THE ROLE OF MAREK S DISEASE VIRUS MEQ GENE PRODUCTS ON MDV PATHOGENICITY AND ONCOGENICITY. Huimin Dong

Transcription

1 THE ROLE OF MAREK S DISEASE VIRUS MEQ GENE PRODUCTS ON MDV PATHOGENICITY AND ONCOGENICITY by Huimin Dong A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Master of Science in Animal Science Summer 2011 Copyright 2011 Huimin Dong All Rights Reserved

2 THE ROLE OF MAREK S DISEASE VIRUS MEQ GENE PRODUCTS ON MDV PATHOGENICITY AND ONCOGENICITY by Huimin Dong Approved: Mark S. Parcells, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: Jack Gelb Jr., Ph.D. Chair of the Department of Department Animal and Food Science Approved: Robin W. Morgan, Ph.D. Dean of the College of Agriculture and Natural Resources Approved: Charles G. Riordan, Ph.D. Vice Provost for Graduate and Professional Education

3 ACKNOWLEDGMENTS I would like to thank my advisor Dr. Parcells for all of his advice and assistance. Phaedra Hontz, Erin McDowell, Shireen Shaikh, Upendra Katneni, Syamsundar Gaddamanugu and Juniana Rojas for their help and friendship. Also, I would like to thank my parents for their unconditional support and faith in my abilities when I was in doubt. Without their encouragement, none of this could have been possible. Finally, thanks to all my friends, Kun, Xin, Yue, for all kinds of support and help. iii

4 TABLE OF CONTENTS LIST OF TABLES... vii LIST OF FIGURES... viii ABSTRACT... ix Chapter 1 GENERAL INTRODUCTION Marek s disease Marek s Disease Virus (MDV) The MDV genome Serotypes of MDV Pathogenesis Early cytolytic phase Latency Secondary cytolytic phase Transformation Meq Meq dimerization partners Meq-binding proteins Meq spliced products MD vaccination and the evolution of field strain virulence Meq mutations and the evolution of MDV virulence Hypotheses and specific aims The role of Meq spliced products in latency and transformation Construction and characterization of an RB1Bbased Meq deletion virus (RB1BMeqKO) iv

5 Characterization of an MD5-based recombinant MDV, rmdv MATERIALS AND METHODS Cells Antibodies Immunoblotting Meq protein expression cell line establishment RNA purification and RT-PCR Cell proliferation assay Construction of prb1bmeqko Southern blot analysis Chromatin immunoprecipitation (ChIP) assays In vivo characterization of rmdv-1137 and prb1bmeqko Virus reisolation MDCC cell line establishment Flow cytometric analysis Replication of prb1bmeqko in cell culture RESULTS Expression of Meq products during infection Effects of the Meq proteins on cell proliferation in cell culture The binding of Meq proteins to the MDV genome Construction of prb1bmeqko Characterization of prb1bmkeqko in cell culture and in vivo Characterization of rmdv-1137 in vivo Characterization of RB1B- and rmdv derived cell lines DISCUSSION Contribution of Meq gene products to cellular transformation Contribution of Meq to the replication of prb1b Contribution of RB1BMeq to MD5 replication and oncogenicity Conclusion FIGURES TABLES REFERENCES v

6 Appendix A Biosafety approval -rmdv-1137 in vivo study B Biosafety approval -prb1bmeqko in vivo study vi

7 LIST OF TABLES Table 1 Primers for RT-PCR analysis and prb1bmeqko generation Table 2 Primers used for chromatin immunoprecipitation (ChIP) analysis Table 3 Treatment groups and virus dosages for in vivo studies Table 4 Virus reisolation from contact-exposed chickens in rmdv-1137 in vivo study Table 5 Mortality and tumor incidence of rmdv-1137 in vivo study Table 6 Tumor sites for RB1B-, rmdv and MD5-infected chickens Table 7 Immunophenotypes of RB1B- and rmdv-1137-derived cell lines Table 8 Virus reisolation from contact-exposed chickens in prb1bmeqko in vivo study Table 9 Mortality and tumor incidence of prb1bmeqko in vivo study vii

8 LIST OF FIGURES Figure 1 Domain structure of Meq, Meq/vIL-8 and Meq/vIL-8-Δexon Figure 2 Analysis of Meq protein expression in vivo Figure 3 Expressing of Meq proteins in UD37 and UA20 cell lines Figure 4 Effect of Meq proteins expression on HTC cell proliferation Figure 5 Chromatin immunoprecipitation analysis of MDV genomebinding by Meq proteins Figure 6 Southern blot analysis of prb1bmeqko Figure 7 Meq promoter region analysis of prb1b and prb1bmeqko Figure 8 Single-step growth curves of prb1b and prb1bmeqko Figure 9 Replication of prb1b, prb1bmeqko, and MD5 replication in vivo Figure 10 Pathogenicity of rmdv viii

9 ABSTRACT Marek s Disease (MD) is a lymphoproliferative disease of chickens caused by Marek s disease virus (MDV). MDV induces rapid-onset T-cell lymphomas in chickens and T-cell transformation requires expression of a viral protein called Meq, (Marek s EcoRI-Q-encoded protein). Previously, we reported that changes in the coding sequence of Meq correlated with increased virulence. Our present study had three aims. The first aim was to determine the expression pattern of Meq proteins in vivo and to characterize their functions. Our data indicated that full-length Meq was expressed during lytic infection in vivo, with a peak in expression at three weeks. Meq splice-variant proteins were first observed at this time point, and these were also observed in MDV-induced tumors, and MDV-transformed cell lines. All Meq proteins induced cell proliferation, bound to the MDV genome at Meq, ICP4, and pp38/pp14 promoters, but only full length Meq functions as a transcriptional activator. The second research aim was to examine the replication and pathogenesis of an RB1B-based double Meq knock-out virus. Our results suggest that the deletion of meq had no effect on its lytic replication in cell culture, but markedly attenuated the virus (RB1BMeqKO) in vivo. Unlike an MD5-based Meq deletion virus (MD5 Meq), RB1BMeq KO replicated to a very low level and caused no thymic atrophy. As a third research aim, we examined the effect of three Meq point mutations on changes in pathogenicity using an in vivo-selected recombinant virus, rmdv rmdv-1137 had the RB1B form of Meq expressed within the context of the MD5 genome. rmdv-1137 resembled both RB1B and MD5 in vivo, in terms of replication, ix

10 transmission, and pathogenicity. rmdv-1137 induced tumors from which we were able to establish cell lines similar to RB1B-, but not from MD5-induced lymphomas. Our data suggests that changes in meq sequence mediate subtle changes in oncogenicity and that the background strain also affects MDV pathogenicity and oncogenicity. x

11 Chapter 1 GENERAL INTRODUCTION 1.1 Marek s disease Marek s Disease (MD) was initially described by Hungarian veterinary pathologist Jozsef Marek as an inflammation of major nerves in layer chickens in 1907 (60). The disease was seen as paralysis in older, layer chickens and upon histopathological evaluation, nerves showed marked inflammation and demyelination. In 1929, Pappenheimer and colleagues first identified lymphomas also associated with this nerve inflammation and for the next 40 years, the condition was referred to as Neurolymphomatosis gallinarum (65). As birds suffering MD and avian leukosis showed the similar clinical symptoms and pathological changes, it was not until 1954, over 40 years after the first description of MD, that MD was successfully differentiated from avian leukosis (21). The causative agent, a cell-associated herpesvirus, Marek s Disease Virus (MDV), was then identified in 1969 (27, 28). MD is of great economic importance; not only because of its direct consequence causing mortality and carcass condemnation, but also due to the immunosuppression it induces, which can lead to secondary infection. MDV enters birds as infectious dander via inhalation (9). The signs of MD depend on the virus strain, host susceptibility, and exposure dosage, varying from mild paralysis, to rapid paralysis, lymphoma formation, and severe dermatitis in the skin (red leg, skin leukosis). The genetic susceptibility of the host, its vaccination status, 1

12 levels of maternal antibodies, and age of exposure also contribute to the clinical presentation in infected birds (91). 1.2 Marek s Disease Virus (MDV) The MDV genome The MDV genome is a linear, double-stranded DNA of approximately 180 kbp (103). MDV belongs to the genus Mardivirus, a member of the Alphaherpesvirinae subfamily of the family Herpesviridae. There are two members of the genus Mardivirus, Marek s disease virus serotype 1 and 2 (MDV-1 and MDV-2). An antigenically-related serotype of MDV is serotype 3 or Meleagrid herpesvirus, more commonly known as herpesvirus of turkeys (HVT). All MDVs share the same genome structure. The genome of MDV has two unique regions, unique short (Us) and unique long (U L ), flanked by inverted internal (IR L,IR S ) and terminal repeats (TR L,TR S ). TR L and IR L as well as IRs and TRS are present in inverse orientation with identical sequences. During replication, four isomeric forms of viral DNA can be formed by inversion of U L and U S regions relative to each other through homologous recombination between the repeats (84) Serotypes of MDV The genomes of MDV-1, MDV-2 and HVT strains have be sequenced, and the comparison of their sequences indicates that the sequence similarity between them ranges from 50% to 80%, and the genomes are largely collinear, with the main differences being in the repeat flanking the U L region (1, 40, 45, 54, 104). Genus- and type-specific genes are present in these three genomes, and are located in the inverted 2

13 repeat regions, predominantly TR L and IR L (45). Only MDV-1 causes clinical disease in chickens, while MDV-2 and HVT are both non-pathogenic (89, 107) Pathogenesis The Cornell Model describes the pathogenesis of MD with four phases: early cytolytic, latency, secondary cytolytic, and transformation (18) Early cytolytic phase MDV is taken into chickens through inhalation of infectious dander, and enters the circulation via phagocytosis by the lung epithelium, which transfer the virus to recruited macrophages and B-cells (6, 9). The virus genome is detectable in primary and secondary lymphoid tissues, bursa of Fabricius, thymus, spleen and cecal tonsils, as early as 2-7 dpi, accompanied by expression of MDV early protein pp38 and lymphocytolysis with necrosis and infiltration of inflammatory cells (7). Macrophages have been shown to support some level of lytic infection and increased infection of macrophages has been seen with higher virulent MDVs (e.g. C12/130) (8). The main target cells of this early lytic phase are B cells, which are substantially eliminated in bursa of Fabricius and circulation (97). However, B cells in the spleen are not essential for MDV replication, as surgical removal of spleens either had no effect on the appearance of latently-infected blood lymphocytes, nor did it abolish lymphoma development (88). During this lytic phase of infection, the activation of T cells, particularly CD4+ cells, is observed. During this phase, no infectious cell-free virus is produced, and it is still unknown how the virus spreads between cells. However, Wu et al. shows that gh/gl complex is essential for spreading between uninfected cells (109), and others 3

14 have demonstrated that gb (92), ge/gi, gm/gn and VP22, are essential for MDV cellto-cell spreading (38, 93, 101) Latency Following the early cytolytic phase of infection, MDV establishes latency in T- cells, primarily CD4+ T-cells (97). The definition of herpesvirus latency is the persistence of the viral genome in infected cells without the production of infectious virus. By 6-7 dpi, the MDV lytic antigen expression subsides in lymphoid organs and the switch from early lytic phase to latency phase starts. The host immune response to lytic infection has been shown to play an essential role in switching from cytolysis to latency (17). The role of host factors in latency is supported by the findings that immunosuppression prior to infection with MDV leads to prolonged early lytic infection, and chemically-induced immunosuppression after latency leads to reactivation and cytolytic infection. Latency-maintaining factor (LMF) and host cytokines, as well as soluble mediators (nitric oxide, NO), are involved in maintaining latency (17, 110). In addition, unlike the early lytic phase, the predominant infected cells in latency are CD4+ TCR αβ+ T cells, which can be detected as early as 3 dpi. During latency, transcription of the viral genome is limited to latencyassociated transcripts (LATs), a complex family of spliced RNAs localizing to nucleus, that is abundant in MDV-transformed cells, but reduced upon MDV reactivation (22). Meq also plays a role in maintaining latency by blocking apoptosis of CD4+ cells (55), transactivating latent gene expression (68), and suppressing the promoters of MDV lytic genes ICP4 and pp38/pp14 (56). 4

15 Secondary cytolytic phase The virus undergoes reactivation and another semi-productive infection and cytolysis cycle approximately 3-4 weeks post-infection, coincident with the immunosuppression associated with proliferation of latently-infected CD4+ T-cells (18). Although it is still unknown what causes the virus switch from latency to secondary cytolytic phase, it has been confirmed that once the virus is reactivated from latency, the virus replicates within the feather follicle epithelium (FEE) and will be shed to the environment in the dander, where it can remain infectious essentially indefinitely (19). Expression of glycoprotein D (gd) was believed to be associated with virus shedding, as it is only expressed in FFE in vivo (63). However interruption of the gd-encoding gene (U S 6) does not prevent horizontal transmission (2). More recently, glycoprotein C (gc) and the protein kinase encoded by the U L 13 gene was found to be essential for horizontal transmission of MDV (42). The mechanisms regulating MDV productive infection at this site are currently unknown, however Transformation During the secondary cytolytic phase, the transformation phase of infection becomes apparent, in which latently-infected CD4+ T cells proliferate and give rise to lymphomas. The spleen is a primary site for lymphomas formation, however, it is not essential for this, because splenectomized birds still develop tumors (88). Lymphomas have been observed in multiple organs, including the spleen, kidney, liver, intestine, and skin. MDV-transformed cells are a mixed population of T-lymphocytes expressing CD30, Marek s EcoRI-Q-encoded protein (Meq), MHC-II, and Marek s-associated tumor surface antigens (MATSAs) (16, 52). CD30 is a host-encoded surface antigen, which is over-expressed in EBV-associated human lymphomas such as Hodgkin s 5

16 lymphoma, in which it is called the Reed-Sternberg antigen (16). The proposed function of CD30 in tumor formation is that it contributes to polarization of the host immune response to a T H2 or humoral response, an ineffectual response in anti-tumor immunity (94). Thus, MDV-transformed T-cells appear to have a T H3 or T-regulatory (T reg ) immunophenotype (94). The relationship between latently infected cells and transformed cells is unclear, but it is confirmed that the episomal and integrated copies of MDV genome co-exist (36), with integrated forms being much more common. The site of integration is randomly distributed and transformation is associated with the integration sites near telomeres of the host s mini-chromosomes and larger chromosomes (35, 36, 61). Integration of the MDV genome may inhibit the expression of cytolytic gene expression and/or enhance the latency and transformation associated gene transcription. In a recently-described model for MDV latency, the MDV genome was found to integrate in an REV-transformed T-cell line and remain hypomethylated, indicating that DNA methylation is not directly involved in the silencing of lytic-phase genes during latency (4, 5) Meq Meq is the most consistently expressed MDV gene expressed in transformed cells (44). Meq is a 339 a. a. monocistronic protein, which expressed only by MDV-1 strains in transformed cells and tumor cells lines (43). Mild and virulent MDVs (m/vmdvs) from the 1960s and 1970s encode a larger form of Meq, which is 398 a. a. and these contain reiterations of a C-terminal, proline-rich repeat (PPR) domain (95). Meq is comprised of a basic DNA binding domain at its N-terminus followed by a leucine zipper dimerization motif (bzip). Meq has a long C-terminal transactivation 6

17 domain composed of proline-rich duplications followed by a 39 a.a. activation domain (79) Meq dimerization partners Via its leucine zipper (ZIP) domain, Meq can either form homodimers with itself or heterodimers with cellular protein, such as c-jun and ATF (78). Meq has been shown to dimerize with c-jun, CREB, ATF-1, -2, -3 and Fra-2 (55) and Jun-B, Jun-D, and NFIL3 (81). The form readily found in tumors in cell lines is the Meq/c-Jun heterodimer (55). It has been shown that Meq can serve as a transcriptional activator or repressor depending on its dimerization partner (79). As a heterodimer, Meq/Jun binds to AP-1-like sites, such as its own promoter and the chicken IL-2 promoter (56). As a homodimer, Meq shows high affinity binding to a core sequence of ACACA, which is a DNA-bending motif present in the MDV genome at the origin of replication, the ICP4 promoter and at the bidirectional promoter of pp38/pp14 (78). These predicted consensus sites have been confirmed to bind Meq in vivo (56). The target genes of Meq have been examined in DF-1 cells through microarray analysis (55). In addition to blocking pro-apoptotic and inducing proliferation and anti-apoptotic genes, many of the Meq-responsive genes are cytoskeleton-associated genes, as well as those involved in cell-extracellular matrix interaction, suggesting that Meq, together with cellular b-zip proteins, may play an essential role in changing cell shape and mobility. In addition, as the only major oncogene to be identified so far in MDV, the transforming property of Meq has been supported by data that Meq can promote anchorage-independent growth, anti-apoptosis and cell cycle progression (57, 58). 7

18 As AP-1 transcription factors are well defined in their ability to bind to defined sequences found in many the promoters of genes associated with cell proliferation, the homology shared between Meq and c-jun suggests the possibility of Meq in regulating transcription through its dimerization as well. It has been confirmed by Levy et al., that expression of Meq upregulates the genes similar to those upregulated by v-jun, indicating Meq transformation is very similar to the retroviral v-jun transformation pathway (55). Moreover, the Meq/Meq homodimer itself is not sufficient to induce tumors (99), but is required for transforming T-cells, as recombinant viruses having bzip domains that can form only homo- or heterodimers, could not induce tumors in vivo, despite replication in vivo and in cell culture(12, 100) Meq-binding proteins Meq also interacts with several cell cycle regulatory proteins. Meq binds to p53 via its b-zip domain through the C-terminal tetradimerization domain of p53 (48). Meq can also bind to the Retinoblastoma (Rb) protein through a pocket-protein binding LXCXE domain (where X is any amino acid) at the end of the leucine zipper region (79). It also has been shown that Meq interacts with C-terminal binding protein 1 (CtBP-1), which is a highly conserved cellular transcription co-repressor (11). The interaction between the motif Pro-Leu-Asp-Leu-Ser (PLDLS) of Meq and CtBP-1 is critical for inducing lymphomas, as the mutation in this binding motif completely abolishes oncogenesis (11). Besides p53 and Rb, Meq can interact with cyclin dependent kinase 2 (CDK2), the main kinase involved in the phosphorylation of Rb during cell cycle progression (58). CDK2 can phosphorylate Meq at residue serine 42 (S42) and this results in the translocation of Meq to cytoplasm. The importance of this 8

19 cytoplasmic trafficking of Meq is unclear with respect to its function. In addition, Meq binds the chaperone HSP-70, as well (111) Meq spliced products In addition to the full-length, unspliced form of Meq, at least two splice variants were detected (5) (described later). A 700 bp of Meq alternative spliced transcript was named as Meq-sp or MeqΔC-BamL and later described as Meq/vIL-8. It encodes a 28kDa nuclear protein, and it has been found in MDV transformed lymphoid cell line, MKT-1 and a non-pathogenic vaccine strain, CVI-988 (74). Meq/vIL-8 connects the bzip domain of Meq to exons 2 and 3 of vil8, an MDVencoded chemokine (70, 71). Peng and Shirazi reported that Meq/vIL-8 could bind to an AP-1 site with the consensus sequence of TGAGTCA when it dimerizes with c- Jun, but not with full length Meq (73). They also reported that C-terminal of Meq/vIL- 8 has little transactivation activity in a CAT reporter assay and concluded it as a dominant negative regulator of Meq (73). Subsequent analysis via fluorescence resonance energy transfer (FRET) and fluorescence recovery after photobleaching (FRAP) indicated that Meq does not interact with Meq/vIL-8 in vivo and they showed different nuclear mobilities (3). In MDV-transformed cells as well as Meq expression cells, Meq localizes to the nucleus, nucleolus and at Cajal bodies (3, 58). Within the nucleus, Meq migrates very quickly with mobility consistent with its function as a transcription factor (3). The spliced form of Meq, however, shows very different migration rates and appears to localize primarily to structural sites within the nucleolus, Cajal bodies, and nucleoplasm (3). 9

20 1.2.5 MD vaccination and the evolution of field strain virulence MD has been successfully controlled by vaccination since the first use of a vaccine produced from an attenuated serotype 1 MDV (MDV-1), HPRS-16att (29). HPRS-16att was used primarily in Europe and the UK, while the apathogenic herpesvirus of turkeys (HVT) was used in the US (107). However, vaccination blocks tumor formation, but does not prevent challenge field strain viruses from replicating and shedding. There have been at least two distinct increases in MDV virulence since the advent of large scale vaccination. A first increase in MDV virulence, however, began in the mid-1960s, and it has been attributed to high breeding density and mixed-aged farms. The virus isolated from the vaccinated but infected birds was termed virulent MDVs (vmdvs), or acute MDV strains (10). However, a few years after using HVT vaccine in the early 1970s (64), another increase in virulence was observed, causing visceral lymphomas and profound immunosuppression (91, 105). The specific viruses were termed very virulent MDVs (vvmdv), leading to the replacement of the monovalent HVT vaccine with bivalent vaccination using HVT in conjunction with an apathogenic MDV of chickens, MDV-2 (20, 23, 24, 108). The first MDV-2 strain isolated was SB-1, and this strain is used primarily in US bivalent vaccines (90). Together with the implementation of in ovo vaccination as a labor-saving practice (87), MD had been largely controlled for a decade. Another increase in MD losses occurred during the early 1990s, that was later connected with the emergence of an even more virulent pathotype, vv+ MDVs (106). The isolation of field strains that could routinely cause vaccine breaks in bivalentlyvaccinated chickens necessitated the use of an attenuated MDV-1 strain initially used as a vaccine in Europe (82, 83). This strain CVI988 or Rispens, is used in combination 10

21 with HVT or in trivalent combination with HVT and SB1 in broiler breeders and layers, but is not usually used in broilers (15) Meq mutations and the evolution of MDV virulence In an attempt to identify genetic changes associated with increasing virulence, Shamblin et al. compared the sequences of the major glycoproteins, phosphoprotein 38 (pp38)-coding regions, and Meq genes of strains representing different pathotypes, from vmdv to vv+mdv (95). No pathotype-associated genetic changes in pp38, or the major glycoproteins were found, but pathotype-specific mutations in Meq appeared to correlate with virulence evolution. Briefly, lower virulent MDVs showed point mutations in the amino terminal basic region involved in nucleoli localization motif and expansions in a 21 a.a. proline-rich repeat (from three copies to five or more). Higher virulent MDV strains had point mutations in the proline-rich repeats that interrupted the stretches of four prolines at the second position (PPPP P(Q/A)PP), with strains of highest virulence having insertions at all three PPPP sequences. In addition, all vv+mdv Meqs had an amino acid substitution at the putative retinoblastoma protein (Rb)-binding domain (LaChE -> LaRhE). The restoration of this motif in vv+ MDV Meq form significantly increases the proliferation induction ability in cell culture suggesting that the changes of binding affinity between Meq and Rb may affect the ability of these strains in regulating cell cycle mediated by Rb family proteins (Kumar et al., unpublished). In addition to these mutations in Meq, our lab reported a deletion of 12 bp within the signal peptide of glycoprotein L (gl) found in some of the vv and vv+mdv strains (95), A major focus of the Parcell s laboratory has been identifying the mechanism by which these mutations may affect MDV virulence. 11

22 1.2.7 Hypotheses and specific aims The focus of my research has been on the function of Meq proteins as they relate to latency, transformation and the evolution of MDV virulence. Much of this research has been ongoing in the laboratory and my research has been focused in three areas: (1) the role of Meq spliced products in MDV latency and transformation, (2) the construction and characterization of a RB1B-based Meq deletion mutant, and (3) the characterization of a recombinant MDV having the genetic background of MD5 and the Meq gene of RB1B The role of Meq spliced products in latency and transformation As we described above, Meq is the primary oncoprotein of MDV, and the deletion of Meq or even a mutation of a specific motif completely blocks the tumor formation (11, 59). We reported that downstream of Meq, MDV encodes a vil-8 homolog, deletion of which significantly reduces the lytic replication of MDV in vivo, and decreased oncogenicity (71). We speculated that the loss of tumor formation was not only due to the loss of vil-8, but also the loss of Meq spliced variant expression. The initial identification of a spliced form of Meq, connecting the amino terminal basic region and part of the leucine zipper to vil-8 (Meq/vIL-8) was by Peng and Shirazi and they speculated that it may function as a negative regulator of Meq (73). Subsequent work employing fluorescently-tagged version of Meq and Meq/vIL-8 indicated that they showed that they showed different nuclear mobilities and did not interact with each other (3). Together with the domain analysis of Meq/vIL-8 (Figure 1), we hypothesized that not only full length of Meq, but also at least two other spliced variants, are involved in MDV oncogenicity. 12

23 The specific aims of this project were: 1) Detect the expression of Meq protein products in vivo, 2) Characterize the functions of Meq spliced products in cell culture. The first aim was achieved by examining the protein expression of samples obtained from in vivo studies during the course of MDV infection, in MDV- induced tumors and in MDV-derived cell lines. This work has been essential to provide direct evidence of the timing of Meq protein expression in vivo. The second aim was divided into several sub-aims. As Meq spliced variants retain the nuclear localization signal, DNA binding motif, and N-term from Meq (Figure 1), we tested whether Meq spliced variants were involved in cell transformation by testing their abilities to induce cell proliferation. Another aspect of their function that we examined was to determine if all forms of Meq bind to the MDV genome. This sub-aim was examined experimentally via chromatin immunoprecipitation (ChIP) assays Construction and characterization of an RB1B-based Meq deletion virus (RB1BMeqKO) An MD5 strain-based deletion virus (MD5 Meq) was found to be attenuated for oncogenicity and has subsequently been found to induce protection to vv+mdv challenge (49, 59, 98). In our laboratory, we have found that MD5 Meq showed profound thymic atrophy in SPF chickens (data not shown), which lack maternal antibody to MDV. Commercial broiler chickens did not show thymic atrophy when vaccinated with MD5 Meq, however the thymic atrophy seen in SPF chickens demonstrated that this vaccine would not be safe according to government licensing standards. To test whether the background strain of MDV could affect the safety of a Meq deletion virus, we constructed a double Meq deletion virus using the BAC-based 13

24 prb1b strain and selectable markers (Kan and Amp) to replace each copies of Meq. This virus, prb1bmeqko was compared to its parent virus (RB1B) in terms of its replication in cell culture, its pathogenicity in vivo, and its ability to cause thymic or bursal atrophy in SPF chickens Characterization of an MD5-based recombinant MDV, rmdv-1137 Previous research in our laboratory suggested that mutations in Meq may directly affect MDV virulence. One means by which we attempted to make recombinant MDVs, prior to the use of BAC-based technology, was to select recombinant MDVs in vivo through the co-transfection of CEF with MD5 Meq and the cloned Meq loci from v, vv and vv+mdvs. After two in vivo selection studies, we were able to isolate one strain, rmdv-1137 having the meq gene of the RB1B strain inserted into the MD5 genome (Kumar et al., 2011, submitted). We have characterized rmdv-1137 in comparison to MD5 and RB1B parental viruses, with regards to their pathogenicity in vivo, their oncogenicity, the composition of tumors caused by these viruses, and the immunophenotype of cell lines established from tumors. 14

25 Chapter 2 CHAPTER 1MATERIALS AND METHODS 2.1 Cells The cell culture transformed macrophage/monocyte cell line, HTC (80) was used for establishing expression cell lines. HTC cells were maintained in DMEM (GibcoBRL) supplemented with 10% FBS, 1X PSN and 1X fungizone at 37 C with 5% CO 2. For viremia determination and virus normal propagation, Chicken embryo fibroblasts (CEF) were used. CEFs were prepared from specific-pathogen-free (SPF) 10-day-old embryonated eggs (Sunrise Inc., Catskill, N.Y.), and are maintained in M199 media supplemented with 3% calf sera (Life Technologies), 1X PSN and 1X fungizone. 2.2 Antibodies For the detection of Meq gene products, we used a polyclonal antibody to Meq that was generated using the first 169 a.a. expressed in a bacterial expression system and was a kind gift of Dr. Lucy F. Lee, USDA-Avian Disease and Oncology Laboratory (USDA-ADOL) (50). The anti-meq antibody was diluted 1:2000 for use in immunoblotting. A monoclonal antibody to glyceraldehyde 3 - phosphate dehydrogenase (GAPDH) was obtained commercially (US Biologicals) and was used at 1: 1000 dilution for immunoblotting. A polyclonal antibody to the MDV US1 protein was used at 1: 750 dilution as described here (14). 15

26 2.3 Immunoblotting For SDS-PAGE analysis, cell were lysed in radioimmune precipitation assay buffer (RIPA, 50 mm Tris, ph 8.0, 150 mm NaCl, 1mM EDTA, 1% NP-40, 0.25% sodium deoxycholate) supplemented with protease and phosphatase inhibitors [pepstatin A, leupeptin, aprotinin (1 µg/ml each) and phenylmethyl sulfonyl fluoride (PMSF, 1mM), (sigma)]. To release chromatin-bound Meq proteins, 20,000 units of Microccocal nuclease (New England Biolabs, Chatsworth, MA) were added to the lysis buffer. Lysates were kept on ice for 30 min with vortexing every 5 minutes. Lysate supernatants were collected after 5 minutes spin at 13,000 rpm at 4 C to remove insoluble debris. Protein concentrations were determined via BCA protein kit (Thermo Scientific Inc., Rockford, IL). For western blotting, 40 µg of protein lysates were separated by 10% SDS- PAGE and transferred to nitrocellulose membrane using standard method (85). After overnight drying, membranes were rehydrated and blocked in 5% dry milk, 1X PBS, 0.01% Tween-20 for 1 hr, followed by three washes (1X PBS, 0.01% Tween-20). Membranes were incubated with primary antibodies described above at the described dilutions for 1 hr, and washed three times with wash buffer for 5 minutes per wash. Blots were incubated with horse peroxidase-conjugated goat anti-rabbit (or mouse) secondary antibodies (1:5000, Thermo Scientific Inc., Rockford, IL) for 30 minutes, followed by three washes. Antibody-binding was detected using SuperSignal West Dura Extended Duration Substrate Kit (Thermo Scientific Inc., Rockford, IL). Blots were subjected to autoluminography using X-ray Film (X-OMAT-MR, Kodak, Rochester, NY.). 16

27 2.4 Meq protein expression cell line establishment HTC cells were transfected with plasmids pbk-cmv (vector only), and pbk- CMV encoding T7RB1BMeq, T7RB1BMeq/vIL-8, T7RB1BMeq/vIL-8-Δexon 3, and T7-v-Src, using Lipofectamine 2000 (Invitrogen) and G418 selection. Briefly, cells were plated in a 6 well dishes and incubated overnight. After 16 hrs, 1 µg of each of the expression vectors and empty vector were transfected using 5 µl of lipofectamine 2000 following the manufacturer s instructions. After 48 hrs, cells were selected using growth media containing 400 µg/ml of G418 (Geneticin, Invitrogen) for 2 weeks. Surviving cells were maintained in growth media containing 200 µg/ml of G RNA purification and RT-PCR For detection of Meq expression in HTC-based cell lines, total RNAs were extracted from each cell line using RNeasy Columns with on-column DNAse treatment, according to recommendation of the manufacturer (Qiagen, Valencia, CA). RT-PCR for amplifying Meq N-term, v-src open reading frame and β-actin was performed using One-step RT-PCR kit from Qiagen (Qiagen, Valencia, CA) following manufacturer instructions. Briefly, 1µg of total RNA was added into the enzyme mix in the total volume of 50 µl reactions, with 0.6 µm of each primer (Table 1). RT-PCR was performed as follows: 50 C for 30 minutes for reverse transcription, 95 C for 15 minutes for initial RT inactivation and initial PCR activation followed by 35 cycles of normal 3-step PCR cycling, with 94 C for 1 minute, 55 C for 1 minute and 72 C for 1 minute with a final extension for 10 minutes at 72 C. 17

28 2.6 Cell proliferation assay To measure changes in cellular proliferation as a result of Meq or v-src expression, 2 x 10 5 cells from each cell lines was plated in quadruplicate wells in 24- well dishes. To each well, 0.1 mg/ml of resazurin was added to the medium. Cells were kept at 37 C covered in foil, and fluorescence intensity was measured at 0, 24, 48, 72 hrs using SynergyTM 2 multi-mode microplate reader (BioTek Instruments, Inc, Winooski, VT) with a 560 nm excitation/590 nm emission filter set. Emission readings obtained at 24, 48 and 72 hrs were compared to the T=0 hr time point. 2.7 Construction of prb1bmeqko For inserting meq genes from different pathotype strains, a prb1b BAC clone was constructed having both copies of Meq deleted (prb1bmeqko), using a modified two-step Red-mediated recombination procedure (42). Briefly, kanamycin and ampicillin resistance genes were PCR amplified using AccuPrime pfx supermix (Invitrogen, Inc.) and primers having Meq flanking sequences in their 5 ends. For the kanamycin-based meq deletion cassette, 20 ng of play-2 plasmid DNA was used as template (41), and MDV EcoR-Q fragment forward and reverse primers (Table 1). The reaction conditions were 94 C (5 minutes) for an initial denaturation, followed by 35 cycles of 94 C for 1 min, 55 C for 1 min, and 68 C for 1.5 min, with a final extension at 68 C for 10 min. PCR product was digested with Dpn I (to fragment templated DNA) and purified by QIAquick PCR purification kit (Qiagen). Approximately 100 ng of the purified product was electroporated into recombinationcompetent GS1783 E. coli harboring prb1b (a kind gift from Klaus Osterrieder, Freie University of Berlin) (41). 18

29 After electroporation, single Meq-knock out recombinants were selected on LB agar plates with 50 µg/ml of kanamycin (Kan), 30 µg/ml of Chloramphenicol (Cam). The Kan r and Cam r clones were picked and examined for Meq deletion and Kan-cassette insertion. As the recombination resulted in single-copy meq gene knockout viruses, the whole procedure was repeated using another set of primers targeting the non-deleted meq copy using Amp r as a positive selection marker. For Amp-cassette insertion the β-lactamase (bla) gene was amplified from puc19 using Meq deletion primers (Table 1). This cassette targets replacement within the region deleted by the Kan r meq-replacement cassette, hence, only the non-deleted meq locus would contain the recombination target sequences. The deletion of the two copies of the meq gene from the BAC clones was then confirmed by Southern blot hybridization. 2.8 Southern blot analysis Deletion of the Meq ORF was confirmed via Southern blot hybridization. For this procedure, 2 µg of prb1b and prb1bmeqko DNA were digested with EcoRI and separated on 0.8% agarose-1x TBE gel in quadruplicate loadings. The digested DNAs were transferred to positive charged nylon membrane (Hybond-N+, Millipore, Bedford, MA) via capillary transfer using standard procedures (85), and fragments were immobilized via UV crosslinking (Stralinker, Stratagene, Inc.). The probes for each replicate were P1 the Meq ORF, P2 the Kan cassette, and P3 the Amp cassette (Figure 7). In addition, fragments were probed with the entire MDV genome using prb1b DNA (1 µg) that had been digested with Msp-1. The Meq ORF probe (P1 in Figure 7B) was the PCR product of Meq coding sequence. The Kan probe (P2 in Figure 7) was the PCR product of the kanamycin resistance gene from play 2 and 19

30 the Amp probe (P3 in Figure 7) was the PCR product of the bla gene from plasmid puc19. The probes were labeled directly via crosslinking with alkaline phosphatase using the Amersham Alkphos direct labeling reagents (GE healthcare, Buckinghamshire, U.K.). Prehybridization of blots, probe hybridization, and washes were performed according to the manufacturer instructions. After washing, CDP-Star (GE Healthcare) substrate was added to each blot and subjected to autoluminography via X-ray film (X-OMAT-MR, Kodak, Rochester, NY.). 2.9 Chromatin immunoprecipitation (ChIP) assays For ChIP analysis of the Meq proteins binding to the MDV genome, HTC cells were used (80). Cells were co-transfected with Meq protein expression plasmids and a BAC-based prb1b from which both copies of the Meq gene were deleted (prb1bmeqko). prb1bmeqko was used as a source of the MDV genome to ensure that the binding of Meq proteins was due to exogenously added Meq protein expression vectors and were not expressed from the endogenous Meq encoded within the prb1b genome. For co-transfections, 5 x 10 6 HTCs were plated in 100 mm dishes 16 hours prior to transfection. Cells were transfected with 2 µgs of each of the following vectors: pbkcmv (empty vector), pbkcmv-t7 Meq, pbkcmv-t7 Meq/vIL-8 and pbkcmv-t7meq/vil-8 Δexon3. In addition to an expression vector, each dish was co-transfected with 2 µgs of prb1bmeqko. RB1B-transformed T-cell line, MDCC-UD37 (see below) was used a positive control Meq protein expression. At 24 hrs post-transfection, cells were harvested using TrpLE (Invitrogen), washed with PBS, and fixed with 1% formaldehyde for 15 minutes at RT. Fixed cells were washed twice with cold 1X PBS, resuspended in 1.5 ml of sonication lysis buffer (50 20

31 mm Tris, ph 8.0, 1% SDS, 10 mm EDTA supplemented with protease inhibitors), and sonicated three times on ice with 0.5 sec/pulse for 40 pulses (550 Sonic Dismembrator, Fisher scientific). Lysates were centrifuged at 14,000 rpm for 15 minutes and the supernatant liquid was collected and adjusted to 10 ml using chromatin IP buffer (20mM Tris, ph 8.0, 0.01% SDS, 1.1% Triton X-100, 2mM EDTA, 150mM NaCl, with protease inhibitors). A sample of total chromatin (500 µl) was collected and the DNA purified for each co-transfection, to serve as an input control. Lysates were pre-cleared to reduce non-specific binding by adding 100 µl of pre-washed protein A-agarose beads (Sigma) and mixing at 4 C for 4 hours. Beads were then pelleted (14,000 rpm, 10 min, 4 C) and the pre-cleared chromatin was transferred to fresh tubes and immunoprecipitated with anti-meq polyclonal Ab (51) (1:500) overnight at 4 C. To precipitate DNA-protein complexes, 100 µl washed protein A-agarose beads were added and mixed for 4 hrs at 4 C. The beads were recovered and washed for 10 minutes with low salt wash buffer (20 mm Tris, ph 8.0, 0.1% SDS, 1% Triton X-100, 2 mm EDTA, 150 mm NaCl, with protease inhibitors), high salt wash buffer (20 mm Tris, ph 8.0, 0.1% SDS, 1% Triton X-100, 2 mm EDTA, 500 mm NaCl, with protease inhibitors), and twice with cold 1X TE, ph 8.0. Chromatin was eluted in 1% SDS in 100 mm NaHCO 3, ph 7.5, at room temperature for 10 min. Crosslinking was then reversed by incubating samples at 65 C for 6 hours. Isolated chromatin was ethanol precipitated, washed and purified via proteinase K digestion, extraction with phenol/chloroform and EtOH precipitation using standard methods (85). DNA was finally resuspended in 40 µl of 1X TE buffer, ph

32 To detect specific MDV genomic sequences within the pool of ChIP DNA, PCR was performed using three sets of primers, designed to amplify the promoters of pp14, ICP4, and Meq (Table 2). PCR was performed using 25 µl reactions with 2 µl of template (Input or ChIP DNA), 2.5 pm of each PCR primer, and 21 µl of AccuPrime pfx Supermix (Invitrogen). The amplification conditions were: initial denaturation at 95 C for 5 minutes, followed by 94 C for 1 minute, 55 C for 1 minute and 68 C for 40 seconds. Samples were removed for analysis at 20, 25 and 30 cycles for agarose gel electrophoresis analysis. As positive controls, prb1b BAC and appropriate BamHI clone (BamHI-H, BamHI-A, and BamHI-I 2, respectively) (39). DNAs were used as templates for PCR In vivo characterization of rmdv-1137 and prb1bmeqko Characterization of rmdv SPF leghorns were obtained as embryonated eggs (Sunrise Farms, Catskill, NY), and were hatched at the University of Delaware, Allen laboratory. One-day old birds from each group were inoculated with 500 PFU (target dosages) of CEF infected with MD5, RB1B and recombinant virus rmdv Chicken injected with uninfected CEF served as mock infected controls. The treatment groups were Mock, RB1B, MD5 and rmdv-1137 (Table 3A). Chickens were neck-tagged according to treatment, and were housed in isolator units under negative pressure in the Allen Laboratory. At two weeks post-inoculation, one-day old birds were placed in contact with each group to monitor horizontal transmission. Chicks were monitored daily for signs of MD, and birds showing severe signs were euthanasia and necropsy (Table 5). 22

33 Characterization of prb1bmeqko. In a separate experiment, prb1bmeqko was compared in pathogenicity to Mock- and prb1b-infected treatment groups (Table 3B) Virus reisolation For both in vivo experiments, the viral load of SPC and PBMC were determined through virus reisolation from inoculated chickens at 1, 2, 3 and 4 weeks post-inoculation and at week 5 from contact-exposed chickens (3 weeks postplacement), as described previously (86). Briefly, three randomly-selected chickens were taken per treatment group, per time point, bled via cardiac puncture, euthanized via cervical dislocation, and spleens were aseptically removed. Spleens were pooled, homogenized to cell suspensions, washed, and adjusted to 2 x 10 7 cells/ml and 100 µl (i.e., 2 x 10 6 cells) was plated onto freshly-prepared secondary CEF in triplicate 60 mm dishes. PBMC from three birds per treatment group were isolated from whole blood using Histopaque M1119 (Sigma), washed, adjusted to 2 x 10 7 cells/ml. PBMCs were then plated, as above. At 5 days post-plating, dishes were fixed with 95% EtOH and viral plaques were enumerated after staining for the pp38 antigen (H mab, provided by Dr. Lucy F. Lee), as described previously (86). Virus reisolation was also performed from three contact-exposed chickens per treatment group at 3 wks postcontact (i.e., 5 wks post-inoculation) MDCC cell line establishment Tumor specimens were obtained from culled chickens exhibiting signs of MD (paralysis, ataxia, torticollis, red-leg, etc.), and at necropsy. The tumors were minced 23

34 into small sections and were homogenized on ice using glass Tenbroek tissue grinders in M199 medium supplemented with antibiotics [penicillin G (50 μg/ml), streptomycin sulphate (50 μg/ml), and neomycin sulphate (100 μg/ml); Gibco-Invitrogen, Grand Island, NY.]. After filtering the cell suspension through sterile cheesecloth, lymphocytes were purified by density gradient centrifugation (700 xg for 30 minutes) using histopaque M1119 (Sigma, St.Louis, MO) and washed twice with Iscove s ITS medium (see below). After the final spin, cells were resuspended in Iscove s ITS medium [Iscove s modified Dulbecco medium supplemented with 20% FBS, 10% chicken serum, 1% nonessential amino acids, 1% ITS supplement (insulin, transferring, selenium), 4mM glutamine, 2mM sodium pyruvate, 2 μm β-mercaptoethanol, 1X PSN, 0.5 X fungizone]. Cells were plated in 6-well dishes at the densities of , , , , , and cells/ml, monitored daily, and split 1:3 or 1:5 every 4 to 7 days until established. Stocks were frozen in 10% DMSO/90%FBS at passages 2, 5, 10, 20, 30 and 40, etc Flow cytometric analysis Lymphoblastoid cell lines established from RB1B- and rmdv induced tumors were characterized for surface antigen expression (Table 7). For each cell lines, 3 x 10 7 cells of MDCC-UD35, UD36, UD37 and UD38 were collected, washed and then resuspended in 1 ml of antibody diluent (1XPBS, 3% goat serum, 1% BSA, 0.1% NaN 3 ). For each antibody, 50 µl of cells (~ 1.5 x 10 6 cells) from each cell line were incubated with primary antibody on ice for 1 hr. Cells were washed three times with 4 mls of FACs wash buffer (1X PBS, ph 7.4, 1% BSA, 0.1% NaN3, 0.45 µm filtered), the cells were incubated with FITC-conjugated secondary antibody on ice for 30 24

35 minutes on orbital shaker. After the third wash, cells were resuspended in 250 µl of FACs wash buffer and were analyzed on a FACS in the Center for Translational Cancer Research (CTCR) in the Department of Biology, University of Delaware. Each cell line was stained in at least three separate experiments. In some instances, cells were fixed with 2% paraformaldehyde (in 1X PBS) after staining, prior to acquisition Replication of prb1bmeqko in cell culture To evaluate whether the deletion of Meq from prb1b affects its lytic replication in cell culture, we performed a set of single-step growth curves analysis at 37 C and 41 C. For each viruses (prb1b and prb1bmeqko), (24) identical 60mm dishes of secondary CEF were infected at approximately 200 PFU/dish an placed at either 37 C or 41 C. On 1, 2, 3, 5 and 7 days post infection, duplicate dishes were harvested and titrated onto freshly-plated secondary CEF. All dishes were cultivated for 5 days at 37 C and 41 C, followed by fixation and immunofluorescence analysis using anti-mdv US-1 antibody (13, 67). 25

36 Chapter 3 RESULTS 3.1 Expression of Meq products during infection Meq/vIL8, a fusion of the amino terminus of Meq to exons 2 and 3 of vil8 was initially described by Peng and Shirazi as a possible negative regulator of Meq transcriptional activation (73, 75). Subsequent analysis indicated that the spliced forms of Meq show less nuclear mobility, but more importantly, do not dimerize with full length Meq in co-expressing cells (3). A limitation to the study of the spliced forms of Meq, was their low abundance in protein samples taken from MDV-infected chicken cells and tumors (data not shown). We speculated that because Meq/vIL-8 showed much lower nuclear mobility compared to the full length Meq protein, and also contain a DNA-binding domain, these proteins could be tightly-bound to chromatin, and may partition in the insoluble fraction during protein purification. Treating the whole protein lysate with micrococcal nuclease increased the solubility of those proteins and allowed for a more accurate assessment of their expression. In this study, we demonstrated that the expression of full-length Meq in vivo is detectable at all four weeks after inoculation (Figure 2), with a notable increase at week 3, corresponding to latency, as well as in tumors and derived cell lines. The three week time point is also when spliced forms of Meq, Meq/vIL-8 and Meq/vIL-8- Δexon3 are detectable (Figure 2). Additionally, both full length Meq and its spliced products were detectable in RB1B-induced tumor samples and RB1B-transformed cell lines (Figure 2). 26

37 According to the western blotting results, the expression of Meq/vIL-8-Δ exon 3 is at a lower level than that of Meq/vIL-8 and full length Meq. As a control for lytic infection, anti-us 1 was used and US1 protein was expressed at weeks 1 and 2. This is consistent with our viremia data that the Meq expression increases while the viremia in the spleen decreases, as measured by PFU per million cells (Figure 2). We confirmed the identity of the smaller proteins as containing vil8 exons 2 and 3 (for Meq/vIL8) and exon2 (for Meq/vIL8 exon3) through examining cell line MDCC-UA20, a cell line established from the vil8 deletion virus RB1B vil8smgfp (72) (Figure 3). Loss of specific protein species from the UA20 cell line lane clearly shows that deletion of vil8 exons from MDV, results in a loss of these protein species. These data demonstrate that these proteins are truly expressed in vivo and are not degradation products of the Meq protein. 3.2 Effects of the Meq proteins on cell proliferation in cell culture Given the differences in the transcriptional activation or repression between Meq and its spliced products (47), we examined the effects of those individual proteins on cellular proliferation. We established HTC-based cell lines expressing Meq, Meq/vIL-8 and Meq/vIL-8-Δ exon 3, and v-src (Figure 4). Expression of Meq, its spliced products and v-src are confirmed by RT-PCR (Figure 4A). The growth properties of HTC cell lines were obtained using Alarmar blue, a cell viability indicator, which uses the reducing power of healthy cells. The active ingredient of alarmar blue is resazurin, a blue non-fluorescent indicator dye that is converted to bright red fluorescent resorufin via the reduction of mediated by metabolically-active cells (33). We found that the cell lines expressing full-length Meq, Meq/vIL-8 and Meq/vIL-8-Δ exon 3 all had significantly higher growth rates than vector controls 27

38 (Figure 4B). The cell line expressing v-src, which is a positive control, also showed more rapid proliferation than the vector-only control. 3.3 The binding of Meq proteins to the MDV genome Given the timing of the Meq spliced protein expression in vivo (Figure 2), and their lacking of transactivation ability, we then investigated whether Meq spliced variants bind to MDV genome via chromatin immunoprecipitation. As Meq and its spliced variants are all expressed in MDV-transformed cell lines (Figure 2), here we used a BAC-based infectious clone of the RB1B genome (76), which was repaired for horizontal transmission (42). For this analysis, we generated a BAC-based recombinant have both copies of Meq deleted (prb1bmeqko, Figure 6, described below). The reason for using prb1bmeqko was to exclude the confounding effects of endogenous Meq expression from the transfected RB1B genome. The ChIP data indicated that all three Meq proteins (Meq, Meq/vIL8, Meq/vIL8 exon3) all bind to the MDV genome at lytic (ICP4, pp14/pp38) and latent (Meq) promoters (Figure 5). We used a semi-quantitative method to examine the relative binding affinity of each protein to the MDV genome, by removing 5 µl of PCR reaction at 20, 25 and 30 cycles (Figure 5). The deletion of Meq locus in prb1bmeqko removed one copy of the Meq promoter, which was still detectable by PCR (Figure 7), and hence our estimate for the protein binding affinity to the Meq promoter may appear lower than what is observed for MDV-transformed cell line, as the intensity of UD37-derived ChIP appears greater than the transfected cell lines. By comparing the PCR band intensity of all three proteins at different cycle number, and through the comparison of 10% input DNA bands and ChIP bands 28

39 (Figure 5), we conclude that all three Meq gene products bound to all three promoters with approximately the same affinity. 3.4 Construction of prb1bmeqko We constructed a BAC-based infectious clone of the RB1B genome with two copies of meq deleted (prb1bmeqko) via Red recombination as described above. Kanamycin and ampicillin resistance cassettes were used sequentially as positive markers to select for recombinants. The flanking sequences in the ampicillin cassette were designed in the way that only the existing EcoR-Q could serve as a target for recombination (Figure 6A). Southern blotting was used to confirm the deletion. The EcoR I-digested prb1b and prb1bmeq KO probed with the whole MDV genome indicated the loss of the EcoR-Q fragments in prb1bmeqko (Figure 6B). Probing the same digested DNA with the Meq, kanamycin cassette, and ampicillin cassette probes, indicated the loss of Meq locus, and the presence of Kan r and Amp r cassettes (Figure 6B). As we used prb1bmeqko in chromatin immunoprecipitation to exclude the impact of endogenous Meq in MDV genome binding, we later examined whether the deletion of EcoR-Q fragment actually deleted Meq promoter, which could give false positive results in the semi-quantitative PCR. Sequence analysis suggested that the kanamycin cassette that we used to replace EcoR-Q fragment, deleted part of the promoter of Meq, which contains the Meq binding site (Figure 7A) but the ampicillin cassette did not, hence, only one copy of the Meq promoter remained, as shown by PCR analysis of this region (Figure 7B). 29

40 3.5 Characterization of prb1bmkeqko in cell culture and in vivo MD5ΔMeq was shown to have no effects on MDV lytic replication in cell culture, although it is directly involved in MDV-mediated transformation (59). To examine whether prb1bmeqko showed the same property in cell culture and in vivo, we performed both single-step growth curve analysis to compare the lytic replication of prb1b and prb1bmeqko, and an in vivo trial, to compare the replication and pathogenicity of these viruses. In cell culture, prb1b and prb1bmeq KO replicated to similar titers at both 37 C and at 41 C (Figure 8). CEF are characteristically grown at 37 C to delay their proliferation in order to allow time for MDV plaques (foci) to form. The growth of CEF at 41 C is more rapid, and hence cells reach confluency more rapidly than at 37 C. Therefore, similar replication at both temperatures suggests that Meq is truly nonessential for replication in culture. In vivo, we found that the replication of prb1bmeqko was only detected at week one and two, after which, the virus titer in SPC and PBMC was too low to be detected (Figure 9), while prb1b showed a characteristic pattern of replication in both SPC and PBMC, with a decrease in virus titer at VR3, which is considered as a latency phase, and increase in virus titer at VR4 (Figure 9). We also included the data of MD5 Meq in figure 9, which shows a somewhat similar pattern to prb1bmeqko, but replicates to a somewhat higher level at weeks one and two. In terms of pathogenicity and oncogenicity, prb1b induced 18% mortality and 82% of tumor incidence in inoculated chickens (Table 9), and it was transmitted horizontally (Table 8) and induced 13% of tumor incidence in contact-exposed chickens (Table 9). Meanwhile, MD5 Meq and prb1bmeqko failed to cause death 30

41 in inoculated birds, and as expected, no tumor incidence was observed in contactexposed birds (Table 9). Horizontal transmission was observed in MD5 Meq, with viremia data showing 17.5 PFU/10 6 spleen cells isolated from contact-exposed birds (Table 8). We did not reisolate virus from spleen cells isolated from prb1bmeqko contact-exposed birds (Table 8). Our data indicated that the deletion of meq in prb1b strain completely blocks its pathogenicity and oncogenicity, and the loss of Meq affects virus replication in vivo, which are similar to that seen for MD5 Meq (59). In addition, we found that unlike MD5 Meq, prb1bmeqko caused no thymic atrophy (data not shown). As an aside, we observed that prb1b was not as lethal as the native RB1B strain, as the mortality of prb1b in inoculated birds is 18% (3 out of 17) and 0% in contact-exposed birds, was less than the mortality of RB1B inoculated and contactexposed birds observed in rmdv-1137 in vivo study (Table 5). Consequently, the absence of thymic atrophy and somewhat lower levels of replication of prb1bmeqko compared to MD5 Meq is likely due to differences in the genomes of RB1B and MD5 outside of the meq loci. 3.6 Characterization of rmdv-1137 in vivo As Meq is directly associated with MDV-infected cell transformation, we asked if the acquisition of meq from a different virulent strain changed its parental MDV biological function in terms of pathogenicity and tumorigenicity. To address this, we selected a recombinant virus rmdv-1137 in vivo that harbors the meq gene from the RB1B strain recombined into the MD5 genome, and here we compared it with its parental viruses RB1B and MD5 in vivo (Kumar et al. submitted). 31

42 rmdv-1137 replicated similarly to its parental viruses MD5 and RB1B in SPC and PBMC (Figure 10A). Virus titers in SPC reached the highest at week 3 post inoculations in all three groups, and then declined at week 4. In PBMC, the titers of MD5, rmdv-1137 and RB1B all gradually increased during the four weeks course of reisolation (Figure 10A). In pathogenicity, except for the mock group, the inoculated birds from each group started to show Marek s signs from 3 weeks post-infection, and most of the birds died within 7 weeks after inoculation (Figure 10B), with mean death times (MDT, day at which 50% have succumbed) being 29, 38 and 36 for rmdv-1137, RB1B, and MD5, respectively (Figure 10B). The contact-exposed birds showed the similar survival curves, with MDT being 31 days for rmdv-1137, 37 days for RB1B and 41 days for MD5 (Figure 10C). All three viruses spread to contact birds at comparable level, via measuring the viremia levels in spleen cells and PBMCs after 3 weeks of contact (Table 4). In this trial, rmdv-1137 and RB1B appeared more pathogenic than MD5. Due to the limited numbers of chickens that were used in this trial, however, we can only conclude that rmdv-1137 is as lethal as both of its parental viruses, RB1B and MD5. During necropsy, we noticed that the birds inoculated with or exposed to rmdv-1137 and RB1B usually showed discrete tumors, with well-defined margins, while MD5-infected or contact-exposed birds showed defused tumors, which are difficult to be separated from the normal tissues (data not shown). The incidence of RB1B and rmdv-1137-induced tumors were higher than MD5-induced tumors (Table 5), with spleen and kidney being the primary tumor sites (Table 6). 32

43 3.7 Characterization of RB1B- and rmdv derived cell lines We processed numerous tumor samples from RB1B, rmdv-1137 and MD5 inoculated and contact-exposed tumors in attempts to establish cell lines. After 30 passages, we were able to establish four cell lines, and designated them MDCC-UD35, -UD36, -UD37 and -UD38. Cell lines UD35 and UD37 were RB1B tumor derived, while UD36 and UD38 were rmdv-1137 derived. Table 7 shows the results of the immunophenotypic analysis on these four MDCCs. These results demonstrated that the cell lines MDCC-UD35, -UD36 and UD 37 have immunophenotypes characteristic of MDV-transformed, CD4+ T cells. None of these cell lines expressed B cell or CTL surface markers. These cell lines expressed various levels of CD28, CD30, CD44, CD45, MHC-I, MHC-II, MATSA and integrin β1. All cell lines showed TCR2 (αvβ 1 ) with UD37 also showing some TCR3 (αvβ 2 ) expression (Table 7). These findings are consistent with MDCC immnuophenotypes, suggesting that they are T-helper cells phenotype (69). MDCC-UD38, a cell line derived from rmdv-1137 contact spleen tumor, showed two populations by light scattering that differed somewhat in their surface expression. Both of the populations were negative for CD4, CD8, and B cell marker expression, but expressed CD44 and high levels of CD164, a mucin identified by monoclonal antibody AV60 (69). One population was weakly positive for CD3, however no T-cell receptor class (1, 2, or 3) was found to be expressed on either population. Interestingly, both populations showed a high level expression of CD30 and integrin β1, which are found highly expressed in MDV transformed cell lines and MD lymphomas cells (69).The exact lineage of UD38 still needs to be elucidated, however we have reported such aberrant expression in MDV cell lines, particularly those induced by vv+mdvs (96). 33

44 Chapter 4 DISCUSSION 4.1 Contribution of Meq gene products to cellular transformation Meq is the major oncoprotein of MDV, a virus which can rapidly induce lymphomas in chickens as early as three weeks post-infection. Meq is consistently expressed during MDV infection, in MDV-induced tumors, and MDV-transformed cell lines. Meq expression is essential for tumor formation, as the deletion of meq or even the mutation in a specific domain completely abrogates its oncogenicity (11). Moreover, the interactions of Meq with itself (homodimerization) and with c-jun (heterodimerization) appear to be essential for T-cell transformation (12, 99, 100). In light of our finding of Meq slice variants being expressed during latency, in lymphomas, and cell lines, however, an alternative hypothesis is that these forms are important to tumorigenesis. In the works focusing on homo- and heterodimerization of Meq, mutants were constructed having alternative zipper domains (GCN4, c-fos, etc.), which also remove the splice donor site for the generation of Meq spliced products. Given that the spliced forms show activities consistent with them being involved in oncogenesis (increased cellular proliferation, etc.), it seems likely that at least part of the phenotypes observed for the leucine-zipper mutants could be ascribed to their loss of spliced product expression. Deletion of vil8 (all three exons), does not abrogate oncogenicity, however it does decrease this significantly (30-32, 72). In our initial characterization of a cell line derived from an RB1BvIL8 smgfp-induced lymphoma (UA20), we found that the 34

45 marker gene was constitutively expressed from these loci despite downregulation of this cassette during latency at other loci (37, 72, 77). UA20 cells were also found to be more lymphocytioid than lymphoblastoid, and this cell line has never been passed through crisis (i.e., greater than 30 passages) (M. Parcells, unpublished). Combined, our data suggest that spliced forms of Meq contribute to the efficient transformation of latently-infected T-cells and the sustained repression of lytic promoters, including heterologous promoters, during latency and transformation. Since the proteins derived from spliced Meq transcripts lack transcriptional activation function (47), it is difficult to envision how they could be involved in shifting the transcriptional expression to contribute to tumorigenesis. The binding of Meq to cellular protein CtBP-1 is also essential for cell transformation (11), as the mutation of the CtBP-1 binding site in Meq completely abrogates oncogenicity. The CtBP-1-binding consensus PLDLS resides in the Meq amino terminus and is common to not only to the full length protein, but also both of the splice variant-derived proteins that we describe here (Figure 1). We have recently found that although Meq co-localizes with, and can interact with CtBP-1, Meq/vIL8 and Meq/vIL8 exon3 bind CtBP-1 with greater affinity, translocate this protein to the nucleolus, and decrease its mobility to that of Meq/vIL8 and Meq/vIL8 exon3 (3)(M. Parcells, unpublished). The significance of the interactions of CtBP-1 with Meq/vIL8 and Meq/vIL8 exon3 is suggested by when these protein species appear during in vivo infection. In our present work, we report that Meq splice variant-derived proteins are detectable in MDV-infected chicken spleen cells, RB1B-induced tumor samples, and RB1B-transformed cell lines (Figure 2). Their expression becomes detectable from VR3 (21 dpi), a time corresponding to the establishment of latency, as measured by 35

46 decreased lytic protein expression (US1) and a decrease in virus titer. Our ChIP analysis confirmed that Meq/vIL-8 and Meq/vIL-8- exon 3 all bind to the MDV genome at the Meq promoter, as well as lytic promoters (ICP4 and pp38/pp14) (Figure 5). Since CtBP-1 is a scaffold protein for the binding of chromatin remodeling enzymes (histone methyltransferases, acetylases/deacetylases) (26), the appearance of Meq/vIL8 and Meq/vIL8 exon3 at 21 dpi could signal the recruitment of chromatin silencing (pp38/pp14, ICP4 promoters) and activating (Meq promoter) expression. We found that despite their having no transcriptional activation functions (47, 73), all three forms of Meq induced cellular proliferation (Figure 4). The differences in cell proliferation were observed as early as 24 hrs within cells expressing full length Meq, Meq/vIL-8, and v-src (positive control), but not in Meq/vIL-8- exon3. At the end of 72 hrs, all Meq spliced products and positive control were showing significant cellular proliferation induction compared to the vector-only HTC cell line. However, during each time point, Meq/vIL-8- exon 3 was the weakest one in inducing cell proliferation, while Meq/vIL-8 showed the strongest ability, and the differences between them were statistically significant (p = at 72 hr). On the other hand, Meq/vIL-8- exon 3 failed to block apoptosis induced by staurosporine induction (47). It therefore seems likely that there are some fundamental differences between Meq/vIL-8 and Meq/vIL-8- exon3, and that exon 3 of vil-8 may play an important role in governing signaling pathways. A role in the latency establishment and maintenance of latency can clearly be envisioned through the interaction of these proteins with CtBP-1 and the MDV genome. As Meq/vIL8 and Meq/vIL8 exon3 lack transcriptional activation potential, however, it is unclear how they could be contributing to transformation. In this regard, 36

47 the interactions with CtBP-1 could also play a role. CtBP-1, through the targeted repression of specific genes (i.e., E-cadherin, p53, and other pro-apoptotic proteins), appears to be important to tumor development and progression in other cancers (25). Consequently, through the downregulation of cell-cycle regulators by recruitment of Meq/vIL8, one could envision these interactions leading to proliferation and apoptosis resistance, as well as changes in anchorage independence. In light of these data, we hypothesize a model, that Meq is expressed throughout MDV infection, however when MDV infection elicits the innate antiviral response, factors are induced within the infected T-cell to downregulate virus replication (i.e., IFN-α and/or γ) and increase either the splicing efficiency of Meq transcripts or relieve the blocking of splicing resulting in increased expression of Meq spliced products (Meq/vIL8, Meq/vIL8 exon3, etc.). These products bind to the MDV genome and recruit CtBP-1, and sequester MDV genome to a nucleolar repression domain in the activated T cells. As chicken microchromosome 16 has been found to encode one of the nucleolar organizing regions (NORs), as well as the chicken B locus (MHC and immune regulatory genes) (34), the sequestration of CtBP- 1 to this sub-nuclear domain by Meq proteins could directly contribute to not only cell proliferation and apoptosis resistance, but also polarization of the CD4+ T-cell to becoming the T H3, (T reg ) immunophenotype associated with MDV lymphomas (94). This work provides a framework for the future study of Meq proteins and T- cell transformation. As many transcripts in T-cells undergo differential splicing during development, activation, and differentiation, the increased appearance of spliced variants of Meq is likely to be regulated either by the induction of splicing factors, or by a release of splicing repression. Since vil8 is regulated as a late phase 37

48 lytic gene with three exons (72), the loss of vil8 expression as Meq splicing increases suggests changes in vil8 exon 1 usage with a concomitant increase in Meq splice donor usage. These, and additional questions will be addressed in the future to delineate clearly the roles of these splice variants on MDV latency regulation and transformation. 4.2 Contribution of Meq to the replication of prb1b Meq is dispensable for the cell culture replication of MD5 (59). Here we constructed a BAC-based RB1B MDV, which has two copies of Meq deleted, and tested the effects of deletion on replication in cell culture and in vivo. Our data indicated that there was no difference between prb1b and prb1bmeqko in lytic replication in cell culture (Figure 8), however, in vivo, prb1bmeqko could be reisolated only at the very first week after inoculation, and then it decreased markedly by the second week (Figure 9). These data are similar to what we have observed for MD5 Meq (data not shown)(59), as was previously reported for a non-bac-based RB1B Meq insertion mutant, RB1BMeqlac (J. Cantello and R. Morgan, unpublished). MD5 Meq has been characterized and tested by different groups in terms of its vaccine efficacy, safety, and its ability to induce protection from vv+mdv challenge (53). MD5 Meq, however, does induce profound thymic atrophy in SPF chickens, particularly by 2 weeks post-infection (M. Parcells, unpublished). Here, we report that deletion of meq from the RB1B strain does not induce thymic atrophy, but appears to have more limited replication than MD5 Meq. MD5 Meq was found to successfully spread to FFE (59), and transmit horizontally, but we were unable to detect horizontal transmission of prb1bmeqko via virus reisolation, while a low level of virus recovery was observed in spleen cells 38

49 from MD5 Meq contact-exposed chickens (Table 8). The lack of prb1bmeqko horizontal transmission may be due to the low pathogenicity and poor horizontal transmission ability of prb1b BAC strain itself, as we noticed that the mortality of prb1b inoculated birds and contact-exposed birds were lower than the non-bac wild type RB1B strain (compare table 9 with table 5), or to the very limited infection of prb1bmeqko. 4.3 Contribution of RB1BMeq to MD5 replication and oncogenicity To understand the functional significance of changes in Meq coding sequence on MDV pathogenicity, we previously sought to select for recombinant viruses in vivo through the acquisition of tumorigenicity (Kumar et al., submitted). In two experiments, we co-transfected CEF with MD5 Meq and various meq loci DNAs. These transfected CEF were then inoculated into chickens for the selection of recombinants based on tumor formation. Using this method, we were able to isolate a recombinant virus, rmdv-1137 (from a contact-exposed chickens, neck tag number 1137), that contains two copies of meq loci of RB1B in the MD5 genomic background (Kumar et al., submitted). rmdv-1137 showed similar replication to its parental viruses, RB1B and MD5 in both spleen cells and PBMC. Based on survival curve data, it appeared that rmdv-1137 was not only as pathogenic as its parent viruses, it appeared to be slightly more pathogenic, particularly to contact-exposed chickens. Interestingly, rmdv-1137 did show differences in oncogenicity, having similarities to RB1B in that it induced very discrete tumors, whereas MD5 induced difuse tumors (data not shown). This appeared to be directly associated with our success in establishing four cell lines from RB1B- and rmdv-1137-induced lymphomas, but not from MD5-induced lymphomas. 39

50 This finding is consistent with our hypothesis that Meq may be directly associated with tumor invasion and metastasis, possibly by altering cell focal adhesion signaling, or in recruitment of different cells during tumorigenesis. We found that the turnover of actin is increased in T-cells transformed by vmdv, vvmdv and vv+mdv by showing the decrease in the ration of G-actin to F-actin (Parcells, unpublished). As Meq is directly associated with tumor formation, and at least some target genes of Meq are attachment/motility related (55), it is we hypothesize that Meq may contribute to metastasis by altering target actin content expressed in cells transformed by RB1B and MD5. In addition to actin, integrins are upregulated in MDVtransformed cell lines (66, 102), which have been associated with MDCC that are highly metastatic in vivo (46). Recently, differences in transcriptional activation and colony formation in soft agar have been demonstrated for RB1B and MD5 forms of Meq (62). Our data from the in vivo study of rmdv-1137, characterizing the immunophenotypic profiles of four MDCCs is also suggestive of important functional differences between RB1B and MD5 Meq proteins. Recently we have found significant compositional differences in tumors induced by RB1B and MD5 (Kumar et al., submitted), and these differences may contribute to the inability to establish MD5 transformed cell lines. Unlike RB1B induced tumors, which show high percentages of CD4+ T cells, MD5 induced tumors contained increased percentage of B cells, as well as increased levels of unstained (unknown) cells (data not shown). We therefore speculate that changes in tumor composition may directly affect the ability to establish cell lines. These results await confirmation using the prb1b-bac system for directly constructing RB1B viruses having the Meq genes of v, vv and vv+ MDVs. 40

51 4.4 Conclusion In conclusion, we report that splice-variant forms of Meq are expressed as proteins that appear during latency at 21 dpi and are also found in tumors and MDVderived cell lines. Deletion of vil8 from the MDV genome abrogates their expression and appears to affect the replication and genome repression of tumors caused by the deletion virus. All forms of Meq induced the proliferation of HTC cells within 24 hrs, although this was to different levels. All of these Meq proteins bind to the MDV genome at lytic (pp38/pp14, ICP4) and latent promoters (Meq), suggesting their putative roles in regulating MDV genome expression during latency. An RB1B-based double Meq knock-out (prb1bmeqko) replicated similarly to MD5 Meq, but did not cause the thymic atrophy seen with MD5 Meq, demonstrating that lytic gene expression is sufficient to cause this immune suppression, and that mutations in non-meq genes affect the differences in pathogenicity between MD5 and RB1B. Three point mutations that define differences in the coding sequence of RB1B and MD5 Meq proteins appear to subtly affect the tumor composition and ability to establish cell lines from MDV-induced tumors. 41

52 FIGURES Repression DNA-binding Dimerization Repression (PRR) Activation Pro Basic L L L L L H Meq exon 2 Pro Basic L L L L K R exon Meq/vIL8 Pro Basic L L L L K R CXC domain 150 Meq/vIL8 exon 3 Figure 1 Domain structure of Meq, Meq/vIL-8 and Meq/vIL-8-Δexon3. The domains of Meq proteins are shown: amino terminal repression, DNA binding, nuclear localization, and leucine zipper domains. Proline-rich repeats (PRR) and activation domains are unique to full-length Meq. Exon 2 of vil-8 contains the CXC chemokine domain, while exon 3 is divergent from chicken cellular IL-8 molecules (9E3/CEF4, K60) and has unknown function. The deletion of exon 3 in Meq/vIL-8- Δexon 3 is via alternative splice acceptor site usage and adds an additional 5 amino acids to the C-term of Meq/vIL-8- exon3. 42

53 Figure 2 Analysis of Meq protein expression in vivo. The immunoblots above show the expression of Meq proteins during RB1B infection. Each protein sample is from the pool of three spleens from RB1B-inoculated chickens. Each sample was taken at different times after inoculation as indicated as VR1, 2, 3 and 4 (corresponding to 1, 2, 3 and 4 weeks post-infection, lanes 2-4). As controls, HTC were transfected with plasmids expressing full-length Meq (Meq), Meq/vIL-8 (M8) and Meq/vIL-8-Δexon3 (M8 3) (lane 8-10), and a spleen sample from mockinfected group (VR2) was used as negative control (lane 1). Tumor sample from an RB1B-inoculated chicken (lane 6) and the protein lysate from RB1B-Induced tumor cell line UD37 (lane 7), were included. The viral titer was measured by co-cultivation on CEF and the data shown at the bottom is in PFU/10 6 cells plated. The same blot was incubated with anti-gapdh as a protein loading control, and anti-us1 as an indication of the level of MDV lytic protein expression. 43

54 Vector HTC x Meq M8 M8 3 U D 37 U A 20 Meq Meq/vIL8 Meq/vIL8-Δexon3 Figure 3 Expressing of Meq proteins in UD37 and UA20 cell lines. An immunoblot showing the expression of Meq proteins in UD37 (lane 5) and UA20 (lane 6) cell lines is shown. UD37 cells were derived from an RB1B-induced lymphoma, and UA20 was derived from a recombinant RB1BvIL8 smgfp (72). Lane 1 to 4 are positive controls protein lysates extracted from HTC cells transfected with plasmids expressing full-length Meq (Meq), Meq/vIL8 (M8) and Meq/vIL8- exon3 (M8 3). 44

55 A Mr v Meq M8 M8Δ3 UD35 Mr v vsrc N-Term Meq β-actin B hr 24hr 48hr 72hr HTC+pBKCMV HTC+T7RBMeq HTC+T7RBMeq/vIL8 HTC+T7Meq/vIL8- Δexon3 HTC+vSrc Figure 4 Effect of Meq proteins expression on HTC cell proliferation. Panel A are agarose gels showing the RT-PCR amplicons of Meq gene products and v-src in HTC-based cell lines, and chicken ß-actin (RNA control). Lane 2-6 shows the amplicons using primers targeting the N-term of Meq, that is common to all Meq gene products. Chicken β-actin was amplified from the total RNA using the primers which across the intron between exon IV and exon V (72). Abbreviations are HTC pbkcmv (v), HTC pbkcmv-t7meq (Meq), HTC pbkcmv-t7meq/vil8 (M8), HTC pbkcmv-t7-meq/vil8- exon3 (M8 3), UD35 RB1B-transformed cell line (positive control for Meq expression), and pbkcmv-v-src (vsrc). Panel B depicts growth curves using resazurin to evaluate the effect of Meq proteins on cell growth. 45

56 Figure 5 Chromatin immunoprecipitation analysis of MDV genome-binding by Meq proteins. Photographs of PCR amplicons show the binding of Meq, Meq/vIL-8, and Meq/vIL-8- exon 3 to the genome of prb1bmeqko via ChIP. prb1b-bac and BamHI clone plasmid DNAs were used as positive controls for PCR primers. The entire MDV genome (prb1b), BamHI-I2 fragment, BamHI-A fragment, BamHI-H fragment were used for the positive controls of Meq, ICP4, and pp38/pp14 promoters, respectively. The RB1B-transformed cell line UD37 was used as a control for the presence of all Meq proteins. For each ChIP sample, 10% input ChIP DNA was used as a control for the presence of the genome to normalize for differences in transfection efficiency. Samples of each PCR reaction were removed at 20, 25, and 30 cycles and were separated on 1% agarose gel. Abbreviations are vector only (Vector), prkcmv-t7- Meq (Meq), pbkcmv-t7-meq/vil-8 (M8) and pbkcmv-t7-meq/vil-8- exon 3 ( exon 3). 46

57 Figure 6 Southern blot analysis of prb1bmeqko. Panel A shows a diagram of the genomes of prb1b and prb1bmeqko. Insets show the genome of prb1bmeqko with positive selection markers inserted at the meq loci and their orientations. Panel B, Southern blots of the meq loci of prb1b and prb1bmeqko. DNAs were digested with EcoRI and separated using a 0.8% agarose gel, immobilized to Nylon membranes, and probed with: MDV genome (prb1b), P1 (meq probe), P2 (Kan probe) and P3 (Amp probe). The black arrow indicates the location of the EcoRI-Q fragment in prb1b, which is absent in prb1bmeqko. Abbreviations: prb1b (RB), and prb1bmeqko (KO). Molecular size markers in kbp are shown, at left. 47

58 Figure 7 Meq promoter region analysis of prb1b and prb1bmeqko. Panel A shows the meq promoter of prb1b and the ampicillin cassette within the meq promoter of prb1bmeqko. The replacement of meq locus with the kanamycin resistance gene deleted the meq promoter. Panel B, a photograph of an agarose gel of PCR amplicons for the meq promoter used in the ChIP analysis. Abbreviations: prb1b (RB) and prb1bmeqko (KO). 48

59 Figure 8 Single-step growth curves of prb1b and prb1bmeqko. Single-step growth curves of prb1b and prb1bmeqko are shown for replication at 37 C (left), and 41 C (right). Data shown are the mean values of dilution dishes. 49

60 Figure 9 Replication of prb1b, prb1bmeqko, and MD5 replication in vivo. Virus reisolation from spleen cells at weekly intervals following prb1b, prb1bmeqko, and MD5 Meq inoculation is shown at left. Data shown are the mean titers of triplicate dishes and are PFU per million cells plated. Virus reisolation from PBMC is shown at right. As above, data are mean titers of triplicate dishes and are PFU per million cells plated. 50

61 PFU/10 6 spleen cells A Spleen cells MOCK MD RB1B PBMC Week post-inoculation Week post-inoculation B. C. 51

62 Figure 10 Pathogenicity of rmdv Panel A shows the virus reisolation data from Mock-, RB1B-, rmdv-1137-, MD5- infected spleen cells (left) and PBMC (right). Data are the means of triplicate dishes and are represented as PFU per million cells plated with pooled cells. Panels B and C show the survival curves of Mock-, RB1B-, rmdv-1137-, MD5- infected chickens (B) and contact-exposed birds (C). 52

63 TABLES Table 1 Primers for RT-PCR analysis and prb1bmeqko generation Gene Product (bp) Sequence Chicken β-actin 628 (unspliced) 274 (spliced) ACTF4: 5 - CCATGAAACTACCTTCAACTCCA-3 ACTR4: 5 - GATTCATCGTACTCCTGCTTGCT-3 N-term Meq 280 v-src 1631 Kan r cassette 1099 Amp r cassette 1409 For: 5 -AAGAGATGTCTCAGGAGCCAGAG-3 Rev: 5 -TCTGCAGCTCTTCACATGCTTCA-3 For: 5'-GCTAGC ATGACTGGTGGACAGCAAATGGGTCGGATG GGGAGCAGCAAGAGCAAGCC-3' Rev: 5'- GAATTCTAGATTACTCAGCGACCTC-3' Forward: 5 - AACCCAATTCGGTGATATAAAGACGATAGT CAT GCATGACGTGGGGGGCTGGATCGACTGAAG GATGACGACGATAAGTAGGG-3 Reverse: 5 - TCCCGAGAATTCAAACTATTCTTG TAATGTCGTACGAGCCTCGTTCCGTTCGCT CTT TCACAACCAATTAACCAATTCTGATTAG-3 Forward: 5 - GAAATGATCGATTTATACCTACCTCTT AAATAAACTATTGCTCCTTTATAAAATGTAG GGATAACAGGGTAATGACACCCGCCAACAC CCGCTGA-3 Reverse: 5 - ACAGTGAACAAGCAAAAGGGGAAGAGAGT CTCC GGATAGCCGTTACAATCCGGATTTTGGTCAT GAGATTATC-3 53

64 Table 2 Primers used for chromatin immunoprecipitation (ChIP) analysis Promoter Product (bp) Sequence ICP4 301 Meq 362 pp38/pp Forward: 5 - CCTGTCGAGTCTGCGATCTTC-3 Reverse: 5 - CAAAAGGCTCTTATCATCTACTA-3 Forward: 5 - GACGGCTCTGGGCTTGTTTTGA-3 Reverse: 5 - ACGGTCACAATTCACCTGTCA-3 Forward:5 - GTGATGTGTATGCAAATGAGCAG-3 Reverse: 5 - GAGCATCGCGAAGAGAGAAGG-3 54

65 Table 3 Treatment groups and virus dosages for in vivo studies Group A rmdv-1137 in vivo study MDV Strain Dosage in PFU Number of Birds Inoculates Contacts 1 Mock RB1B 744 ± ± MD5 504 ± Group B prb1bmeqko in vivo study MDV Strain Dosage in PFU Number of Birds Inoculates Contacts 1 Mock prb1b 1285 ± prb1bmeqko 1355 ± MD5 Meq 21 ±

66 Table 4 Virus reisolation from contact-exposed chickens in rmdv-1137 in vivo study Group MDV Strain Spleen Cells PFU/10 6 cells PBMC 1 Mock 0±0 0±0 2 RB1B 280±4 164± ±23 133±19 4 MD5 406±29 200±12 56

67 Table 5 Mortality and tumor incidence of rmdv-1137 in vivo study Group MDV Strain Mortality 1 Tumor Incidence 2 Inoculates Contacts Inoculates Contacts 1 Mock 0 (0/15) 0 (0/8) 0 (0/15) 0 (0/8) 2 RB1B 100 (11/11) 87 (7/8) 91 (10/11) 12.5 (1/8) (11/11) 87 (7/8) 45 (5/11) 62.5 (58) 4 MD5 100 (9/9) 50 (4/8) 22 (2/9) 25 (2/8) 1 Percent mortality was calculated using number of chickens, which died after two weeks post-inoculation or placement and excludes those taken for virus reisolation sampling. 2 Similarly, tumor incidence is shown as percentage (actual numbers) for those chickens showing distinct lymphomas either at cull or at final necropsy. Chicken numbers are those excluding non-specific mortality and those taken for virus reisolation sampling. 57

68 Table 6 Tumor sites for RB1B-, rmdv and MD5-infected chickens Group Inoculate/ Contact Tumor Incidence Tumor Site Kidney Liver Spleen Gonad RB1B Inoculate 77% RB1B Contact 12.5% rmdv rmdv Inoculate 38% Contact 62.5% MD5 Inoculate 22% MD5 Contact 25%

69 Table 7 Immunophenotypes of RB1B- and rmdv-1137-derived cell lines Antigen UD35 UD36 UD37 UD UD CD /- - CD CD CD8β TCR TCR /- +/- TCR /- BU lgm CD CD CD CD45 +/ CD / GRL-2 + +/- +/ MATSA(143B) +/ MHC-I MHC-II (Ia) JR22(integrinβ1) UD38 shows two different cell populations by scatter profile which were not separated after numerous passage, expression of both populations is shown /- means that not all cells showed expression, +, ++, +++ and ++++ indicate levels of fluorescence expression above control. 59

70 Table 8 Virus reisolation from contact-exposed chickens in prb1bmeqko in vivo study Group MDV Strain PFU/10 6 cells Spleen Cells 1 Mock 0 2 prb1b 68 3 prb1bmeqko 0 4 MD5 Meq

71 Table 9 Mortality and tumor incidence of prb1bmeqko in vivo study Group MDV Strain Mortality 1 Tumor Incidence 2 Inoculates Contacts Inoculates Contacts 1 Mock 0 (0/20) 0 (0/20) 0 (0/20) 0 (0/20) 2 prb1b 18 (3/17) 0 (0/15) 82(14/17) 13 (2/15) 3 prb1bmeqko 0(0/8) 0(0/20) 0 (0/8) 0 (0/20) 4 MD5 Meq 0(0/14) 0(0/15) 0 (2/14) 0(0/15) 1 Percent mortality was calculated using number of chickens which died after two weeks post-inoculation or placement and excludes those taken for virus reisolation sampling. 2 Similarly, tumor incidence is shown as percentage (actual numbers) for those chickens showing distinct lymphomas either at cull or at final necropsy. Chicken numbers are those excluding non-specific mortality and those taken for virus reisolation sampling. 61

72 REFERENCES 1. Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, D. L. Rock, and G. F. Kutish The genome of turkey herpesvirus. J Virol 75: Anderson, A. S., M. S. Parcells, and R. W. Morgan The glycoprotein D (US6) homolog is not essential for oncogenicity or horizontal transmission of Marek's disease virus. J Virol 72: Anobile, J. M., V. Arumugaswami, D. Downs, K. Czymmek, M. Parcells, and C. J. Schmidt Nuclear localization and dynamic properties of the Marek's disease virus oncogene products Meq and Meq/vIL8. J Virol 80: Arumugaswami, V., P. M. Kumar, V. Konjufca, R. L. Dienglewicz, S. M. Reddy, and M. S. Parcells Latency of Marek's disease virus (MDV) in a reticuloendotheliosis virus-transformed T-cell line. I: uptake and structure of the latent MDV genome. Avian Dis 53: Arumugaswami, V., P. M. Kumar, V. Konjufca, R. L. Dienglewicz, S. M. Reddy, and M. S. Parcells Latency of Marek's disease virus (MDV) in a reticuloendotheliosis virus-transformed T-cell line. II: expression of the latent MDV genome. Avian Dis 53: Baaten, B. J., K. A. Staines, L. P. Smith, H. Skinner, T. F. Davison, and C. Butter Early replication in pulmonary B cells after infection with Marek's disease herpesvirus by the respiratory route. Viral Immunol 22: Baigent, S. J., L. J. Ross, and T. F. Davison A flow cytometric method for identifying Marek's disease virus pp38 expression in lymphocyte subpopulations. Avian Pathol 25: Barrow, A. D., S. C. Burgess, S. J. Baigent, K. Howes, and V. K. Nair Infection of macrophages by a lymphotropic herpesvirus: a new tropism for Marek's disease virus. J Gen Virol 84:

73 9. Beasley, J. N., L. T. Patterson, and D. H. McWade Transmission of Marek's disease by poultry house dust and chicken dander. Am J Vet Res 31: Biggs, P. M., H. G. Purchase, B. R. Bee, and P. J. Dalton Preliminary report on acute Marek's disease (fowl paralysis) in Great Britain. J Natl Cancer Inst 37: Brown, A. C., S. J. Baigent, L. P. Smith, J. P. Chattoo, L. J. Petherbridge, P. Hawes, M. J. Allday, and V. Nair Interaction of MEQ protein and C-terminal-binding protein is critical for induction of lymphomas by Marek's disease virus. Proc Natl Acad Sci U S A 103: Brown, A. C., L. P. Smith, L. Kgosana, S. J. Baigent, V. Nair, and M. J. Allday Homodimerization of the Meq viral oncoprotein is necessary for induction of T-cell lymphoma by Marek's disease virus. J Virol 83: Brunovskis, P., and L. F. Velicer The Marek's disease virus (MDV) unique short region: alphaherpesvirus- homologous, fowlpox virushomologous, and MDV-specific genes. Virology 206: Brunovskis, P., and L. F. Velicer The Marek's disease virus (MDV) unique short region: alphaherpesvirus-homologous, fowlpox virushomologous, and MDV-specific genes. Virology 206: Bublot, M., and J. Sharma Vaccination Against Marek's Disease, p In F. Davison and V. Nair (ed.), Marek's Disease, An Evolving Problem, vol. 1. Elsevier Academic Press, Compton, UK. 16. Burgess, S. C., J. R. Young, B. J. Baaten, L. Hunt, L. N. Ross, M. S. Parcells, P. M. Kumar, C. A. Tregaskes, L. F. Lee, and T. F. Davison Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30). Proc Natl Acad Sci U S A 101: Buscaglia, C., B. W. Calnek, and K. A. Schat Effect of immunocompetence on the establishment and maintenance of latency with Marek's disease herpesvirus. J Gen Virol 69 ( Pt 5): Calnek, B. W Marek's disease--a model for herpesvirus oncology. Crit Rev Microbiol 12: Calnek, B. W., H. K. Adldinger, and D. E. Kahn Feather follicle epithelium: a source of enveloped and infectious cell-free herpesvirus from Marek's disease. Avian Dis 14:

74 20. Calnek, B. W., K. A. Schat, M. C. Peckham, and J. Fabricant Field trials with a bivalent vaccine (HVT and SB-1) against Marek's disease. Avian Dis 27: Campbell, J. G., and P. M. Biggs A proposed classification of the leucosis complex and fowl paralysis. Br Vet J 117: Cantello, J. L., M. S. Parcells, A. S. Anderson, and R. W. Morgan Marek's disease virus latency-associated transcripts belong to a family of spliced RNAs that are antisense to the ICP4 homolog gene. J Virol 71: Chang, J. D., C. S. Eidson, M. J. Dykstra, S. H. Kleven, and O. J. Fletcher Vaccination against Marek's disease and infectious bursal disease. I. Development of a bivalent live vaccine by co-cultivating turkey herpesvirus and infectious bursal disease vaccine viruses in chicken embryo fibroblast monolayers. Poult Sci 62: Chang, J. D., C. S. Eidson, S. H. Kleven, and O. J. Fletcher Vaccination against Marek's disease and infectious bursal disease. II. Titration and in vivo efficacy of the coinfection-derived bivalent live vaccine for turkey herpesvirus and infectious bursal disease virus. Poult Sci 63: Chinnadurai, G The transcriptional corepressor CtBP: a foe of multiple tumor suppressors. Cancer Res 69: Chinnadurai, G Transcriptional regulation by C-terminal binding proteins. Int J Biochem Cell Biol 39: Churchill, A. E Herpes-type virus isolated in cell culture from tumors of chickens with Marek's disease. I. Studies in cell culture. J Natl Cancer Inst 41: Churchill, A. E., and P. M. Biggs Herpes-type virus isolated in cell culture from tumors of chickens with Marek's disease. II. Studies in vivo. J Natl Cancer Inst 41: Churchill, A. E., R. C. Chubb, and W. Baxendale The attenuation, with loss of oncogenicity, of the herpes-type virus of Marek's disease (strain HPRS-16) on passage in cell culture. J Gen Virol 4: Cortes, P. L., and C. J. Cardona Pathogenesis of a Marek's disease virus mutant lacking vil-8 in resistant and susceptible chickens. Avian Dis 48:

75 31. Cui, X., L. F. Lee, H. D. Hunt, W. M. Reed, B. Lupiani, and S. M. Reddy A Marek's disease virus vil-8 deletion mutant has attenuated virulence and confers protection against challenge with a very virulent plus strain. Avian Dis 49: Cui, X., L. F. Lee, W. M. Reed, H. J. Kung, and S. M. Reddy Marek's disease virus-encoded vil-8 gene is involved in early cytolytic infection but dispensable for establishment of latency. J Virol 78: Czekanska, E. M. Assessment of cell proliferation with resazurin-based fluorescent dye. Methods Mol Biol 740: Delany, M. E., C. M. Robinson, R. M. Goto, and M. M. Miller Architecture and organization of chicken microchromosome 16: order of the NOR, MHC-Y, and MHC-B subregions. J Hered 100: Delecluse, H. J., and W. Hammerschmidt Status of Marek's disease virus in established lymphoma cell lines: herpesvirus integration is common. J Virol 67: Delecluse, H. J., S. Schuller, and W. Hammerschmidt Latent Marek's disease virus can be activated from its chromosomally integrated state in herpesvirus-transformed lymphoma cells. Embo J 12: Dienglewicz, R. L., and M. S. Parcells Establishment of a lymphoblastoid cell line using a mutant MDV containing a green fluorescent protein expression cassette. Acta Virologica 43: Dorange, F., B. K. Tischer, J. F. Vautherot, and N. Osterrieder Characterization of Marek's disease virus serotype 1 (MDV-1) deletion mutants that lack UL46 to UL49 genes: MDV-1 UL49, encoding VP22, is indispensable for virus growth. J Virol 76: Fukuchi, K., M. Sudo, Y. S. Lee, A. Tanaka, and M. Nonoyama Structure of Marek's disease virus DNA: detailed restriction enzyme map. J Virol 51: Izumiya, Y., H. K. Jang, M. Ono, and T. Mikami A complete genomic DNA sequence of Marek's disease virus type 2, strain HPRS24. Curr Top Microbiol Immunol 255: Jarosinski, K. W., N. G. Margulis, J. P. Kamil, S. J. Spatz, V. K. Nair, and N. Osterrieder Horizontal transmission of Marek's disease virus requires US2, the UL13 protein kinase, and gc. J Virol. 65

76 42. Jarosinski, K. W., N. G. Margulis, J. P. Kamil, S. J. Spatz, V. K. Nair, and N. Osterrieder Horizontal transmission of Marek's disease virus requires US2, the UL13 protein kinase, and gc. J Virol 81: Jones, D., L. Lee, J. L. Liu, H. J. Kung, and J. K. Tillotson Marek disease virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly expressed in lymphoblastoid tumors. Proc Natl Acad Sci U S A 89: Jones, D., L. Lee, J. L. Liu, H. J. Kung, and J. K. Tillotson Marek disease virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly expressed in lymphoblastoid tumors [published erratum appears in Proc Natl Acad Sci U S A 1993 Mar 15;90(6):2556]. Proc Natl Acad Sci U S A 89: Kingham, B. F., V. Zelnik, J. Kopacek, V. Majerciak, E. Ney, and C. J. Schmidt The genome of herpesvirus of turkeys: comparative analysis with Marek's disease viruses. J Gen Virol 82: Koyama, T., Y. Nakajima, K. Miura, M. Yamazaki, M. Shinozaki, T. Kumagai, and M. Sakaniwa Analysis of extracellular matrix proteins in malignant chicken cell lines. J Vet Med Sci 59: Kumar, P. M., V. Arumugaswami, H. Dong, Y. Farnell, R. L. Dienglewicz, P. Tavlarides-Hontz, and M. S. Parcells Spliced gene products of the Meq oncoprotein of Marek's disease virus (MDV) are expressed during latency, bind to the MDV genome, are potent transcriptional repressors, and induce cellular proliferation. J Virol in press. 48. Kung, H. J., L. Xia, P. Brunovskis, D. Li, J. L. Liu, and L. F. Lee Meq: an MDV-specific bzip transactivator with transforming properties. Curr Top Microbiol Immunol 255: Lee, L. F., K. S. Kreager, J. Arango, A. Paraguassu, B. Beckman, H. Zhang, A. Fadly, B. Lupiani, and S. M. Reddy Comparative evaluation of vaccine efficacy of recombinant Marek's disease virus vaccine lacking Meq oncogene in commercial chickens. Vaccine 28: Lee, L. F., J. L. Liu, X. P. Cui, and H. J. Kung Marek's disease virus latent protein MEQ: delineation of an epitope in the BR1 domain involved in nuclear localization. Virus Genes 27:

77 51. Lee, L. F., J. L. Liu, X. P. Cui, and H. J. Kung Marek's disease virus latent protein MEQ: delineation of an epitope in the BR1 domain involved in nuclear localization. Virus Genes 27: Lee, L. F., X. Liu, J. M. Sharma, K. Nazerian, and L. D. Bacon A monoclonal antibody reactive with Marek's disease tumor-associated surface antigen. J Immunol 130: Lee, L. F., B. Lupiani, R. F. Silva, H. J. Kung, and S. M. Reddy Recombinant Marek's disease virus (MDV) lacking the Meq oncogene confers protection against challenge with a very virulent plus strain of MDV. Vaccine 26: Lee, L. F., P. Wu, D. Sui, D. Ren, J. Kamil, H. J. Kung, and R. L. Witter The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus. Proc Natl Acad Sci U S A 97: Levy, A. M., O. Gilad, L. Xia, Y. Izumiya, J. Choi, A. Tsalenko, Z. Yakhini, R. Witter, L. Lee, C. J. Cardona, and H. J. Kung Marek's disease virus Meq transforms chicken cells via the v-jun transcriptional cascade: a converging transforming pathway for avian oncoviruses. Proc Natl Acad Sci U S A 102: Levy, A. M., Y. Izumiya, P. Brunovskis, L. Xia, M. S. Parcells, S. M. Reddy, L. Lee, H. W. Chen, and H. J. Kung Characterization of the chromosomal binding sites and dimerization partners of the viral oncoprotein Meq in Marek's disease virus-transformed T cells. J Virol 77: Liu, J. L., Y. Ye, L. F. Lee, and H. J. Kung Transforming potential of the herpesvirus oncoprotein MEQ: morphological transformation, serumindependent growth, and inhibition of apoptosis. J Virol 72: Liu, J. L., Y. Ye, Z. Qian, Y. Qian, D. J. Templeton, L. F. Lee, and H. J. Kung Functional interactions between herpesvirus oncoprotein MEQ and cell cycle regulator CDK2. J Virol 73: Lupiani, B., L. F. Lee, X. Cui, I. Gimeno, A. Anderson, R. W. Morgan, R. F. Silva, R. L. Witter, H. J. Kung, and S. M. Reddy Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. Proc Natl Acad Sci U S A 101: Epub 2004 Aug 2. 67

78 60. Marek, J Multiple Nervenentzündung (Polyneuritis) bei Hühnern. Dtsch. Tierärztl. Wochenschr. 15: Moore, F. R., K. A. Schat, N. Hutchison, C. Leciel, and S. E. Bloom Consistent chromosomal aberration in cell lines transformed with Marek's disease herpesvirus: evidence of genomic DNA amplification. Int J Cancer 54: Murata, S., T. Okada, R. Kano, Y. Hayashi, T. Hashiguchi, M. Onuma, S. Konnai, and K. Ohashi Analysis of transcriptional activities of the Meq proteins present in highly virulent Marek's disease virus strains, RB1B and Md5. Virus Genes. 63. Niikura, M., R. L. Witter, H. K. Jang, M. Ono, T. Mikami, and R. F. Silva MDV glycoprotein D is expressed in the feather follicle epithelium of infected chickens. Acta Virol 43: Okazaki, W., H. G. Purchase, and B. R. Burmester Protection against Marek's disease by vaccination with a herpesvirus of turkeys. Monatsh Veterinarmed 25: Pappenheimer, A. M., L. C. Dunn, and S. M. Seidlin Studies on Fowl Paralysis (Neurolymphomatosis Gallinarum) : Ii. Transmission Experiments. J Exp Med 49: Parcells, M. S., and S. C. Burgess Immunological Aspects of Marek's disease virus (MDV)-induced Lymphoma Progression, p In H. E. a. A. N. Kaiser (ed.), Selected Aspects of Cancer Progression: Metastasis, Apoptosis and Immune Response, vol. 11. Springer, The Netherlands. 67. Parcells, M. S., A. S. Anderson, J. L. Cantello, and R. W. Morgan Characterization of Marek's disease virus insertion and deletion mutants that lack US1 (ICP22 homolog), US10, and/or US2 and neighboring shortcomponent open reading frames. J Virol 68: Parcells, M. S., V. Arumugaswami, J. T. Prigge, K. Pandya, and R. L. Dienglewicz Marek's disease virus reactivation from latency: changes in gene expression at the origin of replication. Poult Sci 82: Parcells, M. S., and S. C. Burgess Immunological Aspects of Marek's disease virus (MDV)-induced Lymphoma Progression, p In H. E. a. A. N. Kaiser (ed.), Selected Aspects of Cancer Progression: Metastasis, Apoptosis and Immune Response, vol. 11. Springer, The Netherlands. 68

79 70. Parcells, M. S., and S. C. Burgess Immunological aspects of Marek s disease virus (MDV)-induced lymphoma progression Immune Suppression and Modulation In H. E. N. Kaiser (ed.), Selected Aspects of Cancer Progression: Metastasis, Apoptosis and Immune Response, vol. Volume 11. Springer Netherlands, Amsterdam. 71. Parcells, M. S., S. F. Lin, R. L. Dienglewicz, V. Majerciak, D. R. Robinson, H. C. Chen, Z. Wu, G. R. Dubyak, P. Brunovskis, H. D. Hunt, L. F. Lee, and H. J. Kung Marek's disease virus (MDV) encodes an interleukin-8 homolog (vil-8): characterization of the vil-8 protein and a vil-8 deletion mutant MDV. J Virol 75: Parcells, M. S., S. F. Lin, R. L. Dienglewicz, V. Majerciak, D. R. Robinson, H. C. Chen, Z. Wu, G. R. Dubyak, P. Brunovskis, H. D. Hunt, L. F. Lee, and H. J. Kung Marek's disease virus (MDV) encodes an interleukin-8 homolog (vil-8): characterization of the vil-8 protein and a vil-8 deletion mutant MDV. J Virol 75: Peng, Q., and Y. Shirazi Characterization of the protein product encoded by a splicing variant of the Marek's disease virus Eco-Q gene (Meq). Virology 226: Peng, Q., and Y. Shirazi Isolation and characterization of Marek's disease virus (MDV) cdnas from a MDV-transformed lymphoblastoid cell line: identification of an open reading frame antisense to the MDV Eco-Q protein (Meq). Virology 221: Peng, Q., M. Zeng, Z. A. Bhuiyan, E. Ubukata, A. Tanaka, M. Nonoyama, and Y. Shirazi Isolation and characterization of Marek's disease virus (MDV) cdnas mapping to the BamHI-I2, BamHI-Q2, and BamHI-L fragments of the MDV genome from lymphoblastoid cells transformed and persistently infected with MDV. Virology 213: Petherbridge, L., A. C. Brown, S. J. Baigent, K. Howes, M. A. Sacco, N. Osterrieder, and V. K. Nair Oncogenicity of virulent Marek's disease virus cloned as bacterial artificial chromosomes. J Virol 78: Prigge, J. T., V. Majerciak, H. D. Hunt, R. L. Dienglewicz, and M. S. Parcells Construction and characterization of Marek's disease viruses having green fluorescent protein expression tied directly or indirectly to phosphoprotein 38 expression. Avian Dis 48:

80 78. Qian, Z., P. Brunovskis, L. Lee, P. K. Vogt, and H. J. Kung Novel DNA binding specificities of a putative herpesvirus bzip oncoprotein. J Virol 70: Qian, Z., P. Brunovskis, F. Rauscher, 3rd, L. Lee, and H. J. Kung Transactivation activity of Meq, a Marek's disease herpesvirus bzip protein persistently expressed in latently infected transformed T cells. J Virol 69: Rath, N. C., M. S. Parcells, H. Xie, and E. Santin Characterization of a spontaneously transformed chicken mononuclear cell line. Vet Immunol Immunopathol 96: Reinke, A. W., G. Grigoryan, and A. E. Keating. Identification of bzip interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays. Biochemistry 49: Rispens, B. H., H. v. Vloten, N. Mastenbroek, H. J. Maas, and K. A. Schat Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis 16: Rispens, B. H., H. v. Vloten, N. Mastenbroek, J. L. Maas, and K. A. Schat Control of Marek's disease in the Netherlands. II. Field trials on vaccination with an avirulent strain (CVI 988) of Marek's disease virus. Avian Dis 16: Roizman, B. S., A.E Fields virology. Lippincott-Raven Press, New York. 85. Sambrook, J Molecular cloning: a laboratory manual, 2 ed. Cold Spring Harbor Press. 86. Santin, E. R., C. E. Shamblin, J. T. Prigge, V. Arumugaswami, R. L. Dienglewicz, and M. S. Parcells Examination of the effect of a naturally occurring mutation in glycoprotein L on Marek's disease virus pathogenesis. Avian Dis 50: Sarma, G., W. Greer, R. P. Gildersleeve, D. L. Murray, and A. M. Miles Field safety and efficacy of in ovo administration of HVT + SB-1 bivalent Marek's disease vaccine in commercial broilers. Avian Dis 39: Schat, K. A Role of the spleen in the pathogenesis of Marek's disease. Avian Pathol 10:

81 89. Schat, K. A., and B. W. Calnek Characterization of an apparently nononcogenic Marek's disease virus. J Natl Cancer Inst 60: Schat, K. A., and B. W. Calnek Protection against Marek's diseasederived tumor transplants by the nononcogenic SB-1 strain of Marek's disease virus. Avian Dis 22: Schat, K. A., B. W. Calnek, and J. Fabricant Characterisation of two highly oncogenic strains of Marek's disease virus. Avian Pathol 11: Schumacher, D., B. K. Tischer, W. Fuchs, and N. Osterrieder Reconstitution of Marek's disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein B- negative MDV-1 mutant. J Virol 74: Schumacher, D., B. K. Tischer, S. M. Reddy, and N. Osterrieder Glycoproteins E and I of Marek's disease virus serotype 1 are essential for virus growth in cultured cells. J Virol 75: Shack, L. A., J. J. Buza, and S. C. Burgess The neoplastically transformed (CD30hi) Marek's disease lymphoma cell phenotype most closely resembles T-regulatory cells. Cancer Immunol Immunother 57: Shamblin, C. E., N. Greene, V. Arumugaswami, R. L. Dienglewicz, and M. S. Parcells Comparative analysis of Marek's disease virus (MDV) glycoprotein-, lytic antigen pp38- and transformation antigen Meq-encoding genes: association of meq mutations with MDVs of high virulence. Vet Microbiol 102: Shamblin, C. E., N. Greene, V. Arumugaswami, R. L. Dienglewicz, and M. S. Parcells Comparative analysis of Marek's disease virus (MDV) glycoprotein-, lytic antigen pp38- and transformation antigen Meq-encoding genes: association of meq mutations with MDVs of high virulence. Vet Microbiol 102: Shek, W. R., B. W. Calnek, K. A. Schat, and C. H. Chen Characterization of Marek's disease virus-infected lymphocytes: discrimination between cytolytically and latently infected cells. J Natl Cancer Inst 70: Su, S., Y. Li, A. Sun, P. Zhao, J. Ding, H. Zhu, and Z. Cui [Protective immunity of a meq-deleted Marek's disease virus against very virulent virus challenge in chickens]. Wei Sheng Wu Xue Bao 50:

82 99. Suchodolski, P. F., Y. Izumiya, B. Lupiani, D. K. Ajithdoss, O. Gilad, L. F. Lee, H. J. Kung, and S. M. Reddy Homodimerization of Marek's disease virus-encoded Meq protein is not sufficient for transformation of lymphocytes in chickens. J Virol 83: Suchodolski, P. F., Y. Izumiya, B. Lupiani, D. K. Ajithdoss, L. F. Lee, H. J. Kung, and S. M. Reddy Both homo and heterodimers of Marek's disease virus encoded Meq protein contribute to transformation of lymphocytes in chickens. Virology 399: Tischer, B. K., D. Schumacher, M. Messerle, M. Wagner, and N. Osterrieder The products of the UL10 (gm) and the UL49.5 genes of Marek's disease virus serotype 1 are essential for virus growth in cultured cells. J Gen Virol 83: Trapp, S., M. S. Parcells, J. P. Kamil, D. Schumacher, B. K. Tischer, P. M. Kumar, V. K. Nair, and N. Osterrieder A virus-encoded telomerase RNA promotes malignant T cell lymphomagenesis. J Exp Med 203: Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, D. L. Rock, and G. F. Kutish The genome of a very virulent Marek's disease virus. J Virol 74: Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, D. L. Rock, and G. F. Kutish The genome of a very virulent Marek's disease virus. J Virol 74: Witter, R. L Characteristics of Marek's disease viruses isolated from vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency. Avian Dis 27: Witter, R. L Increased virulence of Marek's disease virus field isolates. Avian Dis 41: Witter, R. L., K. Nazerian, H. G. Purchase, and G. H. Burgoyne Isolation from turkeys of a cell-associated herpesvirus antigenically related to Marek's disease virus. Biken J 13: Witter, R. L., J. M. Sharma, L. F. Lee, H. M. Opitz, and C. W. Henry Field trials to test the efficacy of polyvalent Marek's disease vaccines in broilers. Avian Dis 28: Wu, P., W. M. Reed, and L. F. Lee Glycoproteins H and L of Marek's disease virus form a hetero-oligomer essential for translocation and cell surface expression. Arch Virol 146:

83 110. Xing, Z., and K. A. Schat Inhibitory effects of nitric oxide and gamma interferon on in vitro and in vivo replication of Marek's disease virus. J Virol 74: Zhao, Y., D. Kurian, H. Xu, L. Petherbridge, L. P. Smith, L. Hunt, and V. Nair Interaction of Marek's disease virus oncoprotein Meq with heatshock protein 70 in lymphoid tumour cells. J Gen Virol 90:

84 74

85 75