Paper ID: ART

Size: px
Start display at page:

Download "Paper ID: ART"

Transcription

1 analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in EDTA.Laboratory aware of the changes that occur during specific setting in order to decide whether to samples that are too old to obtain reliable r measurement of Complete blood coun differential count (DIFF) as well as periphe (PBS) morphology are essential for the corre of haematology results. Parameters useful for diagnosis and haematological disorders, such as mean cell and PBS morphology are unreliable after 12 swelling of red cells during storage at Ro affects volume-dependant variables an

2 count with automated differential count is s at least 24 h or even to 72 h, with signifi depending on the type of automated blood particular, the monocyte count tends to eosinophil and lymphocyte counts tend to time; neutrophil count is stable up to 72 h generation instruments. A recent study, by Daves, Zaglereta SYSMEX XN, suggested no meaningful bia after 3 h under different storage conditions blood cell distribution width (RDW) and (impedance technique, PLT-I) at 37 meaningful bias was observed for me haemoglobin (MCH) and mean corpuscular at room temperature, red blood cell (RBC corpuscular haemoglobin concentration (M MCV and PLT-I at 4 C, and RBC, RDW and PLT-I at 37 C. After 24 h, a mean

3 Exclusion Criteria: Blood sample collected indoor (MKCG M Blood samples received from primary health care centres. (I.e. blood samples w storage time and condition.) Blood samples received from perip verification. Procedure 88 randomly selected blood samples venepuncture and anticoagula dipotassiumethylenediamine tetra-acetic aci measured within 1 h of collection onsys (installed in the section of haematology un of Pathology, MKCG Medical College, B sample was taken as the baseline (0 h) sam measurements were made at 5, 24, and 48 baseline measurement.

4 showed significant decreases (P<0.05) at collection.neutrophil count was stable up increased slightly in 48h sample. The s contained too few basophils to obtain reli basophil stability. EDTA-induced changes w hours after collection, which precluded a ma count. Morphological Changes in Ps (Perephera Depending on the time the peripheral b prepared, morphological changes were seen all Cells. Some neutrophils showed nuclea changes in the chromatin, that is homogenously compared to fresh nuclei, structure of the lobes that may become cytoplasmic rim appeared ragged or less w vacuolization and loss of granules may be ob shrinkage, chromatin condensation in

5 collection when stored at room temperature significant decrease in WBC count was ob due to degenerative changes in cells).how changes were observed for TWBC in refri up to 48h. Platelets were only stable up to 24 hours when stored at Room temperature. Ti concentration-related changes in PLT shape spherical and swelling do occur in specim EDTA; as a result of these changes, the me (MPV) is not a fully reliable value after 24 at room temperature. Interestingly, MPV v refrigerated sample showed increased dev control value in 24h sample as compared to temp. Storage of samples at 4 C increased the s parameters. CBC parameters, namely WBC

6 MCV(FL) MCH(pg.) MCHC(g/dl) RDW (%) PLT(10 9 /L) MPV(Fl) RET% Table 4: Mean, mean percentage change a Count on s n=88 FRESH 5 hr. Change% (<1hr) Lo NEUT LYMPH MONO EO BASO

7 Figure 3: (variation of Haemoglobin% w storage time, in both incubated and refrige

8 Figure 11: (variation of Differenti Figure 12: (variation of Differential C

9 Figure 15: (variation of Total Eosinophi prolonged storage time, in both incubated a sample) Figure 16: (variation of Total Neutrophi prolonged storage time, in both incubated a sample)

10

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital

Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital HEMATOPATHOLOGY Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital JOAN-LLUIS VIVES-CORRONS, MD, ISABEL BESSON, PHD, JOSEP MARIA JOU, MD, AND GABRIELA GUTIERREZ, MB The

More information

INFECTION/ INFLAMMATION

INFECTION/ INFLAMMATION HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital

More information

Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa

Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa Quality control in the hematology laboratory for the sake of the patient Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa The FBC. Most frequently requested lab test Usually delegated

More information

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Sample stability for complete blood cell count using the Sysmex XN haematological analyser

Sample stability for complete blood cell count using the Sysmex XN haematological analyser ORIGINAL ARTICLE Sample stability for complete blood cell count using the Sysmex XN haematological analyser Massimo Daves 1, Elmar M. Zagler 1, Roberto Cemin 2, Flora Gnech 1, Alexandra Joos 1, Stefan

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

Evaluation of haematology analyzer CELL-DYN 3700 SL

Evaluation of haematology analyzer CELL-DYN 3700 SL Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Kathleen Finnegan MS MT(ASCP)SHCM

Kathleen Finnegan MS MT(ASCP)SHCM Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Haematology Comparability Document

Haematology Comparability Document South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

Incorporating Differentials Into Every Complete Blood Count. Paige Flowers, LVT Dogwood Veterinary Internal Medicine

Incorporating Differentials Into Every Complete Blood Count. Paige Flowers, LVT Dogwood Veterinary Internal Medicine Incorporating Differentials Into Every Complete Blood Count Paige Flowers, LVT Dogwood Veterinary Internal Medicine Complete Blood Count Diagnostic performed to evaluate the quantity and morphology of

More information

Performance evaluation of Celltac G: a new automated hematology analyzer

Performance evaluation of Celltac G: a new automated hematology analyzer Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

XN-SERIES. XN Technology and Case Studies

XN-SERIES. XN Technology and Case Studies XN Technology and Case Studies Karen Hoffman MT(ASCP) Clinical Applications Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Proper Slide Preparation

Proper Slide Preparation Hematology Essentials: A Foundation for WBC Review Using Case Studies Christine Hinz, MS, MLS(ASCP) CM Proper Slide Preparation smooth, homogenous film 1/2 to 3/4 the slide length straight feather edge

More information

Blood Cell Identification Graded

Blood Cell Identification Graded Blood Cell Identification Graded Case History The patient was a five-day-old girl with an elevated unconjugated bilirubin and a weakly positive direct antiglobulin test (DAT). Her CBC showed: WBC = 11.0

More information

Detection of important abnormalities of the differential

Detection of important abnormalities of the differential J Clin Pathol 1989;42:772-776 Detection of important abnormalities of the differential count using the Coulter STKR blood counter D F BARNARD, S A BARNARD, A B CARTER, S J MACHN, K G PATTERSON, A YARDUMAN

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester

More information

10/30/2015. XN Case Studies: Every Picture Tells a Story

10/30/2015. XN Case Studies: Every Picture Tells a Story XN Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples

More information

Complete Blood Count PSI AP Biology

Complete Blood Count PSI AP Biology Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für

More information

Icd code for cbc with differential/ platelet

Icd code for cbc with differential/ platelet Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

Lavender Top Management SUCCESS BEYOND FINANCES

Lavender Top Management SUCCESS BEYOND FINANCES Lavender Top Management Alfonso Ziccardi Ass.Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES 1 . VISION Mission/ Vision To successfully

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44

More information

Lavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision

Lavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision Lavender Top Management Alfonso Ziccardi Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES Mission/ Vision. VISION To successfully develop

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Influence of a light meal on routine haematological tests

Influence of a light meal on routine haematological tests ORIGINAL ARTICLE Influence of a light meal on routine haematological tests Giuseppe Lippi 1, Gabriel Lima-Oliveira 2, Gian Luca Salvagno 1, Martina Montagnana 1, Matteo Gelati 1, Geraldo Picheth 3, Alberto

More information

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs 1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.

More information

EDUCATIONAL COMMENTARY DIFFERENTIATING IMMATURE PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY DIFFERENTIATING IMMATURE PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click on Continuing Education on the left side of the

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für

More information

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:

More information

Research article Ερευνητικό άρθρο

Research article Ερευνητικό άρθρο : 145-154 : 145-154 Research article Ερευνητικό άρθρο Effects of Storage Duration and Temperature on the Values of Haematological Parameters in Bovine and Ovine Blood Samples Kirmizigul A.H. 1 *, Gokce

More information

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016 XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient

More information

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100

Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)

More information

XN-SERIES. Hematology Case Studies: Every Picture Tells a Story

XN-SERIES. Hematology Case Studies: Every Picture Tells a Story Hematology Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9 ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti

More information

+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies

+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies In house hematology laboratories: pros and cons of bench-top analyzers and the essentials of a blood film exam. NCSU-CVM Clinical Pathology January 22, 2014 Jaime Tarigo, DVM, PhD, DACVP Goals Understand

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

Evaluation of the Abbott CELL-DYN 4000 Hematology Analyzer

Evaluation of the Abbott CELL-DYN 4000 Hematology Analyzer Hematopathology / EVALUATION OF THE ABBOTT CELL-DYN 4 HEMATOLOGY ANALYZER Evaluation of the Abbott CELL-DYN 4 Hematology Analyzer Ernesto Grimaldi, MD, and Francesco Scopacasa, PhD Key Words: Abbott CD

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für

More information

Standard Operating Procedure

Standard Operating Procedure Subject Differential: Counting and Morphology Index Number Lab-5074 Section Laboratory Subsection Hematology Automated Laboratory Category Departmental Contact Moldenhauer, Emily C Last Revised 11/28/2017

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Sysmex Journal International Vol.9 No.2 (1999)

Sysmex Journal International Vol.9 No.2 (1999) Sysmex Journal International Vol.9 No. (999) Evaluation and Clinical Usefulness of the Automated Hematology Analyzer, Sysmex XE- TM Kazuto TSURUDA, Tomohiro TSUJI, Tetsuya USUI, Sachiko KITAJIMA, Atsuko

More information

Continuing Education Questions

Continuing Education Questions FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one

More information

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue

More information

Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential

Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential H e m a t o p a t h o l o g y / REFRIGERATION IMPROVES CBC COUNT STABILITY Refrigerated Storage Improves the Stability of the Complete Blood Cell Count and Automated Differential Brent L. Wood, MD, PhD,

More information

Hematopoiesis Simplified: Part 1 Erythropoiesis

Hematopoiesis Simplified: Part 1 Erythropoiesis Hematopoiesis Simplified: Part 1 Erythropoiesis Larry Johnson Texas A&M University Hematopoiesis Simplified: Part 1 Erythropoiesis Objectives are to: Identify the developmental cells of erythropoiesis

More information

Complete Blood Count (CBC)

Complete Blood Count (CBC) Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction

More information

Blood Cell Identification Graded

Blood Cell Identification Graded BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

Blood Cell Identification Graded

Blood Cell Identification Graded Blood Cell Identification Graded Case History The patient is a 20-year-old female with sickle cell disease who presents with bilateral leg pain for 3 days. She is scheduled to have bilateral hip and leg

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

Deconstructing the CBC

Deconstructing the CBC Deconstructing the CBC Dr. Ann M. Wexler Solano Hematology Oncology September 10, 2017 What Are the Major Components of Blood? Red Blood Cells (also called erythrocytes) White Blood Cells (also called

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan

Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan Mohamed Elyass, AmeraAbdullah, Exany Samuel, Nada yassen, Ahmed

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Leukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University

Leukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University Leukocytosis dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University My first day at work in 1997 3y with fever, cough Is this bronchitis, pneumonia, pharyngitis, sinusitis, else? Is this

More information

Interpreting Blood Tests Part 1. Dr Andrew Smith

Interpreting Blood Tests Part 1. Dr Andrew Smith Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and

More information

3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story

3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story OBJECTIVES Hematology Case Studies: Every Picture Tells a Story Jason Anderson, MPH, MT(ASCP) Field Product Specialist Discuss how scattergram and histogram pictures can provide insight into abnormal hematology

More information

Automated Hematology Analyzer. Differentiate with the XT-4000i

Automated Hematology Analyzer. Differentiate with the XT-4000i XT-4000i Automated Hematology Analyzer Differentiate with the XT-4000i Advanced Technology Solutions to Meet Your Lab s Needs Even with these challenges, the need for hematology testing has remained steady

More information

Laboratory Testing for the Primary Care Optometrist

Laboratory Testing for the Primary Care Optometrist General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a

More information

MORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman

MORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman MORPHOLOGY OF BONE MARROW ASPIRATES Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman BONE MARROW ASPIRATION Sites Sternum Anterior or posterior iliac spines Aspiration from

More information

Evaluation of the Automated Haematology Analyser Sysmex NE-8000

Evaluation of the Automated Haematology Analyser Sysmex NE-8000 Devreese et al.: Haematological cell eounting: The Sysmex NE-8000 339 Eur. J. Clin. Chem. Clin. Biochem. Vol. 29, 1991, pp. 339-345 1991 Waller de Gruyter & Co. Berlin New York Evaluation of the Automated

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Does Morphology Matter in 2017

Does Morphology Matter in 2017 Does Morphology Matter in 2017 ISLH May 2017 Kathryn Foucar Distinguished Professor Emerita kfoucar@salud.unm.edu Objectives Recognize unique RBC and WBC abnormalities in non-neoplastic disorders Learn

More information

Letter to the Editor. Effect of edta-anticoagulated whole blood storage on cell morphology examination. A need for standardization

Letter to the Editor. Effect of edta-anticoagulated whole blood storage on cell morphology examination. A need for standardization International Journal of Laboratory Hematology LETTER TO THE EDITOR The Official journal of the International Society for Laboratory Hematology INTERNATIONAL JOURNAL OF LABORATORY HEMATOLOGY Letter to

More information