Nature Genetics: doi: /ng.3731
|
|
|
- Barbara Thompson
- 5 years ago
- Views:
Transcription
1
2 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver samples were prepared under DD conditions in Yoshitane et al. 6, Koike et al. 4 and Vollmers et al. 7 and under LD conditions in Menet et al. 5. (b) Circadian expression profiles of two isoforms of Adar p15 and p11 in the mouse liver examined by qrt-pcr analysis. The signals were normalized to Rps29 (mean ± SEM; n = 3). (c) Temporal profiles of Arntl and Adarb1 mrnas (determined by qrt-pcr) and the editing levels at the Flnb Q/R site (determined by direct sequencing analysis) in mouse liver through 3 days in DD. (d) Temporal expression profiles of Adarb1, Adarb1 long isoform, Adar p15, Adar p11, Adarb2, Dbp and Arntl in mouse tissues. The signals were normalized to Rps29 (mean ± SEM; n = 3). (e) Temporal profiles of the editing levels at the Q/R site of Flnb, the Y/C and I/M sites of Cacna1d and the A and B sites of Htr2c in direct sequencing analysis (mean ± SEM; n = 3). (f) Temporal profiles of ADARB1 protein levels (top panel, indicated by an arrowhead) in control and Adarb1-KO liver nuclear extracts. Non-specific bands were indicated by asterisks. TBP served as a loading control (bottom panel). (b, d, e) The temporal changes were analyzed by one-way ANOVA, * p <.5, ** p <.1, *** p <.1 and n.s. p.5.
3
4 Supplementary Figure 2 Circadian regulation of A-to-I RNA editing in mouse liver. (a) Direct sequencing chromatograms from RT-PCR products of Cdk13 mrna at various times of the day. (b) Circadian profiles of editing levels at the Cdk13 Q/R site in direct sequencing analysis (mean ± SEM; n = 3). (c) Regulation of alternative splicing of Adarb1 transcripts by Adarb1-mediated editing. The self-editing site is shown as a closed circle, and the indicated PCR primer set amplifies only the long isoform. (d) Circadian expression profiles of the long (top) and short isoforms (middle) of Adarb1 transcripts, determined by RT-PCR analyses. The relative band intensities [long / (long + short) (%)] were plotted (bottom). The gene specific primers used in this RT-PCR were described in Supplementary Table 6. (e) Direct sequencing chromatograms from RT-PCR products of Cog3 and Copa mrnas at various times of the day. (f) Circadian profiles of editing levels [G / (A+G) (%)] at the indicated editing sites in RNA-Seq analysis (top and 3rd panels) and in direct sequencing analysis (2nd and bottom panels, mean ± SEM; n = 3). (g) Neighbor preferences of ADAR and ADARB1 represented by Two Sample Logo sequence motifs. Logo displays enriched bases above the upper line and depleted bases below the lower line on both sides of the central edited adenosine. (h) Trinucleotide preferences of ADAR and ADARB1. (b, f) The temporal changes were analyzed by one-way ANOVA, * p <.5, ** p <.1, *** p <.1, n.s. p.5 and N.D. not detected.
5
6 Supplementary Figure 3 Gene expression rhythms revealed by RNA-seq in Adarb1-knockout mice. (a) Comparison between two biological replicates of transcript expression levels (FPKM) exhibited a high degree of reproducibility with an average R 2 value of.98. (b) Overlap of rhythmic transcripts between control (black) and Adarb1-KO liver (yellow). A solid line circle indicates rhythmic transcripts with strong rhythmic expression, and a dotted circle indicates those with weak rhythmic expression. (c) Temporal expression profiles of Slcola4 and Aim1l in qrt-pcr analysis. The signals were normalized to Rps29 (mean ± SEM; n = 3). The temporal changes were analyzed by one-way ANOVA, * p <.5, ** p <.1 and n.s. p.5. (d) Temporal expression profiles of Cpeb2, Hmgxb4 and Gmeb1 in RNA-Seq analysis (Data are mean; n = 2). (e) Pie charts showing the enrichment of transcripts that were defined as arrhythmic at nascent RNA levels in the previous study 5. (f, g) Circadian expression profiles of typical clock genes in RNA-Seq analysis (f) and in qrt-pcr analysis (g) of control and Adarb1-KO mouse liver. In panel g, the signals were normalized to Rps29 (mean ± SEM; n = 3). (h) A heat map of rhythmically expressed genes both in control and Adarb1-KO mice (n = 659). Gene expression levels of two biological replicates across time points were shown in each lane corresponding to one gene, ordered by the phases. High expression levels were displayed in yellow and low in blue. (i) A histogram of acrophase (circadian peak phase) of the 659 rhythmic genes in both genotypes.
7
8 Supplementary Figure 4 Short-period phenotype of ADARB1 deficiency. (a) Differences in circadian peak phase (Δacrophase) of the 659 rhythmic genes between control and Adarb1-KO mouse liver (*** p <.1 by Paired t-test). The acrophase in control was set to. (b) In NIH3T3 cells transiently transfected with an shrna expression vector (control sh, Adarb1_sh1, Adarb1_sh2 or Adarb1_sh3), Adarb1 mrna levels were examined by qrt-pcr. The signals were normalized to Rps29 (mean ± SEM; n = 3; ** p <.1 by Student's t-test). (c) Unsynchronized NIH3T3 cells were transiently transfected with a Flag-ADARB1 expression vector in combination with an shrna expression vector (control sh, Adarb1_sh1, Adarb1_sh2 or Adarb1_sh3). The cell lysates were subjected to immunoblotting. ACTB served as a loading control. (d, e) A representative set of bioluminescence rhythms of Fig.4c (d) and 4d (e) was shown. (f) Circadian profiles of CRY1 (arrowhead), PER2, CLOCK and ARNTL proteins in control and Adarb1-KO mice liver nuclear extracts (mean ± SEM; n = 3; * p <.5 by Student's t-test). Nonspecific bands are indicated by asterisks. (g) Dual luciferase reporter assay in unsynchronized NIH3T3 cells transiently transfected with a luciferase- Cry2 3 -UTR reporter (nt ) in combination with a let-7g expression vector (mean ± SEM; n = 3; * p <.5, ** p <.1 and n.s. p.5 by Student's t-test). The relative luciferase activities were normalized to the signals from the cells transiently transfected with an empty pcdna3.1/v5-his plasmid, and the mean value of the empty luciferase reporter was set to 1. (h) Circadian periods of synchronized NIH3T3 cells transiently transfected with a Arntl-luciferase reporter in combination with control sh, Adarb1 shrna and let- 7g expression vectors (mean ± SEM; n = 6; * p <.5, *** p <.1 by Student's t-test). (i) A model for the ADARB1-mediated regulations of the rhythmical A-to-I RNA editing events and global circadian outputs. The circadian expression of Adarb1 by CLOCKdependent transactivation produces the rhythmic profiles of ADARB1-dependent A-to-I RNA editing. ADARB1 plays an essential role for the robust circadian oscillation by suppressing CRY2 expression through the regulation of mirna biogenesis. ADARB1-mediated post-transcriptional regulation contributed to circadian profiles of steady-state mrna levels and global circadian outputs.
9 Terajima et al., Table S4 Repeat families B1 B2 B4 ERV1 ERVK ERVL ERVL_MaLR L1 L2 Registered editing sites (8,41) 3,357 1, Editing sites in this study (389) Rhythmic Editing sites in this study (132)
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplementary Information for
Supplementary Information for Involvement of urinary bladder Connexin43 and the circadian clock in the coordination of diurnal micturition rhythm Hiromitsu Negoro, 1,2 Akihiro Kanematsu, 1,3 Masao Doi,
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs.
Supplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs. (a) Dose-responsive expression of tper2 by Dox. Note that there are
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
CIRCADIAN SIGNALING NETWORKS
Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P. Matthias and RG Clerc Roger G. Clerc 07.05.2014 CIRCADIAN SIGNALING NETWORKS Master pacemaker SCN «Slave clocks»
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Supplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Transcription Regulation And Gene Expression in Eukaryotes (Cycle G2 # )
Transcription Regulation And Gene Expression in Eukaryotes (Cycle G2 #13709-01) CIRCADIAN SIGNALING NETWORKS RG. Clerc May 19. 2010 www.fmi.ch/training/teaching Circadian rythms : most physiological processes
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Histogram showing hybridization signals for chicken (left) and quail (right) genomic DNA analyzed by Chicken GeneChip (n=3). www.nature.com/nature 1 Supplementary Figure 2. Independent
Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination
Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Supplementary. properties of. network types. randomly sampled. subsets (75%
Supplementary Information Gene co-expression network analysis reveals common system-level prognostic genes across cancer types properties of Supplementary Figure 1 The robustness and overlap of prognostic
Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication
Manuscript EMBO-2010-74756 Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication Tsai-Ling Liao, Chung-Yi Wu, Wen-Chi Su, King-Song Jeng and Michael Lai Corresponding
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
SUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1