Paper ID: ART
|
|
- Hope Spencer
- 5 years ago
- Views:
Transcription
1 analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in EDTA.Laboratory aware of the changes that occur during specific setting in order to decide whether to samples that are too old to obtain reliable r measurement of Complete blood coun differential count (DIFF) as well as periphe (PBS) morphology are essential for the corre of haematology results. Parameters useful for diagnosis and haematological disorders, such as mean cell and PBS morphology are unreliable after 12 swelling of red cells during storage at Ro affects volume-dependant variables an
2 count with automated differential count is s at least 24 h or even to 72 h, with signifi depending on the type of automated blood particular, the monocyte count tends to eosinophil and lymphocyte counts tend to time; neutrophil count is stable up to 72 h generation instruments. A recent study, by Daves, Zaglereta SYSMEX XN, suggested no meaningful bia after 3 h under different storage conditions blood cell distribution width (RDW) and (impedance technique, PLT-I) at 37 meaningful bias was observed for me haemoglobin (MCH) and mean corpuscular at room temperature, red blood cell (RBC corpuscular haemoglobin concentration (M MCV and PLT-I at 4 C, and RBC, RDW and PLT-I at 37 C. After 24 h, a mean
3 Exclusion Criteria: Blood sample collected indoor (MKCG M Blood samples received from primary health care centres. (I.e. blood samples w storage time and condition.) Blood samples received from perip verification. Procedure 88 randomly selected blood samples venepuncture and anticoagula dipotassiumethylenediamine tetra-acetic aci measured within 1 h of collection onsys (installed in the section of haematology un of Pathology, MKCG Medical College, B sample was taken as the baseline (0 h) sam measurements were made at 5, 24, and 48 baseline measurement.
4 showed significant decreases (P<0.05) at collection.neutrophil count was stable up increased slightly in 48h sample. The s contained too few basophils to obtain reli basophil stability. EDTA-induced changes w hours after collection, which precluded a ma count. Morphological Changes in Ps (Perephera Depending on the time the peripheral b prepared, morphological changes were seen all Cells. Some neutrophils showed nuclea changes in the chromatin, that is homogenously compared to fresh nuclei, structure of the lobes that may become cytoplasmic rim appeared ragged or less w vacuolization and loss of granules may be ob shrinkage, chromatin condensation in
5 collection when stored at room temperature significant decrease in WBC count was ob due to degenerative changes in cells).how changes were observed for TWBC in refri up to 48h. Platelets were only stable up to 24 hours when stored at Room temperature. Ti concentration-related changes in PLT shape spherical and swelling do occur in specim EDTA; as a result of these changes, the me (MPV) is not a fully reliable value after 24 at room temperature. Interestingly, MPV v refrigerated sample showed increased dev control value in 24h sample as compared to temp. Storage of samples at 4 C increased the s parameters. CBC parameters, namely WBC
6 MCV(FL) MCH(pg.) MCHC(g/dl) RDW (%) PLT(10 9 /L) MPV(Fl) RET% Table 4: Mean, mean percentage change a Count on s n=88 FRESH 5 hr. Change% (<1hr) Lo NEUT LYMPH MONO EO BASO
7 Figure 3: (variation of Haemoglobin% w storage time, in both incubated and refrige
8 Figure 11: (variation of Differenti Figure 12: (variation of Differential C
9 Figure 15: (variation of Total Eosinophi prolonged storage time, in both incubated a sample) Figure 16: (variation of Total Neutrophi prolonged storage time, in both incubated a sample)
10
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationBrief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationChanges of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationEvaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital
HEMATOPATHOLOGY Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital JOAN-LLUIS VIVES-CORRONS, MD, ISABEL BESSON, PHD, JOSEP MARIA JOU, MD, AND GABRIELA GUTIERREZ, MB The
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationQuality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa
Quality control in the hematology laboratory for the sake of the patient Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa The FBC. Most frequently requested lab test Usually delegated
More informationDR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationSample stability for complete blood cell count using the Sysmex XN haematological analyser
ORIGINAL ARTICLE Sample stability for complete blood cell count using the Sysmex XN haematological analyser Massimo Daves 1, Elmar M. Zagler 1, Roberto Cemin 2, Flora Gnech 1, Alexandra Joos 1, Stefan
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationEvaluation of haematology analyzer CELL-DYN 3700 SL
Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationKathleen Finnegan MS MT(ASCP)SHCM
Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationHaematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationIncorporating Differentials Into Every Complete Blood Count. Paige Flowers, LVT Dogwood Veterinary Internal Medicine
Incorporating Differentials Into Every Complete Blood Count Paige Flowers, LVT Dogwood Veterinary Internal Medicine Complete Blood Count Diagnostic performed to evaluate the quantity and morphology of
More informationPerformance evaluation of Celltac G: a new automated hematology analyzer
Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo
More informationHematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationXN-SERIES. XN Technology and Case Studies
XN Technology and Case Studies Karen Hoffman MT(ASCP) Clinical Applications Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationProper Slide Preparation
Hematology Essentials: A Foundation for WBC Review Using Case Studies Christine Hinz, MS, MLS(ASCP) CM Proper Slide Preparation smooth, homogenous film 1/2 to 3/4 the slide length straight feather edge
More informationBlood Cell Identification Graded
Blood Cell Identification Graded Case History The patient was a five-day-old girl with an elevated unconjugated bilirubin and a weakly positive direct antiglobulin test (DAT). Her CBC showed: WBC = 11.0
More informationDetection of important abnormalities of the differential
J Clin Pathol 1989;42:772-776 Detection of important abnormalities of the differential count using the Coulter STKR blood counter D F BARNARD, S A BARNARD, A B CARTER, S J MACHN, K G PATTERSON, A YARDUMAN
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester
More information10/30/2015. XN Case Studies: Every Picture Tells a Story
XN Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples
More informationComplete Blood Count PSI AP Biology
Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
More informationIcd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationLavender Top Management SUCCESS BEYOND FINANCES
Lavender Top Management Alfonso Ziccardi Ass.Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES 1 . VISION Mission/ Vision To successfully
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44
More informationLavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision
Lavender Top Management Alfonso Ziccardi Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES Mission/ Vision. VISION To successfully develop
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationInfluence of a light meal on routine haematological tests
ORIGINAL ARTICLE Influence of a light meal on routine haematological tests Giuseppe Lippi 1, Gabriel Lima-Oliveira 2, Gian Luca Salvagno 1, Martina Montagnana 1, Matteo Gelati 1, Geraldo Picheth 3, Alberto
More information1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs
1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.
More informationEDUCATIONAL COMMENTARY DIFFERENTIATING IMMATURE PERIPHERAL BLOOD CELLS
Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click on Continuing Education on the left side of the
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
More informationEDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES
EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationq,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
More informationResearch article Ερευνητικό άρθρο
: 145-154 : 145-154 Research article Ερευνητικό άρθρο Effects of Storage Duration and Temperature on the Values of Haematological Parameters in Bovine and Ovine Blood Samples Kirmizigul A.H. 1 *, Gokce
More informationXN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
More informationPrecision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100
Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)
More informationXN-SERIES. Hematology Case Studies: Every Picture Tells a Story
Hematology Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
More information+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies
In house hematology laboratories: pros and cons of bench-top analyzers and the essentials of a blood film exam. NCSU-CVM Clinical Pathology January 22, 2014 Jaime Tarigo, DVM, PhD, DACVP Goals Understand
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationEvaluation of the Abbott CELL-DYN 4000 Hematology Analyzer
Hematopathology / EVALUATION OF THE ABBOTT CELL-DYN 4 HEMATOLOGY ANALYZER Evaluation of the Abbott CELL-DYN 4 Hematology Analyzer Ernesto Grimaldi, MD, and Francesco Scopacasa, PhD Key Words: Abbott CD
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
More informationStandard Operating Procedure
Subject Differential: Counting and Morphology Index Number Lab-5074 Section Laboratory Subsection Hematology Automated Laboratory Category Departmental Contact Moldenhauer, Emily C Last Revised 11/28/2017
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationSysmex Journal International Vol.9 No.2 (1999)
Sysmex Journal International Vol.9 No. (999) Evaluation and Clinical Usefulness of the Automated Hematology Analyzer, Sysmex XE- TM Kazuto TSURUDA, Tomohiro TSUJI, Tetsuya USUI, Sachiko KITAJIMA, Atsuko
More informationContinuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
More informationSue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD
Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue
More informationRefrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential
H e m a t o p a t h o l o g y / REFRIGERATION IMPROVES CBC COUNT STABILITY Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential Brent L. Wood, MD, PhD,
More informationHematopoiesis Simplified: Part 1 Erythropoiesis
Hematopoiesis Simplified: Part 1 Erythropoiesis Larry Johnson Texas A&M University Hematopoiesis Simplified: Part 1 Erythropoiesis Objectives are to: Identify the developmental cells of erythropoiesis
More informationComplete Blood Count (CBC)
Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction
More informationBlood Cell Identification Graded
BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationBlood Cell Identification Graded
Blood Cell Identification Graded Case History The patient is a 20-year-old female with sickle cell disease who presents with bilateral leg pain for 3 days. She is scheduled to have bilateral hip and leg
More informationClinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationDeconstructing the CBC
Deconstructing the CBC Dr. Ann M. Wexler Solano Hematology Oncology September 10, 2017 What Are the Major Components of Blood? Red Blood Cells (also called erythrocytes) White Blood Cells (also called
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationChanges in Hematologic Parameters Induced by Thermal Treatment of Human Blood
Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationHematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan
Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan Mohamed Elyass, AmeraAbdullah, Exany Samuel, Nada yassen, Ahmed
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationLeukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University
Leukocytosis dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University My first day at work in 1997 3y with fever, cough Is this bronchitis, pneumonia, pharyngitis, sinusitis, else? Is this
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationM. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationCombining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter
Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and
More information3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story
OBJECTIVES Hematology Case Studies: Every Picture Tells a Story Jason Anderson, MPH, MT(ASCP) Field Product Specialist Discuss how scattergram and histogram pictures can provide insight into abnormal hematology
More informationAutomated Hematology Analyzer. Differentiate with the XT-4000i
XT-4000i Automated Hematology Analyzer Differentiate with the XT-4000i Advanced Technology Solutions to Meet Your Lab s Needs Even with these challenges, the need for hematology testing has remained steady
More informationLaboratory Testing for the Primary Care Optometrist
General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a
More informationMORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman
MORPHOLOGY OF BONE MARROW ASPIRATES Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman BONE MARROW ASPIRATION Sites Sternum Anterior or posterior iliac spines Aspiration from
More informationEvaluation of the Automated Haematology Analyser Sysmex NE-8000
Devreese et al.: Haematological cell eounting: The Sysmex NE-8000 339 Eur. J. Clin. Chem. Clin. Biochem. Vol. 29, 1991, pp. 339-345 1991 Waller de Gruyter & Co. Berlin New York Evaluation of the Automated
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationDoes Morphology Matter in 2017
Does Morphology Matter in 2017 ISLH May 2017 Kathryn Foucar Distinguished Professor Emerita kfoucar@salud.unm.edu Objectives Recognize unique RBC and WBC abnormalities in non-neoplastic disorders Learn
More informationLetter to the Editor. Effect of edta-anticoagulated whole blood storage on cell morphology examination. A need for standardization
International Journal of Laboratory Hematology LETTER TO THE EDITOR The Official journal of the International Society for Laboratory Hematology INTERNATIONAL JOURNAL OF LABORATORY HEMATOLOGY Letter to
More information