Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
|
|
|
- Nora Weaver
- 5 years ago
- Views:
Transcription
1 Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja kinnitatud Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte Age Sex Value Unit Reference Abbreviation Prothrombin time All M/F > 70 % 1 P-PT International 18y M/F 0,80-1,20 1 normalized ratio 0d - <3d 1,15-1,35 9 INR 3d - <1m 1,05-1,35 1m - <1y 0,86-1,22 1y - <6y 0,92-1,14 6y - <11y 0,87-1,20 11y - <18y 0,97-1,30 Activated partial 18y M/F 28,9 38,1 sec 1 thromboplastin time 0d - <3d 34,3-44,8 9 P-APTT 3d - <1m 29,5-42,2 1m - <1y 35,1-46,3 1y - <6y 33,6-43,8 6y - <11y 31,8-43,7 11y - <18y 33,9-46,1 Thrombin time All M/F < 21 sek 1 P-TT Fibrinogen 18y M/F 2,0-4,0 g/l 1 P-Fibr 0d - <3d 1,92-3,74 9 3d - <1m 2,83-4,01 1m - <1y 0,82-3,83 1y - <6y 1,62-4,01 6y - <11y 1,99-4,09 11y - <18y 2,12-4,33 Factor VII 18y M/F % 1 P-FVII 0d - <3d d - <1m m - <1y y - <6y y - <11y y - <18y Factor VIII 18y M/F % 1 P-FVIII 0d - <3d d - <1m m - <1y y - <6y Page 1 of 8
2 6y - <11y y - <18y Factor IX 18 y M/F % 1 P-F IX 0d - <3d d - <1m m - <1y y - <6y y - <11y y - <18y Factor XI 18a M/N % 1 P-FXI 0p - <3p p - <1k k - <1a a - <6a a - <11a a - <18a Factor VIII inhibitor Factor IX inhibitor All M/F BU 1 P-FVIII inh, FIX inh Factor inhibitor screening All M/F 1 P-F inh screen Von Willebrand factor All M/F % 1 P-vWF Free Protein S 18y M % 1 P-fPS F d - <3d d - <1m m - <1y y - <6y y - <11y y - <18y Protein C 18y M/F % 1 P-PC 0d - <3d d - <1m m - <1y y - <6y y - <11y y - <18y Activated protein C resistance All M/F 120 sec 1 P-APCR Antithrombin III 18y M/F % 1 Page 2 of 8
3 P-ATIII 0d - <3d d - <1m m - <1y y - <6y y - <11y y - <18y D-dimer 18y M/F < 0,5 µg/ml 1 P-DD 0d - <3d < 2,47 9 3d - <1m < 2,74 1m - <1y < 0,42. 1y - <6y < 0,53 6y - <11y < 0,56 11y - <18y < 0,39 Lupus sensitive All M/F APTT (31,4 43,4) sec 1 P-PTT-LA Lupus anticoagulant All M/F 1 P-LA (normalized ratio < 1,2 Low molecular heparin P-LMWH Rivaroxaban P-RXN Page 3 of 8 All All M/F M/F 0,5-1,0 3-4 h after dosage; 0-0,1 no treatment Missing in normal plasma Result depends on dosage, time of sampling etc. IU/mL 1 ng/l 12 Reptilase time All M/F <20 sec 1 P-RT Ristocetin cofactor activity All M/F Cut off for von Willebrand disease < 40 % 10 P-vWF:RCo Plasminogen All M/F % 1 P-Plasm Platelet function test sec All M/F with epinefrin 14 B-PFA-Col/Epi Platelet function test with ADP B-PFA-Col/ADP Platelet function test with P2Y12 B-PFA-P2YP12 All M/F All M/F 106 sec 14 sec Erythrocyte 17y - <51y F < 12 mm/h 3 11
4 sedimentation rate 51y - <61y < 19 B-ESR 61y - <70y < y < 35 17y - <51y M < 10 51y - <61y < 12 61y - <70y < y < 30 COMPLETE BLOOD COUNT WITH 5-DIFF B-CBC-5DIFF Red blood cells 18y F 3,9-5, /L 4 B-RBC M 4,2-5,7 0d - <7d M/F 4,0-6,6 5 7d - <14d 3,9-6,3 14d - <1m 3,6-6,2 1m - <2m 3,0-5,4 2m - <3m 2,7-4,9 3m - <6m 3,5-5,2 6m - <3y 3,5-5,6 3y - <12y 3,8-5,6 12y - <15y M 4,4-5,7 15y - <18y 4,5-6,0 12y - <18y F 4,0-5,6 White blood cells 21y M/F 3,5-8, /L 4 B-WBC Birth 9,0-30,0 8 <12h 13,0-38,0 12h - <1d 9,4-34,0 1d - <8d 5,0-21,0 8d - <15d 5,0-20,0 15d - <2m 5,0-19,5 2m - <1y 6,0-17,5 Page 4 of 8 1y - <3y 6,0-17,0 3y - 5y 5,5-15,5 5y - <7y 5,0-14,5 7y - <9y 5,4-13,5 9y - <11y 4,5-13,5 11y - <17y 4,5-13,0 17y - <21y 4,5-11,0 Hemoglobin 18y F g/l 4 B-Hb M d - <7d M/F d - <14d d - <1m m - <2m
5 2m - <3m m - <6m m - <3y y - <12y y - <15y M y - <18y y - <18y F Hematocrit 18y M % 4 B-Hct F d - <7d M/F d - <14d d - <1m m - <2m m - <3m m - <6m m - <3y y - <12y y - <15y M y - <18y y - <18y F Platelets B-PLT All M/F /L 4 Mean cell volume 18y M/F fl 4 B-MCV 0d - <7d d - <14d d - <1m m - <2m m - <3m m - <6m m - <3y y - <12y y - <18y Mean cell 4 hemoglobin 18y M/F pg B-MCH Mean cell 18y M/F g/l 4 hemoglobin 0d - <7d concentration 7d - <1m B-MCHC 1m - <3m m - <6m m - <3y y - <12y y - <18y RDW-CV 18y M/F 11,6-14,0 % 3 B-RDW-CV 0d - <18y Page 5 of 8
6 Reticulocytes 18y M/F 0,5-2,5 % 3 B-Ret % B-Ret # 10 9 /L Neutrophils M/F 40,0-80,0 % 3 21y B-Neut% 2,0-7, /L B-Neut# Birth 6,0-26,0 8 <12h 6,0-28,0 12h - <1d 5,0-21,0 1d - <8d 1,5-10,0 8d - <15d 1,0-9,5 15d - <2m 1,0-9,0 2m - <7m 1,0-8,5 7m - <5y 1,5-8,5 5y - <9y 1,5-8,0 9y - <17y 1,8-8,0 17y - <21y 1,8-7,7 Band neutrophils 18y M/F 0-5,0 % 3 Lymphocytes 21y M/F 20,0-40,0 % 3 B-Lymph% 1,0-3, /L B-Lymph# 0h - <12h 2,0-11,0 8 12h - <1d 2,0-11,5 1d - <15d 2,0-17,0 15d - <2m 2,5-16,5 2m - <7m 4,0-13,5 7m - <1y 4,0-10,5 1y - <3y 3,0-9,5 3y - <5y 2,0-8,0 5y - <7y 1,5-7,0 7y - <9y 1,5-6,8 9y - <11y 1,5-6,5 11y - <17y 1,2-5,2 17y - <21y 1,0-4,8 Monocytes B-Mono% B-Mono# Eosinophils B-Eo% B-Eo# Page 6 of 8 18y M/F 2,0-10,0 % 3 0,2-1, /L 0d - <7d 0,5-1,7 5 7d - <14d 0,3-1,3 14d - <3m 0,5-1,8 3m - <6m 0,2-1,6 6m - <3y 0,2-1,4 3y - <12y 0,1-1,1 12y - <18y 0,0-1,0 18y M/F 1,0-6,0 % 3 0,0-0, /L 0d - <7d 0,2-0,7 5 7d - <14d 0,2-0,8
7 Basophils B-Baso% B-Baso# Page 7 of 8 14d - <3m 0,2-0,6 3m - <6m 0,0-1,1 6m - <3y 0,0-1,0 3y - <12y 0,0-0,7 12y - <18y 0,0-0,7 18y M/F 0-1,0 % 3 0-0, /L 0d - <7d 0-0,3 5 7d - <18y 0-0,2 CEREBROSPINAL FLUID Leukocytes CSF-WBC Erythrocytes CSF-RBC 16y M/F /L 6 0d - <2m <27 2m - <16y <7 18a 0 Newborn preterm (<7d) <1000 Newborn term (<7d) <800 Neonate (7-30d) <50 3m - <18y <5 CEREBROSPINAL FLUID MICROSCOPY CSF-Diff Lymphocytes 18y M/F % 6 Monocytes 3-37 Neutrophils 0-2 Lymphocytes Neonate (<30d) 2-38 Monocytes Neutrophils 0-8 Histiocytes 1-9 URINE TEST STRIP Specific gravity U-SG strip 18y M/F ph U-pH strip 4,8 7,4 Leukocytes U-WBC strip (< 10 x 10 6 /L) Erythrocytes U-RBC strip (< 5 x 10 6 /L) Nitrite U-Nit strip Protein U-Pro strip (<0,1 g/l) Glucose U-Gluc strip (<1,7 mmol/l) 7 13
8 Ketone U-Ket strip (<0,5 mmol/l) Urobilinogen U-Ubg strip (<17 µmol/l) Bilirubin U-Bil strip (<3,4 mmol/l) URINE MICROSCOPY Erythrocytes U-ERY All M/F <4 /hpf Leukocytes M <2 U-WBC F <4 Hyaline cast U-hyaline cast M/F Diagnostica Stago methodology, 2015/ Lewis SM, Bain BJ, Bates I. Dacie and Lewis Practical Haematology, Nordic Reference Interval Project, Calgary Laboratory Services, CBC Reference values, CLSI H56-A, European Urinalysis Guidelines, Greer JP, Arber DA, Glader B et al. Wintrobe s Clinical Hematology, Diagnostica Stago methodology, Chrono-Log Ristocetin cofactor assay methodology, 07/ Innovance PFAP2Y methodology, Diagnostica Stago methodology, Roche Urisys teststrips methodology, Dade PFA Collagen/EPI Test Cartidge and Dade PFA Collagen/ADP Test Cartidge methodology, 2012 Page 8 of 8
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
Test Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS
1 of 6 Policy #: 800 (PLH-800-13) Initiated Date: 12/4/2002 Reviewed Date: 8/1/2016 Subject: HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS Approved by: Laboratory Director, Jerry Barker (electronic signature)
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
BASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
GRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
NEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
e-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT
HAEMATOLOGY INTRODUCTION
HAEMATOLOGY INTRODUCTION Haematology Laboratory offers a comprehensive range of routine and specialised haematological investigations. The laboratory also offers Routine Urine Sediment Microscopy and molecular
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK University Hospitals NHS Foundation Trust Haematology and Transfusion Department Mindelsohn Way Edgbaston Contact: Tel: +44 (0) 121 371 5963
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
LabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
Inspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091668 Age 40 Years Gender Male 29/8/2017 120000AM 29/8/2017 100156AM 29/8/2017 120820M Ref By Final COAGULATION ROFILE 2 FACTOR VIII FUNCTIONAL /ACTIVITY (Electromechanical
1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil
LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
Lab Guide Hematology Section Lab Guide
Lab Guide - 2018 Hematology Section Lab Guide Activated Partial Thromboplastin Time (APTT) One tube 2.7 ml citrated blood sample filled up to the mark on the tube label. (Light blue top tube, citrated
Paper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
Haematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
Internal Quality Control in the Haemostasis laboratory. Dr Steve Kitchen Sheffield Haemophilia and Thrombosis centre & UK NEQAS Blood Coagulation
Internal Quality Control in the Haemostasis laboratory Dr Steve Kitchen Sheffield Haemophilia and Thrombosis centre & UK NEQAS Blood Coagulation Why do we need Quality control? Philadelphia Enquirer Aug
Changes of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
Hematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
Introduction to coagulation and laboratory tests
Introduction to coagulation and laboratory tests Marc Jacquemin Special Haemostasis Laboratory Center for Molecular and Vascular Biology University of Leuven Coagulation in a blood vessel: fibrin stabilises
Step 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
Online catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44
Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
Chapter 11. Lecture and Animation Outline
Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have
Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Dr Fergus Jack Poole Hospital Tel: +44 (0) 1202 442 497 Longfleet Road E-Mail: fergus.jack@poole.nhs.uk
Preferred Clinical Services for Leading Age Florida August 26-27, 2015
DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I November 12, 2015 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired and
6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
Important Considera/ons for Coagula/on Tests on Children and Neonates
Important Considera/ons for Coagula/on Tests on Children and Neonates Cindy Neunert, MD MSCS Associate Professor Pediatric Hematology/Oncology/Bone Marrow Transplant Columbia University Medical Center
15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
Insights on the Quality of Coagulation Testing
Insights on the Quality of Coagulation Testing Piet Meijer ECAT Foundation The Netherlands No conflicts of interest HAEMOSTATIC BALANCE BLEEDING HAEMOSTATIC BALANCE THROMBOSIS HAEMOSTATIC BALANCE Thrombosis
Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
HYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences (Haematology) Pathology Building Queen Alexandra Hospital Portsmouth PO6 3LY United Kingdom Contact: Mrs Victoria Hunt Tel:
ENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XIII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION XIII MHD I November 13, 2014 STUDENT COPY MHD I, Session XIII, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
Brief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
NOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
Blood Lecture Test Questions Set 2 Summer 2012
Blood Lecture Test Questions Set 2 Summer 2012 1. Leukocytes are attracted to a site of injury or disease by: a. diapedesis b. chemotaxis c. leukocytosis d. heparin e. leukomotosis 2. Leukocytes leave
cobas u 601 urine analyzer Providing precise and secure test results
Providing precise and secure test results 1 of 6 Providing precise and secure test results cobas u 601 urine analyzer is a modular, analytical system platform for urine strip testing and features a fully
Recommendations for Celiac Disease Testing. IgA & ttg IgA
Recommendations for Celiac Disease Testing IgA & ttg IgA IgA Normal ttg IgA Negative IgA >10 mg/dl, but less than age matched range IgA
Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia
Use of the XE-21 in a Patient with Cold Auto-immune Hemolytic Anemia Gudrun STAMMINGER and Lothar BEIER Klinikum Chemnitz ggmbh, Institut für Laboratoriumsmedizin, Flemmingstraße 2, Chemnitz, Germany.
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
Interpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
Hematologic Disorders. Assistant professor of anesthesia
Preoperative Evaluation Hematologic Disorders Dr M.Razavi Assistant professor of anesthesia Anemia Evaluation needs to consider the extent and type of surgery, the anticipated blood loss, and the patient's
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
Coagulation an Overview Dr.Abdolreza Abdolr Afrasiabi Thal assem a & Heamophili hilia G ene i tic R esearc C en er Shiraz Medical Medic University
In The Name God Coagulation an Overview Dr.Abdolreza Afrasiabi Thalassemia & Heamophilia Genetic Research hcenter Shiraz Medical University Bleeding Clotting Hemostasis Review of platelet function Platelets
Please contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
Generate Knowledge Pre-Analytical Variables in the Coagulation Lab: Why Does It Matter?
Generate Knowledge Pre-Analytical Variables in the Coagulation Lab: Why Does It Matter? Paul Riley, PhD, MBA Pre-Analytical Variables: Objectives 1. Define Pre-Analytical variables 2. Explain how blood
AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
Chapter 19 Blood Lecture Outline
Chapter 19 Blood Lecture Outline Cardiovascular system Circulatory system Blood 1. distribution 2. regulation 3. protection Characteristics: ph 7.4 38 C 4-6 L Composition: Plasma Formed elements Erythrocytes
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 20 June 2017 ccredited to Haematology & Blood Tranfusion Craigavon rea Hospital
* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
Blood Cells Med Terms Quiz
Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:
INFORMATION FOR USERS OF THE HAEMATOLOGY DEPARTMENT
Page 1 of 19 INFORMATION FOR USERS OF THE HAEMATOLOGY DEPARTMENT Page 2 of 19 CONTENTS 1. LABORATORY LOCATION... 2 2. KEY STAFF CONTACT DETAILS... 4 3. LABORATORY OPENING TIMES... 5 4. TRANSPORTING SAMPLES...
Chapter 19 Cardiovascular System Blood: Functions. Plasma
Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,
Primary Exam Physiology lecture 5. Haemostasis
Primary Exam Physiology lecture 5 Haemostasis Haemostasis Body s response for the prevention and cessation of bleeding. Broadly consists of: Primary Haemostasis - vascular spasm and platlet plug formation
HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences Pathology Building Hull Royal Infirmary Anlaby Road Hull HU3 2JZ Contact: Dr Andrew Botham Tel: +44 (0)1482
Effective Date: Approved by: Laboratory Director, Jerry Barker (electronic signature)
1 of 5 Policy #: 702 (PHL-702-05) Effective Date: 9/30/2004 Reviewed Date: 8/1/2016 Subject: TRANSFUSION GUIDELINES Approved by: Laboratory Director, Jerry Barker (electronic signature) Approved by: Laboratory
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer