the envelopes) are indicated by asterisks. (G) to (N) Magnified images of thylakoid ultrastructures of (G), riq1 (H), riq2 (I), curt1a (J), riq1 curt1a (K) and (L), and riq2 curt1a (M) and (N), as defined by the dotted squares in Figures 9 (A) to (F), 17
18 Genotype Chl a+b/fw (μg/mg) Chl a/b Wild type 1.38 ± ± 0.04 riq ± ± 0.04 riq2 1.5 ± ± 0.04 riq1 riq2 1.6 ± ± 0.01 Supplemental Table 1. Chlorophyll Content and Chlorophyll a/b Ratio. Chlorophyll (Chl) content and a/b ratio were determined as described by Porra et al. (1989). FW; fresh weight. Data are means ± SD (n = 3). 18
19 Supplemental Table 2. List of Primers Used in This Study. 19
Photosynthesis: The light Reactions. Dr. Obaidur Rahman NSU
Photosynthesis: The light Reactions Dr. Obaidur Rahman NSU When Molecules Absorb or Emit Light, They Change Their Electronic State lowest-energy, or ground state higher-energy, or excited, state extremely
More informationLight-Driven Proton Translocation
Module 0220502 Membrane Biogenesis and Transport Lecture 11 Light-Driven Proton Translocation Dale Sanders 23 February 2009 Aims: By the end of the lecture you should understand How electrons and protons
More informationEnhanced Photoprotection by Protein-Bound vs Free Xanthophyll Pools: A Comparative Analysis of Chlorophyll b and Xanthophyll Biosynthesis Mutants
Molecular Plant Volume 3 Number 3 Pages 576 593 May 2010 RESEARCH ARTICLE Enhanced Photoprotection by Protein-Bound vs Free Xanthophyll Pools: A Comparative Analysis of Chlorophyll b and Xanthophyll Biosynthesis
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationTable I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold).
Supplemental Tables Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold). PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5
More informationSupporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationRegular Paper. Introduction
Remodeling of the Major Light-Harvesting Antenna Protein of PSII Protects the Young Leaves of Barley ( Hordeum vulgare L.) from Photoinhibition under Prolonged Iron Deficiency Akihiro Saito1, 2, 3, Tomohisa
More informationDe-epoxidation of violaxanthin after reconstitution into different. carotenoid binding sites of light-harvesting complex II *
JBC Papers in Press. Published on April 11, 2001 as Manuscript M102147200 De-epoxidation of violaxanthin after reconstitution into different carotenoid binding sites of light-harvesting complex II * Peter
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,350 108,000 1.7 M Open access books available International authors and editors Downloads Our
More informationPhosphorylation of Photosystem II Controls Functional Macroscopic Folding of Photosynthetic Membranes in Arabidopsis C W OA
The Plant Cell, Vol. 21: 3950 3964, December 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Phosphorylation of Photosystem II Controls Functional Macroscopic Folding of Photosynthetic
More informationSupplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
More informationExpression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
More informationProblem Set #5 4/3/ Spring 02
Question 1 Chloroplasts contain six compartments outer membrane, intermembrane space, inner membrane, stroma, thylakoid membrane, and thylakoid lumen each of which is populated by specific sets of proteins.
More informationBiochimica et Biophysica Acta
Biochimica et Biophysica Acta 1827 (2013) 709 722 Contents lists available at SciVerse ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbabio Monogalactosyldiacylglycerol
More informationSupporting Information
Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing
More informationGREENING BARLEY SEEDLINGS UNDER HIGH TEMPERATURE
GEN. APPL. PLANT PHYSIOLOGY, 2005, 31(1-2), 3-14 3 GREENING BARLEY SEEDLINGS UNDER HIGH TEMPERATURE Y.A. Maiseyenkava, N.L. Pshybytko, L.F. Kabashnikova Institute of Biophysics and Cellular Engineering,
More informationBiochemical characterization of the plastid terminal oxidase and its implication in photosynthesis
Biochemical characterization of the plastid terminal oxidase and its implication in photosynthesis Kathleen Feilke To cite this version: Kathleen Feilke. Biochemical characterization of the plastid terminal
More informationSUPPLEMENTARY INFORMATION
An intact light harvesting complex I antenna system is required for complete state transitions in Arabidopsis Samuel L. Benson a+, Pratheesh Maheswaran b++, Maxwell A. Ware b, C. Neil Hunter a, Peter Horton
More informationThe xanthophyll cycle pigments in Secale cereale leaves under combined Cd and high light stress conditions
Available online at www.sciencedirect.com Journal of Photochemistry and Photobiology B: Biology 90 (2008) 47 52 www.elsevier.com/locate/jphotobiol The xanthophyll cycle pigments in Secale cereale leaves
More informationFluorescence parameters and redox kinetics allow measurement of PSII (and PSI) activities
Fluorescence parameters and redox kinetics allow measurement of PSII (and PSI) activities Photosynthetic bacteria are divided into - anoxygenic - oxygenic and - Halobacteria One and two electron transporters:
More informationUniversity of Groningen. Photosynthesis in silico van Eerden, Floris Jan
University of Groningen Photosynthesis in silico van Eerden, Floris Jan IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the
More informationRedox Modulation of Cyclic Electron Flow around Photosystem I in C3 Plants
Biochemistry 2006, 45, 13465-13475 13465 Redox Modulation of Cyclic Electron Flow around Photosystem I in C3 Plants Cécile Breyton, Beena Nandha, Giles N. Johnson, Pierre Joliot, and Giovanni Finazzi*,
More informationAGI code Agrisera antibody name Product number
AGI code Agrisera antibody name Product number AT1G02280 Toc33 chloroplast outer envelope membrane translocon complex protein AS07 236 AT1G03130 PsaD PSI-D subunit of photosystem I AS09 461 AT1G06680 PsbP
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationThe violaxanthin cycle protects plants from photooxidative damage by more than one mechanism
Proc. Natl. Acad. Sci. USA Vol. 96, pp. 8762 8767, July 1999 Plant Biology The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism MICHEL HAVAUX* AND KRISHNA K. NIYOGI
More informationBiochimica et Biophysica Acta
Biochimica et Biophysica Acta 1807 (2011) 326 335 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbabio Regulation of LHCII aggregation
More informationROLE OF MINERAL NUTRITION IN ALLEVIATING DETRIMENTAL EFFECTS OF ENVIRONMENTAL STRESSES ON CROP PRODUCTION
ROLE OF MINERAL NUTRITION IN ALLEVIATING DETRIMENTAL EFFECTS OF ENVIRONMENTAL STRESSES ON CROP PRODUCTION by Ismail CAKMAK Sabanci University Istanbul, Turkiye HUGE INCREASES IN WORLD POPULATION FOOD SECURITY
More informationLight-Harvesting Chlorophyll alb Complexes: lnterdependent Pigment Synt hesis and Protein Assembly
The Plant Cell, Vol. 7, 689-704, June 1995 O 1995 American society of Plant Physiologists Light-Harvesting Chlorophyll alb Complexes: lnterdependent Pigment Synt hesis and Protein Assembly F. Gerald Plumley
More informationSupplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1,
Supplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1, gasr-8 and k10g6.4 based on WormBase (http://wormbase.org),
More informationCAMBRIDGE INTERNATIONAL EXAMINATIONS General Certificate of Education Advanced Level
Centre Number Candidate Number Name CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certificate of Education Advanced Level BIOLOGY 9700/04 Paper 4 Structured Questions A2 Core Candidates answer on the Question
More informationBiology 638 Biochemistry II Exam-3. (Note that you are not allowed to use any calculator)
Biology 638 Biochemistry II Exam-3 (Note that you are not allowed to use any calculator) 1. In the non-cyclic pathway, electron pathway is. Select the most accurate one. a. PSII PC Cyt b 6 f PC PSI Fd-NADP
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationIn nature, plants experience considerable
article addendum Plant Signaling & Behavior 5:1, 81-85; January 2010; 2010 Landes Bioscience article addendum This manuscript has been published online, prior to printing. Once the issue is complete and
More informationVitamin E Protects against Photoinhibition and Photooxidative Stress in Arabidopsis thaliana
The Plant Cell, Vol. 17, 3451 3469, December 2005, www.plantcell.org ª 2005 American Society of Plant Biologists Vitamin E Protects against Photoinhibition and Photooxidative Stress in Arabidopsis thaliana
More informationOpen Research Online The Open University s repository of research publications and other research outputs
Open Research Online The Open University s repository of research publications and other research outputs Enhancement of Carotenoid Biosynthesis and Antioxidant Responses in Diatoms by Light Modulation
More informationUniversity of Groningen
University of Groningen The PsbW protein stabilizes the supramolecular organization of photosystem II in higher plants Garcia-Cerdan, Jose G.; Kovacs, Laszlo; Toth, Tuende; Kereiche, Sami; Aseeva, Elena;
More informationPeptidyl Prolyl Isomerase Activity in Chloroplast Thylakoid Lumen is a Dispensable Function of Immunophilins in Arabidopsis thaliana
Peptidyl Prolyl Isomerase Activity in Chloroplast Thylakoid Lumen is a Dispensable Function of Immunophilins in Arabidopsis thaliana Björn Ingelsson1, Alexey Shapiguzov1, 3, Thomas Kieselbach2 and Alexander
More information* Nitrogen Control of Chloroplast Differentiation and Metabolism. Final Report
.... It Final Report * Nitrogen Control of Chloroplast Differentiation and Metabolism %& @ oflll DE-FG02-96ER20213 W%z Gregory W. Schmidt OA~~ql Brigitte U. Bruns Botany Department @a University of Georgia
More informationPlant Cell, Development & Ultrastructure
PCDU Lecture Plant Cell, Development & Ultrastructure Plant Cell Biology Labs Download at: http://goo.gl/111tha Peroxisomes (Microbodies/) Catabolism of Fatty Acids Catabolism of Fatty Acids Glyoxysomes
More informationGreen Plant Photosystem I Binds Light-Harvesting Complex I on One Side of the Complex
Biochemistry 2001, 40, 1029-1036 1029 Green Plant Photosystem I Binds Light-Harvesting Complex I on One Side of the Complex Egbert J. Boekema, Poul Erik Jensen, Eberhard Schlodder, Jan F. L. van Breemen,
More informationPlant Physiology Preview. Published on July 28, 2017, as DOI: /pp
Plant Physiology Preview. Published on July 28, 2017, as DOI:10.1104/pp.17.00622 1 2 3 Over-expression of the RieskeFeS protein increases electron transport rates and biomass yield Andrew J. Simkin 2,
More informationBiochemical and Structural Studies of the Large Ycf4-Photosystem I Assembly Complex of the Green Alga Chlamydomonas reinhardtii W
The Plant Cell, Vol. 21: 2424 2442, August 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Biochemical and Structural Studies of the Large Ycf4-Photosystem I Assembly Complex of the
More informationThylakoid protein phosphorylation in evolutionally divergent species with oxygenic photosynthesis
FEBS Letters 423 (1998) 178^182 FEBS 19856 Thylakoid protein phosphorylation in evolutionally divergent species with oxygenic photosynthesis Saijaliisa Pursiheimo, Eevi Rintamaëki, Elena Baena-Gonzalez,
More informationLarge-scale in vitro production, refolding and dimerization of PsbS in different microenvironments
www.nature.com/scientificreports Received: 19 July 2017 Accepted: 17 October 2017 Published: xx xx xxxx OPEN Large-scale in vitro production, refolding and dimerization of PsbS in different microenvironments
More informationSupplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
More informationCell wall components:
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during
More informationMain differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function
More informationStructure and dynamics of thylakoids in land plants
Journal of Experimental Botany, Vol. 65, No. 8, pp. 1955 1972, 2014 doi:10.1093/jxb/eru090 Advance Access publication 12 March, 2014 Darwin Review Structure and dynamics of thylakoids in land plants Mathias
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
More informationHigh Light Induced Disassembly of Photosystem II Supercomplexes in Arabidopsis Requires STN7-Dependent Phosphorylation of CP29
High Light Induced Disassembly of Photosystem II Supercomplexes in Arabidopsis Requires STN7-Dependent Phosphorylation of CP29 Rikard Fristedt, Alexander V. Vener* Division of Cell Biology, Department
More informationBiotechnology for Biofuels. Open Access RESEARCH. Luodong Huang, Baoyan Gao, Manman Wu, Feifei Wang and Chengwu Zhang *
https://doi.org/10.1186/s13068-019-1355-5 Biotechnology for Biofuels RESEARCH Open Access Comparative transcriptome analysis of a long time span two step culture process reveals a potential mechanism for
More informationTrue or False: 1. Reactions are called endergonic if they occur spontaneously and release free energy.
True or False: 1. Reactions are called endergonic if they occur spontaneously and release free energy. 2. Enzymes catalyze chemical reactions by lowering the activation energy 3. Biochemical pathways are
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationBCH 4054 September 24,1999
BCH 4054 September 24,1999 PRE-TEST 2 GROUP NAME This test is take-home and open book, and it is intended that all members of the group contribute to completing it. Only one copy is to be submitted by
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationInstitute for Community Medicine, Ernst Moritz Arndt University of Greifswald, Greifswald, Germany f
The Plant Cell, Vol. 21: 2715 2732, September 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Dynamic Plastid Redox Signals Integrate Gene Expression and Metabolism to Induce Distinct
More informationLeaf Gas Exchange: Theory and Practice Using The LI-6400XT
Leaf Gas Exchange: Theory and Practice Using The LI-6400XT R.L. Garcia October 2015 LI-COR BioSciences Copyright 2014 LI-COR Biosciences, Inc. All rights reserved. LI-COR Product Line LIGHT PROCESS AT
More informationExpression of 5-amino levulinic acid induced photodynamic damage to the thylakoid membranes in dark sensitized by brief pre-illumination
J. Biosci., Vol. 15, Number 3, September 1990, pp. 199 204. Printed in India. Expression of 5-amino levulinic acid induced photodynamic damage to the thylakoid membranes in dark sensitized by brief pre-illumination
More informationLight triggers PILS-dependent reduction in nuclear auxin signalling for growth transition
In the format provided y the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 217.15 Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition Chloé
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationGiulia Friso, a,1 Lisa Giacomelli, a,1 A. Jimmy Ytterberg, a,1 Jean-Benoit Peltier, a,1 Andrea Rudella, a Qi Sun, b and Klaas J.
The Plant Cell, Vol. 16, 478 499, February 2004, www.plantcell.org ª 2004 American Society of Plant Biologists In-Depth Analysis of the Thylakoid Membrane Proteome of Arabidopsis thaliana Chloroplasts:
More informationLinköping University Post Print. A Protein Phosphorylation Threshold for Functional Stacking of Plant Photosynthetic Membranes
Linköping University Post Print A Protein Phosphorylation Threshold for Functional Stacking of Plant Photosynthetic Membranes Rikard Fristedt, Pontus Granath and Alexander Vener N.B.: When citing this
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationAbsence of isoprene modifies chloroplastidic membranes in poplar
Plant Physiology Preview. Published on May 14, 2015, as DOI:10.1104/pp.15.00612 1 2 3 4 5 6 7 8 9 10 Running title: Absence of isoprene modifies chloroplastidic membranes in poplar Corresponding author:
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationNature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
More informationXanthophyll cycle a mechanism protecting plants against oxidative stress
Redox Report Communications in Free Radical Research ISSN: 1351-0002 (Print) 1743-2928 (Online) Journal homepage: http://www.tandfonline.com/loi/yrer20 a mechanism protecting plants against oxidative stress
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationPHOTOSYNTHESIS AND RESPIRATION. Lecture 2. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 2 PHOTOSYNTHESIS AND RESPIRATION Lecture 2 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 3 RESPIRATION Aerobic and Anaerobic Respiration 4 Early earth was populated by anaerobes:
More informationSingle-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
More informationA mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany
A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid Lewis Kurschner and Karen Thulasi Masters in Botany Fatty acid nomenclature Fatty acyl composition Chain length Degree of unsaturation and position
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationConfiguration and Dynamics of Xanthophylls in Light-harvesting Antennae of Higher Plants
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 27, Issue of July 6, pp. 24862 24870, 2001 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Configuration and
More informationECU. Biology Department
ECU Biology Department hotosynthesis O 2 CO 2 H2 O C 6 H 12 O 6 An Energy Absorbing athway CO is the 2 source sunlight is the source hotosynthesis is the main biosynthetic pathway by which carbon and energy
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationA previously found thylakoid membrane protein of 14 kda (TMP14) is a novel subunit of plant photosystem I and is designated PSI-P
FEBS Letters 579 (2005) 4808 4812 FEBS 29860 A previously found thylakoid membrane protein of 14 kda (TMP14) is a novel subunit of plant photosystem I and is designated PSI-P Anastassia Khrouchtchova a,
More informationSupporting Information for
Supporting Information for CuO Nanoparticle Interaction with Arabidopsis: Toxicity, Parent-Progeny Transfer and Gene Expression Zhenyu Wang,, Lina Xu, Jian Zhao,,, Xiangke Wang, Jason C. White, and Baoshan
More informationMcWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
More informationNOT FOR SALE OR DISTRIBUTION
CHAPTER 1 Photosynthesis: The Light Reaction CHAPTER UTLIE 1.1 verview Jones & 1.2 Bartlett The Learning, Hill Reaction 1.3 Photosynthetic Pigments Chlorophyll a Accessory Pigments 1.4 rigin of the Z-Scheme
More information3/19/2009. Ch. 5 Microbial metabolism. Metabolism basics (Fig. 5.1) Basic concepts of metabolic processes. Redox reactions (Fig. 5.
Ch. 5 Microbial metabolism Breakdown of carbohydrates, lipids and proteins to produce cellular energy (catabolism) Redox (reduction/oxidation) reactions capture, store and use energy via electron transfers
More informationPrimary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
More informationGlutathione and zeaxanthin formation during high light stress in foliose lichens
Glutathione and zeaxanthin formation during high light stress in foliose lichens J. Štepigová, H. Vráblíková, J. Lang, K. Večeřová, M. Barták Institute of Experimental Biology, Faculty of Science, Masaryk
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit.
Supplementary Figure 1 PL gene expression in tomato fruit. Relative expression of five PL-coding genes measured in at least three fruit of each genotype (cv. Alisa Craig) at four stages of development,
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationTal Isaacson, Fruit tree sciences, Newe Ya ar, ARO, ISRAEL RGC8
Genetic and biochemical characterization of fruit from different apricot accessions highlights apricot as a rich source of phytoeneand phytofluene, and indicates CCD4 gene as a potential regulator of fruit
More informationLack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
More informationA high light (HL) level is a commonly occurring environmental stress for both plants and photosynthetic
OPEN SUBJECT AREAS: LIGHT RESPONSES PROTEIN-PROTEIN INTERACTION NETWORKS Received 1 May 2014 Accepted 29 September 2014 Published 22 October 2014 Correspondence and requests for materials should be addressed
More informationProtein co-migration database (PCoM -DB) for
Takabayashi et al. SpringerPlus 213, 2:148 a SpringerOpen Journal RESEARCH Protein co-migration database (PCoM -DB) for Arabidopsis thylakoids and Synechocystis cells Atsushi Takabayashi 1,2*, Ryosuke
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationAffinity Purification of Photosystem I from Chlamydomonas reinhardtii using a Polyhistidine Tag
Affinity Purification of Photosystem I from Chlamydomonas reinhardtii using a Polyhistidine Tag Jonathan A. Brain Galina Gulis, Ph.D. 1 Kevin E. Redding, Ph.D. 2 Associate Professor of Chemistry Adjunct
More informationPSI photoinhibition is more related to electron transfer from PSII to PSI rather than PSI redox state in Psychotria rubra
Photosynth Res (2016) 129:85 92 DOI 10.1007/s11120-016-0275-5 ORIGINAL ARTICLE PSI photoinhibition is more related to electron transfer from PSII to PSI rather than PSI redox state in Psychotria rubra
More informationSupplementary Figure 1. Overview of steps in the construction of photosynthetic protocellular systems
Supplementary Figure 1 Overview of steps in the construction of photosynthetic protocellular systems (a) The small unilamellar vesicles were made with phospholipids. (b) Three types of small proteoliposomes
More informationSupplementary Figures
J. Cell Sci. 128: doi:10.1242/jcs.173807: Supplementary Material Supplementary Figures Fig. S1 Fig. S1. Description and/or validation of reagents used. All panels show Drosophila tissues oriented with
More informationExposure of the shaded side of apple fruit to full sun leads to up-regulation of both the xanthophyll cycle and the ascorbate glutathione cycle
Plant Science 1 (24) 1479 148 Exposure of the shaded side of apple fruit to full sun leads to up-regulation of both the xanthophyll cycle and the ascorbate glutathione cycle Fengwang Ma 1, Lailiang Cheng
More informationThe coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationBIOCHEMISTRY - CLUTCH REVIEW 6.
!! www.clutchprep.com CONCEPT: AMINO ACID OXIDATION Urea cycle occurs in liver, removes amino groups from amino acids so they may enter the citric acid cycle 2 nitrogen enter the cycle to ultimately leave
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More information