Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital

Size: px
Start display at page:

Download "Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital"

Transcription

1 HEMATOPATHOLOGY Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital JOAN-LLUIS VIVES-CORRONS, MD, ISABEL BESSON, PHD, JOSEP MARIA JOU, MD, AND GABRIELA GUTIERREZ, MB The Abbott" Cell-Dyn 3500 (Abbott CD 3500, Abbott Diagnostics Division, Mountain View, CA) is a fully automated hematology analyzer capable of providing a complete blood count (CBC) profile, including a five-part differential leukocyte count (DLC) and flagging system in this study. The CBC profile and DLC flagging system of the Abbott CD 3500 were evaluated according to the HA-20 protocol of the National Committee for Clinical and Laboratory Standards (NCCLS) and compared to the Technicon H*2 blood analyzer currently used in the authors' laboratory. Linearity, carryover, precision, and stability were all within the limits established by the manufacturer. No significant breakdowns were found during the evaluation period. Evaluation of DLC indicated an excellent correlation with the manual reference method for neutrophils, lymphocytes, and eosinophils (r = 0.916, 0.936, 0.967, respectively), a good correlation for monocytes (r = 0.11) and a poor correlation for basophils (r = 0.22). Overall flagging for morphologic abnormalities displayed higher sensitivity (5%) than specificity (67%), with a false-positive ratio of 33%. In general, these results are in accordance with those obtained by other authors in the same period of time. (Key words: Blood analyzer; Automated YVBC differential count; Abbott CD 3500) Am J Clin Pathol 1996; 105: Advances in hematology automation have resulted in reliable devices that perform multicell differentials, allowing significant gains in speed and precision compared with the traditional 100-cell manual differential. The CELL-DYN 3500 (Abbott Diagnostics Division, Mountain View, CA) is a fully automated hematology analyzer that provides a comprehensive profile including complete blood count (CBC) and differential leukocyte count (DLC). To separate the five leukocyte subpopulations, the instrument uses the multiple angle polarized light scatter separation (MAPSS) process. 1 ' 2 Moreover, when abnormal leukocytes are present, the system generates different "suspect"flagsand can estimate the percentage of blasts, variant lymphocytes, immature granulocytes, and bands. Over a period of 3 months, we evaluated CBC and DLC performance of the Abbott CD 3500 in a University Hospital Hematology Laboratory using blood From the Hematology Laboratory Department and Postgraduate School of Hematology, Hospital Clinic i Provincial. University of Barcelona. Barcelona, Spain. Supported in part by a grant of the Spanish Ministery of Health (FIS Ref. 93/ ). Manuscript received July ; revision accepted December 6, Address reprint requests to Dr. Vives-Corrons: Haematology Laboratory Department, Hospital Clinic i Provincial, Villarroel, Barcelona, Spain. samples collected from adult patients into K3 EDTA tubes, following the guidelines prepared by the International Council for Standardization in Hematology 3 and using the HA-20 protocol of the National Committee for Clinical and Laboratory Standards. System Description MATERIALS AND METHODS The Abbott CD 3500 uses both impedance and laser optical methodology, and is designed to provide CBC and a five-part DLC. Leukocytes are counted and classified using a combination of hydrodynamic focusing and laser light scatter derived from the MAPSS technology. 12 The light source is a helium-neon laser and the angle of scatter is a function of cell size, refractive index, nuclearcytoplasmic ratio, nuclear shape, and granularity. A 10 narrow angle depolarized laser scatter is added to the traditional 0 and 90 angles used by other devices. Hydrodynamic focusing and the use of laminarflowtechnology place cells single file as they stream through a flow cell for precise analysis. A unique feature is the addition to the single-aperture impedance RBC/PLT transducer of a von Behrens plate device that prevents the cells from reentering the sensing zone after passing through the orifice and therefore, protects against an overestimate of 553

2 55 HEMATOPATHOLOGY CD 3500 TABLE 1. CRITERIA OF MORPHOLOGICAL DLC FLAGGING (TRUE POSITIVE) True-Positive Flags BD Bands > 6% Ig Myelocytes and/or metamyelocytes and/or promyelocytes > 2% BD/Ig Bands > 6% and/or myelocytes and/or metamyelocytes and/or promyelocytes > 2% VL Atypical or immature or abnormal lymphocytes > 5% Blasts Blasts > 1% NRBCs Nucleated red blood cells > 2% BD = bands; VL = variant lymphocytes; NRBCs = nucleated red blood cells. the counts. Results are presented in a report that includes 12 CBC parameters, percentages, and absolute numbers of five-part DLC, 6 scattergrams and 2 histograms. The software enables storage of all information including scattergrams in a 10,000 sample memory, and the complete analysis requires 355 nh of blood in the primary automatic sampling mode, but only 130 nl in the secondary mode. The instrument is equipped with samplers that automatically transport and mix the blood tube. In our experiment, the Abbott CD 3500 analyzer was installed and operated in accordance with manufacturer's instructions. Following the manufacturer's guidelines, calibration was done by matching nondifferential parameters to the reference fully automated hematology analyzer, already in use in our laboratory (Technicon H*2 Bayer Diagnostics). Manufacturer-provided materials were used for calibration and daily quality control. Before starting the evaluation, service engineers of the Abbott Diagnostic Division examined the instrument to ensure optimum installation and general performance. Facility The Clinic Hospital of the University of Barcelona is a 1,000-bed tertiary care public institution and a referral center for Hematology Laboratory.The team responsible for the evaluation process included a team leader (JLV), key operators (MK, MP, RG, and ME), and specialists in quality assurance and informatics (JMJ, GG, and IB). Blood Samples The evaluation was performed with whole blood specimens obtained from the routine samples received in the laboratory. All samples were collected as venous blood in 5 ml evacuated tubes containing K 3 EDTA (1.5 mg/ ml), and first run through the reference instrument, then tested within 1 hour, on the Abbott CD-3500, except for the sample stability studies. All blood films were TABLE 2. COEFFICIENTS OF VARIATION OF WITHIN AND BETWEEN BATCH PRECISION OBSERVED WITH THE ABBOTT CD 3500 WBCs RBCs Hemoglobin Packed cell volume MCV MCH MCHC RDW Platelets MPV PDW PCT Neutrophils Lymphocytes Monocytes Eosinophils Basophils Within (%) Between (%) WBCs = white blood cells; RBCs = red blood cells; MCV = mean corpuscular volume; MCH = mean corpuscular hemoglobin; MCHC = mean corpuscular hemoglobin concentration; RDW = red cell distribution width; MPV = mean platelet volume; PDW = platelet distribution width; PCT = plaquetocrit. made within hours of collection. Assessments were conducted in accordance with the recommendations of the ICSH. 3 Samples were processed in parallel on the laboratory's routine Technicon H*2 analyzer. Linearity Linearity was evaluated by analyzing serial dilutions (10% to 100%, in 10% increments) of five specimens in platelet-free autologous plasma selected to cover the ranges for the dilution-sensitive hematologic parameters (HgB, HCT, RBC, WBC, PLT). Results were converted to graph form for visual examination and further tested in accordance with the recommendations of the ICSH. 3 Imprecision Between-batch imprecision was assessed by analyzing 20 samples in triplicate and in three consecutive batches. Within-batch (replicate) imprecision was evaluated by TABLE 3. TOTAL LEUKOCYTE (WBC), RED BLOOD CELL COUNT (RBC), HEMOGLOBIN (HgB), AND PLATELET COUNT (PLT) PERCENT CARRYOVER IN THE ABBOTT CD 3500 WBCs RBCs Hgb Values are given as the mean of five replicate experiments. Pit 0.3 A.J.C.P.-May 1996

3 VIVES-CORRONS ET AL. 555 Evaluation of Abbott CD 3500 Blood Analyzer TABLE. COMPARABILITY TEST BETWEEN ABBOTT CD 3500 AND TECHNICON H*2 Parameter CD 3500 H*2 P Slope Intercept r P WBC(X10 9 /L) RBC(X10'7L) Hemoglobin (g/l) Packed cell volume (L/L) MCV(fL) MCH (pg) MCHC(g/L) RDW Plt(X10 9 /D MPV(fL) Neutrophils (%) Lymphocytes (%) Monocytes (%) Eosinophils (%) Basophils (%) 10.3 ± ± ± ± ± ± ± ± ± ± ± ±3. 0. ± ± ± ± ± ± ± ± ±2..3 ± ± ± ± ±.6 2. ± ± <10~ <10' <10~ 6 <10-5 <10" <10-3 <10~ <I0" 6 <I0" 6 <10" 2 See Table 2 for definition of acronyms. analyzing 20 samples in triplicate, and three times in the same batch. The results were expressed in terms of coefficient of variation (CV) for each CBC parameter. In both groups the statistical method used was the two-way analysis of variance. Carryover Carryover was evaluated for total WBC, RBC, HB and PLT as described by ICSH. 3 High to low sample carryover testing was performed by testing a high value specimen consecutively in triplicate (a!,a 2,a 3 ), followed immediately by testing a low value specimen consecutively in triplicate (b,b 2,b 3 ).For each magnitude, five experiments were performed. Percent carryover for each parameter was calculated from the formula: (bi-b 3 )/(a 3 -b 3 ) X 100. Comparability One hundred fifty blood samples selected on the basis of the recommended ICSH range of values 3 were analyzed side-by-side with the Abbott CD 3500 and Technicon H*2 instruments. All the CBC and DLC parameters measured were compared by linear regression and paired t-test analysis. Effect of Storage Blood samples were obtained from 10 healthy volunteers and 10 patients with abnormalities affecting the various parameters. Measurements were performed immediately (0 time), then again at 30 minutes, 1 hour, 2 hours, hours, 6 hours, hours, 12 hours, 2 hours, and hours from the time of collection on separate specimens stored for the various times at room temperature (20 C) and at C. Results for all parameters were compared by using initial analyses (time 0 minutes) as 100% values and values obtained at varying times as percentages of the initial time value. Inaccuracy Inaccuracy was evaluated in 50 blood samples selected on the basis of the ICSH recommended range of values 3 by comparing three CBC parameters (HgB, HCT, and MCHC) from the Abbott CD 3500 with the ICSH reference standard. 56 The data were tested by linear regression analysis and the paired t- test g 2 m 0 o> S -" ) Time (h) FIG. 1. Effect of specimen storage at room temperature (1-20 C) on the complete blood count (CBC) parameters of the Abbott CD 3500 blood analyzer. Vol. 105-No. 5

4 556 HEMATOPATHOLOGY Neutrophils * Lymphocytes Monocytes Eosinophils * Basophils 12 2 Time (h) FIG. 2. Effect of specimen storage at room temperature (1-20 C) on the differential leukocyte count (DLC) results of the Abbott CD 3500 blood analyzer. Evaluation of DLC A total of blood specimens classified into "instrumentflagged" (7 samples) and "normal" (103 samples) groups, were coded and examined independently by four experienced technologists who each carried out a blood film evaluation and a 00-cell manual differential (200- cell counts on two different smears). Results from the two 200-cell differential counts were averaged and the results analyzed according to the NCCLS H20-A protocol. The percentage of neutrophils from the Abbott CD 3500 were compared with the smear total percentage of neutrophils (segmented, band, metamyelocytes, myelocytes and promielocytes). The Abbott CD 3500 lymphocytes, eosinophils monocytes, and basophils were compared with the percentage of lymphocytes, eosinophils, monocytes and basophils on the blood film. Clinical Sensitivity Morphologic classification of bloodfilmsas normal or abnormal was based on the visual reference DLC data as described in Table 1. Reference qualitative abnormals included samples exhibiting one or more of the following abnormalities: neutrophil left shift (BAND), presence of immature granulocytes (IG), IG/BAND, blast cells (BLAST), nucleated red blood cells (NRBC) and atypical or variant lymphoid cells (VarL). Abbott CD 3500 qualitative classifications were based on the positivity for certain descriptive flags reported by the instrument. Samples were identified as qualitatively abnormal (flagged) when one or more of the flags that indicated an abnormality of the leukocyte population was positive. The flags were assessed collectively. Linearity RESULTS Inspection of plots of CBC parameter values against a wide sample dilution range indicated a satisfactory linearity for all the parameters sensitive to dilution (HgB, RBC, WBC, HCT, and PLT). Statistical analysis revealed a correlation coefficient higher than 0.9 for all the CBC parameters evaluated. Imprecision Coefficients of variation (CV%) for each CBC parameter and for both between-batch and within-batch experiments are shown in Table 2. These results indicate a good precision (within and between batches) for RBC, HgB, MCV, and MCHC, but moderate precision for WBC, HCT, MCH, and RDW. As expected with the PLT count and the DLC, the instrument imprecision showed a wider CV range. Carryover Carryover data for WBC, RBC, HgB and PLT are presented in Table 3. Except for RBC count, the results of high to low carryover testing were less than 1%. TABLE 5. RESULTS OF WHOLE BLOOD STABILITY TESTS GIVEN IN ABSOLUTE VALUES Time WBCs RBCs HgB MCV Pit Hct Neutrophils Lymphocytes Monocytes Eosinophils Basophils Hours) (X 10 9 /L) (X 10,2 IL) (g/q (X 10* IL) (L/L) (<*>) (%) (Ob) (%) (%) w See Table 2 for definition of acronyms. A.J.C.P.'May 1996

5 VIVES-CORRONS ET AL. 557 Evaluation of Abbott CD 3500 Blood Analyzer TABLE 6. RESULTS OF INACCURACY ASSESSMENT OF THE ABBOTT CD 3500 DLC Parameter CD 3500 Manual DLC* Slope Intercept Neutrophils (%) Lymphocytes (%) Monocytes (%) Eosinophils (%) Basophils (%) 6.5 ± ± ± ± ± ± ± ± ± 0. ± 0. <10~ 5 <10~ 5 <10~ 5 <10~ 3 <10" <10-6 <10" 3 <10" 5 00 cell manual differential counts. Comparability Abbott CD 3500 and Technicon H*2 measurements of CBC parameters were compared. The results of linear regression analysis and a paired t-test are shown in Table. There was an excellent correlation between the two instruments as demonstrated by the r values for WBC, HgB, HCT, RBC, MCV, PLT, NEUT, LYM, and EOS, moderate correlation for MCH, RDW, and MONO, and poor correlation for MCHC, MPV, RDP, PCT, and BASO. The paired t-test demonstrated significant differences between instruments for all the parameters with the exception of the WBC, HgB, MCV, LYM, and BASO. Effect of Storage Results of the stability tests are represented in Figures 1 and 2. The results given in absolute values are represented in Table 5. At room temperature (1-20 C) variation from the original values was <10% for all parameters, except for the WBC count that decreased by 12.1% at hours, and the percentage of monocytes and basophils that decreased at 2 hours. The eosinophil counts showed a slight increase at 12 hours. The refrigerated samples ( C) also showed essentially stable results for up to 2 hours for all the parameters (VPM, PCT, MONO, and BASO presented a variation >10% at 2 hours). TABLE 7. ASSESSMENT OF THE ABBOTT CD 3500 FLAGGING SYSTEM ACCORDING TO THE CRITERIA DEFINED IN TABLE 1 Total samples tested: True positive (0) Sensitivity: X 100 = 5% True positive (0) + False negative (7) True negative (96) Specificity: X 100 = 67% True negative (96) + False positive (7) False positive (7) False positive (%): X 100 = 33% False positive (7) + True negative (96) False negative (7) False negative (%): X 100= 15% False negative (7) + True positive (0) Inaccuracy Results of inaccuracy studies revealed an excellent correlation between the Abbott CD 3500 and the reference standard for HgB and HCT (r = in both cases), but a poor correlation for MCHC (r = 0.720). Paired t-test showed a significant difference only for MCHC (301 ±. vs. 295 ± 12., P =.05). Evaluation of DLC Of the initial blood samples, 7 were excluded because of the presence of qualitative morphologic abnormalities after visual observation of the blood film (reference 00-cell manual differential). Therefore for the comparative study of the instrument and the manual method, a total of 13 samples were used. The results of the statistical analysis of the Abbott CD 3500 and the 00-cell manual differential count are shown in Table 6. A close correlation was observed between the instrument and reference method for neutrophils (r = 0.936), lymphocytes (r = 0.916) and eosinophils (r = 0.967). Clinical Sensitivity One hundred-ninety blood samples were chosen to evaluate the significance of the Abbott CD 3500 flags. The results of the instrument's flagging assessment, performed following the method of Galen and Gambino 7 are summarized in Table 7. The Abbott CD 3500 performance was substantially higher for true negative (TN) than false negative (FN) flags, and essentially similar for false positive (FP) and true positive (TP) flags. Considering the presence of any flag, 7 samples were flagged by the system, giving an FP rate of 33% and a specificity of only 67%. The breakdown of specific flags is summarized in Table. DISCUSSION The Abbott CD 3500 is an automated hematology analyzer that provides a CBC with cell sizing and a five-part DLC by using the MAPSS technology. 1,2 With regard to Vol. 105-No. 5

6 55 HEMATOPATHOLOGY TABLE. BREAKDOWN OF SPECIFIC FLAGS Flag True Positive False Positive False Negative True Negative Total FP Rate <%) FN Rate <%) Bands Ig Bands/Ig VL BL NRBCs VL = variant lymphocytes; BL = blast cells: NRBCs = nucleated red blood cells. reproductibility (between and within-batch imprecision), the instrument's performance in our study was satisfactory. Furthermore it demonstrated minimal carryover and a good linearity for HgB, WBC, RBC, HCT, and PLT. Stability studies of blood samples in EDTA (K 3 ) at 1-20 C demonstrated time dependent variations in the monocyte and basophil percentages after 2 hours of storage. However, by hours, there was an increase in the proportion of eosinophils, and a decrease in the total WBC count and in the proportion of monocytes and basophils. Storage effects can be reduced by maintaining samples at C. Although no reduction of the proportion of neutrophils was observed after 2 hours of storage as reported by Theodorsen and colleagues, our results give further support to the ICSH recommendations that automated DLC should be performed within a day of blood sampling. 9 For nearly all parameters measured in our study, there was an excellent correlation between the Abbott CD 3500 and the Technicon H*2, and the Abbott CD 3500 provides excellent quantitative results for the WBC differential without quantitative morphologic abnormalities. Furthermore, agreement between Abbott CD 3500 and the 00-cell manual differential count was good for eosinophils, lymphocytes, and neutrophils, modest for monocytes and poor for basophils. For monocytes, this low performance may have been due to the reduced presence of this population in the samples examined 10 or to the difficulty of monocyte recognition by the operators when using Romanowsky stain." For basophils, the low correlation with the reference method was probably because of the reference method's statistical fallibility, due to the low number and irregular distribution of the cells in the peripheral blood films. Like other automated hematology analyzers, the Abbott CD 3500 can generate leukocyte flags to alert the user to the presence of abnormal cells. The sensitivity and specificity of the flagging system (clinical sensibility) was tested by classifying all samples into TN, TP, FN, FP, according to the instrument's flags and the morphologic abnormalities encountered after blood film examination. For suspect flags, the instrument exhibited a good sensitivity rate (5%) with a specificity rate of only 67%, reflecting the high false-positive ratio (33%). Recent evaluations of the Abbott CD reported similar results with a specificity rate of 72% and a false-positive ratio of 2%. Gulati and colleagues 1 mentioned that morphologic abnormalities not consistently detected by the Abbott CD 3500 include occasional cases of increased band cells and the presence of neutrophil hypersegmentation or atypical lymphocytes. In this study, the Abbott CD 3500 failed to identify four cases with 7% to 15% of band cells, two cases with atypical lymphocytes, and one case with a moderate number of immature granulocytes. The clinical significance of missing such abnormalities when the overall hematology profile is normal has been questioned. 15 The detection of increased bands adds little to the diagnosis of infection or inflammation in persons with neutrophilia 16 or with normal total WBC counts. 17 Two recent evaluations of four fully automated hematology analyzers 119 reported similar conclusions for all the instruments (Technicon H*2, Coulter STKS, Abbott Cell-Dyn 3000 and Sysmex NE-000). These results underscore the importance of routine blood film examination, even in cases that do not require a visual differential count. In conclusion, the Abbott CD 3500 essentially appears to improve on the Abbott CD in its ability to identify abnormal cell populations by lowering the falsenegative rates without increasing the false positives. This raises our confidence in the qualitative flagging of the instrument and in its usefulness as an adjunct to routine hematologic blood examination. Acknowledgments. The authors thank M. Kinder, M. Perez, R. Garcia, and M. Espasa for their skill and willingness in technical support. REFERENCES Terstappen LW, degrooth BG, Visscher K. Four parameter white blood cell differential counting based on light scattering measurements. Cytometry 19;9:39-. Al-Ismail SA, Bond K, Carter AB, et al. Two-centre evaluation of the Abbott CD 3500 blood counter. Clin Lab Haematol 1995;17: AJ.C.P.-May 1996

7 VIVES-CORRONS ET AL. 559 Evaluation of Abbott 3500 Blood Analyzer 3. International Council for Standardization in Haematology. Guidelines for the evaluation of blood cell analyzers including those used for differential leukocyte and reticulocyte counting and cell marker applications. Prepared by the expert panel on Cytometry. Clin Lab Haematol 199; 16: National Committee for Clinical Laboratory Standards. Leukocyte Differential Counting NCCLS Approved Standard H20-A. Villanova, PA, National Committee for Clinical Laboratory Standards. Reference and Selected Procedures for the Quantitative Determination of Haemoglobin in Blood NCCLS Approved Standard H15-A2. Villanova, PA, International Committee for Standardization in Haematology. Recommended methods for the determination of packed cell volume by centrifugation. WHO/Lab, 199, pp Galen RS, Gambino SR. In: Beyond Normality: The Predictive Value and Efficiency of Medical Diagnosis. New York: John Wiley, 1975, p 19.. Theodorsen I, Holter R, Akselberg K, Lande K. Comparison of five automated haematology analyzers. SysmexJ Intern 199;: International Council for Standardization in Haematology (ICSH). Recommendations for ethylenediaminetetraacetic acid anticoagulation of blood for blood cell counting and sizing: Expert Panel on Cytometry. Am J Clin Pathol 1993; 100: Rumke CL. Imprecision of ratio-derived differential leukocyte counts. Blood Cells 195:11: Verwilghen RL. Standardization and cell counting in haematology: ICSH document. Biochim Clin 1990; 1: Cornbleet PJ, Myrick D, Judkins S, Levy R. Evaluation of the Cell- Dyn 3000 differential. Am J Clin Pathol 1992;9: Aubert-Letrillart B, Binet JL, Baudet S, Azguiz Z, Merle-Beral H. Performance evaluation of the haematological analyzer Cell- Dyn 3000 (Abbott). Nouv R Francaise d'haematologie 1993;35: GulatiGL. Advances of the past decade in automated hematology. Am J Clin Pathol l992;9(suppll):sl I-SI Bridgen ML, Page NE. The lack of clinical utility of white blood cell differential counts and blood morphology in elderly individuals with normal hematology profiles. Arch Pathol Lab Med 1990;11: Morse EE, Nashed A, Spilove L. Automated differential leukocyte counts. Ann Clin Lab Sciences 199; 19: Ardron MJ, Westengard JC, Dutcher T. Band neutrophil counts are unnecessary for diagnosis of infection in patients with normal total leukocyte counts. Am J Clin Pathol 199; 102: Bentley SA, Johnson A, Bishop CA. A parallel evaluation of four automated hematology analyzers. Am J Clin Pathol 1993; 100: Jones RG, Faust AM, Matthews RA. Quality team approach in evaluating three automated hematology analyzers with five-part differential capability. Am J Clin Pathol 1995; 103: Jou JM, Aymerich M, Villamor N, Brugues RM, Vives-Corrons JLL. Resultadosde la evaluation del autoanalizador hematologicocell-dyn 3000 (CD 3000) (Summary). Sa^re 1992;37:103.

Evaluation of the Abbott CELL-DYN 4000 Hematology Analyzer

Evaluation of the Abbott CELL-DYN 4000 Hematology Analyzer Hematopathology / EVALUATION OF THE ABBOTT CELL-DYN 4 HEMATOLOGY ANALYZER Evaluation of the Abbott CELL-DYN 4 Hematology Analyzer Ernesto Grimaldi, MD, and Francesco Scopacasa, PhD Key Words: Abbott CD

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

Performance evaluation of Celltac G: a new automated hematology analyzer

Performance evaluation of Celltac G: a new automated hematology analyzer Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

Evaluation of haematology analyzer CELL-DYN 3700 SL

Evaluation of haematology analyzer CELL-DYN 3700 SL Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo

More information

INFECTION/ INFLAMMATION

INFECTION/ INFLAMMATION HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital

More information

Detection of important abnormalities of the differential

Detection of important abnormalities of the differential J Clin Pathol 1989;42:772-776 Detection of important abnormalities of the differential count using the Coulter STKR blood counter D F BARNARD, S A BARNARD, A B CARTER, S J MACHN, K G PATTERSON, A YARDUMAN

More information

Evaluation of the Diagnostic Performance of the Sysmex XT-2000i Automated Hematology Analyzer in the Detection of Immature Granulocytes

Evaluation of the Diagnostic Performance of the Sysmex XT-2000i Automated Hematology Analyzer in the Detection of Immature Granulocytes Evaluation of the Diagnostic Performance of the Sysmex XT-2000i Automated Hematology Analyzer in the Detection of Immature Granulocytes A. M. CENCI *1, M. MACONI *2, and B. CASOLARI *1 *1 Laboratory of

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential

Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential H e m a t o p a t h o l o g y / REFRIGERATION IMPROVES CBC COUNT STABILITY Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential Brent L. Wood, MD, PhD,

More information

First comparative evaluation of leucocyte differential and reticulocyte count between Abbott Cell -DYN 3700 and Beckman-Coulter Gen S

First comparative evaluation of leucocyte differential and reticulocyte count between Abbott Cell -DYN 3700 and Beckman-Coulter Gen S 111 Riv Med Lab - JLM, Vol. 4, N. 2, 2003 First comparative evaluation of leucocyte differential and reticulocyte count between Abbott Cell -DYN 3700 and Beckman-Coulter Gen S H. Vandeputte a, D. Darre

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

Paper ID: ART

Paper ID: ART analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in

More information

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)

More information

LYDIA NELSON, M.S., MT(ASCP), SH, SAMUEL CHARACHE, M.D., SANDRA WINGRELD, MT(ASCP), AND EDWARD KEYSER, MT(ASCP)

LYDIA NELSON, M.S., MT(ASCP), SH, SAMUEL CHARACHE, M.D., SANDRA WINGRELD, MT(ASCP), AND EDWARD KEYSER, MT(ASCP) Laboratory Evaluation of Differential White Blood Cell Count nformation from the S-Plus V and H-1 in Patient Populations Requiring Rapid "Turnaround" Time LYDA NELSON, M.S., MT(ASCP), SH, SAMUEL CHARACHE,

More information

Evaluation of Coulter S-Plus Three-part Differential in Population with a High Prevalence of Abnormalities

Evaluation of Coulter S-Plus Three-part Differential in Population with a High Prevalence of Abnormalities Evaluation of Coulter S-Plus Three-part Differential in Population with a High Prevalence of Abnormalities JOANNE CORNBLEET, M.D. AND SALLY KESSINGER, MT(ASCP)SH The authors evaluated the Coulter 15 S-Plus

More information

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für

More information

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016 XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient

More information

Automated Hematology Analyzer. Differentiate with the XT-4000i

Automated Hematology Analyzer. Differentiate with the XT-4000i XT-4000i Automated Hematology Analyzer Differentiate with the XT-4000i Advanced Technology Solutions to Meet Your Lab s Needs Even with these challenges, the need for hematology testing has remained steady

More information

Abbott Cell-Dyn Reticulocyte Method Comparison and Reticulocyte Normal Reference Range Evaluation

Abbott Cell-Dyn Reticulocyte Method Comparison and Reticulocyte Normal Reference Range Evaluation Laboratory Hematology 8:85-90 2002 Carden Jennings Publishing Co.. Ltd. Abbott Cell-Dyn Reticulocyte Method Comparison and Reticulocyte Normal Reference Range Evaluation T. SCHISANO, L. VAN HOVE Abbott

More information

Performance Evaluation of NS-hema21t Automated Hematology Analyzer and Comparison of the Hematological Parameters with Sysmex XT1800i

Performance Evaluation of NS-hema21t Automated Hematology Analyzer and Comparison of the Hematological Parameters with Sysmex XT1800i 217 IJSRST Volume 3 Issue 8 Print ISSN: 2395-611 Online ISSN: 2395-62X Themed Section: Science and Technology Performance Evaluation of NS-hema21t Automated Hematology Analyzer and Comparison of the Hematological

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

ADVANCED HAEMATOLOGY BATTLE OF THE BANDS. Dennis B. DeNicola, DVM, PhD, DACVP IDEXX Laboratories, Inc. Westbrook, Maine, USA BACKGROUND

ADVANCED HAEMATOLOGY BATTLE OF THE BANDS. Dennis B. DeNicola, DVM, PhD, DACVP IDEXX Laboratories, Inc. Westbrook, Maine, USA BACKGROUND ADVANCED HAEMATOLOGY BATTLE OF THE BANDS Dennis B. DeNicola, DVM, PhD, DACVP IDEXX Laboratories, Inc. Westbrook, Maine, USA BACKGROUND The identification of immature neutrophils (bands, metamyelocytes,

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

The white blood cell differential (WBC-diff) technologies

The white blood cell differential (WBC-diff) technologies The New Hematology Analyzer Sysmex Performance Evaluation of a Novel White Blood Cell Differential Technology Katharina Ruzicka, MD; Mario Veitl, MD; Renate Thalhammer-Scherrer, MD; Ilse Schwarzinger,

More information

Customer Information Literature List White Blood Cells

Customer Information Literature List White Blood Cells Customer Information Literature List White Blood Cells Date: September 2015 Subject: Literature List White Blood Cells Issued by: Scientific Customer Services Number: 150901 Note: Whether references are

More information

Sysmex Journal International Vol.9 No.2 (1999)

Sysmex Journal International Vol.9 No.2 (1999) Sysmex Journal International Vol.9 No. (999) Evaluation and Clinical Usefulness of the Automated Hematology Analyzer, Sysmex XE- TM Kazuto TSURUDA, Tomohiro TSUJI, Tetsuya USUI, Sachiko KITAJIMA, Atsuko

More information

Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation.

Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation. Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation. Sysmex America White Paper One Nelson C. White Parkway,

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

Evaluation of the QBC Star centrifugal three-part differential haematology system

Evaluation of the QBC Star centrifugal three-part differential haematology system ORIGINAL ARTICLE 67 Evaluation of the QBC Star centrifugal three-part differential haematology system O. ERHABOR, G. RICHARDSON, I. MOHAMMED, C. THORNTON, J. BARK, M. HURST, D. HAMER and P. KINSELLA Blood

More information

8.2 Principles of Quantitative Hematologic Determinations (1)

8.2 Principles of Quantitative Hematologic Determinations (1) 3 8. FIELD CENTER HEMATOLOGY SERVICES 8.1 Clinical Significance Quantitation of the formed elements of the blood (erythrocytes -RBCs, leukocytes - WBCs, and platelets) is important in the ARIC study primarily

More information

PointCare NOW TM Technical Note

PointCare NOW TM Technical Note PointCare NOW TM Technical Note Introduction to our Technology And Summary of Evaluation and Performance data 1 of 19 Introduction The PointCare NOW is a portable, and very fast, diagnostic instrument

More information

Lavender Top Management SUCCESS BEYOND FINANCES

Lavender Top Management SUCCESS BEYOND FINANCES Lavender Top Management Alfonso Ziccardi Ass.Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES 1 . VISION Mission/ Vision To successfully

More information

Lavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision

Lavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision Lavender Top Management Alfonso Ziccardi Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES Mission/ Vision. VISION To successfully develop

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für

More information

Interpreting Hematology Scatter-Plots; One Cancer Center s Keys to Seeing the BIG Picture

Interpreting Hematology Scatter-Plots; One Cancer Center s Keys to Seeing the BIG Picture Interpreting Hematology Scatter-Plots; One Cancer Center s Keys to Seeing the BIG Picture Barbara L. Burch, MHA MT (ASCP) Laboratory Manager New York University Clinical Cancer Center Disclosure Ms Burch

More information

Detection and Classification of Acute Leukemia by the Coulter STKS Hematology Analyzer

Detection and Classification of Acute Leukemia by the Coulter STKS Hematology Analyzer HEMATOPATHOLOGY Detection and Classification of Acute Leukemia by the Coulter STKS Hematology Analyzer JAMES D. HOYER, MD, 1 CATHERINE P. FISHER, MD, 1 VICKI M. SOPPA, BS, 1 KAY L. LANTIS, SH, MT(ASCP),

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

BACKGROUND. Absolute neutrophil counts (ANCs) and absolute phagocyte counts

BACKGROUND. Absolute neutrophil counts (ANCs) and absolute phagocyte counts 2681 Utility of Automated Counting to Determine Absolute Neutrophil Counts and Absolute Phagocyte Counts for Pediatric Cancer Treatment Protocols Nobuko Hijiya, M.D. 1,2 Mihaela Onciu, M.D. 3 Scott C.

More information

Automated Quantitation of Hemoglobin-Based Blood Substitutes in Whole Blood Samples

Automated Quantitation of Hemoglobin-Based Blood Substitutes in Whole Blood Samples Hematopathology / HEMOGLOBIN-BASED BLOOD SUBSTITUTES Automated Quantitation of Hemoglobin-Based Blood Substitutes in Whole Blood Samples Jolanta Kunicka, PhD, 1 Michael Malin, PhD, 1 David Zelmanovic,

More information

Determination of hemoglobin is one of the most commonly

Determination of hemoglobin is one of the most commonly ORIGINAL ARTICLE Multiple-Site Analytic Evaluation of a New Portable Analyzer, HemoCue Hb 201+, for Point-of-Care Testing Sten-Erik Bäck, PhD,* Carl G. M. Magnusson, PhD, Lena K. Norlund, MD, PhD, Henning

More information

Optimization of Criteria for Verification of Automated Platelet Counts Generated by the Sysmex XE-2100 Hematology Analyzer

Optimization of Criteria for Verification of Automated Platelet Counts Generated by the Sysmex XE-2100 Hematology Analyzer Optimization of Criteria for Verification of Automated Platelet Counts Generated by the Sysmex XE-2100 Hematology Analyzer Science Gene Gulati, PhD, Sean Cote, DO, Eric Behling, MD, William Kocher, MD

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

Forum for Collaborative HIV Research External Validation of CD4 and Viral Load Assays Paris, France June 29, 2007

Forum for Collaborative HIV Research External Validation of CD4 and Viral Load Assays Paris, France June 29, 2007 Forum for Collaborative HIV Research External Validation of CD4 and Viral Load Assays Paris, France June 29, 2007 Thomas J. Spira, M.D. International Laboratory Branch Global AIDS Program Centers for Disease

More information

LEANING Away Waste and Improving Patient Care with Advances in Hematology

LEANING Away Waste and Improving Patient Care with Advances in Hematology LEANING Away Waste and Improving Patient Care with Advances in Hematology Selke Mantie, MLS (ASCP), CLS (CSMLS), SSGBC Disclosure I am receiving an honorarium from Sysmex for today s presentation Objectives

More information

XN-SERIES. XN Technology and Case Studies

XN-SERIES. XN Technology and Case Studies XN Technology and Case Studies Karen Hoffman MT(ASCP) Clinical Applications Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S.

BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S. BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S. Introducing the DxH 500, an Open-vial Hematology System *. Quality 5-part Differential in a Compact Design The first

More information

Blutbild 2012: Automatisiert oder manuell? Georg Stüssi Servizio di Ematologia Istituto Oncologico della Svizzera Italiana

Blutbild 2012: Automatisiert oder manuell? Georg Stüssi Servizio di Ematologia Istituto Oncologico della Svizzera Italiana Blutbild 2012: Automatisiert oder manuell? Georg Stüssi Servizio di Ematologia Istituto Oncologico della Svizzera Italiana IS THERE STILL A ROLE FOR THE MANUAL BLOOD COUNT? Indication for examination

More information

10/30/2015. XN Case Studies: Every Picture Tells a Story

10/30/2015. XN Case Studies: Every Picture Tells a Story XN Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples

More information

Cbc with differential

Cbc with differential Cbc with differential Other tests might be necessary based on the results of the differential test and follow-up tests. Your doctor has many ways of determining and treating causes of abnormal blood cell

More information

Flow cytometry leukocyte differential : a critical appraisal

Flow cytometry leukocyte differential : a critical appraisal Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All

More information

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and

More information

Advanced Hematology Five-Part Differential. Simple Operation

Advanced Hematology Five-Part Differential. Simple Operation HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior

More information

3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story

3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story OBJECTIVES Hematology Case Studies: Every Picture Tells a Story Jason Anderson, MPH, MT(ASCP) Field Product Specialist Discuss how scattergram and histogram pictures can provide insight into abnormal hematology

More information

Complete Blood Count (CBC)

Complete Blood Count (CBC) Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction

More information

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:

More information

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE

More information

Continuing Education Questions

Continuing Education Questions FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory

Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Azza S Eldanasoury 1, Noha H Boshnak 2, Raghda E Abd El Monem 3 1 MD, Professor of Clinical

More information

Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa

Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa Quality control in the hematology laboratory for the sake of the patient Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa The FBC. Most frequently requested lab test Usually delegated

More information

Evaluation of the Automated Haematology Analyser Sysmex NE-8000

Evaluation of the Automated Haematology Analyser Sysmex NE-8000 Devreese et al.: Haematological cell eounting: The Sysmex NE-8000 339 Eur. J. Clin. Chem. Clin. Biochem. Vol. 29, 1991, pp. 339-345 1991 Waller de Gruyter & Co. Berlin New York Evaluation of the Automated

More information

Laboratory for diagnosis of THALASSEMIA

Laboratory for diagnosis of THALASSEMIA SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia

More information

HumaCount 5D. Outperforming 5-part Hematology System. CoreLab DX. Hematology

HumaCount 5D. Outperforming 5-part Hematology System. CoreLab DX. Hematology HumaCount 5D Outperforming 5-part Hematology System Direct Capillary Process by OptimalCount Technology Distinct 5-part Differentiation Definite Immature Cell Count (LIC, ALY) CoreLab DX Hematology 5-part

More information

Pseudobasophilia in Pediatric Age Group

Pseudobasophilia in Pediatric Age Group Original Article DOI: 10.17354/ijss/2015/259 Pseudobasophilia in Pediatric Age Group Femela Muniraj 1, Vijay Amritraj 2 1 Assistant Professor, Department of Pathology, Chettinad Hospital & Research Institute,

More information

Myelodysplastic Syndrome Case 158

Myelodysplastic Syndrome Case 158 Myelodysplastic Syndrome Case 158 Dong Chen MD PhD Division of Hematopathology Mayo Clinic Clinical History 86 year old man Persistent borderline anemia and thrombocytopenia. His past medical history was

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

Preechaya Wongkrajang, M.D., Chaicharoen Tantanate, M.D. ABSTRACT

Preechaya Wongkrajang, M.D., Chaicharoen Tantanate, M.D. ABSTRACT OriginalArticle Comparison of Leukocyte Differential Count by Beckman Coulter Unicel DxH800, Beckman Coulter LH780 and Sysmex XE-5000 Preechaya Wongkrajang, M.D., Chaicharoen Tantanate, M.D. Department

More information

Manual Differential Cell Counts Help Predict Bacterial Infection A Multivariate Analysis

Manual Differential Cell Counts Help Predict Bacterial Infection A Multivariate Analysis Hematopathology / LEFT SHIFT MODEL PREDICTS INFECTION Manual Differential Cell Counts Help Predict Bacterial Infection A Multivariate Analysis Michael J. Wile, MD, 1 Louis D. Homer, MD, PhD, 2 Stede Gaehler,

More information

Test Name Results Units Bio. Ref. Interval

Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

Performance Evaluation of the CellaVision DM96 System WBC Differentials by Automated Digital Image Analysis Supported by an Artificial Neural Network

Performance Evaluation of the CellaVision DM96 System WBC Differentials by Automated Digital Image Analysis Supported by an Artificial Neural Network Hematopathology / DIGITAL IMAGE ANALYSIS IN HEMATOLOGY Performance Evaluation of the CellaVision DM96 System WBC Differentials by Automated Digital Image Analysis Supported by an Artificial Neural Network

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

Hematology & Coagulation Practicum Objectives CLS - 647

Hematology & Coagulation Practicum Objectives CLS - 647 Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor

More information

of s and s Disclosure

of s and s Disclosure The s of s and s Successfully implement the Advanced Clinical Parameters to benefit the patient, the lab and the Accountable Care Organization Model Disclosure Honorarium from Sysmex for this lecture 1

More information

Kathleen Finnegan MS MT(ASCP)SHCM

Kathleen Finnegan MS MT(ASCP)SHCM Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester

More information

Blood Cell Identification Graded

Blood Cell Identification Graded BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory

More information

XN-SERIES. Hematology Case Studies: Every Picture Tells a Story

XN-SERIES. Hematology Case Studies: Every Picture Tells a Story Hematology Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology

More information