Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes
|
|
- Blaise Watkins
- 5 years ago
- Views:
Transcription
1 Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes Age and Gender: Association with Analytes The following Age-Sex distribution slides all have a common format: Males on left, Females on right Plot the 2.5 th, 25 th, median, 75 th, and 97.5 th percentiles for each analyte in 5 year age groups from age years of age Data appear sufficiently numerous to provide reasonably smooth curves
2 ALT: Age-Sex Variation ALT: Males : 'Ranges of Normal' ALT: Females : 'Ranges of Normal' ALT (UI) ALT (UI) AST: Age-Sex Variation AST: Males: 'Ranges of Normal' AST: Females : 'Ranges of Normal' AST (UI) AST (UI)
3 GGT: Age-Sex Variation GGT: Males : 'Ranges of Normal' GGT: Females : 'Ranges of Normal' GGT GGT Hepatitis C : Age-Sex Variation Percent Po s itive Hepatitis C Antibody: Within 5-Year Age Groups :18-83 Black line: Female; Das hed red line: Male [ 18, 23) [ 23, 28) [ 28, 33) [ 33, 38) [ 38, 43) [ 43, 48) [ 48, 53) [ 53, 58) [ 58, 63) [ 63, 68) [ 68, 73) [ 73, 78) [ 78, 83) Percent Positivity HepatitisC
4 Cholesterol: Age-Sex Variation Choles terol: Males : 'Ranges of Normal' Choles terol: Females : 'Ranges of Normal' Cholesterol Cholesterol HDL-Cholesterol: Age-Sex Variation HDL: Males : 'Ranges of Normal' HDL: Females : 'Ranges of Normal' HDL HDL
5 Alkaline Phosphatase: Age-Sex Variation Alkaline Phosphatas e: Males : 'Ranges of Normal' Alkaline Phos phatas e : Females : 'Ranges of Normal' Alkaline Phosphatase (IU) Alkaline Phosphatase (IU) Serum Glucose: Age-Sex Variation Glucos e : Males : 'Ranges of Normal' Glucos e : Females : 'Ranges of Normal' GLUCOSE (mg/dl) GLUCOSE (mg/dl)
6 Fructosamine: Age-Sex Variation (Note: Heritage Labs assay has ULN of 1.5) Fructos amine : Males: 'Ranges of Normal' Fructosamine : Females : 'Ranges of Normal' Fructosamine (mg/dl) Fructosamine (mg/dl) Serum Creatinine: Age-Sex Variation Serum Creatinine : Males : 'Ranges of Normal' SerumCreatinine : Females : 'Ranges of Normal' Serum Creatinine Serum Creatinine
7 egfr (Mayo E qn): Age-Sex Variation egfr: Males : 'Ranges of Normal' egfr: Females : 'Ranges of Normal' egfr egfr Urine Protein Assay False negatives(dipstick): Alkaline urine, ascorbic acid, ASA High dose penicillin High sp.gr. (>1.020) False positives: Benzalkonium Phenazopyridine Sulfosalicylic acid method( false pos.) Radiocontrast Aminosalicylic acid Peroxidase ingestion Tolbutamide; Sulfonamides
8 Pre-Analytical Factors Blood Draw: hemolysis Transport: Delay to centrifugation, Mislabeling, (Swapping serum tubes),heat, Hemolysis, Breakage, Loss of seal Processing Caveat about Interference Knowledge It has been my experience that concerns raised about analytical interference coming from self-educated agents, brokers and applicants about knowledge they have acquired from the Internet is based on a specific reports in the medical literature about methods not in current use.
9 Analytic Variation Variation in reagents, variations in sampling, variations in reaction time Coefficient of Variation: = Std. deviation of results/ mean of results Generally labs target 2-3% but CAP proficiency standards are not as tight as that. Some measures are thought to be acceptable with 15-20% Biological Sources of Variability Between-Person Variability --- Population Standard Deviation Within-Person Variability --- Diurnal variation ---Exercise --- Alteration in enzyme induction --- New onset disease --- Alterations in diet or alcohol consumption
10 NHANES-III Variability Stats: Clinical Chemistry 51(2), 2005, pp Between Persons Within Person Analyte (units) 2 n Mean SD CV g,% n Mean SD CV% Index of individuality Method CV i,% Creatinine, urine 3 (mmol/l) 19, Triglycerides 3 (mmol/l) 20, Bilirubin, total 3 (μmol/l) 15, Alanine aminotransferase 3 (U/L) 15, Urea nitrogen 3 (mmol/l) 15, γ-glutamyl transferase 3 (U/L) 11, Aspartate aminotransferase 3 (U/L) 15, HDL-cholesterol 3 (mmol/l) 20, Apolipoprotein B (g/l) 10, Glucose, plasma 3 (mmol/l) 15, Cholesterol, total 3 (mmol/l) 20, Apolipoprotein A (g/l) 10, Creatinine 3 (μmol/l) 16, Selenium 3 (nmol/l) 15, Alkaline phosphatase 3 (U/L) 15, Protein, total (g/l) 16, Calcium, total 3 (mmol/l) 16, Albumin (g/l) 16, Glycohemoglobin, blood 3 (%) 19, Proteinuria Patterns Glomerular: (albumin, transferrin); diabetic nephropathy, GN, MCD Interstitial: (alpha 1, alpha 2, beta 2 globulin, cystatin C, retinolbinding protein); interstital/tubular nephritis, chronic pyelo, congenital tubular nephropathies, calciuric renal diseases. (40% of dxs. leading to ESRD) Mixed: chronic pyelo Dysglobulinemias: MM, MGUS, macroglobulinemia, cryoglobulinemia
11 Orthostatic Proteinuria Young persons Not present in first morning void AST Positive Interference: lipemia, hemolysis Enzyme induction: oxacillin, ampicillin, opiates, erythromycin Negative interference: DKA, beriberi, severe liver dz. Chronic hemodialysis Uremia (follows BUN, reason unknown) Pyridoxal deficiency, pregnancy
12 ALT Incr: Hepatobiliary dzs, Obesity (1-3x) Decr: Pyridoxal deficiency, pregnancy Positive Interference: Seasonal variation previously reported in literature and seen in our analyses Seasonal Variation: ALT: Percentiles versus Month of Draw Percentiles
13 Bilirubin Only if associated with AlkPhos is increase associated with increased risk: Low levels (< 0.5) actually increases mortality risk, perhaps due to a decreased antioxidant effect (and Heritage research shows this to be especially true with increasing GGT which further supports the oxidation hypothesis.) Alkaline Phosphatase Interference: EDTA (so cannot use plasma from whole blood tubes if serum tube damaged.) Stable at 25C, 80-90% 56C x 30 min Drugs: (incr.) acyclovir, amiodarone, amitriptyline, carbamazepine, erythromycin, INH, niacin, phenytoin, sildenafil, valproic acid Would expect many of these to raise GGT as well.
14 Glucose Metronidazole: (decr.) affects hexokinase method (which is the assay Heritage uses) Major artifactual decrease caused in the insurance setting by red cell and white cell metabolism prior to centrifugation. There is consistent predictable impact on serum creatinine for measured values below 50 mg/dl. Creatinine Transport issues: Consistent increases in the median, 25 th and 75 th percentiles of up to 0.3 mg/dl when associated with serum glucose values below 50. Appears to be a linear effect over that range. Red cells have higher levels of both creatine and creatinine than plasma. After consuming available glucose for energy, RBCs turn to creatine as energy source with resultant production of even further creatinine.
15 3) Can you discuss urine proteinuria, protein/creatinine ratio, light chains, albuminuria? Insurance labs use more accurate testing methods than are common in clinical practice. There is no accepted standard for urine protein. Urine has a mixture of proteins, some of the nonalbumin proteins are benign but others strongly associated with life-shortening diseases. Proteinuria vs. Albuminuria The focus on glomerular diseases blinds one by removing interstitial diseases. Filtration is not the only function of the kidneys. Proper recovery of useful filtered solutes and homeostatis are functions of the interstitium. 40% of diseases leading to ESRD are interstial. Specific urine proteins are increased in interstial diseases: cystatin-c, beta-2-microglobulin, alpha-1- microglobulin, retinol-binding protein
16 Proteinuria vs. Albuminuria So it is not just the multiple myeloma and MGUS cases with their (possible) light chain proteinuria that represent a challenge to the dominant view that micro-albumin is the sole arbiter of significant or unhealthy proteinuria There are a much greater number of unrecognized renal disease cases than there are MM cases. The level of proteinuria at which risk begins to increase is well below the conventional ULN of 0.2 gm/gm creatinine. IA reasonable level at which risk could be considered increase is 0.1, and by the time is is 0.15 the risk is at least doubled from a comparison group with levels below the median. Proteinuria vs. Albuminuria In the Heritage experience, among cases where both urine protein and microalbumin have been measured, it is the mixed proteinuria cases (those with an albumin to non-albumin ratios = ) that have the highest risk. The protein-creatinine ratio is an excellent mortality predictor across the full range of both protein and creatinine in our applicant cohort. My hypothesis is that both diabetes and the intrinsic renal diseases have an important inflammatory component. Further hypothesis: This inflammatory process interferes with proper tubular function and the measureable consequence is a greater than normal spillage of the small molecular weight proteins.
17 Interaction: egfr and Ur Prot/Creat ratio Age Last Birthday: Mayo egfr ---> Ur Pr/Cr [ 0, 15) [ 15, 30)[ 30, 45)[ 45, 60)[ 60, 75)[ 75, 90) [ 90,105)[105,120)[120,135)[135,150)[150,165) [ ) [ ) [ ) [ ) [ ) [ ) [ ) [4.00+] Interaction: egfr and Ur Prot/Creat ratio Age Last Birthday: Mayo egfr ---> Ur Pr/Cr [ 0, 15) [ 15, 30) [ 30, 45) [ 45, 60) [ 60, 75) [ 75, 90) [ 90,105) [105,120) [120,135) [ ) [ ) [ ) [ ) [ ) [ ) [ ) [4.00+]
18 Interaction: egfr and Ur Prot/Creat ratio Age Last Birthday: Mayo egfr ---> Ur Pr/Cr [ 0, 15) [ 15, 30) [ 30, 45) [ 45, 60) [ 60, 75) [ 75, 90) [ 90,105) [105,120) [ ) [ ) [ ) [ ) [ ) [ ) [ ) [4.00+] )If a urine specimen is in transit for 3 days from collection to arrival at the lab, and it has large hemoglobin but no RBCs: is there any estimate of the initial specimen s RBC count? Would it expected to usually have RBCs at the time of collection? This is a subject on which honest people apparently disagree. Inanalyses controlling for other known renal markers of mortality, we have found no increase in mortality risk for persons with positive urine hemoglobin who have no red-cells on microscopic analysis. Whether to believe there shouldhave been red cells, might well be moot. We believe that our analysis, which first stratifies by urine protein/creatinine ratio, is properly ascribing the blame (or credit?) for mortality in such cases to the more potent risk indicator: proteinuria. Or perhapsit is simply proteinuria that is adjudicating which cases really have renal disease. The sources of analytical interference that affect dipstick methods also affect the assay used for urine hemoglobin. The same reaction is measured.
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationQuantitative protein estimation of Urine
Quantitative protein estimation of Urine 1 In a healthy renal and urinary tract system, the urine contains no protein or only trace amounts. The presence of increased amounts of protein in the urine can
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationQuantitative estimation of protein in urine
Quantitative estimation of protein in urine By sulphosalicalic acid Method BCH 472 In a healthy renal and urinary tract system, the urine contains no protein or only trace amounts. The presence of increased
More informationDiabetic Nephropathy
Diabetic Nephropathy Outline Introduction of diabetic nephropathy Manifestations of diabetic nephropathy Staging of diabetic nephropathy Microalbuminuria Diagnosis of diabetic nephropathy Treatment of
More informationAuthorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5
AFP All All < 15 ug/l Albumin All 0-3M 25-40 g/l Albumin All 3-12M 32-45 g/l Albumin All 1-70Y 34-48 g/l Albumin All >70Y 32-46 g/l Alk Phos All 0-10Y 80-350 U/L Alk Phos M 10-14Y 45-400 U/L Alk Phos F
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationThe analytical phase
The analytical phase Result interpretation Test request Result Sampling Black box: the lab ANALYTICAL PHASE The CASE Uncle Pete, 67 years old Marked abdominal pain 8 pm, ED Acute abdomen? Assessment (+
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationURINE DIPSTICK AND SULPHOSALICYLIC ACID TEST. Špela Borštnar UREX 2015, Ljubljana, Slovenia
URINE DIPSTICK AND SULPHOSALICYLIC ACID TEST Špela Borštnar UREX 2015, Ljubljana, Slovenia KIDNEY DISEASE? severity of kidney disease = estimating GFR cause of kidney disease = urinalysis URINE EXAMINATION
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationScoring Life Insurance Applicants Laboratory Results, Blood Pressure and Build to Predict All-Cause Mortality Risk
Copyright E 2012 Journal of Insurance Medicine J Insur Med 2012;43:169 177 MORTALITY Scoring Life Insurance Applicants Laboratory Results, Blood Pressure and Build to Predict All-Cause Mortality Risk Michael
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department Poole Hospital Longfleet Road Poole BH15 2JB Contact: Dr Fergus Jack Tel: +44 (0) 1202 442 497 E-Mail: Fergus.jack@poole.nhs.uk
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationTABLE OF CONTENTS GENERAL INFORMATION... 1
BIOO RESEARCH PRODUCTS Glucose Assay Kit Manual Catalog #: 5611-01 BIOO Scientific Corp. 2011 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 1 Required Materials
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More information5/10/2014. Observation, control of blood pressure. Observation, control of blood pressure and risk factors.
Overview The Kidneys Nicola Barlow Clinical Biochemistry Department City Hospital Renal physiology Renal pathophysiology Acute kidney injury Chronic kidney disease Assessing renal function GFR Proteinuria
More informationcobas c 501 analyzer and cobas c 311 analyzer Within Run Imprecision Guidelines
cobas c 501 analyzer and cobas c 311 analyzer General Information How to use these guidelines Unless otherwise indicated, the data presented is the same for both the cobas c 501 analyzer and the cobas
More informationProteinuria DR. SANJAY PANDEYA MD. FRCPC.
Proteinuria DR. SANJAY PANDEYA MD. FRCPC. Objectives Define normal and abnormal range(s) of proteinuria Evaluation of proteinuria Be aware of complications of proteinuria When to refer and when not to
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationAbnormal Liver Chemistries. Lauren Myers, MMsc. PA-C Oregon Health and Science University
Abnormal Liver Chemistries Lauren Myers, MMsc. PA-C Oregon Health and Science University Disclosure 1. The speaker/planner Lauren Myers, MMSc, PA-C have no relevant financial relationships to disclose
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationLab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.
Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationTypes of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationManagement of New-Onset Proteinuria in the Ambulatory Care Setting. Akinlolu Ojo, MD, PhD, MBA
Management of New-Onset Proteinuria in the Ambulatory Care Setting Akinlolu Ojo, MD, PhD, MBA Urine dipstick results Negative Trace between 15 and 30 mg/dl 1+ between 30 and 100 mg/dl 2+ between 100 and
More informationIntroduction to Clinical Diagnosis Nephrology
Introduction to Clinical Diagnosis Nephrology I. David Weiner, M.D. C. Craig and Audrae Tisher Chair in Nephrology Professor of Medicine and Physiology and Functional Genomics University of Florida College
More informationAlaska Native Medical Center Anchorage, AK
ANMC Lab Test Requirements Key: Room Temp (20-25C), Refrigerated (2-8C), (-15 to -25C), Hr (Hours), D (Days), W (Weeks), Mo (Months), Yr (Years). Basic Processing Instructions: Centrifuge all blood specimens
More informationCITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS
CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS Interpreting abnormal liver function tests (LFTs) and trying to diagnose any underlying liver disease is a common scenario in Primary
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationMinimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections
The following table outlines the minimum whole blood volume that must be drawn into a microcollection tube (unless otherwise stated) for an individual test on a neonate, pediatric, patient weighing less
More informationApplicable To Employees of Gundersen Boscobel Area Hospital Laboratory and Gundersen Palmer Lutheran Hospital and Clinics Laboratory.
Subject Creatinine COBAS C311 Index Number Lab-8814 Section Laboratory Subsection Regional/Affiliates Location Category Departmental Contact Tilleraas, Betty Last Revised 1/17/2018 References Required
More informationEvaluation of Cheongmeak DCS TM Reagents for Chemistry Analyzers
임상검사와정도관리 J Lab Med Qual Assur 2010 ; 32:197-204 ISSN 1225-097X Evaluation of Cheongmeak DCS TM Reagents for Chemistry Analyzers Kyeong Seob Shin, Taek Eun Jeong, and Bo Ra Son Department of Laboratory
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationA. SAP is the D-Lab's name for a specific set of serum biochemical tests.
Understanding CBC, SAP, UA/Laura J. Steadman, DVM I. CBC - Complete Blood Count A. Three major types of cells are counted 1. Red Blood Cells 2. White Blood Cells 3. Platelets B. Cells are counted at the
More informationMEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.
MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationGeneral Chemistry Scheme Guide
General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and
More informationEvaluation of VACUETTE SECONDARY Tubes
Evaluation of VACUETTE SECODARY Tubes Background VACUETTE SECODARY Tubes are used as a secondary container for aliquoting, storing and transporting blood, blood components and urine from the primary tube
More informationBiochemistry Adult Reference Ranges
Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC
More informationManufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
More informationUni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List
0130-430 Magnesium LiquiColor Test 0140-050 Sodium Test 0150-250 Calcium (CPC) LiquiColor Test 0153-030 Calcium Standard (10 mg/dl) 0155-225 Calcium (Arsenazo) LiquiColor Test 0160-050 Potassium Test 0210-250
More informationEvaluation of VACUETTE Urine CCM tube for Clinical Chemistry
Evaluation of VACUETTE Urine CCM tube for Clinical Chemistry Background The VACUETTE Urine CCM tube is for the collection, transport and storage of urine samples for urine culture and urinalysis in the
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationSupporting Materials for a 31-Day Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects
Supporting Materials for a 31- Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects Brent L. Finley a, Kenneth M. Unice b, Brent D. Kerger c, Joanne M. Otani a, Dennis
More informationBS-230. Clinical Chemistry Analyzer
BS-230 Clinical Chemistry Analyzer Flexible loading: 80 sample positions, Up to 80 reagent positions. Up to (40 fixed + 40 interchangeable) μl minimum reaction volume Disposable Cuvettes to avoid contamination
More informationTEST LIST SAMPLE REQUIREMENT. 1 ml serum None
ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN
More informationEvidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA
Evidence Based Commutability: Bias 2 Study Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Australian Bias Studies conducted by Gus Koerbin, ACT Pathology on behalf of AACB Harmonisation Committee
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationEXAM COVER SHEET. Course Code: CLS 432. Course Description: Clinical Biochemistry. Final Exam. Duration: 2 hour. 1st semester 1432/1433.
EXAM COVER SHEET Course Code: CLS 432 Course Description: Clinical Biochemistry Final Exam Duration: 2 hour 1st semester 1432/1433 Student Name: Student Uni No: Part 1 Multiple choice questions Answer
More informationDEPARTMENT: Regulatory Compliance Support
PAGE: 1 of 5 REPLACES POLICY DATED: 1/16/98, 3/1/99, SCOPE: All Company-affiliated hospitals performing and/or billing laboratory services. Specifically, the following departments: Business Office Admitting/Registration
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationWSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:
WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x
More informationCase Studies: Renal and Urologic Impairments Workshop
Case Studies: Renal and Urologic Impairments Workshop Justine Lee, MD, DBIM New York Life Insurance Co. Gina Guzman, MD, DBIM, FALU, ALMI Munich Re AAIM Triennial October, 2012 The Company You Keep 1 Case
More informationPostanalytical phase
Postanalytical phase Test request POSTANALYTICAL Result interpretation PHASE Result Sampling Black box: the lab And the RESULT is created The technician approves the result; it is transferred to the lab
More informationSerodos and Serodos plus
Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution
More informationGENERAL. Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry)
GENERAL Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry) ESSAY ANSWER QUESTIONS 2 Questions - each question is worth 35 marks.all questions should be attempted Question
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationSeeing is not Believing (13-Nov-2004)
In: 55th Annual Meeting of the American College of Veterinary Pathologists (ACVP) & 39th Annual Meeting of the American Society of Clinical Pathology (ASVCP), ACVP and ASVCP (Eds.) Publisher: American
More informationRoyal College of Pathologists of Australasia Allowable Limits of Performance
The RCPA (Royal College of Pathologists of Australasia) have developed a thorough set of specifications for allowable error. For those not bound by the CLIA regulations, these can serve as a valuable resource.
More informationTotal Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment
Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationAspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationReagents on COBAS INTEGRA Systems
within specification within specification Lipemia AAGP α1-acid Glycoprotein X X no no no no no no no AAGP2 α1-acid Glycoprotein Gen.2 X X X 60 60 1000 1026 1026 621 700 AAT2 α1-antitrypsin ver.2 X X X
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More information