ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt
|
|
- Alison Short
- 6 years ago
- Views:
Transcription
1 ggcgcgtcgagatgatcacgacggcatgctagctagccatacgcgtcaatcgtagctagct actctagtacgatgctagctacgtacgtcatgatcgatcgatcgtagctagctagctagctaga gggcgctgctcttcgttgtgcacacttacgtagcatgctagctagctagctgtcagtcagtacga tac Cell Biology of Genomes: catcgtagcattttagccgcggctagctagctagcta ca From aging to cancer resistance aacgtacgtacggtcgtaaagtagatgag cggcattagggcaggatgatttgagtgagagtcgttgaggcgatgggttaaatgcgaagtac acgtgtctgggcgttagggacgatgaggactcgtagctagtcagtacgtcagtacggctagc gctatagctaggctagatattagctatcgtacgtacgtacgggtaggctgctgtgacggtgagg ggctaggggctaggacgtgtggacgtagatcatactgcagtactgctacgtcatgactgcagt gtacgtatccagtcatgactgcatacgtcgtacgactgactgtctatcgtcatgtacgtcatgtc tagtctagctagctagctacgatcgtacgatcgtagctagctagctacgtacgtgcatcatgca The cell biology of genomes: from aging to cancer resistance gtcagcgcgtagatgctagctagctagctagctagctagctacgtagcgcgcgctatattagc atgcattagtcgatgctagctacgtacgtagctacgtacggtcagctacgtacgtcagtcagac The genome as a cellular entity ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt - spatial organization in 3D gatttatatatattagagccggccggcggcgtagctagcattatatgcgtagcaaaacgatgc - temporal re-organization tagtagctagctagcgtatgactgactgcatagcgctacgggcagggcgtcgatcgatcgtag - dynamics atgctagctagctagctgactgactcgatacgcatggtctgatctacgatcgatcgtacgatcg
2 The Cell Biology of Genomes Architectural elements of the nucleus Non-random genome organization Nuclear bodies Dynamics Misteli, Scientific American, 2011
3 Aging
4 Aging
5 Aging is a health burden Aging-associated diseases Cancer Diabetes Cardiovascular disease Hypertension Arthritis Osteoporosis Dementia Health care cost From Finkel, Nat. Rev Societal burden
6 The difficulty of studying human aging Complexity Physiology Environment Disease
7 Human pre-mature aging diseases Disease gene Cellular defect Tumor susceptibility Werner Syndrome WRN RecQ DNA helicase TUMORS Bloom Syndrome BLM RecQ DNA helicase TUMORS Dyskeratosis congenita DKC1 rrna processing telomerase TUMORS Cockayne Syndrome ERCC6/8 DNA repair NO TUMORS Trichothiodystrophy XPD/TFIIH DNA repair Transcription NO TUMORS Hutchinson-Gilford Progeria Syndrome Lamin A/C Nuclear architecture NO TUMORS DISEASES OF THE CELL NUCLEUS
8 Hutchinson-Gilford Progeria Syndrome Jonathan Hutchinson 1886 Hastings Gilford 1897
9 Hutchinson-Gilford Progeria Syndrome Pre-mature aging syndrome 1 in 12 million affected Disease onset months Life expectancy years Growth failure, loss of body fat skin defects, alopecia, joint stiffness, osteoporosis, atherosclerosis, cardiovascular disease, stroke
10 HGPS: Weight and growth 10 Y.O. 4 Y.O. Gordon et al, Pediatrics, 2007
11 HGPS: Cardiovascular defects Vascular morphology MRI 5 year old with carotid obstruction Arterial Wall Echodensity Mapping Control Olive et al, ATVB, 2010 HGPS I M A Kieran et al,. Pediatrics 120(4): , 2007
12 HGPS: A very surprising cause! Lumen Lumen
13 The nuclear lamina Lamina Lamin A, B, C proteins - intermediate filaments - form a protein meshwork - structural elements - interacts with chromatin - provide platform for nuclear functions Misteli, Scientific American, 2011
14 HGPS is a Laminopathy 15 human diseases caused by mutations in LMNA > 400 pathogenic mutations described Q6X Q6X T10I T10I S22L R25P R25G R28W R28W R28W E33D E33D L35V Q36X N39S N39S A43T Y45C R50S R50P R50P E53V A57P L59R L59R R60G R60G R62G I63N I63S E82K L85R R89L R89C L92P K97E R101P E111X G125S R132P R133L R133P R133P R133L L140R L140P S143F S143F S143P E145K T150P E161K L162P R166P K171K L183P E186K R190W R190Q D192G N195K R196S E203K E203G E203V I210S L215P K219T H222P H222Y R225X D230N G232E Q234X Q246X L248P R249W R249Q Y259D Y259X K260N Y267C Y267H Q294P R298C D300N L302P S303P E317K A318T R321X S326T R331P R331E R336Q E347K R349L R349W Q355X D357H E358K M371K R377H R377L L380S E381A R386K L387V R388C R388H Q396R R399C R399C R399H R401C V415I L421P R439C Muscular dystrophies Neuropathies Lipodystrophy Systemic Syndromes (aging, demapathies) R439C V440M* V440M* D446V R453P R453W N456K N456I N456D N459Y G465D I469T R471C R471G R471C R471H Y481H Y481X R482L R482W R482Q K486N T488P Q493X W498C W498R H506D L512P W520S W520G R527P R527H R527C R527C* T528R T528K T528M* T528M* A529V A529T L530P R541C R541S R541H R541K K542N S573L S573L E578V R582H S583L R584H C591F G608S G608G T623S* R624H R644C R644C R644H R654X R654X 5 3 LMNA (lamin A) Dittmer and Misteli, Genome Biology, 2011
15 HGPS is a splicing disease Wild type mutant nt 12 GGC>GGT 500 bp 400 bp 300 bp Lamin A progerin Lamin C Eriksson et al., Nature, 2003 De Sandre-Giovannoli et al., Science, 2003
16 Nuclear defects in HGPS H3 Tri-Me-K9 g-h2ax Structural abnormalities Chromatin/Epigenetic defects Protein degradation/mislocalization DNA damage Scaffidi and Misteli, Nat.Med 2005
17 Protein aggregates at the nuclear periphery progerin Localization Dynamics Mechanical properties WT progerin Scaffidi and Misteli, Nature Med, 2005 Dahl et al., PNAS, 2006
18 Lamina impairment in HGPS patient cells Lamina Lamina protein composition Nuclear defects Aberrant nuclear morphology Elevated DNA damage Epigenetic alternations Loss of protein homeostasis Chromatin disorganization Pegoraro et al, NCB,2009 Kubben, Nucleus, 2011 Genome interactions Kubben, Chromosoma, 2011 McCord et al., Genome Res, 2013
19 Stem cell dysfunction in HGPS Progerin Loss of stem cell properties progenitors Differentiation Defects Regeneration Defects AGING Osorio et al, J. Cell Bio., 2008 Scaffidi & Misteli, Nature Cell Bio., 2008 Espada et al, J. Cell Biol, 2008 Rosengardten et al., Aging Cell, 2011
20 Mode of action of progerin Nuclear periphery Nuclear interior farnesylation farnesylation FTase FTIs Assembly into lamina Fails to properly assemble Scaffidi et al., PLoS Biology, 2005
21 FTIs: a cancer silver bullet
22 From gene to clinical trial in 4 years!
23 Therapeutic targets in HGPS Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014
24 Does HGPS teach us anything about normal aging?
25 Progerin in physiological aging LMNA exon 11 sequence Normal G G T G G G C WEAK splice site Graham G G T A/G A G T CONSENSUS splice site HGPS patient G G T G G G T STRONG splice site RNA Protein progerin Scaffidi and Misteli, Science, 2006
26 Progeria-like defects in cells from healthy old individuals Scaffidi and Misteli, Science, 2006
27 From old make young: Elimination of progerin from old cells restores cellular phenotype GGC>GGT Scaffidi and Misteli, Nat. Med., 2005 Scaffidi and Misteli, Science, 2006
28 HGPS coronary similarities with atherosclerosis classic complex plaque morphology including a necrotic core and foci of chronic inflammation. calcification,evidence of plaque erosion and/or rupture a spectrum of early to late-stage plaques
29 Parallels between premature and normal aging Constitutive expression of HIGH levels of progerin Premature aging Molecules Cellular Organism - Use of splice site - Progerin production SPORADIC expression of LOW levels of progerin - Morphology - Epigenetics - DNA damage - Symptoms - Stem cells - Vascular defects Normal aging
30 g-h2ax High levels of persistent DNA damage in HGPS patients control HGPS Liu et al., Nature Med Scaffidi and Misteli, Nature Med But.NO TUMORS
31 Probing transformation potential of HGPS cells htert (immortalize) H-Ras (proliferation) SV40 T antigens (inhibits checkpoints) Normal primary cell Weinberg lab (1999) Transformed cell Colony formation assay in vitro Tumor formation assay in vivo
32 HGPS cells are resistant to transformation in vitro Soft agar assay for colony formation Proliferation kinetics TRS-WT TRS-HGPS WT-TSR HGPS-TSR p<0.0001
33 HGPS cells are resistant to transformation in vivo Xenograft assays Tumors wt HG Wt 1 7/8 Wt 2 6/10 13/18 HG 1 0/8 HG 2 1/8 1/16 Wt1+ Wt lamin A 4/5 Wt1+ progerin 0/5
34 Transformation resistance is due to progerin Soft agar assay off on off on Xenograft model Lamin A progerin GFP-Lamin A GFP-Progerin
35 Defective oncogenic reprogramming and de-differentiation of HGPS cells Transformation TERT Wt1 Wt2 HG1 HG2 TERT/SV40/HRAS WT1 WT2 HG1 HG2 Transformed HGPS cells fail to activate oncogenic pathways including: - RAS pathway - VEGF pathway - NFkB pathways Transformed HGPS cells fail to repress fibroblast-related pathways: - fibroblast markers - ECM pathways - collagen - skin development
36 An shrna screen to identify tumor resistance factors in HGPS HGPS skin fibroblasts (htert/sv40/ras) Oncogenic Reprogramming De-differentiation Transformation Resistance genes Genome-wide shrna suppressor screen 210K shrnas targeting 54K human transcripts, multiple shrnas sequences per gene Identification of genes by microarray hybridization
37 BRD4 Dual role in cancer Tumor promoter: lymphoma, leukemia JQ-1: an inhibitor of BRD4 has antitumor activity - Double bromodomain-containing protein binds preferentially to acetylated histones (Ozato lab, NICHD) - Essential for cellular growth; implicated in cell cycle control, DNA replication, gene bookmarking during mitosis, transcription regulation - Member of several transcription complexes Filippakopoulos et al, Nature 2010 Zuber et al, Nature, 2011 Dawson et al, Nature, 2011 Lockwood, et al., PNAS, 2012 Tumor protector: some solid tumors (breast, colon) Overexpression inhibits xenograft growth and metastatic capacity Crawford et al, PNAS, 2008 Alsarraj et al, Cancer Res, 2011 Rodriguez et al, J Mol Med, 2011
38 BRD4 protects HGPS cells BRD4 from transformation Soft agar assay Xenograft model
39 Loss of BRD4 reactivates cancer BRD4 signatures in HGPS cells Control HGPS HGPS shbrd4 TRANSFORMATION RAS ONCOGENIC SIGNATURE NES=2.05 FDR qval=0.005 NES=2.57 FDR qval<0.001 INFLAMMATION NES=2.34 FDR qval=0.06 NFkB PATHWAY NES=2.01 FDR qval=0.011
40 Activation of a mammary stem BRD4 cell signature upon BRD4 KD Mammary Stem Cell Signature UP (Pece et al, Cell 2010) NES=1.81 FDR qval=0.022 Mammary Stem Cell Signature DOWN (Pece et al, Cell 2010) NES=-1.87 FDR qval=0.017
41 Activation of a mammary stem BRD4 cell signature upon BRD4 KD Mammary Stem Cell Signature UP (Pece et al, Cell 2010) Sphere formation assay NES=1.81 FDR qval=0.022 Mammary Stem Cell Signature DOWN (Pece et al, Cell 2010) NES=-1.87 FDR qval=0.017 TRS-HGPS
42 BRD4 signatures correlate with BRD4 clinical outcome Breast and Lung (BRD4 is protective) BREAST: Van t Veer et al, 2002, 295 samples BREAST: Hatzis et al, 2011, GSE25066, 508 samples TRS-HGPS-like TRS-HGPS-like TRS-HGPS-shBRD4-like TRS-HGPS-shBRD4-like Lymphoma & AML (BRD4 is promoting) LYMPHOMA: Hummel et al, 2006, GSE4475, 221 samples AML: Gaidzik et al, 2011, GSE23312, 269 samples Negative Positive Correlation with BRD4-KD Up signature TRS-HGPS-shBRD4-like TRS-HGPS-like TRS-HGPS-shBRD4-like TRS-HGPS-like
43 BRD4 in oncogenic reprogramming HGPS cells are resistant to oncogenic transformation BRD4 protects HGPS and non-patient cells from oncogenic transformation BRD4 counteracts de-differentiation BRD4 signatures are predictive of patient outcome BRD4 acts as a tumor promoter or a tumor protector in a tissue-specific manner
44 BRD4 protects from oncogenic reprogramming HGPS skin fibroblasts (htert/sv40/ras) Oncogenic Reprogramming Transformed Tumor De-differentiation BRD4 Physical interaction Localization Modifications Chromatin targets Gene expression programs LAMINS PROGERIN Tissue-specific function
45 Progeria a paradigm for modern biomedicine (Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014) Delineated the molecular mechanism of the disease - genetic mutation, RNA processing - protein intermediates - downstream cellular effects - identification of therapeutic targets Disease biology informs about physiological events - lamin modifications and function - stem cell biology in aging - nuclear structure in aging - tumor protection
46 Progeria a paradigm for modern biomedicine (Gordon, Lopez-Otin, Rothman and Misteli, Cell, 2014) Biology informs disease understanding (and is essential to therapy development) Diseases teach us about basic biology Increasingly important as disease genes are being identified
47 Sam Berns
48 Acknowledgements Olufunmilayo AGUNLOYE Beck BURGESS Bharat BURMAN Megan DONEGAN Patricia FERNANDEZ Nard KUBBEN Steve MABON Karen MEABURN Erica PORTER Madaiah PUTTARAJU Vassilis ROUKOS Maayan SALTON Sigal SCHACHAR Vivek SHARMA Sara SNYDER Former members Gianluca Pegoraro NCI Paola Scaffidi CRUK
49
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech
More informationProgeria. Premature human aging: t he progerias. Progerias as models for aging. Hutchinson-Gilford syndrome. Definition:
Premature human aging: t he progerias Reading: Genetic alterations in accelerated ageing syndromes Do they play a role in natural ageing? Monika Puzianowska- Kuznicka. Jacek Kuznicki. 2005. IJBCB, 37;
More informationSupplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationVirological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Oscar Blanch-Lombarte Rome, 7-9 June, 2017 European
More informationSUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation
SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.
More informationPharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis
Pharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis Federico Goodsaid Vice President Strategic Regulatory Intelligence Vertex Pharmaceuticals Is there
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationReviews. Mechanisms Underlying Caloric Restriction, Lipid Metabolism, and Life Span Regulation Issei Komuro, Guest Editor
Reviews This Review is part of a thematic series on Biological Role of Senescence in Cardiovascular Disease, which includes the following articles: Telomere Biology and Cardiovascular Disease Vascular
More informationClinical Cell Biology Organelles in Health and Disease
Department of Ophthalmology University of Kiel, University Medical Center Director: Prof. Dr. Johann Roider Clinical Cell Biology Organelles in Health and Disease Prof. Dr. Alexa Klettner Clinical cell
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationmodified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
More informationReversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome
Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome Paola Scaffidi & Tom Misteli Hutchinson-Gilford progeria syndrome (HGPS) is a childhood premature
More informationOpen PHACTS Computational Protocols for in silico Target Validation of Cellular Phenotypic Screens: Knowing the Knowns
Open PHACTS Computational Protocols for in silico Target Validation of Cellular Phenotypic Screens: Knowing the Knowns Edgar Jacoby, Jean-Marc Neefs, Herman Van Vlijmen, Daniela Digles, Barbara Zdrazil,
More informationTHURSDAY, JANUARY
THURSDAY, JANUARY 15 2015 08.30-09.00 WELCOME COFFEE 09.00-09.15 Welcome and opening comments. A. De Sandre-Giovannoli, N. Lévy Presentation of the French Network on EDMD and other nucleopathies. G. Bonne,
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
Cystic Fibrosis Transmembrane Page 1 of 11 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Prime Therapeutics
More informationInner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling
4th International Melorheostosis Association Conference Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling Howard J. Worman Columbia University New York, NY The Nuclear Envelope By
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13898 Supplementary Information Table 1 Kras mutation status of carcinogen-induced mouse lung adenomas Tumour Treatment Strain Grade Genotype Kras status (WES)* Kras status (Sanger) 32T1
More informationEiger BioPharmaceuticals Reports on 2018 R&D Day
Eiger BioPharmaceuticals Reports on 2018 R&D Day Late Stage Rare and Ultra-Rare Disease Pipeline Advancing >$100M in Cash Available to Achieve Key Milestones PALO ALTO, Calif., December 11, 2018 Eiger
More informationSeptember 20, Submitted electronically to: Cc: To Whom It May Concern:
History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).
More informationPolyomaviridae. Spring
Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm
More informationDeep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
More informationChapt 15: Molecular Genetics of Cell Cycle and Cancer
Chapt 15: Molecular Genetics of Cell Cycle and Cancer Student Learning Outcomes: Describe the cell cycle: steps taken by a cell to duplicate itself = cell division; Interphase (G1, S and G2), Mitosis.
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationFabry Disease X-linked genetic, multi-organ disorder. Fabry disease screening program in Hypertrophic p Cardiomyopathy: preliminary results.
Fabry Disease X-linked genetic, multi-organ disorder Fabry disease screening program in Hypertrophic p Cardiomyopathy: y preliminary results. Globotriaosylceramide, GL3 Brain -galactosidase A Eyes Lactosylceramide
More informationCPTR title slide. A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance
CPTR title slide A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance PAOLO MIOTTO CPTR 2017 Workshop, March 20 23 The Need A lack of user-friendly
More informationFunctional validation of cancer susceptibility genes using gene editing
Functional validation of cancer susceptibility genes using gene editing 2-22-2017 Sabine Topka Research Fellow Niehaus Center for Inherited Cancer Genomics www.mskcc.org Inherited Predisposition to Cancer
More informationmicrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
More informationSusanne Schnittger. Workflow of molecular investigations in JAK2-negative MPNs - the Munich experience
Susanne Schnittger Workflow of molecular investigations in JAK2negative MPNs the Munich experience Cohort single centre experience to apply new markers in a daily diagnostic work flow total: 20,547 cases
More informationEarly cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
More informationRenata Schipp Medical Biology Department
Renata Schipp Medical Biology Department Deffinition of cell The cell is the smallest structural and functional unit of all known living organisms The cell was discovered by Robert Hooke in 1665 and also
More informationHutchinson-Gilford Progeria Syndrome and its Relevance to Cardiovascular Diseases and Normal Aging
382 Biomed Environ Sci, 2013; 26(5): 382-389 Review Hutchinson-Gilford Progeria Syndrome and its Relevance to Cardiovascular Diseases and Normal Aging QI Ying Chun and XIE Xiao Hua # First Department of
More informationChanging demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
Cystic Fibrosis Transmembrane Page 1 of 13 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Prime Therapeutics
More informations u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationIntroduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
More informationSupplementary Figure 1 Weight and body temperature of ferrets inoculated with
Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
More informationChapter 9. Cells Grow and Reproduce
Chapter 9 Cells Grow and Reproduce DNA Replication DNA polymerase Addition of a nucleotide to the 3 end of a growing strand Use dntps as substrate Release of pyrophosphate Initiation of Replication Replication
More informationImportance of molecular cell biology investigations in human medicine in the story of the Hutchinson-Gilford progeria syndrome
Interdisc Toxicol. 2010; Vol. 3(3): 89 93. doi: 10.2478/v10102-010-0018-y Published online in: www.intertox.sav.sk & www.versita.com/science/medicine/it/ This is an Open Access article distributed under
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationTransformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture:
Transformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture: Spandana Baruah December, 2016 Cancer is defined as: «A disease caused
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationIN the spring of 2007, a 2-year clinical drug trial began at
Journal of Gerontology: BIOLOGICAL SCIENCES 2008, Vol. 63A, No. 8, 777 787 Copyright 2008 by The Gerontological Society of America Meeting Report Highlights of the 2007 Progeria Research Foundation Scientific
More informationVertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients
Vertical Magnetic Separation of Circulating Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Chang Eun Yoo 1,2#, Jong-Myeon Park 3#, Hui-Sung Moon 1,2, Je-Gun Joung 2, Dae-Soon Son
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationp53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs
p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs 2013, Katerina I. Leonova et al. Kolmogorov Mikhail Noncoding DNA Mammalian
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Phenotype Prediction Analyses In order to assess the phylogenetic properties of nssnvs, sequence conservation analysis was conducted using
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationBCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney
BCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney Page 2: Immune Mechanisms & Molecular Biology of Host Defence (Prof Campbell) Page 45: Infection and Implications for Cell
More informationNovel Roles for A-Type Lamins in Maintaining Genomic Stability
Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) 1-1-2012 Novel Roles for A-Type Lamins in Maintaining Genomic Stability Abena Redwood Washington
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationCerebral Small Vessel Disease and HAND in ARV-treated Subjects
Cerebral Small Vessel Disease and HAND in ARV-treated Subjects Cristian L. Achim, MD, PhD Ronald J. Ellis, MD, PhD Virawudh Soontornniyomkij, MD ARROW, Bucharest, Romania October 5-6, 2015 Rationale and
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationPersonalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
More informationTUMOR-SUPPRESSOR GENES. Molecular Oncology Michael Lea
TUMOR-SUPPRESSOR GENES Molecular Oncology 2011 Michael Lea TUMOR-SUPPRESSOR GENES - Lecture Outline 1. Summary of tumor suppressor genes 2. P53 3. Rb 4. BRCA1 and 2 5. APC and DCC 6. PTEN and PPA2 7. LKB1
More informationGenetics contributes to size. Bundschu et al., 2005, JBC Shingleton et al., 2005, PLOS
Matters of size Genetics contributes to size Bundschu et al., 2005, JBC Shingleton et al., 2005, PLOS Advantages to examining growth mechanisms in the zebrafish fin The fin and body are easy to measure
More informationKalydeco. Kalydeco (ivacaftor) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.45.03 Subject: Kalydeco Page: 1 of 6 Last Review Date: November 30, 2018 Kalydeco Description Kalydeco
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationOncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationLAL: significato clinico e biologico delle mutazioni di Bcr-Abl
LAL: significato clinico e biologico delle mutazioni di Bcr-Abl Simona Soverini Dipartimento di Ematologia e Scienze Oncologiche L. e A. Seràgnoli Università di Bologna The vast majority of Ph+ ALL patients
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationPI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:
PI3K Background The phosphatidylinositol 3-kinase (PI3K) pathway is a key cell signaling node whose dysregulation commonly results in the transformation of normal cells into cancer cells. The role of PI3K
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More information9/3/2009 DNA i DNA n euk euk yotes Organizatio Organ izatio n of o f gen ge e n tic Locati t on: In n ucleu e s material mater in e ial
DNA in eukaryotes Organization of genetic material in eukaryotes Location: In nucleus In mitochondria DNA in eukaryotes Nuclear DNA: Long, linear molecules; Chromatin chromosomes; 10% of DNA in genes,
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationHUTCHINSON-GILFORD progeria syndrome (HGPS)
Journal of Gerontology: BIOLOGICAL SCIENCES 2007, Vol. 62A, No. 1, 3 8 Copyright 2007 by The Gerontological Society of America Perspectives Article Progeria of Stem Cells: Stem Cell Exhaustion in Hutchinson-Gilford
More informationA Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB).
A Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB). Wanyuan Ao, Steve Aldous, Evelyn Woodruff, Brian Hicke,
More informationCORRECTIONS. PNAS August 4, 2009 vol. 106 no
MEDICAL SCIENCES Correction for A farnesyltransferase inhibitor prevents both the onset and late progression of cardiovascular disease in a progeria mouse model, by Brian C. Capell, Michelle Olive, Michael
More informationDeveloping Best in Class BET Inhibitors for Oncology & AI: from Discovery to the Clinic. Kevin G. McLure, PhD EpiCongress July 2014
Developing Best in Class BET Inhibitors for Oncology & AI: from Discovery to the Clinic Kevin G. McLure, PhD EpiCongress July 2014 Zenith Epigenetics Overview Formed from Resverlogix as an independent
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationCHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS
134 CHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS The recent past has witnessed a rapid rise in the utilization of computational techniques to aid and accelerate biological
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationThe Complexity of Simple Genetics
The Complexity of Simple Genetics? The ciliopathies: a journey into variable penetrance and expressivity Bardet-Biedl Syndrome Allelism at a single locus is insufficient to explain phenotypic variability
More informationCancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationLE IPERCHILOMICRONEMIE FAMILIARI
LE IPERCHILOMICRONEMIE FAMILIARI Livia Pisciotta Di.M.I.-Università di Genova HYPERCHYLOMICRONEMIA SYNDROME Ø Hypertriglyceridemia (>10 mmol/l, >877 mg/dl) Ø Fasting chylomicronemia Ø Recurrent abdominal
More informationCELL CYCLE REGULATION AND CANCER. Cellular Reproduction II
CELL CYCLE REGULATION AND CANCER Cellular Reproduction II THE CELL CYCLE Interphase G1- gap phase 1- cell grows and develops S- DNA synthesis phase- cell replicates each chromosome G2- gap phase 2- cell
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationTARGETS OF CYCLIN D1-CDK
TARGETS OF CYCLIN D1-CDK FIRST TARGET OF THE COMPLEX CYCLIN D-KINASI: prb, IS THE PRODUCT OF THE GENE CONFERRING SUSCEPTIBILITY TO RETINOBLASTOMA - ABSENT OR MUTATED IN SEVERAL HUMAN CANCERS - TRANSCRIPTIONL
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationInternational Journal of Pharma and Bio Sciences
International Journal of Pharma and Bio Sciences HUTCHINSON-GILFORD SYNDROME (PROGERIA): A REVIEW SACHIN KUMAR 1 *, AMIT KUMAR 2, MOHIT SINGLA 1 AND ABHISHEK SINGH 3 1. K.N.G.D Modi Institute of Pharmaceutical
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationCancer and Gene Regulation
OpenStax-CNX module: m44548 1 Cancer and Gene Regulation OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More information1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
More informationCancer and Tyrosine Kinase Inhibition
Cancer and Tyrosine Kinase Inhibition 1 Motivation (1) In first world countries cancer is the second most common cause of death after cardiovascular diseases. For most tumors, treatment is limited to surgery,
More information