Can physical exercise and exercise mimetics improve metabolic health in humans?

Size: px
Start display at page:

Download "Can physical exercise and exercise mimetics improve metabolic health in humans?"

Transcription

1 Can physical exercise and exercise mimetics improve metabolic health in humans? Patrick Schrauwen, PhD NUTRIM school for Nutrition and Translational Research in Metabolism Department of Human Biology, Maastricht University

2

3 Domino effect: diabetes increases risk on many complications

4 Obesity is the major risk factor for type 2 diabetes > 90% of type 2 diabetes patients is obese!

5 Ectopic fat accumulation connects obesity with metabolic disorders

6

7 Muscle fat accumulation (IMCL) is negatively associated with insulin sensitivity Krssak et al., Diabetologia 2002 Sinha et al., Diabetes 2002 Fourouhi et al., Diabetologia 1999 Jacob et al., Diabetes 1999

8 Lipotoxicity; a delicate balance between oxidation and storage? Dietary fat Storage Fat Oxidation

9 Q: Is mitochondrial dysfunction the basis for lipotoxicity?

10 signal intensity (arbitrary units) Relative PCr content Knee extension Against weight 31 P-coil Exercise is performed in MRI scanner during 31P-MRS measurement PCr 100% 80% ATP p i 60% relative resonance frequency 40% time (s) rest exercise recovery

11 Decreased in vivo mitochondrial function in T2DM and first-degree relatives p<0.05 # p=0.08 Phielix et al., Diabetes 2008

12 Intrinsic mitochondrial function using highresolution respirometry O2 Concentration (A) [nmol/ml] State 3 O2 Flux per V (A) [pmol/(sml)] State u :00:00 00:07:30 00:15:00 00:22:30 00:30:00 00:37:30 Range [hh:mm:ss]: 00:45:00 vezels mal glut A DP succ FCCP +1+1 R1 00:19:06 00:21:30 00:26:07 00:33:39 00:36: :45:00

13 intrinsic mitochondrial function is decreased in T2DM and FDR cont fdr t2dm cont fdr t2dm No differences in mtdna copy number Phielix et al., Diabetes 2008

14 Conclusion: Diabetes is associated with lower mitochondrial function in skeletal muscle Q: does an improved mitochondrial function improve insulin resistance?

15 12 week endurance and strength training programme Meex et al., Diabetes 2010

16 Study design Screening Baseline measurements Training 12 weeks Post intervention measurements ` Resistance training: 1x/week, 8 exercises 1 set, 8 repetitions, 50% of MVC 2 sets, 8 repetitions, 75% of MVC Endurance training: 2x/week. 30 minutes on 55% of max power output With permission Progressive training program 5 minutes of warming up and cooling down before and after every training session on 45% of max power output on the ergometer Supervised training and heart rate monitored

17 ml/min/kg body mass watt Exercise training improves physical performance VO2max/kg body mass Maximal power output C T2D 0 C T2D Data are means ± SE Before training After training Meex et al., Diabetes 2010

18 % kg Exercise training barely affects body mass or composition Body mass Fat percentage C T2D 0 C T2D Data are means ± SE No changes in fat free mass Before training After training Meex et al., Diabetes in press Meex et al., Diabetes 2010

19 Exercise training improves metabolic flexibility Metabolic flexibility (Δ RER) Δ CHO oxidation (g/h) Δ Fat oxidation (g/h) C T2D C T2D C T2D Data are means ± SE Before training After training Meex et al., Diabetes 2010

20 PCr recovery rate constant (s -1 ) OXPHOS protein content Exercise training improves mitochondrial function Mitochondrial function (MRS) Mitochondrial density ,06 0,05 0,04 0,03 0,02 0,01 0,00 C T2D 2,0 1,8 1,6 1,4 1,2 1,0 0,8 0,6 0,4 0,2 0,0 C T2D Data are means ± SE Before training After training Meex et al., Diabetes 2010

21 Delta Rd (umol/kg/min) Exercise training improves insulin sensitivity Enodgenous glucose production umol/kg/min Muscle insulin sensitivity Before training After training C T2D hepatic insulin sensitivity basal 4 insulin 2 Meex et al., Diabetes C C pre training post training T2D pre training T2D post training

22 Q: What about effects beyond muscle metabolism?

23 Quantification of cardiac lipid content by 1 H-MRS 128 averages CH 2 CH resonance frequency (ppm) cardiac triggering and breath holds, breathing commands or respiratory gating (resp. sensor or navigator)

24 Exercise training decreases cardiac lipid content in obese subjects Schrauwen-hinderling et al., JCEM 2010

25 Exercise training and metabolic risk Not all subjects respond similarly to exercise training subjects with a high baseline ALAT activity (marker of fatty liver) improve more in TG, HDL, VLDL Optimizing the exercise regime for diabetes also needs focus on the liver!

26 Mitochondrial function?fatty liver glucose uptake insulin sensitivity fatty acid handling metabolic flexibility VLDL-TG output FA clearance inflammatory lipids Glucose output reduced metabolic risk

27 Conclusion: Exercise training improves metabolic health Q: can mitochondrial function be improved without exercise?

28 Calorie restriction mimetics that target sirtuin 1 Sirtuin 1 (SIRT1) = NAD + -dependent histone deacetylase SIRT1 acts as a metabolic sensor, capable of modulating gene expression according to the metabolic state of the cell In 2003, Howitz and colleagues performed an in vitro screen to identify small molecule activators of SIRT1 and identified resveratrol as the most potent activator (Howitz et al., 2003, Nature)

29 Resveratrol Polyphenolic compound Main dietary sources: grapes, wine, peanuts Richest source: Japanese knotweed

30 Q: Can mitochondrial function be improved by functional foods? Hoeks and Schrauwen, TEM 2012

31 Resveratrol in rodents Prevented weight gain in mice on a high-fat diet Improved various biomarkers in the plasma: triglycerides, FFA levels, glucose and insulin values Improved insulin sensitivity Activated AMPK and SIRT1 Increased mitochondrial number and decreases acetylation of PGC-1α Resveratrol shifts the metabolic phenotype of mice on a high-calorie diet towards those on a standard chow diet Baur et al., 2006, Nature Lagouge et al., 2006, Cell

32 Clinical study design placebo d0 d7 d14 d21 d29 d30 placebo d0 d7 d14 d21 d29 d30 resveratrol resveratrol d0 d7 d14 d21 d29 d30 d0 d7 d14 d21 d29 d30 placebo / resveratrol d0 d7 d14 d21 d28 d30 Body weight Blood sample DEXA scan VO 2 max test Body weight Blood sample Body weight Blood sample Body weight Blood sample Intrahepatic lipid content Mitochondrial function Respiration chamber Body weight Blood sample Muscle biopsy Microdialysis test Timmers et al., Cell Metabolism 2011

33 Subjects baseline characteristics (day 0) Timmers et al., Cell Metabolism 2011

34 FIGURE 2 A Molecular mechanism of resveratrol C Mouse vehicle RSV placebo B placebo RSV placebo NDUFB11 NDUFA3 NDUFS6 ETFB NDUFS8 COX7B COX7C UQCRB NDUFB9 SDHC KEGG pathway: oxidative phosphorylation FYN HLA C CBL IFNAR2 JAK1 IRF1 STAT5A ISG20 PRKCD IRAK4 RSV RSV Timmers et al., Cell Metabolism 2011

35 Molecular mechanism of resveratrol pampk / AMPK placebo resveratrol SIRT1 / tubulin placebo resveratrol Timmers et al., Cell Metabolism 2011

36 Mitochondrial metabolism Timmers et al., Cell Metabolism 2011

37 Energy metabolism (day 30) SMR (MJ/d) placebo resveratrol h EE (MJ/d) body weight (kg) placebo resveratrol 0 placebo resveratrol Timmers et al., Cell Metabolism 2011

38 Adipose tissue Konings et al., IJO 2014

39 FIGURE 4 A FIGURE 4 A 4 B B Relative signal intensity Relative signal intensity Relative signal intensity Relative signal intensity (scaled to water resonance) Ectopic lipid accumulation placebo resveratrol 4 placebo resveratrol placebo 3 resveratrol (scaled to water resonance) (scaled to water resonance) (scaled to water resonance) placebo RSV 0 Relative resonance 0frequency (ppm) placebo RSV Relative 3 resonance frequency 3 (ppm) placebo Relative 1 0 resonance frequency (ppm) placebo RSV Relative resonance type frequency 1 stain (ppm) oil-red-o type 1 stain oil-red-o type 1 stain oil-red-o type 1 stain oil-red-o placebo placebo placebo placebo 20 20resveratrol placebo resveratrol resveratrol resveratrol 1 placebo resveratrol Liver fat (%) 3 2 Muscle fat (area fraction) Liver fat (%) Muscle fat (area fraction) Liver fat (%) Liver fat (%) 1 Muscle fat (area fraction) Muscle fat (area fraction) total 0 type 1 0 type 2 total total type 1 type type 1 2 type RSV placebo placebo resveratrol resveratrol placebo resveratrol total type 1 type 2 Timmers et al., Cell Metabolism 2011

40 Blood pressure

41 Plasma biochemistry (day 30) Timmers et al., Cell Metabolism 2011

42 There is more than resveratrol: central role for nutritional sensors in regulating mitochondrial function

43 Acipimox a lipolysis inhibitor - increased rather than decreased FFA: rebound effect Type 2 diabetic patients treated with acipimox or placebo for 2 weeks

44 Acipimox a NAD+ analogue increases muscle mitochondrial function in humans Type 2 diabetic patients treated with acipimox or placebo for 2 weeks C2C12 Van de Weijer et al., Diabetes 2014

45 Conclusion: Mitochondrial function can be improved by NAD+ boosters, also in humans Clinical intervention studies are needed to test if NAD+ is a target to prevent/treat type 2 diabetes

46 Stimulating energy turnover as a target to improve metabolic health Dietary fat Storage Fat Oxidation

Breathtaking organelles in vital bodies; in vivo measures of mitochondrial function

Breathtaking organelles in vital bodies; in vivo measures of mitochondrial function Breathtaking organelles in vital bodies; in vivo measures of mitochondrial function Matthijs Hesselink Nutrition and Toxicology Research Institute Maastricht (NUTRIM) Department of Human Movement Sciences

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Resveratrol. a booster of mitochondria. Marlies de Ligt

Resveratrol. a booster of mitochondria. Marlies de Ligt Resveratrol a booster of mitochondria Marlies de Ligt The studies presented in this thesis were performed within the framework of the NUTRIM School of Nutrition and Translational Research in Metabolism.

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio

More information

Convergent and Divergent Mechanisms in Aging and Cancer

Convergent and Divergent Mechanisms in Aging and Cancer Convergent and Divergent Mechanisms in Aging and Cancer Mariana S. De Lorenzo, PhD Department of Cell Biology & Molecular Medicine delorems@umdnj.edu LEARNING OBJECTIVES 1. To identify convergent and divergent

More information

Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging

Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging Dr. S. Buchwald-Werner 6. May 2015 Vitafoods Europe Conference Healthy Aging Session Consumer demand for healthy-aging

More information

EXERCISE PRESCRIPTION FOR OBESE PATIENT

EXERCISE PRESCRIPTION FOR OBESE PATIENT EXERCISE PRESCRIPTION FOR OBESE PATIENT ASSOC. PROF. DR. MOHD NAHAR AZMI MOHAMED HEAD, SPORTS MEDICINE DEPARTMENT SENIOR MEDICAL LECTURER / CONSULTANT SPORTS PHYSICIAN UNIVERSITI MALAYA MEDICAL CENTER

More information

Resveratrol and Metformin Combination Therapy in Prevention and Treatment of Insulin Resistance. Scott Frendo-Cumbo

Resveratrol and Metformin Combination Therapy in Prevention and Treatment of Insulin Resistance. Scott Frendo-Cumbo Resveratrol and Metformin Combination Therapy in Prevention and Treatment of Insulin Resistance by Scott Frendo-Cumbo A Thesis Presented to The University of Guelph In partial fulfillment of requirements

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

NAFLD AND TYPE 2 DIABETES

NAFLD AND TYPE 2 DIABETES NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

Effects of sitagliptin on cardiac metabolism in mice

Effects of sitagliptin on cardiac metabolism in mice Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

Chapter 14. Energy conversion: Energy & Behavior

Chapter 14. Energy conversion: Energy & Behavior Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making

More information

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity 1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism

More information

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia

More information

Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa

Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis in patients with heart failure (HF) 1

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

More information

Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities

Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis

More information

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES SPORT PATHWAYS WITH FOUNDATION YEAR SEMESTER TWO EXAMINATIONS 2015/2016

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES SPORT PATHWAYS WITH FOUNDATION YEAR SEMESTER TWO EXAMINATIONS 2015/2016 LH8 UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES SPORT PATHWAYS WITH FOUNDATION YEAR SEMESTER TWO EXAMINATIONS 2015/2016 INTRODUCTION TO HUMAN PHYSIOLOGY MODULE NO: SRB3008 Date: Monday

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Principles of Anatomy and Physiology

Principles of Anatomy and Physiology Principles of Anatomy and Physiology 14 th Edition CHAPTER 25 Metabolism and Nutrition Metabolic Reactions Metabolism refers to all of the chemical reactions taking place in the body. Reactions that break

More information

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Medical Biochemistry and Molecular Biology department

Medical Biochemistry and Molecular Biology department Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-

More information

UNIVERSITY OF BOLTON SPORT AND BIOLOGICAL SCIENCES SPORT AND EXERCISE SCIENCE PATHWAY SEMESTER TWO EXAMINATIONS 2016/2017

UNIVERSITY OF BOLTON SPORT AND BIOLOGICAL SCIENCES SPORT AND EXERCISE SCIENCE PATHWAY SEMESTER TWO EXAMINATIONS 2016/2017 LH14 UNIVERSITY OF BOLTON SPORT AND BIOLOGICAL SCIENCES SPORT AND EXERCISE SCIENCE PATHWAY SEMESTER TWO EXAMINATIONS 2016/2017 INTRODUCTION TO SPORT AND EXERCISE PHYSIOLOGY MODULE NO: SPS4002 Date: Thursday

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

The use of fasting and glycogen depletion to enhance skeletal muscle adaptation to training

The use of fasting and glycogen depletion to enhance skeletal muscle adaptation to training The use of fasting and glycogen depletion to enhance skeletal muscle adaptation to training Andrew Philp Ph.D. MRC-ARUK Centre for Musculoskeletal Ageing Research School of Sport, Exercise and Rehabilitation

More information

Funded Application: Example #3

Funded Application: Example #3 Funded Application: Example #3 Advice from the student: Make sure you explore several options before finding a topic you're really interested in, and make plenty of visits to mentor's laboratory to discuss

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Non-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure. By: Jessica Chan & Dayna Weststeyn

Non-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure. By: Jessica Chan & Dayna Weststeyn Non-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure By: Jessica Chan & Dayna Weststeyn Hypothesis The hypothesis for this point presentation is that non-shivering

More information

The Role of Mitochondria in the Pathophysiology of Skeletal Muscle Insulin Resistance

The Role of Mitochondria in the Pathophysiology of Skeletal Muscle Insulin Resistance REVIEW The Role of Mitochondria in the Pathophysiology of Skeletal Muscle Insulin Resistance Ines Pagel-Langenickel, Jianjun Bao, Liyan Pang, and Michael N. Sack Translational Medicine Branch, National

More information

Metabolism. Chapter 5. Catabolism Drives Anabolism 8/29/11. Complete Catabolism of Glucose

Metabolism. Chapter 5. Catabolism Drives Anabolism 8/29/11. Complete Catabolism of Glucose 8/29/11 Metabolism Chapter 5 All of the reactions in the body that require energy transfer. Can be divided into: Cell Respiration and Metabolism Anabolism: requires the input of energy to synthesize large

More information

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5

More information

Fat Metabolism, Insulin and MTHFR

Fat Metabolism, Insulin and MTHFR Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain

More information

Chapter 21 Training for Anaerobic and Aerobic Power

Chapter 21 Training for Anaerobic and Aerobic Power Section 06: Exercise Training to Improve Performance Chapter 21 Training for Anaerobic and Aerobic Power Chapter 22 Muscular Strength: Training Muscles to Become Stronger Chapter 23 Special Aids to Exercise

More information

Dietary fat, carbohydrates and inflammation. Ellen Blaak, PhD

Dietary fat, carbohydrates and inflammation. Ellen Blaak, PhD Dietary fat, carbohydrates and inflammation Ellen Blaak, PhD of Human Biology NUTRIM School for Nutrition, Toxicology and Metabolism Maastricht University Medical Centre The Netherlands ILSI workshop,

More information

Biol 219 Lec 7 Fall 2016

Biol 219 Lec 7 Fall 2016 Cellular Respiration: Harvesting Energy to form ATP Cellular Respiration and Metabolism Glucose ATP Pyruvate Lactate Acetyl CoA NAD + Introducing The Players primary substrate for cellular respiration

More information

Diabetes in Older Adults

Diabetes in Older Adults Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia

More information

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Health Innovations Research Institute (Annual Meeting 2012) Metabolism, Exercise and Disease (MED) Skeletal muscle in health and disease

Health Innovations Research Institute (Annual Meeting 2012) Metabolism, Exercise and Disease (MED) Skeletal muscle in health and disease Health Innovations Research Institute (Annual Meeting 2012) Metabolism, Exercise and Disease (MED) Skeletal muscle in health and disease John A. Hawley, Ph.D. Exercise Metabolism Group School of Medical

More information

The art of tracing dietary fat in humans. Leanne Hodson

The art of tracing dietary fat in humans. Leanne Hodson The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:

More information

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

More information

A Closer Look at The Components Of a Balanced Diet

A Closer Look at The Components Of a Balanced Diet A Closer Look at The Components Of a Balanced Diet The essential nutrients are carbohydrates, fats, proteins, vitamins, minerals, dietary fibre and water. These nutrients will ensure that the systems and

More information

Exercise as precision medicine for insulin resistance and its progression to type 2 diabetes: a research review

Exercise as precision medicine for insulin resistance and its progression to type 2 diabetes: a research review DiMenna and Arad BMC Sports Science, Medicine and Rehabilitation (2018) 10:21 https://doi.org/10.1186/s13102-018-0110-8 REVIEW Exercise as precision medicine for insulin resistance and its progression

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Overview. ESNL Tour Research Findings. Ongoing/Planned Studies

Overview. ESNL Tour Research Findings. Ongoing/Planned Studies ESNL Tour Research Findings Overview Curves I & II Combined Curves Extension Curves Calcium Curves Osteoarthritis Curves Intensity Metabolism Study Ongoing/Planned Studies 1 Exercise & Sport Nutrition

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

DO OBESITY AND PHYSICAL INACTIVITY UNDERLIE THE INSULIN RESISTANCE OF AGING? Francesca Amati. MD, University of Geneva, Switzerland, 1994

DO OBESITY AND PHYSICAL INACTIVITY UNDERLIE THE INSULIN RESISTANCE OF AGING? Francesca Amati. MD, University of Geneva, Switzerland, 1994 DO OBESITY AND PHYSICAL INACTIVITY UNDERLIE THE INSULIN RESISTANCE OF AGING? by Francesca Amati MD, University of Geneva, Switzerland, 1994 MS, Clinical Research (Translational research track), School

More information

High Protein Diets in Weight Reduction

High Protein Diets in Weight Reduction High Protein Diets in Weight Reduction Effects on fat mass, muscle mass and risk factors of the metabolic syndrome Donald K. Layman and Layne E. Norton Department of Food Science & Human Nutrition University

More information

Gene expression in insulin resistance

Gene expression in insulin resistance Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m

More information

The systems physiology of exercise

The systems physiology of exercise The systems physiology of exercise Professor Graham Kemp Department of Musculoskeletal Biology, Institute of Ageing & Chronic Disease Magnetic Resonance & Image Analysis Research Centre University of Liverpool

More information

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

More information

Diagnostic exercise tests and treatment options in McArdle disease

Diagnostic exercise tests and treatment options in McArdle disease Diagnostic exercise tests and treatment options in McArdle disease John Vissing Neuromuscular Clinic and Research Unit, Department of Neurology, University of Copenhagen, Rigshospitalet, Copenhagen Exercise

More information

CHAPTER 7 Energy for Muscular Activity

CHAPTER 7 Energy for Muscular Activity CHAPTER 7 Energy for Muscular Activity Kinesiology Books Publisher 1 TABLE OF CONTENTS Chemistry of Energy Production Three Energy Systems Immediate Energy: Phosphagen System Short-term Energy: Glycolytic

More information

Exploring the link between gut microbiota and metabolic health

Exploring the link between gut microbiota and metabolic health Food Matters Live, Nov 21-23 rd, London Exploring the link between gut microbiota and metabolic health Ellen Blaak Professor in Physiology of fat metabolism, Department of Human Biology NUTRIM School of

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

Diabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs

Diabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,

More information

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)

More information

Biochemistry 7/11/ Bio-Energetics & ATP. 5.1) ADP, ATP and Cellular Respiration OVERVIEW OF ENERGY AND METABOLISM

Biochemistry 7/11/ Bio-Energetics & ATP. 5.1) ADP, ATP and Cellular Respiration OVERVIEW OF ENERGY AND METABOLISM Biochemistry 5. Bio-Energetics & ATP 5.1) ADP, ATP and Cellular Respiration Prof. Dr. Klaus Heese OVERVIEW OF ENERGY AND METABOLISM 1. The food we eat, (carbohydrates/ glucose /sugar, lipids/fat, proteins),

More information

Improving Access to Quality Medical Care Webinar Series

Improving Access to Quality Medical Care Webinar Series Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX

More information

Diabetes mellitus. Treatment

Diabetes mellitus. Treatment Diabetes mellitus Treatment Recommended glycemic targets for the clinical management of diabetes(ada) Fasting glycemia: 80-110 mg/dl Postprandial : 100-145 mg/dl HbA1c: < 6,5 % Total cholesterol: < 200

More information

Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs

Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders Cary O. Harding, MD Molecular & Medical Gene5cs Acknowledgements OHSU Melanie Gillingham, PhD, RD Annie Behrend, MS, RD Autumn Fletcher,

More information

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies

More information

AMPK. Tomáš Kučera.

AMPK. Tomáš Kučera. AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

More information

Adipose triglyceride lipase deletion from adipocytes, but not skeletal myocytes, impairs acute exercise performance in mice

Adipose triglyceride lipase deletion from adipocytes, but not skeletal myocytes, impairs acute exercise performance in mice Am J Physiol Endocrinol Metab 308: E879 E890, 2015. First published March 17, 2015; doi:10.1152/ajpendo.00530.2014. Adipose triglyceride lipase deletion from adipocytes, but not skeletal myocytes, impairs

More information

Overall Energy metabolism: Integration and Regulation

Overall Energy metabolism: Integration and Regulation Overall Energy metabolism: Integration and Regulation We have discussed various fuels which are oxidized via different catabolic pathways to generate ATP, or reducing equivalents required to carry out

More information

Set foundation for exercise prescription Clarify the work rest relationship Understand VO2M Understand overtraining Look at how to use aerobic

Set foundation for exercise prescription Clarify the work rest relationship Understand VO2M Understand overtraining Look at how to use aerobic Set foundation for exercise prescription Clarify the work rest relationship Understand VO2M Understand overtraining Look at how to use aerobic equipment Specific, Measurable, Action-oriented, Realistic,

More information

IB Sports, Exercise and Health Science. Learning Outcomes

IB Sports, Exercise and Health Science. Learning Outcomes IB Sports, Exercise and Health Science Learning Outcomes 1 TOPIC 1: ANATOMY 1.1. THE SKELETAL SYSTEM 1.1.1 Distinguish anatomically between the axial and appendicular skeleton. 1.1.2 Distinguish between

More information

OVERVIEW OF ENERGY AND METABOLISM

OVERVIEW OF ENERGY AND METABOLISM Biochemistry 5. Bio-Energetics & ATP 5.1) ADP, ATP and Cellular Respiration OVERVIEW OF ENERGY AND METABOLISM 1. The food we eat, (carbohydrates/ glucose /sugar, lipids/fat, proteins), are our only source

More information

AEROBIC METABOLISM DURING EXERCISE SYNOPSIS

AEROBIC METABOLISM DURING EXERCISE SYNOPSIS SYNOPSIS This chapter begins with a description of the measurement of aerobic metabolism by direct calorimetry and spirometry and proceeds with a discussion of oxygen drift as it occurs in submaximal exercise

More information

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings

More information

Chapter 1: Exercise Physiology. ACE Personal Trainer Manual Third Edition

Chapter 1: Exercise Physiology. ACE Personal Trainer Manual Third Edition Chapter 1: Exercise Physiology ACE Personal Trainer Manual Third Edition Introduction Physiology is the study of the myriad functions in a living organism. Exercise physiology is the study of the ways

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Placental Transport in Pathologic Pregnancies

Placental Transport in Pathologic Pregnancies Note: for non-commercial purposes only Placental Transport in Pathologic Pregnancies Gernot Desoye Clinic of Obstetrics and Gynaecology Medical University, Graz Most Common Pregnancy Pathologies Diabetes

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

SUMMER EXAMINATIONS 2013

SUMMER EXAMINATIONS 2013 SUMMER EXAMINATIONS 2013 MODULE TITLE LEVEL TIME ALLOWED Human Anatomy and Physiology Four Two Hours Instructions to students: Please answer all questions on the exam paper. Please enter your student number

More information

METABOLIC SYNDROME AND HCV: FROM HCV

METABOLIC SYNDROME AND HCV: FROM HCV METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,

More information

Lecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross

Lecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross Lecture 5: Cell Metabolism Biology 219 Dr. Adam Ross Cellular Respiration Set of reactions that take place during the conversion of nutrients into ATP Intricate regulatory relationship between several

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Metabolic changes in SBMA. Andy Lieberman University of Michigan Medical School

Metabolic changes in SBMA. Andy Lieberman University of Michigan Medical School Metabolic changes in SBMA Andy Lieberman University of Michigan Medical School Research funding: NIH, MDA, APMRF Disclosures Scientific advisory boards: KDA, NNPDF Industry collaborations: Ionis Pharmaceuticals

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/19941 holds various files of this Leiden University dissertation. Author: Jonker, Jacqueline Thérèse Title: Ectopic fat depositions in obesity and diabetes

More information

Glycemic control in type 2 diabetes. Exercise prescription in type 2 diabetes treatment. Target for diabetes intervention.

Glycemic control in type 2 diabetes. Exercise prescription in type 2 diabetes treatment. Target for diabetes intervention. Exercise prescription in type 2 diabetes treatment Glycemic control in type 2 diabetes Prof. L.J.C. van Loon The level of glycemia is associated with the development of cardiovascular complications Glycemic

More information

Part 3:Strategies for successful aging. Avoiding disease with physical activity

Part 3:Strategies for successful aging. Avoiding disease with physical activity Part 3:Strategies for successful aging Avoiding disease with physical activity Causes of disability and disease with aging Causes of death for old individuals Atherosclerosis (CHD) CNS-vascular accidents

More information

Chapter 12 Nutrition

Chapter 12 Nutrition Chapter 12 Nutrition Nutrients macronutrients: large required daily quantities carbohydrates, lipids, proteins micronutrients: small required daily quantities vitamins, minerals Also required: water and

More information

N utrient Overload and Divergence in A daptive Redox Responses between Hear t and Skeletal Muscle

N utrient Overload and Divergence in A daptive Redox Responses between Hear t and Skeletal Muscle N utrient verload and Divergence in A daptive Redox Responses between Hear t and Skeletal Muscle Ethan J. A nderson Department of Pharmacology & Toxicology, and Cardiovascular Sciences, East Carolina University

More information