(Press Release) The Results of Radioactive Material Monitoring of the Surface Water Bodies within Ibaraki Prefecture
|
|
- Brett Marshall
- 5 years ago
- Views:
Transcription
1 (P l) h l f dc Ml M f h fc W Bd h Ib Pfc Fd, Dcb 2, 2011 W E D, E M B, M f h E Dc l: chbd: Dc: b Yhd (x. 6610) Dp Dc: F (x. 6614) Cd: H H (x. 6628) I ccdc h h Cph d M Pl dd b h M Cd M, h M f h E (MOE) c dc l (fc bd (, l d hd, d c), c.). pl f h fc bd f Ib Pfc d h pd f A 30-Ocb 8 h b d p f MOE ff dc l; h l h cl b cpld d ld h. h l f Fh Pfc (pb 15-Ocb 14 pl) h ld b ld b O (1) Lc 128 l fc p, c. h fc bd h Ib Pfc (: 93 lc, L d hd: 12 lc, C d bh : 23 lc) (2) Mhd M f cc f dc l (dc d (I-131), dc c (C-134 d C-137)) d d M f cc f dc l d pl d- l h d f d d pl cllc p ( c, c.) 2. Ol f l (1) W Ql dc d (I-131) d dc c (C-134, C-137) dcbl (D) lc (L dc l: 1Bq/L). * l Gd: Ec Ppd f cl Fcl (cl f C) dd f c h I f Fd d D (D W) dc d (I-131): 300Bq/ dc c (l f C C-137): 200Bq/ (2) d dc d (I-131): D lc (L dc l: 30Bq/ (dd d)) dc c () C-134: D-2,600Bq/ (dd d) (L dc l: 10Bq/ (dd d)) C-137: D-3,000Bq/ (dd d) (L dc l: 10Bq/ (dd d)) (L d hd)
2 C-134: D-850Bq/ (dd d) (L dc l: 20Bq/ (dd d)) C-137: Bq/ (dd d) (C d bh ) C-134: D-76Bq/ (dd d) (L dc l: 10Bq/ (dd d)) C-137: 11-97Bq/ (dd d) (L dc l: 10Bq/ (dd d)) (3) d E dc d (I-131): D lc (L dc l: 30Bq/ (d)) dc c () C-134: 53-4,800Bq/ (d) C-137: 61-5,200Bq/ (d) (L d hd) C-134: 22-1,400Bq/ (d) C-137: 22-1,600Bq/ (d) (C d bh ) C-134: D-660Bq/ (d) (L dc l: 10Bq/ (d)) C-137: Bq/ (d) pl d () (L d hd) μ/h μ/h (Ax f dl) (Mp chd) F Pl I cd h l z, MOE d c dc l, d, c., l, c. h fll pfc: Fh, M, Y ( p), Ib, ch, G, d Chb ( p).
3 (Ib Pf.-1): W Ql M l A p Fll dph W p pl dph pc Elccl cdc bd dc d c / /L I-131 C-134 C-137 Ybh Bd bh C 2011/9/ <1 <1 <1 Mbh Bd bh C 2011/9/ <1 <1 <1 Ed Dchbh Bd bh C 2011/9/ <1 <1 <1 bh bh C 2011/9/ <1 <1 <1 Hz Ibh Bd bh C 2011/9/9 Cld, h <1 <1 <1 bh Bd hh C 2011/9/9 Cld <1 <1 <1 bh Bd bh C 2011/9/ <1 <1 <1 h hbh Bd bh C 2011/9/10 Cl <1 <1 <1 W hh C 2011/9/10 Cl <1 <1 <1 Hdbh Bd hh C 2011/9/10 Cl <1 <1 <1 zbh Bd hh C 2011/9/ <1 <1 <1 H hhbh Bd hh C 2011/9/ <1 <1 <1 J j W Hchh C 2011/9/ <1 <1 <1 M Mbh Bd Hchh C 2011/9/ <1 <1 <1 Yz Mbh Bd Dch 2011/9/ <1 <1 <1 Oh Ohbh Bd Dch 2011/9/ <1 <1 <1 bh Bd Dch 2011/9/ <1 <1 <1 j Y Hchh C 2011/9/ <1 <1 <1 A Abh Bd Hchh C 2011/9/ <1 <1 <1 hbh Bd Hchh C/h C 2011/9/ <1 <1 <1 Yd Azbh Bd Hchh C 2011/9/ <1 <1 <1 hchbh Bd Hchh C 2011/9/10 Cl <1 <1 <1 j bh Bd Hchh C/ Vll 2011/9/ <1 <1 <1 M hzbh Bd Hchh C 2011/9/ <1 <1 <1 h h Obh Bd Vll 2011/9/ <1 <1 <1 j H W bd O O Obh Bd Hchh C 2011/9/ <1 <1 <1 ch Hchh C/hch 2011/9/ <1 <1 <1 h Izbh Bd hch 2011/9/ <1 <1 <1 Fj bh Bd Mh C 2011/9/ <1 <1 <1 h Mh C 2011/9/ <1 <1 <1 H pl p P Mcpl pl d Wh d (l h d bch) dc c Mbh Bd Hchh C/h C 2011/9/ <1 <1 <1 W pfc pl, d Hchh C 2011/9/ <1 <1 <1 Ehh Bd Mh C 2011/9/ <1 <1 <1 bh Bd Mh C/Hchh C 2011/9/ <1 <1 <1 Ybh Bd Hchh C 2011/10/ <1 <1 <1 H bh Bd Ibch 2011/10/4 Cl <1 <1 <1 H hh Ibch 2011/10/4 Cl <1 <1 <1 bh Bd Ibch 2011/10/ <1 <1 <1 D Obh Bd Hh C/Och 2011/10/ <1 <1 <1 Ih Ibh Bd Mh C 2011/9/ <1 <1 <1 H Hbh Bd Mh C/Och 2011/10/ <1 <1 <1 H Ahbh Bd Hh C 2011/9/ <1 <1 <1 hbh Bd Hh C 2011/9/10 Cl <1 <1 <1 zbh Bd Hh C 2011/9/ <1 <1 <1 d Uchjhh Bd h C 2011/10/ <1 <1 <1 L Yd hbh Bd h C 2011/10/ <1 <1 <1 bh Bd h C 2011/10/ <1 <1 <1 G JA Yhh h C 2011/10/ <1 <1 <1 hbh Bd hh C 2011/10/ <1 <1 <1 pl p f ld f h h, d f dff p l h, f p d. Gl (Ax)
4 (Ib Pf.-1): d M l A p Fll dph Md p Md pl dph Md c Pp dc d c % I-131 C-134 C-137 Ybh Bd bh C 2011/9/ d < ,100 Mbh Bd bh C 2011/9/ d h l < Ed Dchbh Bd bh C 2011/9/ d h l < bh bh C 2011/9/ d h l < Hz Ibh Bd bh C 2011/9/9 Cld, h d < bh Bd hh C 2011/9/9 Cld d h l <30 1,400 1,700 bh Bd bh C 2011/9/ l h d <30 1,000 1,200 h hbh Bd bh C 2011/9/10 Cl d < W hh C 2011/9/10 Cl d < Hdbh Bd hh C 2011/9/10 Cl d < zbh Bd hh C 2011/9/ d < H hhbh Bd hh C 2011/9/ d < J j W Hchh C 2011/9/ d h l < M Mbh Bd Hchh C 2011/9/ d h l < Yz Mbh Bd Dch 2011/9/ Gl/d h l < Oh Ohbh Bd Dch 2011/9/ d h l < bh Bd Dch 2011/9/ d < j Y Hchh C 2011/9/ l h d < A Abh Bd Hchh C 2011/9/ d h l < hbh Bd Hchh C/h C 2011/9/ Gl h d < Yd Azbh Bd Hchh C 2011/9/ d h l < hchbh Bd Hchh C 2011/9/10 Cl d < j bh Bd Hchh C/ Vll 2011/9/ d h l < M hzbh Bd Hchh C 2011/9/ l h d < h h Obh Bd Vll 2011/9/ d < j H O O Obh Bd Hchh C 2011/9/ d h l < ch Hchh C/hch 2011/9/ d h l < h Izbh Bd hch 2011/9/ d h l < Fj bh Bd Mh C 2011/9/ Gl < h Mh C 2011/9/ l h d <30 2,500 3,000 H pl p W bd P Mcpl pl d Wh dc c Mbh Bd Hchh C/h C 2011/9/ d h l < W pfc pl, d Hchh C 2011/9/ d h l < Ehh Bd Mh C 2011/9/ l < bh Bd Mh C/Hchh C 2011/9/ l h d <30 2,000 2,400 Ybh Bd Hchh C 2011/10/ d h l <30 2,000 2,400 H bh Bd Ibch 2011/10/4 Cl d h l < H hh Ibch 2011/10/4 Cl d h l < bh Bd Ibch 2011/10/ d h l < D Obh Bd Hh C/Och 2011/10/ d h l < Ih Ibh Bd Mh C 2011/9/ d h l < H Hbh Bd Mh C/Och 2011/10/ d h l < H Ahbh Bd Hh C 2011/9/ d < hbh Bd Hh C 2011/9/10 Cl d h l < zbh Bd Hh C 2011/9/ d < d Uchjhh Bd h C 2011/10/ d < L Yd hbh Bd h C 2011/10/ d h l < bh Bd h C 2011/10/ d h l < Gl c f dc l Bq/ (dd G JA Yhh h C 2011/10/ d h l < hbh Bd hh C 2011/10/ Gl/d h l < pl p f ld f h h, d f dff p l h, f p d.
5 j h H W bd (Ib Pf.-1): d E ( c) M l pl p P Mcpl pl d Wh A p Cc f dc l Bq/(d A d Cc f dc l Bq/(dA d Pp dc d dc c μ/h Pp dc d dc c μ/h I-131 C-134 C-137 I-131 C-134 C-137 Ybh Bd bh C 2011/9/ Cl-l < L < Mbh Bd bh C 2011/9/ d < , L < Ed Dchbh Bd bh C 2011/9/ L <30 1,200 1, Cl-l <30 1,400 1, bh bh C 2011/9/ d < d < Hz Ibh Bd bh C 2011/9/9 Cld, h 27.2 L <30 1,000 1, L <30 1,200 1, O bh Bd hh C 2011/9/9 Cld 29.9 d < d < bh Bd bh C 2011/9/ L < L < , h hbh Bd bh C 2011/9/10 Cl 27.1 L < L < W hh C 2011/9/10 Cl 27.0 d < d < Hdbh Bd hh C 2011/9/10 Cl 30.5 d < d < H zbh Bd hh C 2011/9/ d < d < hhbh Bd hh C 2011/9/ d <30 1,600 1, d < J j W Hchh C 2011/9/ Cl-l <30 1,300 1, d < M Mbh Bd Hchh C 2011/9/ d < L < Yz Mbh Bd Dch 2011/9/ L < L < *1 Oh Ohbh Bd Dch 2011/9/ L < L < *1 bh Bd Dch 2011/9/ d < L < *1 j Y Hchh C 2011/9/ L < d < *1 A Abh Bd Hchh C 2011/9/ Cl-l < Cl-l < *1 hbh Bd Hchh C/h C 2011/9/ Cl-l < Cl-l < Yd Azbh Bd Hchh C 2011/9/ Cl-l < Cl-l < *1 hchbh Bd Hchh C 2011/9/10 Cl 31.8 Cl-l < Cl-l < *1 j bh Bd Hchh C/ Vll 2011/9/ Cl-l < L < *1 M hzbh Bd Hchh C 2011/9/ d < L < h Obh Bd Vll 2011/9/ L < L < O Obh Bd Hchh C 2011/9/ Cl-l < Cl-l < ch Hchh C/hch 2011/9/ L < L < h Izbh Bd hch 2011/9/ L < Fj bh Bd Mh C 2011/9/ Cl-l < L < h Mh C 2011/9/ L < Cl-l < H Mbh Bd Hchh C/h C 2011/9/ L < L < W pfc pl, d Hchh C 2011/9/ L < L < Ehh Bd Mh C 2011/9/ d < , L < bh Bd Mh C/Hchh C 2011/9/ L < d < Ybh Bd Hchh C 2011/10/ L < L < H bh Bd Ibch 2011/10/4 Cl 23.2 L < L < H hh Ibch 2011/10/4 Cl 18.7 L < L < bh Bd Ibch 2011/10/ L < L < , D Obh Bd Hh C/Och 2011/10/ L < Ih Ibh Bd Mh C 2011/9/ L <30 1,300 1, L < , H Hbh Bd Mh C/Och 2011/10/ L < L < H Ahbh Bd Hh C 2011/9/ (l xpd) *1 hbh Bd Hh C 2011/9/10 Cl 29.8 Cl-l < Cl-l < *1 zbh Bd Hh C 2011/9/ Cl-l < Cl-l < *1 d Uchjhh Bd h C 2011/10/ d < d < L Yd hbh Bd h C 2011/10/ L < , L < bh Bd h C 2011/10/ L < L < G JA Yhh h C 2011/10/ L < L < hbh Bd hh C 2011/10/ (l xpd) A d d h, C-172 C-161 f Hch-Al Mdcl, Ld. F p h *1 h cl,, Mdl 3 f Ldl M Ic., d f h h *2, Mdl 5000 f Hlh Phc I d. F d h h Mdl 3 Mdl 5000 hd dc b ll hh h h d h C-172 C-161 (b 1.6 hh). pl p f ld f h h, d f dff p l h, f p d. l Lf b h b l
6 L Hch (Ib Pf.-2): W Ql M l W bd P Mcpl A p Fll dph pl d Wh W p pl dph pc Elccl cdc bd dc d dc c c / /L I-131 C-134 C-137 b bhbh Bd Oh C 2011/9/10 Cl <1 <1 <1 bh Bd Ihh C/Oh C 2011/9/ <1 <1 <1 Hbh Bd Ihh C 2011/9/ <1 <1 <1 jh hbh Bd h C 2011/9/10 Cl <1 <1 <1 Hh Hhbh Bd h C 2011/9/ <1 <1 <1 Ich bh Bd h C 2011/9/ <1 <1 <1 bh Bd/l 354 chh C 2011/9/ <1 <1 <1 h hbh Bd chh C 2011/10/ <1 <1 <1 Ebh Bd chh C/bh C 2011/9/ <1 <1 <1 Bz Bzbh Bd chh C 2011/10/3 Cl <1 <1 <1 H hbh Bd chh C 2011/10/ <1 <1 <1 hh Bd Ach 2011/10/3 Cl <1 <1 <1 O Ohhh Bd h C/Ihh C 2011/9/ <1 <1 <1 h hbh Bd Ihh C 2011/9/12 Cld <1 <1 <1 Yh Hchbh Bd Ih C 2011/10/4 Cl <1 <1 <1 M Abh Bd Ih C 2011/10/ <1 <1 <1 hbh Bd Chh C 2011/10/ <1 <1 <1 hbh Bd Mh C 2011/10/7 Cl <1 <1 <1 bh Bd Chh C 2011/10/ <1 <1 <1 Hchb Ihbh Bd Jh C 2011/10/ <1 <1 <1 G hhh Bd Chh C 2011/8/30 Cl <1 <1 <1 D hhhh Bd Chh C 2011/8/ <1 <1 <1 bh Bd Chh C 2011/8/ <1 <1 <1 I Jbh Bd hh C 2011/8/ <1 <1 <1 d Ihbh Bd bh C 2011/10/ <1 <1 <1 Fbh Bd h C/dh C 2011/10/ <1 <1 <1 Y Mbh Bd bh C 2011/10/ <1 <1 <1 h hh Bd bh C 2011/10/6 Cld <1 <1 <1 I Obh Bd bh C 2011/10/ <1 <1 <1 Y Uh L x h C 2011/10/ <1 <1 <1 Mb Ibh Bd h C 2011/9/ <1 <1 <1 I Mzbh Bd h C 2011/10/6 Cld <1 <1 <1 h Chl bbh Bd h C 2011/9/ <1 <1 <1 M Mbh Bd ch 2011/10/ <1 <1 <1 O Odbh Bd h C 2011/10/ <1 <1 <1 d hbbh Bd Bdh C 2011/10/ <1 <1 <1 h Ozbh Bd h C 2011/10/ <1 <1 <1 I Ubh Bd Bdh C 2011/10/6 Cl <1 <1 <1 C f L Jh C/Bdh C 2011/10/7 Cl <1 <1 <1 Hh bh Bd Jh C/Bdh C 2011/10/7 Cl <1 <1 <1 W Mbh Bd h C 2011/9/ <1 <1 <1 pl p hh Bd h C 2011/9/ <1 <1 <1 F ch 2011/9/ <1 <1 <1 Ihh C 2011/9/ <1 <1 <1 pl p f ld f h h, d f dff p l h, f p d. Gl d (l h d bch)
7 L Hch (Ib Pf.-2): d M l A p Fll dph Md p Md pl dph Md c Pp dc d c % I-131 C-134 C-137 b bhbh Bd Oh C 2011/9/10 Cl d h l < bh Bd Ihh C/Oh C 2011/9/ d h l < ,000 Hbh Bd Ihh C 2011/9/ d h l < jh hbh Bd h C 2011/9/10 Cl d h l < Hh Hhbh Bd h C 2011/9/ d h l < Ich bh Bd h C 2011/9/ d h l < ,000 bh Bd/l 354 chh C 2011/9/ d h l <30 1,100 1,200 h hbh Bd chh C 2011/10/ l h d <30 2,600 2,900 Ebh Bd chh C/bh C 2011/9/ d h l < Bz Bzbh Bd chh C 2011/10/3 Cl d h l <30 1,200 1,400 H hbh Bd chh C 2011/10/ d h l < hh Bd Ach 2011/10/3 Cl d < O Ohhh Bd h C/Ihh C 2011/9/ d < h hbh Bd Ihh C 2011/9/12 Cld l h d < Yh Hchbh Bd Ih C 2011/10/4 Cl Gl/l h d < M Abh Bd Ih C 2011/10/ l h d < hbh Bd Chh C 2011/10/ d h l <30 <10 <10 hbh Bd Mh C 2011/10/7 Cl d < bh Bd Chh C 2011/10/ d h l < Hchb Ihbh Bd Jh C 2011/10/ l < G hhh Bd Chh C 2011/8/30 Cl l h d < D hhhh Bd Chh C 2011/8/ d < bh Bd Chh C 2011/8/ l h d < I Jbh Bd hh C 2011/8/ l h d < d Ihbh Bd bh C 2011/10/ l h d < Fbh Bd h C/dh C 2011/10/ Gl/l h d < Y Mbh Bd bh C 2011/10/ d h l < h hh Bd bh C 2011/10/6 Cld d h l < I Obh Bd bh C 2011/10/ d h l < ,000 Y Uh L x h C 2011/10/ d < Mb Ibh Bd h C 2011/9/ d h l < I Mzbh Bd h C 2011/10/6 Cld d < h Chl bbh Bd h C 2011/9/ d h l < M Mbh Bd ch 2011/10/ d h l < O Odbh Bd h C 2011/10/ d h l < d hbbh Bd Bdh C 2011/10/ Gl/d h l < h Ozbh Bd h C 2011/10/ d h l < I Ubh Bd Bdh C 2011/10/6 Cl d h l < C f L Jh C/Bdh C 2011/10/7 Cl d h l <30 <10 <10 Hh bh Bd Jh C/Bdh C 2011/10/7 Cl d h l < W Mbh Bd h C 2011/9/ l h d < pl p W bd P Mcpl pl d Wh Gl Cc f dc l Bq/ (dd d) dc c hh Bd h C 2011/9/ l h d < F ch 2011/9/ l h d < Ihh C 2011/9/ d < pl p f ld f h h, d f dff p l h, f p d.
8 L Hch W bd (Ib Pf.-2): d E ( c) M l A p Cc f dc l Bq/(d A d Cc f dc l Bq/(d A d Pp dc d dc c μ/h Pp dc d dc c μ/h I-131 C-134 C-137 I-131 C-134 C-137 b bhbh Bd Oh C 2011/9/10 Cl 28.5 L < L < bh Bd Ihh C/Oh C 2011/9/ L < L < Hbh Bd Ihh C 2011/9/ L < L < jh hbh Bd h C 2011/9/10 Cl 29.9 L <30 3,100 3, L < Hh Hhbh Bd h C 2011/9/ L <30 4,800 5, L <30 3,200 3, Ich bh Bd h C 2011/9/ L < L < bh Bd/l 354 chh C 2011/9/ L < L < h hbh Bd chh C 2011/10/ d <30 1,200 1, d < Ebh Bd chh C/bh C 2011/9/ L < L < Bz Bzbh Bd chh C 2011/10/3 Cl 20.4 L <30 1,100 1, L < H hbh Bd chh C 2011/10/ L < , L < hh Bd Ach 2011/10/3 Cl 22.6 L < L < O Ohhh Bd h C/Ihh C 2011/9/ L < L < h hbh Bd Ihh C 2011/9/12 Cld 31.4 L <30 1,100 1, L < Yh Hchbh Bd Ih C 2011/10/4 Cl 19.4 L < L < M Abh Bd Ih C 2011/10/ (l xpd) hbh Bd Chh C 2011/10/ L < L < *2 hbh Bd Mh C 2011/10/7 Cl 22.6 L < d < , bh Bd Chh C 2011/10/ L < L < *2 Hchb Ihbh Bd Jh C 2011/10/ L < L < G hhh Bd Chh C 2011/8/30 Cl 26.6 L < Cl-l < D hhhh Bd Chh C 2011/8/ L < L < bh Bd Chh C 2011/8/ L < L < I Jbh Bd hh C 2011/8/ L < L < d Ihbh Bd bh C 2011/10/ Cl-l < Cl-l < Fbh Bd h C/dh C 2011/10/ L < , Cl-l < Y Mbh Bd bh C 2011/10/ L <30 1,600 1, Cl-l <30 1,100 1, h hh Bd bh C 2011/10/6 Cld 18.8 Cl-l < Cl-l <30 1,100 1, I Obh Bd bh C 2011/10/ Cl-l <30 1,200 1, Cl-l <30 2,000 2, Y Uh L x h C 2011/10/ Cl-l < L < Mb Ibh Bd h C 2011/9/ Cl-l < Cl-l < I Mzbh Bd h C 2011/10/6 Cld 20.3 L < L < h Chl bbh Bd h C 2011/9/ Cl-l < Cl-l < M Mbh Bd ch 2011/10/ L < L < O Odbh Bd h C 2011/10/ Cl-l < Cl-l < *2 d hbbh Bd Bdh C 2011/10/ L < L < h Ozbh Bd h C 2011/10/ L < L < *2 I Ubh Bd Bdh C 2011/10/6 Cl 24.6 L < L < C f L Jh C/Bdh C 2011/10/7 Cl 24.2 L < L < Hh bh Bd Jh C/Bdh C 2011/10/7 Cl 21.8 L < L < W Mbh Bd h C 2011/9/ Cl-l < Cl-l < pl p P Mcpl pl d Wh hh Bd h C 2011/9/ Cl-l < Cl-l < F ch 2011/9/ L < Cl-l < Ihh C 2011/9/ L < L < A d d h, C-172 C-161 f Hch-Al Mdcl, Ld. F p h *1 h cl,, Mdl 3 f Ldl M Ic., d f h h *2, Mdl 5000 f Hlh Phc I d. F d h h Mdl 3 Mdl 5000 hd dc b ll hh h h d h C-172 C-161 (b 1.6 hh). pl p f ld f h h, d f dff p l h, f p d. l Lf b l h b
9 L d Hd, d C d Bh A: W Ql M l H 1 f h b M H L 1 f h b Oz 1 f h b Offh f 1 f h b Offh f 1 f h b L C f h l 1 f h b Offh f A 1 f h b Offh f 1 f h b L Jbh Bd 1 f h b L 1 f h b Hch I 1 f h b C f Uh L Uh L 1 f h b Offh f E 1 f h b Offh f O E 1 f h b l/hb f Jb, Offh f h 1 f h b Offh f E 1 f h b H /hb f Jb, Offh f H 1 f h b hb f Jb, Offh f j P 1 f h b Offh f M E 1 f h b Iz /hb f Jb, Offh f Iz 1 f h b Offh f M /j E 1 f h b hb f -, Offh f 1 f h b hb f -, Offh f 1 f h b Offh f E 1 f h b B h W bd pl p P Mcpl pl d Wh A p Fll dph Gl Cc f dc l Bq/L W p pl dph cch d dph Elccl cdc bd dc d dc c / /L I-131 C-134 C /9/ <1 <1 < <1 <1 <1 2011/9/ <1 <1 < <1 <1 <1 2011/9/ <1 <1 < <1 <1 <1 2011/9/12 Cl <1 <1 < <1 <1 <1 2011/9/ <1 <1 < <1 <1 <1 2011/9/12 Cl <1 <1 < <1 <1 <1 2011/9/ <1 <1 < <1 <1 <1 2011/9/13 Cl <1 <1 < <1 <1 <1 2011/9/13 Cl <1 <1 < <1 <1 <1 2011/9/ <1 <1 < <1 <1 <1 2011/9/13 Cl <1 <1 < <1 <1 <1 2011/10/5 Cld <1 <1 < <1 <1 <1 2011/10/3 Cl <1 <1 < <1 <1 <1 2011/10/3 Cl <1 0.7 <1 <1 < <1 1.3 <1 <1 <1 2011/10/3 Cl <1 0.3 <1 <1 < <1 0.6 <1 <1 <1 2011/10/3 Cl <1 0.7 <1 <1 < <1 0.3 <1 <1 <1 2011/10/3 Cl <1 <1 < <1 <1 <1 2011/10/ <1 <1 < <1 <1 <1 2011/10/ <1 <1 < <1 <1 <1 2011/10/ <1 <1 < <1 <1 <1 2011/10/4 Cl <1 <1 < <1 <1 <1 2011/10/3 Cl <1 <1 < <1 <1 <1 2011/10/4 Cl <1 <1 < <1 <1 <1 2011/10/6 Cld <1 <1 < <1 <1 <1 Ihfh bh C 2011/9/ <1 <1 <1 h hh C 2011/9/ <1 <1 <1 hb f Jb j Hchh C 2011/9/10 Cl <1 <1 <1 O Hchh C 2011/9/ <1 <1 <1 jh Bch Hchh C 2011/9/ <1 <1 <1 Aj Hchh C 2011/10/ <1 <1 <1 Ubf M Pl Hchh C 2011/10/ <1 <1 <1 hb bd f - O Och 2011/10/ <1 <1 <1 Oh Hh C 2011/9/ <1 <1 <1 hd H hh C 2011/10/ <1 <1 <1 Hz h C 2011/10/ <1 <1 <1 pl p ld f h h. F, f h lccl cdc cl d "l".
10 L d Hd, d C d Bh A: d d d E (L h d Bch) M l W bd H L Oz Offh f Offh f L C f h l L H M Offh f A L Hch I Uh L B h Offh f Jbh Bd C f Uh L Offh f E Offh f O E l/hb f Jb, Offh f h Offh f E H /hb f Jb, Offh f H hb f Jb, Offh f j P Offh f M E hb f -, Offh f hb f -, Offh f Offh f E hb f Jb hb bd f - hd pl p P Iz /hb f Jb, Offh f Iz Offh f M /j E l Gl Cc f dc l Bq/ (dd d) A p Fll dph Cc f dc l Bq/(d A d Md p Md pl dph Md c Pp dc d dc c Pp dc d dc c μ/h c % I-131 C-134 C-137 I-131 C-134 C /9/ l < d < /9/ l <30 <20 37 d < /9/ l < /9/12 Cl l < d < /9/ d < d < /9/12 Cl l < /9/ d < d < /9/13 Cl l <30 <40 90 d < /9/13 Cl d h l < d < /9/ d h l < L < /9/13 Cl d < L < /10/5 Cld l < Cl-l <30 1,400 1, /10/3 Cl d < /10/3 Cl d < /10/3 Cl d <30 < /10/3 Cl d < /10/3 Cl d < /10/ d < /10/ d < /10/ d < /10/4 Cl d h l < /10/3 Cl d < /10/4 Cl d <30 < /10/6 Cld d <30 < IhFh bh C 2011/9/ d h l < d < h hh C 2011/9/ d < d < j Hchh C 2011/9/10 Cl d < d < O Hchh C 2011/9/ d <30 <10 11 d < jh Bch Hchh C 2011/9/ d <30 <10 15 d < Aj Hchh C 2011/10/ d <30 <10 <10 d < Ubf M Pl Hchh C 2011/10/ d < d <30 < O Och 2011/10/ d h l <30 <10 21 d < Oh Hh C 2011/9/ d < d < * H hh C 2011/10/ d < d < Hz h C 2011/10/ d < d < A d d h, C-172 C-161 f Hch-Al Mdcl, Ld. F p h * h cl,, Mdl 3 f Ldl M Ic., d. F d h h Mdl 3 hd dc b ll hh h h d h C- 172 C-161 (b 1.6 hh). pl p ld f h h. Mcpl pl d Wh d d (l h d bch)
11 bh Mbh Bd Dchbh bh Bd hh C Bd Ihfh bh C Mbh Bd Dch bh Bd Ibh Ohbh Bd Bd bh zbh Hdbh hbh Bd Bd Bd Bd hhbh h Bd j W j Y j Hchh C Hchh C hbh Bd Ib Pfc Obh Bd Ubf M Pl h Ihh C Hbh Bd O bh Bd bh hh Oz Bd M Ibch Obh Bd C h b Hh C Oh Bd bhbh Ahbh Bd Bd h Bd Eb h h C hbh b Hhbh h bh C Bd Bd Bd zbh Bd Offh f bh Bd/ bh ch Bd hbh l 354 h C Bd h C Bdh hh C hbh Bd Ihbh bh Bd C Bd JA Yhh Mbh hh Bd Mh Offh f bh Vll C f Bd hh Bd Ach Bd h l Offh hbh f A I Ihbh Obh H Bd hbh hbh Bd Bd Uhh h Ihh Jbh Bd Mh Bd C C Abh C Bd C Bd Fbh Uh L x Bd h dh C C ch I ch ch Jbh Bd Jh C Ozb C h B bbh Od d Bd Bd bh hh Bd ch Gch bh Bd jh Bch Vll h C W pfc pl, d A Ehh Hchh C bh Bd Mh C Bd Ybh Bd O h Ychch Mbh Bd C Abh Bd Azbh Bd bh Bd h h h C b h hhh Bd Bd bh Bd Chh hhhh Bd h C h Y h C h C Izbh Bd O Hchh C Obh Bd ch hch Mbh Bd Mbh Bd C h F Hz
(News Release) The Results of Radioactive Material Monitoring of the Surface Water Bodies within Tochigi Prefecture (2 nd Time)
(Nw l) Th ul of doc Ml Moog of h Sufc W Bod wh Tochg Pfcu (2 d T) Fdy, Mch 30, 2012 W Eo Do, Eo Mg Buu, My of h Eo Dc l: 03-5521-8316 Swchbod: 03-3581-3351 Dco: Nobuo Yohd (x. 6610) Dpuy Dco: Tuo Fuu (x.
More informationOur next questions are about Contingency Management.
II.B.04.01 01 Our next questions are about Contingenc t. Higgins and Petr (1999) describe Contingenc t as the sstematic reinforcement of desired behaviors and the withholding of reinforcement or punishment
More informationIPC REVISION WORKING GROUP. Ninth Session Geneva, June 2 to 13, 2003
E IPC/WG/9/3 ORIGINAL: English only DATE: May 23, 2003 WORLD INTELLECTUAL PROPERTY ORGANIZATION GENEVA SPECIAL UNION FOR THE INTERNATIONAL PATENT CLASSIFICATION (IPC UNION) IPC REVISION WORKING GROUP Ninth
More informationOur next questions are about Multisystemic Therapy.
II.B.10.01 01 Our next questions are about Multisys Therapy. The National Registry of Evidene-Based Praties and Programs (NREPP) desribes Multisys Therapy as follows: Multisys Therapy () for juvenile offenders
More informationAllenylphosphine oxides as simple scaffolds for. phosphinoylindoles and phosphinoylisocoumarins
Supporting Information for Allenylphosphine oxides as simple scaffolds for phosphinoylindoles and phosphinoylisocoumarins G. Gangadhararao, Ramesh Kotikalapudi, M. Nagarjuna Reddy and K. C. Kumara Swamy*
More informationSpherical Bearings Heavy Duty Equipments
Spherical Bearings Heavy Duty Equipments Highlights Quality Service Price Wbf Replacement Parts adaptableto > Caterpillar >Komatsu >Volvo 1 WBF SPHERICAL BEARINGS adaptable to Caterpillar Part No. Description
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Chemical constituents from Agrimonia pilosa Ledeb. and their chemotaxonomic significance Wei-jie Liu, Xue-qian Hou, Hao Chen, Jing-yu Liang*, Jian-bo Sun** Department of Natural
More informationChapter 5: Quantization of Radiation in Cavity and Free Space. Classical Electrodynamics: Maxwell s Equations
C 47 Sg 9 Fh Cll vy Ch 5: Quz f Cvy F S I h lu yu wll l: Cll lg Quz f Cvy Quz f F S Fl Cu l Ph Nu S Ph Mu Ph S C 47 Sg 9 Fh Cll vy Cll ly: Mxwll u 4 J Mxwll u: Cvy J u: wh C 47 Sg 9 Fh Cll vy Sl Pl S:
More informationrdd Doc 643 Filed 04/02/14 Entered 04/02/14 18:32:35 Main Document Pg 1 of 13 UNITED STATES BANKRUPTCY COURT SOUTHERN DISTRICT OF NEW YORK
Pg 1 of 13 UNITED STATES BANKRUPTCY COURT SOUTHERN DISTRICT OF NEW YORK ) In re: ) Chapter 11 ) SOUND SHORE MEDICAL CENTER, OF ) Case No. 13-22840 (RDD) WESTCHESTER, et al. 1 Debtors. ) ) (Jointly Administered)
More informationDeclaration of conformity Adapter
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA Document ID: 34466 Editing status: 2017-05-19 2 CFR FDA stands for Food and Drug Administration, a U.S. authority.
More informationDeclaration of conformity VEGABAR 82
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA and USP Class VI as well as ADI-free Document ID: 47480 Editing status: 2018-09-11 2 CFR FDA stands for Food
More information! "##$ %&' "89 %": F,G %D: F,G %D: -! "# $ #"2, 0 .L FS "J 78! F9# +I l=- ^8# +A LF : F X!F +, +A E +! E H #; E l=- ]B # E [: > L
-! "# $ 12-7 012 (1388 +,- (65 (19 % 1388/3/23 : 1387/3/9 : F,G %D: F,G %D: (Original Article)! "##$ %&' 4 3 4 56 0 2 #"2, 0 1.$ "*+/$ 0 () *+ ", (78! "# $ ( ( 9 (.1.78! "# $ (:;
More informationSUPPORTING INFORMATION for. Identification of key structural characteristics of Schisandra chinensis lignans
SUPPORTING INFORMATION for Identification of key structural characteristics of Schisandra chinensis lignans involved in P-Glycoprotein inhibition Jiří Slanina #, Gabriela Páchniková #, Martina Čarnecká,
More informationAppendix A: International Classification of Diseases, 10th Revision, Clinical Modification Codes (ICD-10) Utilized for VTE Events
Online Appendices to Mahan et al. External validation of a risk assessment model for venous thromboembolism in the hospitalised acutely-ill medical patient (VTE-VALOURR) (Thromb Haemost 2014; 112.4) Appendix
More informationAspects of Hypoglycemia
Aspects of Hypoglycemia Erik T. Paterson 1 M.D. Abstract To two groups of patients the standard six hour oral glucose tolerance test was administered. Over 80 percent of both groups had abnormal responses
More informationMolecular and Cellular Tumor Pathology Laboratory, Cancer Center Karolinska,
Antiproliferative Effects of 1α-OH-vitD 3 in Malignant Melanoma. Potential Therapeutic implications Lucia Spath 1,+, Alessandra Ulivieri 1,4+, Luca Lavra 1,4, Laura Fidanza 2, Marta Carlesimo 2, Maria
More informationIncorporating HDL interaction in an ODE model of Atherosclerosis
Incorporating HDL interaction in an ODE model of Atherosclerosis Diego Lopez Texas A&M University July 29, 2015 Diego Lopez (TAMU) July 29, 2015 1 / 10 Introduction Atherosclerosis A disease of the arteries
More information!"#$"%&'#$&()*'#&+",)%-./&-#&.%'#+-.-0#'1&+.'."+&'#$&+0,-".-"+&
!#$%'#$()*'#+,)%-./-#.%'#+-.-0#'1+.'.+'#$+0,-.-+ 23456774378#$%'%()*%%+,-#+.//012%3454/4%*1-,*064//0*+78431-4*91-008+54/4%*1- #2*4130*+742/342:34*%320%8;434*+4*/23$?82(%@43-93234/+,-#+.//2/3%354/4%*1-,*064//0*+78431-4*91-008+54/4%*1-#2*4130*+
More information3413DI DUCTILE IRON SADDLE WITH BALES
SERVICE SADDLES - FITTING SOLUTIONS FOR HARSH ENVIRONMENTS BODY CASTING: Ductile Iron per ASTM A536. BALES: Carbon Steel per AISI 1080, with electro-galvanized di-chromate finish for added corrosion resistance.
More informationPrevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran
Audiol. 2012;21(2):66-70. Research Article Prevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran Shahrooz Nemati, Gholam Ali Afrooz, Ali Asgari,
More informationStandards. n Built in accordance with NEMA, ANSI, UL and CSA standards
Drive Isolation 4 3 to 990 kva Applications n For industrial and commercial applications with SCR-controlled adjustable speed motor drives, and AC adjustable frequency or DC drives Specifications n NEMA1
More informationPreparation of Stable Aziridinium Ions and Their Ring Openings
Supplementary Information Preparation of Stable Aziridinium Ions and Their Ring Openings Yongeun Kim a Hyun-Joon Ha*, a Sae Young Yun b and Won Koo Lee,*,b a Department of Chemistry and Protein Research
More informationSynthesis and Cosmetic Whitening EŠect of Glycosides Derived from Several Phenylpropanoids
YAKUGAKU ZASSHI 126(3) 173 177 (2006) 2006 The Pharmaceutical Society of Japan 173 Synthesis and Cosmetic Whitening EŠect of Glycosides Derived from Several Phenylpropanoids Shinichi TANIMOTO, Hitoshi
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Synthesis and Preliminary Pharmacological Evaluation of Aryl Dithiolethiones with Cyclooxygenase-2 Selective Inhibitory Activity and Hydrogen-Sulfide-Releasing Properties Shannon
More informationTechnical Parameters. 10-9:9-11:7-12:12-8 & 15-16:16-14:1-13:13-2 Turn Ratios(Choke) 1:1:1:1±1% 7-5:8-4:1-3:2-6
This specification sheet is to be supplied together with the samples to customers. Customers test the samples and assess the test results to determine whether these samples meet the technical requirements.
More informationRLB Series Radial Inductors
*RoHS *RoHS *RoHS OMPLINT OMPLINT OMPLINT eatures our types available High rated current for high current circuits vailable in 12 series RoHS compliant* pplications Power supplies D/D converters General
More informationRapid Detection of Walnut oil by FTIR and Bioactivities of Walnut Protein Hydrolysates
Rapid Detection of Walnut oil by FTIR and Bioactivities of Walnut Protein Hydrolysates Jie Ouyang Espoo Finland, Nov 12, 2013 Walnut distribution in China and the World: Area (Acre) Production (Ton) World
More informationProduct Information Packet ZDFRPM21254C 25HP, 1750RPM,3PH,60HZ,2162C,TEFC,FOOT
Product Information Packet ZFPMC HP, 7PM,PH,HZ,C,FC,FOO Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product
More informationQUALITY INDICATORS FOR RESIDENTIAL CARE FACILITIES Maine Bureau of Medical Services
1.) Prevalence of Bladder Incontinence (High Degree of Incontinence) Previous QI103 2.) Prevalence of Bladder Incontinence (Low Degree of Incontinence) Previous QI104 3.) Prevalence of Bowel Incontinence
More informationRated 10 out of 10 by B.F What do you like about our services? the workout is always different
Testimonials: Rated 10 out of 10 by F.C. I trained with Deana for over a year. I loved how positive, upbeat, and strong she was. I learned so much and I ve never been healthier! Due to a new work schedule
More informationSanitation and health in Delhi Slums
Sanitation and health in Delhi Slums Jeff Hammer Princeton University IGC conference, Lahore, Pakistan March 19, 2014 Conclusions If water enters your home from the street during the year, people in your
More informationH3K 4 HK 7 DS 11 DS 15. Each badge card comes with a round pin badge
page of hildrens ge adge s hildrens ge adge ss ello itty - age s badge hildrens ge adge s hildrens ge adge ello itty ello itty ello itty itty ello LL - L F F - LL - L - L LL F - - L F L L - L F F - L F
More informationSupporting Information for. Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of. 3,5-Disubstituted Pyridines: Mechanistic Studies
Supporting Information for Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of 3,5-Disubstituted Pyridines: Mechanistic Studies Ta-Hsien Chuang* a, Yu-Chi Chen b and Someshwar Pola
More informationGROWTH PERFORMANCE OF THREE-BREED CROSSES OF HOLSTEIN FRIESIAN, BROWN SWISS AND HARIANA CATTLE *
Indian J. Anim. Res., 41 (4) : 244-249, 2007 GROWTH PERFORMANCE OF THREE-BREED CROSSES OF HOLSTEIN FRIESIAN, BROWN SWISS AND HARIANA CATTLE * S. Bindu Madhuri, C.L. Suman and H.S. Pandey Livestock Production
More informationEur. J. Org. Chem WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007 ISSN X SUPPORTING INFORMATION
Eur. J. Org. Chem. 2007 WILEY-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 ISSN 1434 193X SUPPORTING INFORMATION Title: Effect of Varying the Anionic Component of a Copper(I) Catalyst on Homologation
More informationThe Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents. by Bob Deck
The Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents by Bob Deck The purpose of this retrospective study was to evaluate the effects of hydrophilic contact
More informationN -Acetylneuraminic Acid 1, 39 * * * N -Acetylneuraminic Acid Methyl Ester. N -Acetylserotonin 48 * Chemical Name Structural Formula Page.
Chemical ame Structural Formula Page. Cation-Exchange DS- CX0 DS- CX5 DS- CX0 Anion-Exchange DS- AX0 DS- AX0 DS- SAX Super Acetic Acid * -Acetyl-,-didehydro-- deoxyneuraminic Acid 9 * -Acetylneuraminic
More information1 h JUMl '< OUEDIREICTORATE" Technical Service No J.R. Gormly May 1991 Dallas Research Laboratory
1 h JUMl '< OUEDIREICTORATE" GEOCHEMICAL EVALUATION OF OIL ISOLATED FROM WELL 6407/6-4, MIKKEL STRUCTURE, MID-NORWAY Technical Service No. 509-8277 J.R. Gormly May 1991 Dallas Research Laboratory ls3 TECHNICAL
More information5%!H%kB'% Bl:%?Bh]L!?! '% &' V;( (Gastrointestinal Stromal Tumor = GIST) -"%%% -%%%?%%% %%%!D%%% %.H&N9E9F4('wQ,!B5?
9* '(#'"#&%"#$ $ * "# )% % &'(% $"# %1-% % &'(%% % 0$/-. *+, 589:2-5 16-7) 34 2 -C'%? % %?)% 6%?@-'% AB ;< 1=>1 %F4(%I-.H2 C6 ) DE9F4(G'?- ) @,G 2 - G'?- 8 0 -JA-K5' B,L C )
More informationIFANCA HALAL PRODUCT CERTIFICATE
October 30, 2017 Page 1 of 5 Manufactured at: Gradings: E, S, FL, C, MB, CL, TL, PL, DL,PF,PP,PLUS, LT, EDK, MR, FG Ionic Forms: Na, H, K, Ca 1. Purolite C100 2. Purolite C100X10 3. Purolite C120 4. Purolite
More informationNCHA Financial Feature
NCHA Financial Feature November 2, 2018 CMS Finalizes Calendar Year 2019 Payments and 2020 Policy Changes for Home Health Agencies and Home Infusion Therapy Suppliers The Centers for Medicare and Medicaid
More informationNEWS & VIEWS. Hole in the diet-heart hypothesis?
NEWS & VIEWS Hole in the diet-heart hypothesis? Philip C. Calder Faculty of Medicine, University of Southampton, MP887 Southampton General Hospital, Tremona Road, Southampton SO16 6YD, United Kingdom and
More information1,2,3,4,5,6,7,8,9,10,12,14,15,19,20, 27,34,46+Vi. 1,2,3,4,5,6,7,8,9,10,12,14,15,19,20, 27,34,46+Vi
SALMONELLA ANTISERA OUR COMPREHENSIVE PRODUCT RANGE SALMONELLA POLY O, POLY H AND Vi ANTISERA FOR SEROLOGICAL CONFORMATION BY SLIDE AGGLUTINATION Product Reacts with: Number of tests Packing 40211 Poly
More informationThe Czech National Health Care Information System (NH-IS) and its strategy in building population-based reporting
The Czech National Health Care Information System (NH-IS) and its strategy in building population-based reporting Evropská unie Evropský sociální fond Operační program Zaměstnanost Regional reporting of
More informationTeacher s Tools Chemistry Organic Chemistry: Nomenclature and Isomerism
1. Hydrocarbons: a) Naming of hydrocarbons is done based on the number of carbons. 1 = meth 6 = hex 2 = eth 7 = hept 3 = prop 8 = oct 4 = but 9 = non 5 = pent 10 = dec b) Alkanes are hydrocarbons without
More informationLinking Contemporary High Resolution Magnetic Resonance Imaging to the Von Economo
Supplementary Materials of Title Linking Contemporary High Resolution Magnetic Resonance Imaging to the Von Economo legacy: A study on the comparison of MRI cortical thickness and histological measurements
More informationKey words: surgical stress, immunological parameter, gastric cancer, immunotherapy
Key words: surgical stress, immunological parameter, gastric cancer, immunotherapy Table 2 Immunochemotherapy regimen UFT Fig. 2 Changes in the periferal blood after gastrectomy in patients without IgG-FcR
More informationIFANCA HALAL PRODUCT CERTIFICATE
October 30, 2017 Page 1 of 5 Manufactured at: Purolite (China) Company Ltd. Gradings: E, S, FL, C, MB, CL, TL, PL, DL,PF,PP,PLUS, LT, EDK, MR, FG Ionic Forms: Na, H, K, Ca 1. Purolite C100 2. Purolite
More informationIFANCA HALAL PRODUCT CERTIFICATE
July 19, 2017 Page 1 of 5 Gradings: E, S, FL, C, MB, CL, TL, PL, DL,PF,PP,PLUS, LT, EDK, MR, FG Ionic Forms: Na, H, K, Ca 1. Purolite C100 2. Purolite C100X10 3. Purolite C120 4. Purolite C145 5. Purolite
More informationAudiological Assessment In Neonates And Children Suffering From Meningitis
Audiological Assessment In Neonates And Children Suffering From Meningitis ** '( $! $&! " #$%! Leila Faraji * -Abdollah Moussavi ** - Mahdi Akbari** - Omid Khojasteh*** EOAE, ABR!" # $ %& ' :)$* 92>=9
More informationSNUBBER CAPACITOR WITH AXIAL LEADS
Tan δ x 5 4 3 2 TEMPERATURE V/S DISSIPATION FACTOR 5 55 C 25 C +25 C +55 C Temperature +75 C + C ΔC FREQUENCY V/S % CHANGE IN CAPACITANCE C %.5 Highlights, Lw lss plyprpylene dielectric, High frequency
More informationALLTRADE FORKLIFT PARTS PTE LTD
ATTENTION PAGE : 1 (HALLA) FAC0300060 FAC0300080 FAC0311070 FAC0311240 FAD0300600 OK675-15-010 OK675-15-082 OS211-15-173 OS213-15-172 QK0905-15 (HANGCA) 053022 053023 198911A 36010-L9000-G00 40DH-512000
More informationChapter 4. 4 Results. 4.1 Crude extracts Extraction of plants
Chapter 4 4 Results 4.1 Crude extracts 4.1.1 Extraction of plants Hexane extracted the lowest mass of material from the leaves of the ten Ficus species, while the highest mass was obtained with acetone
More informationPitfalls in the premarital testing for thalassaemia
Pitfalls in the premarital testing for thalassaemia Dr. Riad Amer MB ChB, MSc, FRCP, FRCPath, JBH Assistant Professor of Medicine Al Najah University Consultant Haematologist Case 1 Husband and Wife are
More informationITEMS OF WORK LEGEND CONTRACT TIME CALENDAR DAYS III III G TAXILANE VICTOR RECONSTRUCTION ADDISON AIRPORT (ADS) REGISTRATION NO.
IMS OF WOK DSCIPIO PS I PS LIMIS COSUC MPOY ASPL PAVM SCIO A H A12 HG C. ISLL MPOY PAVM MKIS. V3 HG MOV XISI XIL CLI MKIS O H A12 APO. MOV XISI PAVM WIHI H PS III WOK A.COSUC POPOSD IMPOVMS WIHI H PS III
More informationSupporting Information
Supporting Information Wiley-VCH 2010 69451 Weinheim, Germany Direct, One-pot Sequential Reductive Alkylation of Lactams/Amides with Grignard and Organolithium Reagents through Lactam/Amide Activation**
More informationScoliosis Corrective Surgery Impact on Health Related Quality of Life
Scoliosis Corrective Surgery Impact on Health Related Quality of Life Boissiere L, Takemoto M, Cawley DT, Kieser D, Bourghli A, Yilgor C, Alanay A, Acaroglu E, Perez Grueso FJ, Pelisse F, Kleinstück F,
More informationSI APPENDIX. for Polyunsaturated fatty acid saturation by gut lactic acid bacteria affecting host lipid composition
SI APPENDIX for Polyunsaturated fatty acid saturation by gut lactic acid bacteria affecting host lipid composition Shigenobu Kishino, Michiki Takeuchi, Si-Bum Park, Akiko Hirata, Nahoko Kitamura, Jun Kunisawa,
More informationMolybdate activated peroxide delignification. Molybdate. Delignified Pulp. Pulp. Peroxomolybdate. Mo OH H 2 O. Mo O
Molybdate activated peroxide delignification Delignified Pulp Pulp Peroxomolybdate Mo H Molybdate Mo H H 2 2 H 2 Reactions of molybdate-activated activated peroxide with pulp components Reaction with lignin
More informationEOPS PROBATION STUDENT LIST
EOPS PROBATION STUDENT LIST Fall 2018 EOPS The following students have been placed on EOPS Probation due to their not satisfying the semester g.p.a. and/or semester units completed requirements of the
More informationSUMMER 16/17 NEWS FROM THE CEO S U P P O R T I N G P E O P L E L I V I N G W I T H H U N T I N G T O N ' S D I S E A S E
S U P P O R T I N G P E O P L E L I V I N G W I T H H U N T I N G T O N ' S D I S E A S E SUMMER 16/17 NEWS 07 3435 4300 HUNTINGTONSQLD.ORG.AU FROM THE CEO Summer 2016/17 has been filled with wonderful
More informationSupporting Information
1 Supporting Information Hydrophilic and Cell-Penetrable Pyrrolidinyl Peptide Nucleic Acid (PNA) via Post Synthetic Modification with Hydrophilic Side Chains Haruthai Pansuwan, a Boonsong Ditmangklo, b
More information!"#$%&" '($&)*+,"-.(/%*+,"
!"#$%&" '($&)*+,"-.(/%*+," 01%/2),3"4).5"61%7$28"6%9)$5"%$"#/2++7! The Healthy Schools Partnership: Innovative Energy Balance Programming with RD Nutrition Coaches :%871"6%815;"
More informationCourses in the Bachelor program in Psychology (major)
Universität Zürich Binzmühlestrasse 1, Box 1 CH-8050 Zürich www.psychologie.uzh.ch Fall Semester 2016 Clinical Psychology 200a00x 00x Angststörungen Theorien, Befunde und Therapiemöglichkeiten (Anxiety
More informationyellow coloured amorphous powder, which on crystallization from hot acetone resulted in pale
Supporting Information Hexane Extract. Compound I: Elution of column with hexane: dichloromethane (50:50 v/v; 200 ml), gave a pale yellow coloured amorphous powder, which on crystallization from hot acetone
More informationSCH4U Organic Chemistry. hydrocarbon derivatives. mitchell kember
SCH4U rganic Chemistry hydrocarbon derivatives mitchell kember (Family Name) Note: penta can be replaced by meth/eth/prop/but/ # stands for a number from the chain (IUPAC name) (General Formula) (IUPAC
More informationVASOACTIVE ACTIONS OF OLIGO-PG(J) WISCONSIN UNIY-NADISON J A WILL 91 AUG 86 NCASIFIED F/G 6/5 N. hee0. HE.0 1NLSsmEEEEEEEEmiE
VASOACTIVE ACTIONS OF OLIGO-PG(J) WISCONSIN UNIY-NADISON J A WILL 91 AUG 86 NOS@14-86-K-S490 NCASIFIED F/G 6/5 N HE.0 1NLSsmEEEEEEEEmiE I hee0 10 ~ 325 u~~ui -0 h 1 .k.i * Final Repert cn Contract N00014-86-K-0490
More informationSynthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice
Supporting Information Rec. Nat. Prod. 9:4 (2015) 561-566 Synthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice Anita Mahapatra 1*, Purvi Shah 1, Mehul Jivrajani
More informationCADWELD TO THERMOWELD CROSS REFERENCE FOR CATHODIC PROTECTION
ECN 2215 REV "B" 05/08 THE ULTIMATE CONNECTION A DIVISION OF CONTINENTAL INDUSTRIES TO THERMOWELD CROSS REFERENCE FOR CATHODIC PROTECTION 4102 SOUTH 74TH EAST AVENUE / P.O. BOX 994 TULSA, OKLAHOMA 74101
More information(12) United States Patent Cravatt et a].
US008772318B2 (12) United States Patent Cravatt et a]. (10) Patent N0.: (45) Date of Patent: US 8,772,318 B2 Jul. 8, 2014 (54) (75) (73) (21) (22) (86) (87) (65) (60) (51) (52) (58) METHODS AND COMPOSITIONS
More informationDCP Networks
www.bps.org.uk/dcp DCP Networks To support and promote clinical psychology, working collaboratively with people who use our services and wider communities to improve wellbeing and to promote the unique
More informationSynthesis and biological activities of some 3,5-disubstituted-Δ²-pyrazoline derivatives
Oriental Journal of Chemistry Vol. 24(2), 607-612 (2008) Synthesis and biological activities of some 3,5-disubstituted-Δ²-pyrazoline derivatives SADAF J.GILANI, SUROOR A. KHAN*, OZAIR ALAM and HARISH KUMAR
More informationSupporting Information for. An approach to hyperolactone C and analogues using late stage conjugate addition on an oxonium ylide-derived spirofuranone
Supporting Information for An approach to hyperolactone C and analogues using late stage conjugate addition on an oxonium ylide-derived spirofuranone David M. Hodgson* Elena Moreno-Clavijo, Sophie E. Day
More informationSynthesis of Some Novel 2,4-Thiazolidinedione Derivatives and Their Biological Screening as Antidiabetic Agents
Asian Journal of Chemistry Vol. 21, No. 7 (2009), 5068-5072 ynthesis of ome Novel 2,4-Thiazolidinedione Derivatives and Their Biological creening as Antidiabetic Agents.K. JIWANE*, V.K. INGH, K.P. NAMDE
More informationThe National DAFNE Audit
The National DAFNE Audit Data Quality and Centre Performance David Hopkins King s College Hospital, London DAFNE Collaborative 26 th June 2015 Why audit matters Audit has been at the centre of DAFNE since
More informationP G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F
Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC
More informationDDBB536 : REFRIG INTERIOR ASSEMBLY [1/10]
DDBB536 : 001 - REFRIG INTERIOR ASSEMBLY [1/10] Page 1 of 22 DDBB536 : 001 - REFRIG INTERIOR ASSEMBLY [1/10] 1 L20910705 1 BRACKET LIGHT AR 36 2 PE950125 4 LIGHT SOCKET 3 A3079001 4 LAMP - 40W 4 PD020194
More informationProduct Information Packet ZDBRPM HP, 1750RPM,3PH,60HZ,L3213,TEBC,FOOT
Product Information Packet ZBPM HP, 7PM,PH,HZ,L,BC,FOO Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product
More informationLaser Lipo Ltd. Strawberry and Strawberry & Cream. Clinical Trial Protocol
Laser Lipo Ltd K130341 510(k) Strawberry and Strawberry & Cream Clinical Trial Protocol Conducted at: The Heath House Clinic, Crockham Hill, Edenbridge, Kent, UK. Laser Lipo Ltd. K130341 510(k) Page No.
More informationPhospholipids and their metabolism
Phospholipids and their metabolism D. GOMPERTZ J. clin. Path., 26, suppl. (Ass. Clin. Path.), 5, -16 From the Departments of Medicine and Chemical Pathology, Royal Postgraduate Medical School, London Phospholipids
More informationFigure S7: ATR FTIR spectra of enantiomeric UP-PLA-UPy and sc-upy-pla-upy. Figure S9: SEM microphotographs sc-upy-pla-oh in 1,4-dioxane and chloroform
Supporting Information for Macromolecules, DOI: Supramolecular Polylactides by the Cooperative Interaction of the End Groups and Stereocomplexation By M. Brzeziński*, T. Biela Table of Contents Figure
More informationZDBRPM HP, 1750RPM,3PH,60HZ,L3203,TEBC,FOOT
Product Information Packet ZBPM3 HP, 7PM,3PH,HZ,L33,BC,FOO Copyright ll product information within this document is subject to Baldor lectric Company copyright protection, unless otherwise noted. Product
More informationMetabolite identification in metabolomics: Database and interpretation of MSMS spectra
Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu utline Introduction Putative
More informationChapter 5 A Dose Dependent Screen for Modifiers of Kek5
Chapter 5 A Dose Dependent Screen for Modifiers of Kek5 "#$ ABSTRACT Modifier screens in Drosophila have proven to be a powerful tool for uncovering gene interaction and elucidating molecular pathways.
More informationTiffany L. Kruger, D.O. Children s Hospital of Michigan Wayne State University/Kresge Eye Institute
Pediatric Cases Nt Not To Be Missed Tiffany L. Kruger, D.O. Pediatric Ophthalmology Fellow Children s Hospital of Michigan Wayne State University/Kresge Eye Institute Case Presentation CC: Left eye turns
More information*+, - .!"#$% &'
139//6: 139//: 139 %& #$!"/5 / #!"!" )&&# ( '&%$ $ 1 *+, - &3# + "'.!"0!",/.!/-# &, - + ()* %!# & &'!"# $ : -B A$@ / &, /5), &$># &3# $ /?!.5 %! =* : ;< 9 /5), $ + 56,.- + ()* G$! E,0F = 3 (5, - B E,0F
More informationA few other notes that may be of use.
A few other notes that may be of use. - Online Version means that the worksheet is done solely on the computer using Microsoft WORD programme. -Except for the listed words and sentences, the main point
More informationNHC-catalyzed cleavage of vicinal diketones and. triketones followed by insertion of enones and
Supporting Information for NHC-catalyzed cleavage of vicinal diketones and triketones followed by insertion of enones and ynones Ken Takaki*, Makoto Hino, Akira Ohno, Kimihiro Komeyama, Hiroto Yoshida
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Exploiting the Ring Strain in Bicyclo[2.2.1]heptane Systems for the Stereoselective Preparation of Highly Functionalized Cyclopentene, Dihydrofuran, Pyrroline and Pyrrolidine Scaffolds
More informationTreating for Cure or Palliation: Difficult Decisions for Older Adults with Lymphoma
Treating Frail Adults With Common Malignancies: Best Evidence to Personalize Therapy Treating for Cure or Palliation: Difficult Decisions for Older Adults with Lymphoma Raul Cordoba, MD, PhD Lymphoma Unit
More informationNEW YORK STATE MEDICAID PROGRAM INFORMATION FOR ALL PROVIDERS MANAGED CARE INFORMATION
NEW YORK STATE MEDICAID PROGRAM INFORMATION FOR ALL PROVIDERS MANAGED CARE INFORMATION Table of Contents PREPAID CAPITATION PLANS (PCP)... 2 COUNTY/DISTRICT CODES... 7 Version 2018-2 June 1, 2018 1 of
More information"#$%!&%'(%)*!"+%,-./(01!"!"/01%01$!
3405625 "#$'()*"+,-./(01""/0101$ Patient Name: Jonathan Sandman Case Investigation #: 587291 Dear Investigators, We have decided that you should focus your next phase of the investigation on the patient
More informationChemistry Chapter 21
Chemistry 2100 Chapter 21 Lipids Fa3y Acids CH oleic acid (mp 4 C) CH stearic acid (mp 70 C) Triacylglycerols Fatty Acids! The fatty acid components of triglycerides have certain things in common: 1.
More informationSupporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information 1. General Information...S2 a. Materials b. HPLC
More informationProduct Information Packet IDBRPM HP 1750 TEBC FL V
Product Information Packet IBPM7 7 HP 7 BC FL V Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product Information
More information384D THREE PHASE MAGIC SINEWAVES. bits - trans - harms - filt - level
384D-16-22-2-32 Level: 32 of 32 Graph max distortion: 0.5% Report max distortion: 0.25% 30 0.9375 31 0.96875 32 1.0 33 1.03125 34 1.0625 Amplitude: 0.994821 Distortion: 0.249% Transitions: 10 Jitter: -16.5%
More informationSO14 IC Serial Output IC For 14 Bits of Output
ABCircuits www.abcircuits.com POB New Hill () 0-0 General Description SO IC Serial Output IC For Bits of Output The SO IC is designed to provide bits of output data to connect to RS-, RS-, USB, Ethernet
More informationISN Mission: Advancing the diagnosis, treatment and prevention of kidney diseases in the developing and developed world
ISN Mission: Advancing the diagnosis, treatment and prevention of kidney diseases in the developing and developed world Nutrition in Kidney Disease: How to Apply Guidelines to Clinical Practice? T. Alp
More information2016 Themes and Topics List
2016 Themes and Topics List Theme A: Development A.01. Neurogenesis and Gliogenesis A.01.a. Nervous system patterning and developmental cell death A.01.b. Proliferation: Self renewal and cell cycle A.01.c.
More informationPalladium(II)-Catalyzed Cross-Coupling of Simple Alkenes with Acrylates: A Direct Approach to 1,3-Dienes through C H Activation
1 Palladium(II)-Catalyzed Cross-Coupling of Simple Alkenes with Acrylates: A Direct Approach to 1,3-Dienes through C H Activation Zhen-Kang Wen, Yun-He Xu* and Teck-Peng Loh* Division of Chemistry and
More information