ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt

Transcription

1 ggcgcgtcgagatgatcacgacggcatgctagctagccatacgcgtcaatcgtagctagct actctagtacgatgctagctacgtacgtcatgatcgatcgatcgtagctagctagctagctaga gggcgctgctcttcgttgtgcacacttacgtagcatgctagctagctagctgtcagtcagtacga tac Cell Biology of Genomes: catcgtagcattttagccgcggctagctagctagcta ca From aging to cancer resistance aacgtacgtacggtcgtaaagtagatgag cggcattagggcaggatgatttgagtgagagtcgttgaggcgatgggttaaatgcgaagtac acgtgtctgggcgttagggacgatgaggactcgtagctagtcagtacgtcagtacggctagc gctatagctaggctagatattagctatcgtacgtacgtacgggtaggctgctgtgacggtgagg ggctaggggctaggacgtgtggacgtagatcatactgcagtactgctacgtcatgactgcagt gtacgtatccagtcatgactgcatacgtcgtacgactgactgtctatcgtcatgtacgtcatgtc tagtctagctagctagctacgatcgtacgatcgtagctagctagctacgtacgtgcatcatgca The cell biology of genomes: from aging to cancer resistance gtcagcgcgtagatgctagctagctagctagctagctagctacgtagcgcgcgctatattagc atgcattagtcgatgctagctacgtacgtagctacgtacggtcagctacgtacgtcagtcagac The genome as a cellular entity ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt - spatial organization in 3D gatttatatatattagagccggccggcggcgtagctagcattatatgcgtagcaaaacgatgc - temporal re-organization tagtagctagctagcgtatgactgactgcatagcgctacgggcagggcgtcgatcgatcgtag - dynamics atgctagctagctagctgactgactcgatacgcatggtctgatctacgatcgatcgtacgatcg

2 The Cell Biology of Genomes Architectural elements of the nucleus Non-random genome organization Nuclear bodies Dynamics Misteli, Scientific American, 2011

3 Aging

4 Aging

5 Aging is a health burden Aging-associated diseases Cancer Diabetes Cardiovascular disease Hypertension Arthritis Osteoporosis Dementia Health care cost From Finkel, Nat. Rev Societal burden

6 The difficulty of studying human aging Complexity Physiology Environment Disease

7 Human pre-mature aging diseases Disease gene Cellular defect Tumor susceptibility Werner Syndrome WRN RecQ DNA helicase TUMORS Bloom Syndrome BLM RecQ DNA helicase TUMORS Dyskeratosis congenita DKC1 rrna processing telomerase TUMORS Cockayne Syndrome ERCC6/8 DNA repair NO TUMORS Trichothiodystrophy XPD/TFIIH DNA repair Transcription NO TUMORS Hutchinson-Gilford Progeria Syndrome Lamin A/C Nuclear architecture NO TUMORS DISEASES OF THE CELL NUCLEUS

8 Hutchinson-Gilford Progeria Syndrome Jonathan Hutchinson 1886 Hastings Gilford 1897

9 Hutchinson-Gilford Progeria Syndrome Pre-mature aging syndrome 1 in 12 million affected Disease onset months Life expectancy years Growth failure, loss of body fat skin defects, alopecia, joint stiffness, osteoporosis, atherosclerosis, cardiovascular disease, stroke

10 HGPS: Weight and growth 10 Y.O. 4 Y.O. Gordon et al, Pediatrics, 2007

11 HGPS: Cardiovascular defects Vascular morphology MRI 5 year old with carotid obstruction Arterial Wall Echodensity Mapping Control Olive et al, ATVB, 2010 HGPS I M A Kieran et al,. Pediatrics 120(4): , 2007

12 HGPS: A very surprising cause! Lumen Lumen

13 The nuclear lamina Lamina Lamin A, B, C proteins - intermediate filaments - form a protein meshwork - structural elements - interacts with chromatin - provide platform for nuclear functions Misteli, Scientific American, 2011

14 HGPS is a Laminopathy 15 human diseases caused by mutations in LMNA > 400 pathogenic mutations described Q6X Q6X T10I T10I S22L R25P R25G R28W R28W R28W E33D E33D L35V Q36X N39S N39S A43T Y45C R50S R50P R50P E53V A57P L59R L59R R60G R60G R62G I63N I63S E82K L85R R89L R89C L92P K97E R101P E111X G125S R132P R133L R133P R133P R133L L140R L140P S143F S143F S143P E145K T150P E161K L162P R166P K171K L183P E186K R190W R190Q D192G N195K R196S E203K E203G E203V I210S L215P K219T H222P H222Y R225X D230N G232E Q234X Q246X L248P R249W R249Q Y259D Y259X K260N Y267C Y267H Q294P R298C D300N L302P S303P E317K A318T R321X S326T R331P R331E R336Q E347K R349L R349W Q355X D357H E358K M371K R377H R377L L380S E381A R386K L387V R388C R388H Q396R R399C R399C R399H R401C V415I L421P R439C Muscular dystrophies Neuropathies Lipodystrophy Systemic Syndromes (aging, demapathies) R439C V440M* V440M* D446V R453P R453W N456K N456I N456D N459Y G465D I469T R471C R471G R471C R471H Y481H Y481X R482L R482W R482Q K486N T488P Q493X W498C W498R H506D L512P W520S W520G R527P R527H R527C R527C* T528R T528K T528M* T528M* A529V A529T L530P R541C R541S R541H R541K K542N S573L S573L E578V R582H S583L R584H C591F G608S G608G T623S* R624H R644C R644C R644H R654X R654X 5 3 LMNA (lamin A) Dittmer and Misteli, Genome Biology, 2011

15 HGPS is a splicing disease Wild type mutant nt 12 GGC>GGT 500 bp 400 bp 300 bp Lamin A progerin Lamin C Eriksson et al., Nature, 2003 De Sandre-Giovannoli et al., Science, 2003

16 Nuclear defects in HGPS H3 Tri-Me-K9 g-h2ax Structural abnormalities Chromatin/Epigenetic defects Protein degradation/mislocalization DNA damage Scaffidi and Misteli, Nat.Med 2005

17 Protein aggregates at the nuclear periphery progerin Localization Dynamics Mechanical properties WT progerin Scaffidi and Misteli, Nature Med, 2005 Dahl et al., PNAS, 2006

18 Lamina impairment in HGPS patient cells Lamina Lamina protein composition Nuclear defects Aberrant nuclear morphology Elevated DNA damage Epigenetic alternations Loss of protein homeostasis Chromatin disorganization Pegoraro et al, NCB,2009 Kubben, Nucleus, 2011 Genome interactions Kubben, Chromosoma, 2011 McCord et al., Genome Res, 2013

19 Stem cell dysfunction in HGPS Progerin Loss of stem cell properties progenitors Differentiation Defects Regeneration Defects AGING Osorio et al, J. Cell Bio., 2008 Scaffidi & Misteli, Nature Cell Bio., 2008 Espada et al, J. Cell Biol, 2008 Rosengardten et al., Aging Cell, 2011

20 Mode of action of progerin Nuclear periphery Nuclear interior farnesylation farnesylation FTase FTIs Assembly into lamina Fails to properly assemble Scaffidi et al., PLoS Biology, 2005

21 FTIs: a cancer silver bullet

22 From gene to clinical trial in 4 years!

23 Therapeutic targets in HGPS Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014

24 Does HGPS teach us anything about normal aging?

25 Progerin in physiological aging LMNA exon 11 sequence Normal G G T G G G C WEAK splice site Graham G G T A/G A G T CONSENSUS splice site HGPS patient G G T G G G T STRONG splice site RNA Protein progerin Scaffidi and Misteli, Science, 2006

26 Progeria-like defects in cells from healthy old individuals Scaffidi and Misteli, Science, 2006

27 From old make young: Elimination of progerin from old cells restores cellular phenotype GGC>GGT Scaffidi and Misteli, Nat. Med., 2005 Scaffidi and Misteli, Science, 2006

28 HGPS coronary similarities with atherosclerosis classic complex plaque morphology including a necrotic core and foci of chronic inflammation. calcification,evidence of plaque erosion and/or rupture a spectrum of early to late-stage plaques

29 Parallels between premature and normal aging Constitutive expression of HIGH levels of progerin Premature aging Molecules Cellular Organism - Use of splice site - Progerin production SPORADIC expression of LOW levels of progerin - Morphology - Epigenetics - DNA damage - Symptoms - Stem cells - Vascular defects Normal aging

30 g-h2ax High levels of persistent DNA damage in HGPS patients control HGPS Liu et al., Nature Med Scaffidi and Misteli, Nature Med But.NO TUMORS

31 Probing transformation potential of HGPS cells htert (immortalize) H-Ras (proliferation) SV40 T antigens (inhibits checkpoints) Normal primary cell Weinberg lab (1999) Transformed cell Colony formation assay in vitro Tumor formation assay in vivo

32 HGPS cells are resistant to transformation in vitro Soft agar assay for colony formation Proliferation kinetics TRS-WT TRS-HGPS WT-TSR HGPS-TSR p<0.0001

33 HGPS cells are resistant to transformation in vivo Xenograft assays Tumors wt HG Wt 1 7/8 Wt 2 6/10 13/18 HG 1 0/8 HG 2 1/8 1/16 Wt1+ Wt lamin A 4/5 Wt1+ progerin 0/5

34 Transformation resistance is due to progerin Soft agar assay off on off on Xenograft model Lamin A progerin GFP-Lamin A GFP-Progerin

35 Defective oncogenic reprogramming and de-differentiation of HGPS cells Transformation TERT Wt1 Wt2 HG1 HG2 TERT/SV40/HRAS WT1 WT2 HG1 HG2 Transformed HGPS cells fail to activate oncogenic pathways including: - RAS pathway - VEGF pathway - NFkB pathways Transformed HGPS cells fail to repress fibroblast-related pathways: - fibroblast markers - ECM pathways - collagen - skin development

36 An shrna screen to identify tumor resistance factors in HGPS HGPS skin fibroblasts (htert/sv40/ras) Oncogenic Reprogramming De-differentiation Transformation Resistance genes Genome-wide shrna suppressor screen 210K shrnas targeting 54K human transcripts, multiple shrnas sequences per gene Identification of genes by microarray hybridization

37 BRD4 Dual role in cancer Tumor promoter: lymphoma, leukemia JQ-1: an inhibitor of BRD4 has antitumor activity - Double bromodomain-containing protein binds preferentially to acetylated histones (Ozato lab, NICHD) - Essential for cellular growth; implicated in cell cycle control, DNA replication, gene bookmarking during mitosis, transcription regulation - Member of several transcription complexes Filippakopoulos et al, Nature 2010 Zuber et al, Nature, 2011 Dawson et al, Nature, 2011 Lockwood, et al., PNAS, 2012 Tumor protector: some solid tumors (breast, colon) Overexpression inhibits xenograft growth and metastatic capacity Crawford et al, PNAS, 2008 Alsarraj et al, Cancer Res, 2011 Rodriguez et al, J Mol Med, 2011

38 BRD4 protects HGPS cells BRD4 from transformation Soft agar assay Xenograft model

39 Loss of BRD4 reactivates cancer BRD4 signatures in HGPS cells Control HGPS HGPS shbrd4 TRANSFORMATION RAS ONCOGENIC SIGNATURE NES=2.05 FDR qval=0.005 NES=2.57 FDR qval<0.001 INFLAMMATION NES=2.34 FDR qval=0.06 NFkB PATHWAY NES=2.01 FDR qval=0.011

40 Activation of a mammary stem BRD4 cell signature upon BRD4 KD Mammary Stem Cell Signature UP (Pece et al, Cell 2010) NES=1.81 FDR qval=0.022 Mammary Stem Cell Signature DOWN (Pece et al, Cell 2010) NES=-1.87 FDR qval=0.017

41 Activation of a mammary stem BRD4 cell signature upon BRD4 KD Mammary Stem Cell Signature UP (Pece et al, Cell 2010) Sphere formation assay NES=1.81 FDR qval=0.022 Mammary Stem Cell Signature DOWN (Pece et al, Cell 2010) NES=-1.87 FDR qval=0.017 TRS-HGPS

42 BRD4 signatures correlate with BRD4 clinical outcome Breast and Lung (BRD4 is protective) BREAST: Van t Veer et al, 2002, 295 samples BREAST: Hatzis et al, 2011, GSE25066, 508 samples TRS-HGPS-like TRS-HGPS-like TRS-HGPS-shBRD4-like TRS-HGPS-shBRD4-like Lymphoma & AML (BRD4 is promoting) LYMPHOMA: Hummel et al, 2006, GSE4475, 221 samples AML: Gaidzik et al, 2011, GSE23312, 269 samples Negative Positive Correlation with BRD4-KD Up signature TRS-HGPS-shBRD4-like TRS-HGPS-like TRS-HGPS-shBRD4-like TRS-HGPS-like

43 BRD4 in oncogenic reprogramming HGPS cells are resistant to oncogenic transformation BRD4 protects HGPS and non-patient cells from oncogenic transformation BRD4 counteracts de-differentiation BRD4 signatures are predictive of patient outcome BRD4 acts as a tumor promoter or a tumor protector in a tissue-specific manner

44 BRD4 protects from oncogenic reprogramming HGPS skin fibroblasts (htert/sv40/ras) Oncogenic Reprogramming Transformed Tumor De-differentiation BRD4 Physical interaction Localization Modifications Chromatin targets Gene expression programs LAMINS PROGERIN Tissue-specific function

45 Progeria a paradigm for modern biomedicine (Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014) Delineated the molecular mechanism of the disease - genetic mutation, RNA processing - protein intermediates - downstream cellular effects - identification of therapeutic targets Disease biology informs about physiological events - lamin modifications and function - stem cell biology in aging - nuclear structure in aging - tumor protection

46 Progeria a paradigm for modern biomedicine (Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014) Biology informs disease understanding (and is essential to therapy development) Diseases teach us about basic biology Increasingly important as disease genes are being identified

47 Sam Berns

48 Acknowledgements Olufunmilayo AGUNLOYE Beck BURGESS Bharat BURMAN Megan DONEGAN Patricia FERNANDEZ Nard KUBBEN Steve MABON Karen MEABURN Erica PORTER Madaiah PUTTARAJU Vassilis ROUKOS Maayan SALTON Sigal SCHACHAR Vivek SHARMA Sara SNYDER Former members Gianluca Pegoraro NCI Paola Scaffidi CRUK

49