β-cell Preservation and Regeneration After Islet Transplantation

Size: px
Start display at page:

Download "β-cell Preservation and Regeneration After Islet Transplantation"

Transcription

1 β-cell Preservation and Regeneration After Islet Transplantation Jyuhn-Huarng Juang, MD Division of Endocrinology and Metabolism, Department of Internal Medicine, Chang Gung University and Memorial Hospital, TAIWAN

2 Nature History of Type 1 Diabetes N Engl J Med 1986; 314:

3 Human Islet Transplantation

4 Human Islet Transplantation Insulin independence: at 1 year Year rate patient no % 493 (total) % 237 (type 1)

5 Human Islet Transplantation Insulin independence: at 1 year Year rate patient no % 493 (total) % 237 (type 1) % (SIK) Giessen 27% (IAK)

6 Human Islet Transplantation Insulin independence: at 1 year Year rate patient no % 493 (total) % 237 (type 1) % (SIK) Giessen 27% (IAK) % (ITA) 7 (Edmonton) % (ITA) 33 (Edmonton)

7 Human Islet Transplantation Insulin independence: at 1 year Year rate patient no % 493 (total) % 237 (type 1) % (SIK) 27% (IAK) % (ITA) 7 (Edmonton) % (ITA) 33 (Edmonton) % 36 (9 sites)

8 Edmonton Protocol (Shapiro AMJ et al. N Engl J Med 2000;343:230-8) High quality of human islets Glucocorticoid-free immunosuppressive regimen Repeat transplants

9 Human Islet Transplantation Insulin Independence and Graft Function (Edmonton)

10 Graftβ-Cell Preservation and Regeneration Prevent rejection and autoimmune destruction Enhance islet engraftment Promote beta-cell regeneration

11 Prevention of Rejection and Autoimmune Destruction Immunosuppression Immunomodulation Immunoisolation Tolerance induction

12 Approaches to Prevent Rejection and Autoimmune Destruction Microcapsule Hsu BRS et al. Transplant Proc 1996 Cell Transplant 1999 CTLA4 Ig Lu WT et al. Transplant Proc 2001 FasL/HO-1 Tg Juang JH et al. Transplant Proc 2011 DCR3 Tg Sung HH et al. J Exp Med 2004 Rejection Autoimmune

13 Immunoisolation Microparticle Generator Alginate-Poly-L-Lysine-Alginate (APA) Microcapsule Immunoglobulin Glucose Islet Insulin Hsu BRS et al., J Formos Med Assoc 93:240-5, 1994.

14 APA Microencapsuled Rat Islets IL-1ra 15-DSG fibrosis X Macrophage IL-1β X Islet Hsu BRS et al., Cell Transplant 8:307-15, Hsu BRS et al., Transplant Proc 28:1961-3, 1996.

15 DCR3 Transgenic Islets Prevented Autoimmune Destruction Overexpression of DCR3 Protected NOD from Insulitis NOD Mice (12 wks) DCR3 Transgenic Islet Transplantation in NOD Mice DCR3 Transgenic NOD Mice Sung H-H, Juang J-H et al. J Exp Med 2004;199:

16 Graftβ-Cell Preservation and Regeneration Prevent rejection and autoimmune destruction Enhance islet engraftment Promote beta-cell regeneration

17 Problems Related to Islet Engraftment Hyperglycemia Hypoperfusion Hypoxia Ischemia/Reperfusion Nonspecific inflammatory response

18 Approaches to Enhance the Islet Engraftment Additional Islets Juang JH et al. Insulin Juang JH et al. Transplant Proc HBO Juang JH et al. Cell Transplant Pentoxiphylline Juang JH et al. Transplant Proc NDGA Hsu BRS et al. Cell Transplant DSG Juang JH et al. Transplant Proc Diabetes COPP Fu SH et al. Transplant Proc 2004 Islet Growth and Function Rosiglitazone Hsu BRS et al. Transplant Proc 2005 Outcome of Islet Transplantation

19 Beneficial Influence of Additional Islets on Syngeneic Mouse Islet Transplantation Blood Glucose (mg/dl) Tx with 200 islets (n=22) Tx with 200X2 islets (n=53) P<0.001 vs. data at day Graft Removal (n=16) Nephrectomy (n=6) Sham operation (n=5) p < 0.05, p < 0.01 vs. data at day Days after Transplantation Days after Nephrectomy or Graft Removal Juang JH et al., Diabetes 1994;43:1334-9

20 Beta-Cell Mass and Insulin Content of the Graft Graft Removal P<0.01 vs. 200 islets and day Sham Operation 9 P<0.05 vs. day 14 Beta-Cell Mass (mg) Islets 0 14 Days after Graft Removal or Sham Operation Insulin Content (µg) Islets 0 14 Days after Graft Removal or Sham Operation Juang JH et al., Diabetes 1994;43:1334-9

21 Replication Rate of Islet Grafts Replication Rate (%/4h)1.4 Graft Removal Sham Removal p < 0.02 vs. other groups in graft removal, and p < 0.04 vs. day 3 in sham operation Days after One Graft Removal or Sham Removal Juang JH et al., Diabetes 1994;43:1334-9

22 Effect of Insulin Treatment on Syngeneic Mouse Islet Transplantation Blood Glucose (mg/dl) NS (n=16) UT (n=30) P<0.05, P<0.01, P<0.001 vs. NS Ultratard or NS sc qd Days After Transplantation Juang JH et al., Transplant Proc 1998;30:576-7.

23 Blood Glucose Changes After Transplantation 500 Control (n=16) UT-A (n=30) UT-B (n=7) UT-B+A (n=5) Blood Glucose (mg/dl) P<0.05 vs. NS Days After Transplantation Juang JH et al., Transplant Proc 1998;30:576-7.

24 Beta-Cell Mass of Mouse Islet Grafts At 4 Weeks After Transplantation 0.5 Beta-Cell Mass (mg) P<0.05 vs. Control 0 Control UT-B UT-A UT-B+A Juang JH et al., Transplant Proc 1998;30:576-7.

25 Graftβ-Cell Preservation and Regeneration Prevent rejection and autoimmune destruction Enhance islet engraftment Promote beta-cell regeneration

26 Regeneration Therapy in Islet Recipients β-cell Mass Graft Failure Islet Regeneration Insulin independence threshold Islet Transplant Time

27 Pancreatic Targets for Expansion of β-cell Mass Annu Rev Med 2006;57:265 81

28 GLP-1 on β-cell Mass β-cell Endocrine Reviews 2007;28:

29 Exenatide in Clinical Islet Transplantation 1 EXENATIDE 3 2 ISLETS 1 Exenatide reduces the number of islet infusions to achieve normoglycemia (Am J Transplant 2008;8: ) 2 Exenatide rescues islet recipients with allograft dysfunction (Transplantation 2008;86:36 45) 3 Exenatide improves success rates in recipients with supplemental islet infusions (Transplantation 2008;86: )

30 Exendin-4 Improves Outcome of Syngeneic Mouse Islet Transplantation Blood Glucose Diabetes (%) Blood Glucose (mg/dl) 500 P<0.05 vs. control Control (n=17) Exendin-4 (n=16) Days After Transplantation Diabetes (%) Days After Transplantation Juang JH et al., Cell Transplant 17:641-7, 2008 P=0.012 vs. control Control (47.5%) Exendin-4

31 Exendin-4 Expands Mouse Graft β-cell Mass Mouse Islet Graft at 6 Weeks Insulin Staining Exendin-4 Control β-cell Mass 100 µm 100 µm Juang JH et al., Cell Transplant 17:641-7, 2008

32 Exendin-4 Prevents Mouse Graft β-cell Apoptosis and Preserves Graft β-cell Mass β-cell Area Apoptosis Toyoda K et al. Biochem Biophys Res Commun 367:793-9, 2008

33 Liraglutide Prevents Mouse Graft β-cell Apoptosis But Does Not Promote β-cell Proliferation 48 hr Apoptotic β-cells (%) 2 wk BrdU+ β-cells (%) Merani S et al. Endocrinology 149: , 2008

34 Sitagliptin Prolongs Mouse Islet Graft Survival Islets: infected with rad-tk to allow [ 18 F]FHBG PET imaging Kim S-J et al. Diabetes 57:1331 9, 2008

35 Effects of Dipeptidyl Peptidase-4 Inhibition on Syngeneic Mouse Islet Transplantation Blood Glucose MK-0431 LAF 237 P=0.001 Juang JH et al. Diabetes 61 (suppl 1):A409, 2012

36 Effects of Dipeptidyl Peptidase-4 Inhibition on Syngeneic Mouse Islet Transplantation Body Weight MK-0431 LAF 237 P=0.057 Juang JH et al. Diabetes 61 (suppl 1):A409, 2012

37 Effects of Dipeptidyl Peptidase-4 Inhibition on Syngeneic Mouse Islet Transplantation Insulin Content and β-cell Mass MK-0431 LAF 237 Control MK insulin content (ng) β-cell mass (mg) Juang JH et al. Diabetes 61 (suppl 1):A409, 2012

38 Islet Transplantation Graft β-cell Preservation and Regeneration A Cure for Diabetes

39 CGMH Islet Transplant Team Grant Support National Science Council, Taiwan Industrial Technology Research Institute, Taiwan Chang Gung Memorial Hospital, Taiwan

Magnetic Resonance Imaging of Transplanted Mouse Islets Labeled With Chitosan-Coated Superparamagnetic Iron Oxide Nanoparticles

Magnetic Resonance Imaging of Transplanted Mouse Islets Labeled With Chitosan-Coated Superparamagnetic Iron Oxide Nanoparticles Magnetic Resonance Imaging of Transplanted Mouse Islets Labeled With Chitosan-Coated Superparamagnetic Iron Oxide Nanoparticles J.-H. Juang, J.-J. Wang, C.-R. Shen, C.-H. Kuo, Y.-W. Chien, H.-Y. Kuo, Z.-T.

More information

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical

More information

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis The Effects of Exenatide on the Autoimmune Development of Diabetes A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Microbiology in the Undergraduate

More information

SURGICAL CURES FOR DIABETES

SURGICAL CURES FOR DIABETES SURGICAL CURES FOR DIABETES UCSF Diabetes Update March 12, 2009 Andrew M. Posselt, MD, PhD Transplant Surgery, UCSF Surgical Treatment Options Whole Organ Pancreas Transplant Type 1 and 2 Pancreatic Islet

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic

More information

IMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES. A. Ktorza, B.

IMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES. A. Ktorza, B. IMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES A. Ktorza, B. Thorens DIABETES Definition Diabetes is a metabolic disease characterized

More information

Advancing Opportunities To Prevent Type 1 Diabetes

Advancing Opportunities To Prevent Type 1 Diabetes Advancing Opportunities To Prevent Type 1 Diabetes Dr. Allison Green Centre for Immunology and Infection Hull York Medical School York University Type 1 Diabetes Insulin deficiency destabilizes regulation

More information

Islet Cell Transplantation The Oxford AHSN Diabetes Clinical Network Launch Event, February 2014

Islet Cell Transplantation The Oxford AHSN Diabetes Clinical Network Launch Event, February 2014 Islet Cell Transplantation The Oxford AHSN Diabetes Clinical Network Launch Event, February 2014 Stephen Gough Islet Transplant Service (Oxford) Islet v Pancreas Two different approaches Ideal Traetmanet

More information

Mouse Models for Studying Human Islet Transplantation

Mouse Models for Studying Human Islet Transplantation Mouse Models for Studying Human Islet Transplantation Ronald G. Gill, Joshua Beilke,, Nathan Kuhl,, Michelle Kerklo, and Mark M. Nicolls Barbara Davis Center for Childhood Diabetes University of Colorado

More information

Eilandjes transplantatie. Eelco de Koning, LUMC 14 februari 2008

Eilandjes transplantatie. Eelco de Koning, LUMC 14 februari 2008 Eilandjes transplantatie Eelco de Koning, LUMC 14 februari 2008 Pancreas or islets? What tissue do we wish to transplant? Is there competition for donor pancreas? How does the islet isolation and transplantation

More information

Treating Type 2 Diabetes with Bariatric Surgery. Goal of Treating T2DM. Remission of T2DM with Bariatric

Treating Type 2 Diabetes with Bariatric Surgery. Goal of Treating T2DM. Remission of T2DM with Bariatric Treating Type 2 Diabetes with Bariatric Surgery Number (in Millions) of Persons with Diagnosed Diabetes, United States, 198 25 The number of Americans with diabetes increased from 5.6 to 15.8 million Guilherme

More information

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma

More information

The state of affairs of allogenic islet transplantation. William Bennet MD, PhD Fellow Division of Transplant Surgery UCHSC

The state of affairs of allogenic islet transplantation. William Bennet MD, PhD Fellow Division of Transplant Surgery UCHSC The state of affairs of allogenic islet transplantation William Bennet MD, PhD Fellow Division of Transplant Surgery UCHSC Global epidemiology of Diabetes Mellitus IDDM NIDDM 1997 3 700 000 120 300 000

More information

Islet Cell Allo-Transplantation. Disclosure. Objectives

Islet Cell Allo-Transplantation. Disclosure. Objectives Islet Cell Allo-Transplantation Gregory P. Forlenza, MD MCR Assistant Professor Barbara Davis Center University of Colorado Denver Special thanks to Melena Bellin, MD at The University of Minnesota who

More information

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01.

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01. NIH Public Access Author Manuscript Published in final edited form as: Diabetologia. 2013 February ; 56(2): 231 233. doi:10.1007/s00125-012-2788-6. Lipotoxicity impairs incretin signalling V. Poitout 1,2

More information

Journal Club WS 2012/13 Stefanie Nickl

Journal Club WS 2012/13 Stefanie Nickl Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,

More information

(Incretin) ( glucagon-like peptide-1 GLP-1 ) GLP-1. GLP-1 ( dipeptidyl peptidase IV DPP IV ) GLP-1 DPP IV GLP-1 exenatide liraglutide FDA 2 2 2

(Incretin) ( glucagon-like peptide-1 GLP-1 ) GLP-1. GLP-1 ( dipeptidyl peptidase IV DPP IV ) GLP-1 DPP IV GLP-1 exenatide liraglutide FDA 2 2 2 007 18 189-194 (Incretin) Incretin ( ) -1 ( glucagon-like peptide-1 ) ( dipeptidyl peptidase IV ) liraglutide FDA ( Type diabetes mellitus ) -1 ( Glucagon-like peptide-1, ) ( Incretin ) ( Dipeptidyl peptidase

More information

Role of incretins in the treatment of type 2 diabetes

Role of incretins in the treatment of type 2 diabetes Role of incretins in the treatment of type 2 diabetes Jens Juul Holst Department of Medical Physiology Panum Institute University of Copenhagen Denmark Diabetes & Obesity Spanish Society of Internal Medicine

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Treatment of Autoimmune Diabetes by Inhibiting the Initial Event

Treatment of Autoimmune Diabetes by Inhibiting the Initial Event http://dx.doi.org/10.4110/in.2013.13.5.194 pissn 1598-2629 eissn 2092-6685 REVIEW ARTICLE Treatment of Autoimmune Diabetes by Inhibiting the Initial Event * Department of Medicine, Samsung Medical Center,

More information

Clinical impact of de-novo HLA antibodies in pancreas and islet transplantation

Clinical impact of de-novo HLA antibodies in pancreas and islet transplantation Clinical impact of de-novo HLA antibodies in pancreas and islet transplantation David Turner, PhD, FRCPath Lead for H&I Services, Scottish National Blood Transfusion Service Treatment of Type I DM Insulin

More information

Type 2 Diabetes and Cancer: Is there a link?

Type 2 Diabetes and Cancer: Is there a link? Type 2 Diabetes and Cancer: Is there a link? Sonali Thosani, MD Assistant Professor Department of Endocrine Neoplasia & Hormonal Disorders MD Anderson Cancer Center No relevant financial disclosures Objectives

More information

Data from an epidemiologic analysis of

Data from an epidemiologic analysis of CLINICAL TRIAL RESULTS OF GLP-1 RELATED AGENTS: THE EARLY EVIDENCE Lawrence Blonde, MD, FACP, FACE ABSTRACT Although it is well known that lowering A 1c (also known as glycated hemoglobin) is associated

More information

Div. of Endocrinology and Metabolism Konyang University, School of Medicine. Byung-Joon Kim M.D., Ph.D.

Div. of Endocrinology and Metabolism Konyang University, School of Medicine. Byung-Joon Kim M.D., Ph.D. Diabetes and Thyroid Center Div. of Endocrinology and Metabolism Konyang University, School of Medicine Byung-Joon Kim M.D., Ph.D. Background Incretin effect and GLP 1 Receptor in L cells TGR5 receptor

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Designing An)gen- specific Immunotherapy for Treatment of Type 1 Diabetes.

Designing An)gen- specific Immunotherapy for Treatment of Type 1 Diabetes. Designing An)gen- specific Immunotherapy for Treatment of Type 1 Diabetes. Kristin V. Tarbell Immune Tolerance Unit, Diabetes Endocrinology and Obesity Branch, NIDDK Outline Background on type 1 diabetes

More information

José Oberholzer, MD. Director Charles O. Strickler Transplant Center. Chief, Division of Transplantation

José Oberholzer, MD. Director Charles O. Strickler Transplant Center. Chief, Division of Transplantation José Oberholzer, MD Director Charles O. Strickler Transplant Center Chief, Division of Transplantation Professor of Surgery and Biomedical Engineering DISCLOSURES No consulting for, no payments, no stocks

More information

Pancreas After Islet Transplantation: A First Report of the International Pancreas Transplant Registry

Pancreas After Islet Transplantation: A First Report of the International Pancreas Transplant Registry American Journal of Transplantation 2016; 16: 688 693 Wiley Periodicals Inc. Brief Communication Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons doi:

More information

A Practical Approach to the Use of Diabetes Medications

A Practical Approach to the Use of Diabetes Medications A Practical Approach to the Use of Diabetes Medications Juan Pablo Frias, M.D., FACE President, National Research Institute, Los Angles, CA Clinical Faculty, University of California, San Diego, CA OUTLINE

More information

Scope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors

Scope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors Plasma Glucose (mg/dl) Plasma Insulin (pmol/l) Incretin-based Therapy and Inhibitors Scope Mechanism of action ผศ.ดร.นพ.ว ระเดช พ ศประเสร ฐ สาขาว ชาโภชนว ทยาคล น ก ภาคว ชาอาย รศาสตร คณะแพทยศาสตร มหาว ทยาล

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE Robert R. Henry, MD Authors and Disclosures CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Introduction Type 2 diabetes

More information

Immunology Lecture 4. Clinical Relevance of the Immune System

Immunology Lecture 4. Clinical Relevance of the Immune System Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor

More information

Pathways to Protecting from Autoimmunity the Resurrected/Regenerated Beta Cells. Jeffrey Bluestone, PhD Diabetes Center at UCSF

Pathways to Protecting from Autoimmunity the Resurrected/Regenerated Beta Cells. Jeffrey Bluestone, PhD Diabetes Center at UCSF Pathways to Protecting from Autoimmunity the Resurrected/Regenerated Beta Cells Jeffrey Bluestone, PhD Diabetes Center at UCSF Number of Transplants Is islet replacement a viable option? 2000 1800 1600

More information

Optimal glucose control. DM Treatment. Glucose Control one out of many. Many guidelines: Confusing. Theorectically easy

Optimal glucose control. DM Treatment. Glucose Control one out of many. Many guidelines: Confusing. Theorectically easy DM Treatment How to Achieve Optimal Glycaemic Control The Tung Wah Eastern Hospital Experience of DM Share Care Experience Optimal glucose control Theorectically easy More challenging in the real world

More information

MPB333:Molecular Endocrinology of Obesity and Diabetes

MPB333:Molecular Endocrinology of Obesity and Diabetes MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and

More information

Cell Transplantation and Tissue Engineering

Cell Transplantation and Tissue Engineering 43 Cell Transplantation and Tissue Engineering Leader Aksel Foss, Professor, MD, PhD, MHA, FEBS (OUH/UiO) Scientific Staff Hanne Scholz, Msc, PhD, Senior Scientist (OUH) Olle Korsgren, Prof, MD, PhD (Uppsala

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

Regulatory B cells in autoimmunity. Liwei Lu University of Hong Kong, China

Regulatory B cells in autoimmunity. Liwei Lu University of Hong Kong, China Regulatory B cells in autoimmunity Liwei Lu University of Hong Kong, China Multiple functions of B cells in immunity LeBien and Tedder, Blood (2008) B cell functions in autoimmune pathogenesis The Immunopathogensis

More information

Clinical Policy: Pancreas Transplantation Reference Number: PA.CP.MP.102

Clinical Policy: Pancreas Transplantation Reference Number: PA.CP.MP.102 Clinical Policy: Reference Number: PA.CP.MP.102 Effective Date: 01/18 Last Review Date: 03/17 Revision Log Coding Implications Description This policy describes the medical necessity requirements for pancreas

More information

Disclosure. Learning Objectives. Case. Diabetes Update: Incretin Agents in Diabetes-When to Use Them? I have no disclosures to declare

Disclosure. Learning Objectives. Case. Diabetes Update: Incretin Agents in Diabetes-When to Use Them? I have no disclosures to declare Disclosure Diabetes Update: Incretin Agents in Diabetes-When to Use Them? I have no disclosures to declare Spring Therapeutics Update 2011 CSHP BC Branch Anar Dossa BScPharm Pharm D CDE April 20, 2011

More information

SEVENTH EDITION CHAPTER

SEVENTH EDITION CHAPTER Judy Owen Jenni Punt Sharon Stranford Kuby Immunology SEVENTH EDITION CHAPTER 16 Tolerance, Autoimmunity, and Transplantation Copyright 2013 by W. H. Freeman and Company Immune tolerance: history * Some

More information

Evidence-Based Glucose Management in Type 2 Diabetes

Evidence-Based Glucose Management in Type 2 Diabetes Evidence-Based Glucose Management in Type 2 Diabetes James R. Gavin III, MD, PhD CEO and Chief Medical Officer Healing Our Village, Inc. Clinical Professor of Medicine Emory University School of Medicine

More information

INJECTABLE THERAPY FOR THE TREATMENT OF DIABETES

INJECTABLE THERAPY FOR THE TREATMENT OF DIABETES INJECTABLE THERAPY FOR THE TREATMENT OF DIABETES ARSHNA SANGHRAJKA DIABETES SPECIALIST PRESCRIBING PHARMACIST OBJECTIVES EXPLORE THE TYPES OF INSULIN AND INJECTABLE DIABETES TREATMENTS AND DEVICES AVAILABLE

More information

Supporting Information

Supporting Information Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed

More information

Diabetes: What is the scope of the problem?

Diabetes: What is the scope of the problem? Diabetes: What is the scope of the problem? Elizabeth R. Seaquist MD Division of Endocrinology and Diabetes Department of Medicine Director, General Clinical Research Center Pennock Family Chair in Diabetes

More information

The regenerative therapy of type 1 diabetes mellitus 21April 2017 Girne, Northern Cyprus 53rd Turkish National Diabetes Congress

The regenerative therapy of type 1 diabetes mellitus 21April 2017 Girne, Northern Cyprus 53rd Turkish National Diabetes Congress The regenerative therapy of type 1 diabetes mellitus 21April 2017 Girne, Northern Cyprus 53rd Turkish National Diabetes Congress Thomas Linn Clinical Research Unit Centre of Internal Medicine Justus Liebig

More information

Stem Cells and The Endometrium. Director, Division of Reproductive Endocrinology and infertility

Stem Cells and The Endometrium. Director, Division of Reproductive Endocrinology and infertility Stem Cells and The Endometrium Hugh S. Taylor, M.D. Director, Division of Reproductive Endocrinology and infertility Nothing to disclose Stem Cells Cells that are capable of both self-renewal and have

More information

Theranostic Agents for Diabetes Therapy

Theranostic Agents for Diabetes Therapy Theranostic Agents for Diabetes Therapy Jeff W.M. Bulte, Ph.D. Professor of Radiology, Oncology, Biomedical Engineering, and Chemical & Biomolecular Engineering Director of Cellular Imaging Institute for

More information

Beta Cell Replacement/Regeneration

Beta Cell Replacement/Regeneration Beta Cell Replacement/Regeneration David M. Harlan, M.D. Captain, U.S. Public Health Service Diabetes Branch/NIDDK July 19, 29 I. Lessons from previous efforts II. Rationale underlying our combined approach

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Är diabetes mellitus en autoimmun sjukdom? Olle Korsgren

Är diabetes mellitus en autoimmun sjukdom? Olle Korsgren Är diabetes mellitus en autoimmun sjukdom? Olle Korsgren Type 1 Diabetes is currently regarded as a T cell mediated autoimmune disease, a notion expressed in over 50 000 scientific publications. Acute

More information

My Journey in Endocrinology. Samuel Cataland M.D

My Journey in Endocrinology. Samuel Cataland M.D My Journey in Endocrinology Samuel Cataland M.D. 1968-2015 Drs Berson M.D. Yalow phd Insulin Radioimmunoassay Nobel Prize Physiology or Medicine 1977 Rosalyn Yalow: Radioimmunoassay Technology Andrew Schally

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Targeting Incretins in Type 2 Diabetes: Role of GLP-1 Receptor Agonists and DPP-4 Inhibitors. Richard E. Pratley and Matthew Gilbert

Targeting Incretins in Type 2 Diabetes: Role of GLP-1 Receptor Agonists and DPP-4 Inhibitors. Richard E. Pratley and Matthew Gilbert REVIEW Targeting Incretins in Type 2 Diabetes: Role of GLP-1 Receptor Agonists and DPP-4 Inhibitors Richard E. Pratley and Matthew Gilbert Diabetes and Metabolism Translational Medicine Unit, University

More information

Future Therapies in the Treatment of Diabetes: Islet Transplantation

Future Therapies in the Treatment of Diabetes: Islet Transplantation Future Therapies in the Treatment of Diabetes: Islet Transplantation Michael R. Rickels, MD, MS Associate Professor of Medicine University of Pennsylvania Perelman School of Medicine Medical Director,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

DPP-4 inhibitor use and risk of diabetic retinopathy: a new safety issue of a safe drug Nam Hoon Kim

DPP-4 inhibitor use and risk of diabetic retinopathy: a new safety issue of a safe drug Nam Hoon Kim DPP-4 inhibitor use and risk of diabetic retinopathy: a new safety issue of a safe drug Nam Hoon Kim Endocrinology of Metabolism, Korea University College of Medicine Conflict of interest disclosure None

More information

Modulating the Incretin System: A New Therapeutic Strategy for Type 2 Diabetes

Modulating the Incretin System: A New Therapeutic Strategy for Type 2 Diabetes Modulating the Incretin System: A New Therapeutic Strategy for Type 2 Diabetes Geneva Clark Briggs, PharmD, BCPS Adjunct Professor at University of Appalachia College of Pharmacy Clinical Associate, Medical

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Immune Modulation of Type1 Diabetes

Immune Modulation of Type1 Diabetes Immune Modulation of Type1 Diabetes Jay S. Skyler, MD, MACP Division of Endocrinology, Diabetes, and Metabolism and Diabetes Research Institute University of Miami Miller School of Medicine Ideal Therapeutic

More information

MOA: Long acting glucagon-like peptide 1 receptor agonist

MOA: Long acting glucagon-like peptide 1 receptor agonist Alexandria Rydz MOA: Long acting glucagon-like peptide 1 receptor agonist Increases glucose dependent insulin secretion Decreases inappropriate glucagon secretion Increases β- cell growth and replication

More information

Novel drug developed to treat type 2 diabetes are neuroprotective Alzheimer s disease

Novel drug developed to treat type 2 diabetes are neuroprotective Alzheimer s disease Novel drug developed to treat type 2 diabetes are neuroprotective Alzheimer s disease Prof. Christian Hölscher, PhD Biomed and Life Sciences Faculty of Health and Medicine Lancaster University, UK Alzheimer

More information

Drugs used in Diabetes. Dr Andrew Smith

Drugs used in Diabetes. Dr Andrew Smith Drugs used in Diabetes Dr Andrew Smith Plan Introduction Insulin Sensitising Drugs: Metformin Glitazones Insulin Secretagogues: Sulphonylureas Meglitinides Others: Acarbose Incretins Amylin Analogues Damaglifozin

More information

Chief of Endocrinology East Orange General Hospital

Chief of Endocrinology East Orange General Hospital Targeting the Incretins System: Can it Improve Our Ability to Treat Type 2 Diabetes? Darshi Sunderam, MD Darshi Sunderam, MD Chief of Endocrinology East Orange General Hospital Age-adjusted Percentage

More information

Immunomodulator y effects of CMV disease

Immunomodulator y effects of CMV disease Immunomodulator y effects of CMV disease Oriol Manuel MD Service of Infectious Diseases and Transplantation Center University Hospital of Lausanne Switzerland Outline The transplant troll The indirect

More information

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have

More information

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE Diabetes: Definition Pathophysiology Treatment Goals By Scott Magee, MD, FACE Disclosures No disclosures to report Definition of Diabetes Mellitus Diabetes Mellitus comprises a group of disorders characterized

More information

Management of Diabetes After Solid Organ Transplantation

Management of Diabetes After Solid Organ Transplantation Management of Diabetes After Solid Organ Transplantation Aidar R. Gosmanov, MD, PhD, FACE Chief, Endocrinology Section Stratton VAMC, Albany, NY Associate Professor of Medicine Division of Endocrinology,

More information

MECHANISMS OF CELLULAR REJECTION IN ORGAN TRANSPLANTATION AN OVERVIEW

MECHANISMS OF CELLULAR REJECTION IN ORGAN TRANSPLANTATION AN OVERVIEW MECHANISMS OF CELLULAR REJECTION IN ORGAN TRANSPLANTATION AN OVERVIEW YVON LEBRANCHU Service Néphrologie et Immunologie Clinique CHU TOURS ANTIGEN PRESENTING CELL CD4 + T CELL CYTOKINE PRODUCTION CLONAL

More information

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction

More information

Liraglutide: the therapeutic promise from animal models

Liraglutide: the therapeutic promise from animal models REVIEW PAPER Liraglutide: the therapeutic promise from animal models L. B. Knudsen Novo Nordisk A S, Novo Nordisk Park, DK-2760, Måløv, Denmark Correspondence to: Lotte Bjerre Knudsen, Department Biology

More information

Encapsulation with Alginates. Berit L. Strand, Yrr Mørch and Gudmund Skjåk-Bræk Norwegian University of Science and Technology

Encapsulation with Alginates. Berit L. Strand, Yrr Mørch and Gudmund Skjåk-Bræk Norwegian University of Science and Technology Encapsulation with Alginates Berit L. Strand, Yrr Mørch and Gudmund Skjåk-Bræk Norwegian University of Science and Technology Microcapsules in cell therapy Stem cells for the formation of new tissue Chondrocytes

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces

More information

Mae Sheikh-Ali, M.D. Assistant Professor of Medicine Division of Endocrinology University of Florida College of Medicine- Jacksonville

Mae Sheikh-Ali, M.D. Assistant Professor of Medicine Division of Endocrinology University of Florida College of Medicine- Jacksonville Mae Sheikh-Ali, M.D. Assistant Professor of Medicine Division of Endocrinology University of Florida College of Medicine- Jacksonville Pathogenesis of Diabetes Mellitus (DM) Criteria for the diagnosis

More information

Nature Medicine: doi: /nm.3922

Nature Medicine: doi: /nm.3922 Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun

More information

STRATEGIES TO IMPROVE MACROENCAPSULATED ISLET GRAFT SURVIVAL

STRATEGIES TO IMPROVE MACROENCAPSULATED ISLET GRAFT SURVIVAL From the DEPARTMENT OF CLINICAL SCIENCE, INTERVENTION AND TECHNOLOGY DIVISION OF TRANSPLANTATION SURGERY Karolinska Institutet, Stockholm, Sweden STRATEGIES TO IMPROVE MACROENCAPSULATED ISLET GRAFT SURVIVAL

More information

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of

More information

New targets for prevention of type 1 diabetes George S. Eisenbarth Barbara Davis Center Unversity Colorado

New targets for prevention of type 1 diabetes George S. Eisenbarth Barbara Davis Center Unversity Colorado New targets for prevention of type 1 diabetes George S. Eisenbarth Barbara Davis Center Unversity Colorado WEB BOOK: Immunology of Type 1 Diabetes HTTP://WWW.BARBARADAVISCENTER.ORG Board Member/Advisory

More information

YOU HAVE DIABETES. Angie O Connor Community Diabetes Nurse Specialist 25th September 2013

YOU HAVE DIABETES. Angie O Connor Community Diabetes Nurse Specialist 25th September 2013 YOU HAVE DIABETES Angie O Connor Community Diabetes Nurse Specialist 25th September 2013 Predicated 2015 figures are already met 1 in 20 have diabetes:1in8 over 60years old Definite Diagnosis is key Early

More information

IMPROVED DIAGNOSIS OF TYPE 2 DIABETES AND TAILORING MEDICATIONS

IMPROVED DIAGNOSIS OF TYPE 2 DIABETES AND TAILORING MEDICATIONS IMPROVED DIAGNOSIS OF TYPE 2 DIABETES AND TAILORING MEDICATIONS Dr Bidhu Mohapatra, MBBS, MD, FRACP Consultant Physician Endocrinology and General Medicine Introduction 382 million people affected by diabetes

More information

Management of Type 2 Diabetes

Management of Type 2 Diabetes Management of Type 2 Diabetes Pathophysiology Insulin resistance and relative insulin deficiency/ defective secretion Not immune mediated No evidence of β cell destruction Increased risk with age, obesity

More information

Prediction and Prevention of Type 1 Diabetes. How far to go?

Prediction and Prevention of Type 1 Diabetes. How far to go? Prediction and Prevention of Type 1 Diabetes. How far to go? Peter Colman Diabetes and Endocrinology Royal Melbourne Hospital Royal Melbourne Hospital Lancet, Saturday 30 th November 1974; p. 1279-1282

More information

22 Emerging Therapies for

22 Emerging Therapies for 22 Emerging Therapies for Treatment of Type 2 Diabetes Siddharth N Shah Abstract: The prevalence of Diabetes is progressively increasing world-wide and the growth of the disease in our country is phenomenal.

More information

DPP-4 inhibitor. The new class drug for Diabetes

DPP-4 inhibitor. The new class drug for Diabetes DPP-4 inhibitor The new class drug for Diabetes 1 Cause of Death in Korea 1 st ; Neoplasm 2 nd ; Cardiovascular Disease 3 rd ; Cerebrovascular Disease Diabetes 2 Incidence of Fatal or Nonfatal MI During

More information

ORIGINAL ARTICLE. Takumi Tsuji 1, Mariko Inoue 1, Yuya Yoshida 1, Tetsuro Fujita 2, Yukikazu Kaino 3, Takeyuki Kohno 1,2 * ABSTRACT

ORIGINAL ARTICLE. Takumi Tsuji 1, Mariko Inoue 1, Yuya Yoshida 1, Tetsuro Fujita 2, Yukikazu Kaino 3, Takeyuki Kohno 1,2 * ABSTRACT ORIGINAL ARTICLE Therapeutic approach for type 1 diabetes mellitus using the novel immunomodulator FTY72 (fingolimod) in combination with once-daily injection of insulin glargine in non-obese diabetic

More information

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model ESM Methods Preparation and characterization of human MAPC Human MAPC (n=2) used in this study were isolated by ReGenesys BVBA (Athersys Inc. affiliate in Heverlee, Belgium) from bone marrow of a 30-year-old

More information

Diabetes mellitus: new challenges and innovative therapies

Diabetes mellitus: new challenges and innovative therapies EPMA Journal (2010) 1:138 163 DOI 10.1007/s13167-010-0010-9 REVIEW ARTICLE Diabetes mellitus: new challenges and innovative therapies Cristina M. Sena & Carla F. Bento & Paulo Pereira & Raquel Seiça Received:

More information

Diabetes mellitus is a complex of syndromes characterized metabolically by hyperglycemia and altered glucose metabolism, and associated

Diabetes mellitus is a complex of syndromes characterized metabolically by hyperglycemia and altered glucose metabolism, and associated Diabetes mellitus is a complex of syndromes characterized metabolically by hyperglycemia and altered glucose metabolism, and associated pathologically with specific microvascular and macrovascular complications.

More information

Basal & GLP-1 Fixed Combination Use

Basal & GLP-1 Fixed Combination Use Basal & GLP-1 Fixed Combination Use Michelle M. Mangual, MD Diplomate of the American board of Internal Medicine and Endocrinology, Diabetes and Metabolism San Juan City hospital Learning Objectives o

More information

Kidney Transplantation

Kidney Transplantation Kidney Tran nsplantation Historical per rspective and current practice Piyanut Poo otracool, M.D. Departmen nt of Surgery, Ramathibo odi Hospital, Mahidol University Kidney Transplantation DDKT Adult deceased

More information

7/8/2016. Sol Jacobs MD, FACE Division of Endocrinology Emory University School of Medicine

7/8/2016. Sol Jacobs MD, FACE Division of Endocrinology Emory University School of Medicine Sol Jacobs MD, FACE Division of Endocrinology Emory University School of Medicine Participation in investigator initiated clinical research supported by: Merck Boehringer Ingelheim Novo Nordisk Astra Zeneca

More information

Paracrine Mechanisms in Adult Stem Cell Signaling and Therapy

Paracrine Mechanisms in Adult Stem Cell Signaling and Therapy Paracrine Mechanisms in Adult Stem Cell Signaling and Therapy Massimiliano Gnecchi, Zhiping Zhang, Aiguo Ni, Victor J. Dzau Circulation Research 2008 Nov 21;103(11):1204-19 Introduction(1) After AMI all

More information

Update on GLP-1 Past Present Future

Update on GLP-1 Past Present Future Update on GLP-1 p Past Present Future Effects of GLP-1: Glucose Metabolism and Nutritional Balance L-Cells: Glp-1 release Betacellfollowing ingestion Stress Increases satiety reduces appetite Betacell-

More information

AACN PCCN Review. Endocrine

AACN PCCN Review. Endocrine AACN PCCN Review Endocrine Presenter: Carol A. Rauen, RN, MS, CCNS, CCRN, PCCN, CEN Independent Clinical Nurse Specialist & Education Consultant rauen.carol104@gmail.com Endocrine I. INTRODUCTION Disorders

More information

Cardiovascular Benefits of Two Classes of Antihyperglycemic Medications

Cardiovascular Benefits of Two Classes of Antihyperglycemic Medications Cardiovascular Benefits of Two Classes of Antihyperglycemic Medications Nathan Woolever, Pharm.D., Resident Pharmacist Pharmacy Grand Rounds November 6 th, 2018 Franciscan Healthcare La Crosse, WI 2017

More information