Supplementary Figure 1
|
|
- Moris Horn
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 a OD c Time [min] 1 p<.1 H O (LB) 1 µm GlcN (LB) H O (NGM) 1 µm GlcN (NGM) H O (1) 1 µm GlcN (1) d 1 p<.1 Douling Time [min] H O () 1 µm GlcN () LB e 1 p<.1 H O (3) 1 µm GlcN (3) f 1 p<. H O (linded) 1 µm GlcN (linded) g 1 p<.1 H O (HIT ac) 1 µm GlcN (HIT ac) 1 3 Supplementary Figure 1: Details of C. elegans lifespan assays Growth characteristics of E. coli OP in oth LB and NGM media, respectively, depicted a as a photometrically determined growth curve and organismal douling time (for LB media only, since no significant growth in NGM media). c-e Individual lifespan results of data summarized in Fig. 1 (p<.1, log-rank test, n=1 each). f Typical lifespan result for experimental setting where experimenter was unaware of GlcN content or control, respectively (p<., log-rank test, n=1). g Lifespan result using heat-inactivated acteria (p<.1, log-rank test, n=1). Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
2 Supplementary Figure a c d e f p interact. <.1 p interact. =. p interact. =.31 Food uptake [g/d] 3 1 * Food uptake [g/d] 3 1 Plasma GlcN [µmol/l] 3 1 * Plasma GlcN [µ mol/l] 3 1 ** GlcN--PO * GlcN--PO g h i j p interact. =.19 p interact. =.13 Body Mass [g] 3 1 Body Mass [g] Fat [g] 1 1 Fat [g] k l m n p interact =. p interact =.3 Lean Mass [g] Lean Mass [g] mtdna / ndna 1. ***..... mtdna / ndna p interact =. o p EE / MBM [kj/h/kg] p=.9 1 Time [hrs] EE / MBM [kj/h/kg] Time [hrs]
3 Supplementary Figure continued Supplementary Figure : Sex specific results of mouse phenotyping part 1 a Food uptake of a female (lue: p<., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and male C7BL/-NRj mice chronically exposed to GlcN (red), and respective controls (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)=., p<.1, n= 17 control mice and n= GlcN-fed mice). c Plasma levels of GlcN in female (lue: p<., Student s t-test, n= 1 control mice and n= 9 GlcN-fed mice) and d male mice (lue: p<.1, Student s t-test, n= control mice and n= 1 GlcN-fed mice) on a GlcN-containing diet in comparison to control mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)= 1.9, p=., n= 1 control mice and n= 19 GlcN-fed mice). e Hepatic levels of GlcN--phosphate in female (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice) and f male mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,1)= 1.7, p=.31, n= 1 control mice and n= 1 GlcN-fed mice). g-l Body mass (lack: interaction etween gender and treatment, two-way ANOVA, F (1,3)=.71, p=.19, n= 1 control mice and n= GlcN-fed mice), ody fat (lack: interaction etween gender and treatment, twoway ANOVA, F (1,3)=., p=.13, n= 1 control mice and n= GlcN-fed mice) and lean mass (lack: interaction etween gender and treatment, two-way ANOVA, F (1,3)= 1.1, p=., n= 1 control mice and n= GlcN-fed mice) female and male mice. m-n Relative content of mitochondrial DNA in liver specimen of m female (lue: p<.1, Student s t-test, n= control mice and n= GlcN-fed mice) and n male mice (lack: interaction etween gender and treatment, two-way ANOVA, F (1,1)= 11.39, p=.3, n= 1 control mice and n= 13 GlcN-fed mice). o-p Energy expenditure normalized to metaolic ody mass of o female (lue: p=.9, Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and p male mice calculated means for every hour during day, grey area reflects dark phase of the light cycle (lack: interaction etween gender and treatment, two-way ANOVA, F (1,33)= 3.1, p=., n= 17 control mice and n= GlcN-fed mice). Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
4 Supplementary Figure 3 a c f i l Time After Glucose Injection [min] g m d 1 p=. p=. Random 1 Fasted fed Time After Glucose Injection [min] e 1 Random 1 Fasted fed Time After Glucose Injection [min] 1 1 j k * * * 1 Time after Insulin Injection [min] p interact. =.9 p interact. =. h p interact. =. p interact. = Time after Insulin Injection [min] Time after Insulin Injection [min] p n interact. =.7 p interact. =.3 * * o Triglyceride/ Protein u Cholesterol p v Cholesterol Triglyceride/ Protein q p interact. =.7 Triglyceride/ Protein r.... w p interact. =.9 x y z p interact. = Cholesterol FFA ALT [U/I] s FFA ALT [U/I] t ALT [U/I] 7 p interact. = FFA
5 Supplementary Figure 3 continued Supplementary Figure 3: Sex specific results of mouse phenotyping part a Blood glucose values of female mice chronically exposed to GlcN (red) in the random fed (lue: p=., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice) and fasted state (lue: p=., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice). Blood glucose values of male mice chronically exposed to GlcN (red) in the random fed and fasted state (lack: interaction etween gender and treatment, two-way ANOVA, random fed: F (1,3)=., p=.9, n= control mice and n= GlcN-fed mice, fasted: F (1,3)=.3, p=., n= control mice and n= GlcN-fed mice). c-h Glucose tolerance tests in mice chronically exposed to GlcN (red). g asolute (left y-axis) and relative values (right y-axis) for the area under lood glucose curve (AUC) for female and h male mice after chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, asolute AUC: F (1,3)= 1., p=., n= 17 control mice and n= 1 GlcN-fed mice, relative AUC: F (1,3)=.3, p=.1, n= 17 control mice and n= 1 GlcN-fed mice. i-n insulin tolerance tests in mice chronically exposed to GlcN (red). i Blood glucose at asal level and 1, 3,,, 7 and 9 min after insulin injection comined for female and male mice (lue: p<., Student s t-test, n= 1 control mice and n= 1 GlcN-fed mice). Blood glucose at asal level and 1, 3,,, 7 and 9 min after insulin injection for j female and k male (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice). m asolute (left y-axis) and relative values (right y-axis) for the area under lood glucose curve (AUC) for female and n male mice after chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, asolute AUC: F (1,3)=.1, p=.7, n= 1 control mice and n= 1 GlcN-fed mice, relative AUC: F (1,3)=.1, p=.3, n= 1 control mice and n= 1 GlcN-fed mice. o-q Plasma levels of triglycerides of p female and q male mice and o oth sexes in a comined manner chronically exposed to GlcN (red) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=., p=.7, n= control mice and n= GlcN-fed mice. r-t Plasma level of non-esterified/free fatty acids for oth r female and male mice comined, as well as for oth sexes each (s females; t males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.7, p=.3, n= control mice and n= GlcN-fed mice.) u-w Plasma level of total cholesterol for oth u female and male mice comined, as well as for oth sexes each (v females; w males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.3, p=.9, n= control mice and n= GlcN-fed mice.) x-z Plasma level of alanine-aminotransferase for oth x female and male mice comined, as well as for oth sexes each (y females; z males) (interaction etween gender and treatment, two-way ANOVA, F (1,3)=.1, p=., n= control mice and n= GlcN-fed mice.) Controls are always depicted in lack and grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
6 Supplementary Figure a c d e f p interact. =.33 p interact. =.3 UDP-GlcNAc 3x1 x1 1x1 UDP-GlcNAc 3x1 x1 1x1 UDP-GlcNAc 3x1 x1 1x1 Urea 1 Urea 1 p=.7 Urea 1 g h i j k l p interact. =.3 p interact. =.11 p interact. =. Succinate x1 3x1 x1 1x1 * Succinate x1 3x1 x1 1x1 CH 3 -utanoyl-coa 3x1 x1 1x1 p=.7 CH 3 -utanoyl-coa 3x1 x1 1x1 CH 3 -crotonyl-coa.x1 1.x1 1.x1.x1 ** CH 3 -crotonyl-coa.x1 1.x1 1.x1.x1 Supplementary Figure : Sex specific results of mouse phenotyping part 3 a-c Concentrations of UDP-N-acetyl-D-glucosamine in liver samples of treated and untreated mice a oth female and male mice comined, as well as for oth sexes each ( females; males) (interaction etween gender and treatment, two-way ANOVA, F (1,1)=., p=.33, n= control mice and n= GlcN-fed mice.) d Urea plasma levels of mice chronically exposed to GlcN (red). e Urea plasma levels of female mice (lue: p=.7, Student s t-test, n= 9 control mice and n= 9 GlcN-fed mice) and f male mice (interaction etween gender and treatment, two-way ANOVA, F (1,3)=., p=.3, n= 1 control mice and n= 1 GlcN-fed mice.) g liver succinate levels of female (lue: p<., Student s t-test, n= control mice and n= GlcN-fed mice) and h male mice (interaction etween gender and treatment, twoway ANOVA, F (1,1)= 1., p=.3, n= 1 control mice and n= 1 GlcN-fed mice.) i Hepatic levels of methyl-utanoyl-coa of female (lue: p=.7, Student s t-test, n= control mice and n= GlcN-fed mice) and j male mice (interaction etween gender and treatment, two-way ANOVA, F (1,1)=.79, p=.11, n= 1 control mice and n= 1 GlcN-fed mice.) k levels of methyl-crotonyl-coa in liver specimen of control and GlcN-fed female (lue: p<.1, Student s t-test, n= control mice and n= GlcN-fed mice) and l male mice, respectively (interaction etween gender and treatment, two-way ANOVA, F (1,1)=.7, p=., n= 1 control mice and n= 1 GlcN-fed mice.). Controls are always depicted in grey color, whereas GlcN-treatment is depicted in red. The ars represent the mean + s.d.
7 Supplementary Figure aak- ctrl GlcN ctrl GlcN pmk-1 a KO h h 1h 1h KO c aak- ctrl GlcN ctrl GlcN pmk-1 KO h h 1h 1h KO p-ampk aak- N (wt) ctrl GlcN p-ampk ( kda) ( kda) ( kda) ( kda) d e pmk-1 ctrl GlcN KO h h f pmk-1 ctrl GlcN KO h h pmk-1 N (wt) p-p3 ctrl GlcN (3 kda) ( kda) p-p3 (3 kda) ( kda) g h GlcN (h) GlcN (h) p-ampk ( kda) p3 AMPK AMPK ( kda) (3 kda) ( kda) p-p3 (3 kda) p3 (3 kda) ( kda) GlcN (h) i GlcN (h) j GlcN (h) p-ampk ( kda) ( kda) p-p3 (3 kda)
8 Supplementary Figure continued Supplementary Figure : Memrane scans of Western lots depicted in manuscript main figures a-f Immunolotting against phospho-ampk und phospho-p3 in aak--ko, pmk-1-ko and wildtype worms treated with GlcN and respective controls. Immunolotting against α-tuulin was used to normalize protein amount. g-j Immunolotting against phospho-ampk, total AMPK, phospho-p3 and total p3 in HepG-cells treated with GlcN. Immunolotting against α-tuulin was used to normalize protein amount. The memranes showing immunolotting of HepG cells were used to detect the signal of several memranes using the same antiody.
9 Supplementary Tale 1 RNAi Sequences F1D.1 cdna (ORF) ATGGATCTCACTGTTCCAGTTGAATATTCACGTGCCGGTAACACAACTCACAGCGGTAATGTGCATGCCATTCAAGA CGATGAGAAATTCTCGTATGGAACTGCTGGATTCCGATTCAAGTCCGAGAAGCTTCCATTCATCGTCTTCCGGTGTGC TTACGTTGCGAGTCTTCGTGCGCGGCAGCTCAACTCAGCTATCGGAGTGATGATTACAGCTTCACACAATCCATCATG TGACAATGGTGTGAAATTAGTGGATCCAAGTGGCGATATGCTCAATGAGCAGTGGGAGATATACGCGACTGAAGTTGT GAATGCTACTGATGCCGAGCTCCCAGCCGCAGTTCGAGCTCTTGAAAAACAAATTTCAGTCGGAAAGACCCAACTTTC CCGTGTCGTTTGTGGTATGGACACACGTTGCTCTGGTCCTTGTCTGATGAATGCAGCAAGAGCCGGTGCAGCGTTATT CAATGTACAATTCGATGATATCGGTGTTGTGTCGACTCCAATGCTTCATTATGCTGTCAAGGCATTCAACGAGCCAAAA TTCGCAGAGCCAACTCACGATGGATATTATTCTGCAATCGCCGATTCGTTCAAGAAGCTGTATGAAATAACTGAGGAAC CCAAAGACTCGAGATATCAACCAAAAGTCATTGTCGATTGCGCAAACGGAGTCGGTGCTCCACGGTTCAGAAATCTTC TTGAGCGAATCCCATCATCACTTCTGGAAGTTGAATTTCGTAATGAATCGGAAGAACTGAATCAGGGATGTGGTGCCG ATTTCGTTAAGATTTCGCAAAAGTTACCAGCAAACTTCTCACCGACAGCAGCAGAACCAAAATGTGCTTCATTTGATGG AGATGCCGATCGCTTGATGTACTTCCGTGCAAAGGCTTCAGAAAATTCGGAATCAAACGATGCTGAGCTGTTCGACGG TGACAAAATTGCAGTTCTGATTGTCACATACATTCGGGAGCAACTGAAGGATTACGAAAATTCCACTCCGATGGAACGT CTCCGCCTTGGTATTGTTCAAACAGCATATGCGAATGGAAGTTCAACACGCTACATTCGTGAAAAGTTGGGTATTGAGC CAATTATTGTACCTACTGGAGTCAAGCATCTGCATGAAGCTGCTTCTGAGTTCGACATTGGAATTTATTTCGAGGCCAA CGGACACGGAACTGTTGTTTTCAGCGAGATTTTCGACCGCATCATCAGAAGAACTCCAACTGAATCATTACCTCTCCGT CGTCTAGCACTTTTCTCCCGTGTCATCAATGAAACTGTTGGGGATGCTTTTGCAGATTTGCTTGCCGTGGAAGCTGTTC TCCGTCACTATGGATGGTCTATGGATGACTGGGCCGAAAAACTGTATCGAGATGTTCCGAATGTGCAGATCAAAGTTC CAGTTATTGATCGTTCCATTTTCAAAACGACGAACGCCGAGCAAACTCTTGTGAAACCTGTTGGAATTCAAAAAATGAT TGATACGGATGTTGCAAAGTACAATAATTCGAGAGCTTTCATCAGACCATCTGGCACCGAGAACATTGTTCGCGTATAC GCTGAAGCGGATACTGTTGAAAATACATTGCAACTCGGAAAATCTCTCGAACAAGTCGTTCTCAACCTTTGCAACTCGA ACTGA aat-1 (Ahringer lirary) CAAGAGCGATACATCCAGCAAGGAAAATAGCTGGCCAAATGAGTGGAACTTTAATTGGTCTTGATGCATCTGGCATG GTTCTACGAAGCCAGAAGAGTGCGGCAATGGCTGTTCCGATTGCAAGCCAGTAACTGATCTAGAAAATGAAAGTTTCT TGTTCGAGAACATGCATATTTTTTGAAGCTTGAATTCAAGCTTCTAAAATTGATGCTTCAAGAAACTCAGTACCGGGAAA TATTAAAAAAAAAAAGCTATCACACTTACTTGAATATAATTAATCAATTGATACACATCCTTTGATGCCAACAAGTAAGCA ATAGAAAGAGCTCCGGTAAGAATAACAGCGGGAATCGGTGTTTTCGTTTTTTTATTAATCATTGTCAATACAGCTGGCA TTTGTCCTTCACGAGCACCGGAATAAAAAAGTCTCGCTGAAGTGAAAATAACTCCATTAGCTGATCCAATTGTGGAACA TGCAACACAGAGTGGCATAATAAATGCGAATTTTCCATAGAGTTTATTGGCGAAAAGTACCGCTACAGCCGGGGATTC GAGCATTTCATCTGGTGAAATTGCTGTGTAGAGAGCCACATTAGTTAGCACGTAGATTACGGTACAGGATGTGATAGA GATGGCAATTGCGAGTGGAAGGTTTCTGAAAATTATGGTATAAGAAAATAAATAATATATCGTTAAATTTTTTTTACTGTT TCATAATGCAATTAGAACCTAAAATAATTTGCTAGATTAATTGACAAGTATTCTACAACAGATTAAAGTAGACCAATAAAC TACTCATAGTCAGCTCTGAAACTTTAAATAAAAACAATTGGAATGTAAAAACTGTGTTAATGTGTTTCATGTAAACTATAC AATCACTGAAACTTACCGTTTTGGGTTCTGCAACTCCTCGACGATGAAATTCAAGAAATTCCATCCAGAATAAGCGAAT AATCCAGAGTAGAAAGCAAGTGAAACTTTTGTAAAATCTTGAGATGTATTCTCAAAAATATTCTCGAATGAGTCCTTGTA CTGAGATTCACCTGAAATTTTTTATATTTTCTAAATACAGAATAGCTTAAGTGCTCACCAAAGAAAAGGAGACCAAGTCC GGTTAAAATGATAAGACACAGAGCAACAACCTTTGCAA
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationTime after injection (hours) ns ns
Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationglpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda
PvuI 2.0 k PvuI PvuI Rv1101c Rv1100 glpx fum 4.4 k PvuI PvuI ΔglpX Rv1101c Rv1100 HygR fum ΔglpX 5 k 4 k 3 k c 75 kda 50 kda 37 kda GLPX Δ Δ/C GLPX 2 k 1.5 k 25 kda 20 kda PRCB 1 k 0.5 k Supplementary
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More information* * A3027. A4623 e A3507 A3507 A3507
a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationSupplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSupplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on
Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3
More informationPhysiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004
Name Write your name on the back of the exam Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004 This examination consists of forty-four questions, each having 2 points. The remaining
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationCan physical exercise and exercise mimetics improve metabolic health in humans?
Can physical exercise and exercise mimetics improve metabolic health in humans? Patrick Schrauwen, PhD NUTRIM school for Nutrition and Translational Research in Metabolism Department of Human Biology,
More informationSupplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationEffects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationSupporting information
Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction
More informationDietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationB. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationdays days and gbt-i.cd Recipient 20
gbt-i. GFP+ Resident memory cells: gbt-i.gfp+ Recruited memory cells: gbt-i.cd45.1+ 1 2-3 gbt-i. flu.gb sc. CD45.1+ Graft with gbt-i.gfp+ 1 Recipient 1 re- 3 36 Graft with gbt-i.gfp+ and gbt-i.cd45.1+
More informationLight triggers PILS-dependent reduction in nuclear auxin signalling for growth transition
In the format provided y the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 217.15 Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition Chloé
More informationSupplementary Materials: Decrease in Circulating Fatty Acids is Associated with Islet Dysfunction in Chronically Sleep-Restricted Rats
S of S6 Supplementary Materials: Decrease in Circulating Fatty Acids is Associated with Islet Dysfunction in Chronically Sleep-Restricted Rats Shanshan Zhan, Yangyang Wu, Peng Sun, Haiyan Lin, Yunxia Zhu
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Divergent effects of intrinsically active MEK variants on developmental Ras signaling Yogesh Goyal,2,3,4, Granton A. Jindal,2,3,4, José L. Pelliccia 3, Kei Yamaya 2,3, Eyan Yeung
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationIP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationHIV long term complications
HIV- 2015 long term complications 4th Asian Conference on Hepatitis & AIDS 22-23 May 2015, Xi'an, China Kees Brinkman Amsterdam The Netherlands NL 2012: known 17.000 (0,1%) treatment 85% (all) China 2011:
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationRole of the Pyruvate
Role of the Pyruvate Dehydrogenase Complex in the Regulation of Blood Glucose Robert A. Harris Indiana University School of Medicine Indianapolis, Indiana Kyungpook National University School of Medicine
More informationSupplementary information Novel VCP modulators mi2gate major pathologies of rd10, a mouse model of re2ni2s pigmentosa
Supplementary information Novel VCP modulators mi2gate major pathologies of rd1, a mouse model of re2ni2s pigmentosa Hanako Ohashi Ikeda, Norio Sasaoka, Masaaki Koike, Noriko Nakano, Yuki Muraoka, Yoshinobu
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationAdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
More information[U- 13 C5] glutamine. Glutamate. Acetyl-coA. Citrate. Citrate. Malate. Malate. Isocitrate OXIDATIVE METABOLISM. Oxaloacetate CO2.
Supplementary Figures a. Relative mrna levels Supplementary Figure 1 (Christofk) 3.0 2.5 2.0 1.5 1.0 0.5 0.0 LAT1 Fumarate Succinate Palmitate Acetyl-coA Oxaloacetate OXIDATIVE METABOLISM α-ketoglutarate
More informationGenetics Test Review
Name: Period: Heterozygous a genotype with 2 different alleles ex:(a) Homozygous a genotype with 2 of the same alleles ex:(, or aa) Dominant lleles that are expressed more often and can cover up another
More informationSupplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationa Anti-Dab2 RGD Merge
a Anti-Da Merge *** ** Percentage of cells adhered 8 6 4 RGE RAD RGE RAD Supplementary Figure Da are localized at clusters. (a) Endogenous Da is localized at clusters. (), ut not RGE nor RAD peptides can
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationRegulation of Metabolism
Regulation of Metabolism Pratt and Cornely Chapter 19 Regulation by Compartmentalization Form of reciprocal regulation Degradation vs biosynthesis Requires transporters 1 Specialization of organs Fuel
More informationCtrl CCT7 CCT2 GAPDH * * ** ** * Ctrl Size of LC3 dots (a.u.) mrfp GFP mrfp-gfp-lc3 CCT5 KD CCT7 KD
CCT7 Size of dots (a.u.) CCT7 CCT7 /GAPH deitometry (a.u.) /GAPH deitometry (a.u.) a CCT7 Primary cortical neuro 55 CCT5 55 CCT7 55 CCT7 55 55 55 c 3 25 2 DMSO 2 8 Bafilomycin A 5 6 4 5 2 2 3 2 3 d mrfpgfp
More information7.06 Cell Biology EXAM #3 April 24, 2003
7.06 Spring 2003 Exam 3 Name 1 of 8 7.06 Cell Biology EXAM #3 April 24, 2003 This is an open book exam, and you are allowed access to books and notes. Please write your answers to the questions in the
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationSupplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More information