Mouse Models for Studying Human Islet Transplantation
|
|
|
- Beverly Benson
- 5 years ago
- Views:
Transcription
1 Mouse Models for Studying Human Islet Transplantation Ronald G. Gill, Joshua Beilke,, Nathan Kuhl,, Michelle Kerklo, and Mark M. Nicolls Barbara Davis Center for Childhood Diabetes University of Colorado Health Science Center
2 Can a mouse model form an in vivo potency assay?
3 Mouse Models for Assessing Human Islet Function Immune-suppressed wild-type mice (e.g. anti-cd4) T cell-deficient nude (nu/nu( nu/nu) ) mice Severe-combined immune-deficient (SCID( SCID) Recombinase activating gene 1,2-deficient (Rag( -/- )
4 Insulin akita Mutation Missense mutation (Cys96Tyr) in Insulin 2 (Ins 2) gene Prevents appropriate folding of pro-insulin Autosomal-dominant (chromosome 7) Functions as a dominant-negative Durable and irreversible hyperglycemia (> mg/dl) 500mg/dl) Males more severe than females
5 Rag1 -/- akita Blood Glucose AK-1 AK AK-3 AK-4 AK SZ Blood Glucose Rag1 -/- akita Weight Change ) AK-1 AK-2 AK-3 26 AK-4 AK SZ Streptozotocin Weight 5 Day Weight Change Variability SZ-1 SZ-2 SZ-3 SZ-4 SZ SZ-1 SZ-2 SZ-3 SZ-4 SZ Day SZ-3 SZ-2 SZ-1 SZ-4 SZ-5 Animal
6 Utility of akita mice as islet transplant recipients Mathews, CE et al. Transplantation. 73:1333, 2002
7 Islet Function in C57Bl/6 akita Mice Donor n Graft Function (Days) ISOGRAFTS (C57Bl/6) 8 > 100 (x8) ALLOGRATS (BALB/c) (BALB/c) 3 9, 9, 12
8 Islet Transplantation in B6 Rag1 -/-akita Mice Donor Islets Transplant 2000 IEQ under the kidney capsule of B6 Rag1 -/-akita Monitor blood glucose Nephrectomy immunohistochemistry
9 Correlation between in vitro assays and in vivo function in Rag1 -/-akita mice Purity Viability S.I. In vivo function (>30 days) Yes Yes Yes Yes Yes No No No No No Yes
10 Immune Injury Non-Immune Injury Islets
11 Isolated Islets Highly Express Proteins Associated with ER-Distress Nicolls, MR et al. J. Proteome. Res. 2:199, 2003
12 Function of Islet Grafts in Rag1-/- Recipients Donor n Graft Function (days) Mouse 8 >100 (x 8) Rat (WF) 9 >100 (x 9) Porcine Human >100 (x 12) 47,65,74,91,94 >100 (x12)
13 Spontaneous Failure of Human Islets Rag1 -/-akita Mice Blood Glucose (mm) Human Islet Tp#1 Human Islet Tp#2 Normoglycemia Day Post Transplantation
14 Pathology of Failed Human Islets (day 70) Fibrosis (Tri-Chrome) Amyloid (Thyoflavin S)
15 Failure of hiapp Transgenic Mouse Islets Plasma Glucose (mg/dl) STZ 0 Tx Day 100 tg+ 100 tg
16 α α δ α Donor Islet (pre-transp lant) δ α Islet C ell A ttrition in T ransplantatio n 1. M e c ha n ic a l stre s s fro m is le t iso la tio n, infusion and im plantation in ectopic site. 2. Non-im m une response (Specific Aim 1) 3. Inna te im m une re spo nse (S pec ific A im 2) 4. Adaptive im m une response a. Autoim m une response b. A llo im m une re sp o n se 5. Is le t-to x ic im m uno s up p re s s io n 6. Failure of islet revascularization α α δ α Donor Islet (post-transp lant) Figure 1. Factors influencing loss of islet cells following transplantation.
17 Summary / Conclusions Spontaneously diabetic akita mice demonstrate a stable and irreversible model of hyperglycemia Diabetic akita mice can be readily maintained for 2-33 months prior to transplantation Human islets can reverse diabetes in immune- deficient akita mice (Rag1( -/-akita ) Human islets can spontaneously fail over time from non-immune factors (metabolic distress?)
18 Collaborators Mark Nicolls Michelle Kerklo Gina Rayat Josh Beilke Nathan Kuhl
β-cell Preservation and Regeneration After Islet Transplantation
β-cell Preservation and Regeneration After Islet Transplantation Jyuhn-Huarng Juang, MD Division of Endocrinology and Metabolism, Department of Internal Medicine, Chang Gung University and Memorial Hospital,
Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes
University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference
AMDCC Progress Report Duke/UNC/Stanford Unit. Program Director Thomas M. Coffman, MD
AMDCC Progress Report Duke/UNC/Stanford Unit Program Director Thomas M. Coffman, MD Susceptibility Mutation Model Development + ApoE-/- +STZ Kidney Phenotype Screen Vascular & Kidney Phenotype Screen Generate
Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells
Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Islet Cell Allo-Transplantation. Disclosure. Objectives
Islet Cell Allo-Transplantation Gregory P. Forlenza, MD MCR Assistant Professor Barbara Davis Center University of Colorado Denver Special thanks to Melena Bellin, MD at The University of Minnesota who
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
From Bench to Bedside Regulatory T Cells: Can We Make the Police Work for Us?
From Bench to Bedside Regulatory T Cells: Can We Make the Police Work for Us? Sang Mo Kang, MD Qizhi Tang, PhD UCSF Division of Transplantation UCSF Transplant Conference 2012 The Reality of Immunosuppression
T cell development October 28, Dan Stetson
T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages
Stem Cells and The Endometrium. Director, Division of Reproductive Endocrinology and infertility
Stem Cells and The Endometrium Hugh S. Taylor, M.D. Director, Division of Reproductive Endocrinology and infertility Nothing to disclose Stem Cells Cells that are capable of both self-renewal and have
Jonathan RT Lakey, PhD Associate Professor, Director of Surgical Research Director, Clinical Islet Program
Jonathan RT Lakey, PhD Associate Professor, Director of Surgical Research Director, Clinical Islet Program University of California, Irvine Irvine, CA Challenges and Emerging Opportunities DONOR Donor
Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
Magnetic Resonance Imaging of Transplanted Mouse Islets Labeled With Chitosan-Coated Superparamagnetic Iron Oxide Nanoparticles
Magnetic Resonance Imaging of Transplanted Mouse Islets Labeled With Chitosan-Coated Superparamagnetic Iron Oxide Nanoparticles J.-H. Juang, J.-J. Wang, C.-R. Shen, C.-H. Kuo, Y.-W. Chien, H.-Y. Kuo, Z.-T.
Clinical impact of de-novo HLA antibodies in pancreas and islet transplantation
Clinical impact of de-novo HLA antibodies in pancreas and islet transplantation David Turner, PhD, FRCPath Lead for H&I Services, Scottish National Blood Transfusion Service Treatment of Type I DM Insulin
T Cell Differentiation
T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual
José Oberholzer, MD. Director Charles O. Strickler Transplant Center. Chief, Division of Transplantation
José Oberholzer, MD Director Charles O. Strickler Transplant Center Chief, Division of Transplantation Professor of Surgery and Biomedical Engineering DISCLOSURES No consulting for, no payments, no stocks
Harnessing tolerance mechanisms with monoclonal antibodies Prof. Herman Waldmann
Harnessing tolerance mechanisms Herman Waldmann Sir William Dunn School of Pathology, Oxford University, UK 1 1. Transplantation 2 Lymphocyte depletion strategies to minimise drug immunosuppression in
Kidney Transplantation
Kidney Tran nsplantation Historical per rspective and current practice Piyanut Poo otracool, M.D. Departmen nt of Surgery, Ramathibo odi Hospital, Mahidol University Kidney Transplantation DDKT Adult deceased
MPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue
Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction
Transplantation. Immunology Unit College of Medicine King Saud University
Transplantation Immunology Unit College of Medicine King Saud University Objectives To understand the diversity among human leukocyte antigens (HLA) or major histocompatibility complex (MHC) To know the
Cell Transplantation and Tissue Engineering
43 Cell Transplantation and Tissue Engineering Leader Aksel Foss, Professor, MD, PhD, MHA, FEBS (OUH/UiO) Scientific Staff Hanne Scholz, Msc, PhD, Senior Scientist (OUH) Olle Korsgren, Prof, MD, PhD (Uppsala
Journal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
University of Miami School of Medicine. OCR Index As A Rapid Potency Metric of Isolated Islets of Langerhans By Chris Fraker
University of Miami School of Medicine t1 OCR Index As A Rapid Potency Metric of Isolated Islets of Langerhans By Chris Fraker OBS: How it works An oxygen sensitive Ruthenium-based fluorophore is adsorbed
ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model
ESM Methods Preparation and characterization of human MAPC Human MAPC (n=2) used in this study were isolated by ReGenesys BVBA (Athersys Inc. affiliate in Heverlee, Belgium) from bone marrow of a 30-year-old
Immunology Lecture 4. Clinical Relevance of the Immune System
Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor
Records. Adult Kidney Pancreas Transplant Recipient Registration Worksheet. Recipient Information. Provider Information.
Records Adult Kidney Pancreas Transplant Recipient Registration Worksheet FORM APPROVED: O.M.B. NO. 0915 0157 Expiration Date: 07/31/2020 Note: These worksheets are provided to function as a guide to what
New targets for prevention of type 1 diabetes George S. Eisenbarth Barbara Davis Center Unversity Colorado
New targets for prevention of type 1 diabetes George S. Eisenbarth Barbara Davis Center Unversity Colorado WEB BOOK: Immunology of Type 1 Diabetes HTTP://WWW.BARBARADAVISCENTER.ORG Board Member/Advisory
Caspase Inhibitor Therapy Enhances Marginal Mass Islet Graft Survival and Preserves Long Term Function in Islet Transplantation.
Diabetes In Press, published online February 15, 2007 Caspase Inhibitor Therapy Enhances Marginal Mass Islet Graft Survival and Preserves Long Term Function in Islet Transplantation. Received for publication
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
28/04/51. Introduction. Insulin signaling effects on memory and mood. Is accelerated brain aging a consequence of diabetes? chronic hyperglycemia
Introduction Insulin signaling effects on memory and mood (Review) Diabetes mellitus is a chronic disease resulting from defects in insulin secretion, insulin action, or both Long-term diabetes Lawrence
Success with pancreatic islet transplantation in human. In Vivo Bioluminescence Imaging of Transplanted Islets and Early Detection of Graft Rejection
EXPERIMENTAL TRANSPLANTATION In Vivo Bioluminescence Imaging of Transplanted Islets and Early Detection of Graft Rejection Xiaojuan Chen, Xiaomin Zhang, Courtney S. Larson, Marshall S. Baker, and Dixon
Kidney Disease Research
Thomas Weimbs Assistant Professor, Department of Molecular, Cellular & Developmental Biology Kidney Disease Research The mtor pathway is regulated by polycystin 1, and its inhibition reverses renal cystogenesis
Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
New-onset diabetes after transplantation. Christophe Legendre Université Paris Descartes & Hôpital Necker, Paris.
New-onset diabetes after transplantation Christophe Legendre Université Paris Descartes & Hôpital Necker, Paris. Actualités Jean Hamburger Paris, 23-24 avril 2012 NODAT IFG IGT CJ Yates et al, Am J Transplant
Re-Purposing Drugs for the Treatment of Polycystic Kidney Disease:
Re-Purposing Drugs for the Treatment of Polycystic Kidney Disease: Partnership with the Polycystic Kidney Disease Foundation PKD Models: pcy and jck Mice, PCK Rat PreClinOmics, Inc. 1 PKDF Goals The Accelerating
T Cell Development II: Positive and Negative Selection
T Cell Development II: Positive and Negative Selection 8 88 The two phases of thymic development: - production of T cell receptors for antigen, by rearrangement of the TCR genes CD4 - selection of T cells
Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress
omparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress S DAL, S Sigrist, W Bietiger, Peronet, M Pinget and N Jeandidier
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
A new Rag2/Il2rg SCID rat. Enabling cell line xenografts. Accelerating PDX establishment. Humanizing the immune system
A new Rag2/Il2rg SCID rat Enabling cell line xenografts Accelerating PDX establishment Humanizing the immune system Tseten Yeshi, Ph.D. VP R&D services@herabiolabs.com 859-414-0648 About Hera BioLabs SRG
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Tissue-specific exosome biomarkers for noninvasively monitoring immunologic rejection of transplanted tissue
Tissue-specific exosome biomarkers for noninvasively monitoring immunologic rejection of transplanted tissue Prashanth Vallabhajosyula,, Michael R. Rickels, Ali Naji J Clin Invest. 2017;127(4):1375-1391.
Strain Differences in the Diabetogenic Activity of Streptozotocin in Mice
1110 Biol. Pharm. Bull. 29(6) 1110 1119 (2006) Vol. 29, No. 6 Strain Differences in the Diabetogenic Activity of Streptozotocin in Mice Koji HAYASHI, Rhyoji KOJIMA, and Mikio ITO* Laboratory of Analytical
days days and gbt-i.cd Recipient 20
gbt-i. GFP+ Resident memory cells: gbt-i.gfp+ Recruited memory cells: gbt-i.cd45.1+ 1 2-3 gbt-i. flu.gb sc. CD45.1+ Graft with gbt-i.gfp+ 1 Recipient 1 re- 3 36 Graft with gbt-i.gfp+ and gbt-i.cd45.1+
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Robert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School
Harvard-MIT Division of Health Sciences and Technology HST.035: Principle and Practice of Human Pathology Dr. Robert B. Colvin Transplantation: Friendly organs in a hostile environment Robert B. Colvin,
Biological Basis for Increased Risk of Graft Loss in African American (AA)-APOL1 and Beyond
Biological Basis for Increased Risk of Graft Loss in African American (AA)-APOL1 and Beyond Jonah Odim, MBA, MD, PhD Chief, Clinical Transplantation Division of Allergy, Immunology, and Transplantation
Vascular Remodelling in Pancreas Transplantation
Vascular Remodelling in Pancreas Transplantation Prof Steve White Consultant HPB/Transplant Surgeon The Freeman Hospital Newcastle President Elect EPITA European Pancreas Transplants Pancreas Transplants
The Hypoglycemic Phenotype Is Islet Cell Autonomous in Short-Chain Hydroxyacyl-CoA Dehydrogenase Deficient Mice
1672 Diabetes Volume 65, June 2016 Anders Molven, 1,2,3,4 Jennifer Hollister-Lock, 1 Jiang Hu, 1 Rachael Martinez, 1 Pål R. Njølstad, 3,5 Chong Wee Liew, 1,6 Gordon Weir, 1 and Rohit N. Kulkarni 1,7,8
T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015
T Cell Development Xuefang Cao, MD, PhD November 3, 2015 Thymocytes in the cortex of the thymus Early thymocytes development Positive and negative selection Lineage commitment Exit from the thymus and
Briefing - The Kidney Project
Briefing - Goal 1 - Implantable Artificial Kidney Shuvo Roy, PhD Professor Department of Bioengineering and Therapeutic Sciences Department of Surgery Schools of Pharmacy and Medicine UC San Francisco
SUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION doi:10.1038/nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure 1. -. Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm
Improving the Quality of Life for Patients with Chronic Disease
TSX-V: SVA OTCQB: SEOVF - 2017 Presentation June, 2017 Improving the Quality of Life for Patients with Chronic Disease Forward Looking Statements 2 This presentation may contain forward looking statements.
The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Prof. Derek LeRoith
The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Derek LeRoith MD PhD Division of Endocrinology, Diabetes and Bone Diseases Mt Sinai School of Medicine, NY 1 GH/IGF-1 axis Agenda:
BDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides
BDC Keystone Genetics Type 1 Diabetes www.barbaradaviscenter.org Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA
Clinical Policy: Pancreas Transplantation Reference Number: PA.CP.MP.102
Clinical Policy: Reference Number: PA.CP.MP.102 Effective Date: 01/18 Last Review Date: 03/17 Revision Log Coding Implications Description This policy describes the medical necessity requirements for pancreas
Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro.
Manuscript EMBO-2015-91058 Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. Holger A Russ, Audrey V Parent, Jennifer J Ringler, Thomas G Hennings, Gopika
Tenth Annual Report. Prepared by: CITR Coordinating Center The Emmes Corporation Rockville, MD
Tenth Annual Report Prepared by: CITR Coordinating Center The Emmes Corporation Rockville, MD Sponsored by: National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health
Advances in Beta Cell Imaging
Practical Ways to Achieve Targets In Diabetes Care Keystone, Colorado July 15, 2012. Advances in Beta Cell Imaging Gary Cline, Ph.D. Yale University Keystone, Colorado July 15, 2012. Duality of Interest
Islet-Expressed CXCL10 Promotes Autoimmune Destruction of Islet Isografts in Mice With Type 1 Diabetes
Diabetes Volume 66, January 2017 113 Christine Bender, 1 Selina Christen, 1 Klaus Scholich, 2 Monika Bayer, 1 Josef M. Pfeilschifter, 1 Edith Hintermann, 1 and Urs Christen 1 Islet-Expressed CXCL10 Promotes
NHS BLOOD AND TRANSPLANT ORGAN DONATION AND TRANSPLANTATION DIRECTORATE PANCREAS ADVISORY GROUP AUDIT OF STANDARD CRITERIA FOR LISTING SUMMARY
INTRODUCTION NHS BLOOD AND TRANSPLANT ORGAN DONATION AND TRANSPLANTATION DIRECTORATE PANCREAS ADVISORY GROUP AUDIT OF STANDARD CRITERIA FOR LISTING SUMMARY 1 Selection criteria for patients onto the national
Generation of pancreatic β cells for treatment of diabetes: advances and challenges
Shahjalal et al. Stem Cell Research & Therapy (2018) 9:355 https://doi.org/10.1186/s13287-018-1099-3 REVIEW Generation of pancreatic β cells for treatment of diabetes: advances and challenges Hussain Md.
Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
Transgenic expression of CD95 ligand on islet cells induces a granulocytic infiltration but does not confer immune privilege upon islet allografts
Proc. Natl. Acad. Sci. USA Vol. 94, pp. 3943 3947, April 1997 Immunology Transgenic expression of CD95 ligand on islet cells induces a granulocytic infiltration but does not confer immune privilege upon
Future Therapies in the Treatment of Diabetes: Islet Transplantation
Future Therapies in the Treatment of Diabetes: Islet Transplantation Michael R. Rickels, MD, MS Associate Professor of Medicine University of Pennsylvania Perelman School of Medicine Medical Director,
Identification of novel immune regulators of tumor growth using highthroughput
Identification of novel immune regulators of tumor growth using highthroughput screening in vivo Tom Brennan 1 Five Prime s Unique Platform Tests Nearly Every Extracellular Protein to Identify Protein
Endocrine replacement therapy by islet transplantation
Indefinite Survival of Neonatal Porcine Islet Xenografts by Simultaneous Targeting of LFA-1 and CD154 or CD45RB Gina R. Rayat 1 and Ronald G. Gill 2 A variety of transient therapies directed against molecules
Pathways to Protecting from Autoimmunity the Resurrected/Regenerated Beta Cells. Jeffrey Bluestone, PhD Diabetes Center at UCSF
Pathways to Protecting from Autoimmunity the Resurrected/Regenerated Beta Cells Jeffrey Bluestone, PhD Diabetes Center at UCSF Number of Transplants Is islet replacement a viable option? 2000 1800 1600
Improving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
Recent studies have demonstrated that intrathymic
Intrathymic Islet Cell Transplantation Reduces p-cell Autoimmunity and Prevents Diabetes in NOD/Lt Mice IVAN C. GERLING, DAVID V. SERREZE, SHERRI W. CHRISTIANSON, AND EDWARD H. LEITER Intrathymic transplantation
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of
Scores in kidney transplantation: How can we use them?
Scores in kidney transplantation: How can we use them? Actualités Néphrologiques 2017 M Hazzan (Lille France ) Contents Scores to estimate the quality of the graft Scores to estimate old candidates to
Pancreas After Islet Transplantation: A First Report of the International Pancreas Transplant Registry
American Journal of Transplantation 2016; 16: 688 693 Wiley Periodicals Inc. Brief Communication Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons doi:
EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 37, No. 6, , December 2005
EXPERIMENTL and MOLECULR MEDICINE, Vol. 37, No. 6, 513-523, December 25 Effective glycemic control achieved by transplanting non-viral cationic liposome-mediated VEGF-transfected islets in streptozotocin-induced
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
9.3 Stress Response and Blood Sugar
9.3 Stress Response and Blood Sugar Regulate Stress Response Regulate Blood Sugar Stress Response Involves hormone pathways that regulate metabolism, heart, rate and breathing The Adrenal Glands a pair
Supplementary Figure 1: Imaging T-ALL progression and growth in transplanted
Supplementary Figure 1: Imaging T-ALL progression and growth in transplanted rag2e450fs fish. Monoclonal T-ALLs were serially passaged in strain fish and then used as donors (left panel). Cells were transplanted
(Psidium guava Extract) -
347-354 (4 ) 10 1390 -. (Psidium guava Extract) - 5 4 3 2 *2 1 :. -.. 250-180 18 : 10. (STZ) mg/kg 60-1... :. - :. : -1-2 -3-4 -5 09133251067 : : solnep2002@yahoo.com : ... (Psidium guava Extract) - :
Designing An)gen- specific Immunotherapy for Treatment of Type 1 Diabetes.
Designing An)gen- specific Immunotherapy for Treatment of Type 1 Diabetes. Kristin V. Tarbell Immune Tolerance Unit, Diabetes Endocrinology and Obesity Branch, NIDDK Outline Background on type 1 diabetes
Transplantation sites for porcine islets
Diabetologia (17) :197 197 DOI 1.17/s1-17-33-7 SHORT COMMUNICATION Transplantation sites for porcine islets Rebecca A. Stokes 1,,3 & Denbigh M. Simond 3,, & Heather Burns 3, & Anita T. Patel 3, & Philip
Cell Therapy for Lung Indications Choosing the appropriate IND Enabling Animal Model
Cell Therapy for Lung Indications Choosing the appropriate IND Enabling Animal Model Marlowe Eldridge MD Department of Pediatrics and Biomedical Engineering University of Wisconsin School of Medicine and
Nephrogram type. Days between first and second NCCT
Supplemental Table 1. Characteristics of patients with multiple unenhanced CT scans number Contrastenhanced procedure Pre-CE exam egfr present at first NCCT type Days between first and second NCCT present
Transplant A Report from Baylor Annette C. and Harold C. Simmons Transplant Institute Living Liver Donation: An Attractive Option for Some Patients
TransplantUpdate A Report from Baylor Annette C. and Harold C. Simmons Transplant Institute Volume 5 Number 2 Living Liver Donation: An Attractive Option for Some Patients 2 Advanced liver disease is debilitating,
In Vivo Response of Type I Diabetic Bone to Mechanical Loading Depends on gender and/or Disease Severity
In Vivo Response of Type I Diabetic Bone to Mechanical Loading Depends on gender and/or Disease Severity Ashutosh Parajuli 1, Xiaoyu D. Gu 1, Xiaohan Lai 1, Hong Zhang 2, Mia M. Thi, PhD 3, Christopher
Tumor targeting antibodies bridge innate to adaptive immunity. Yang-Xin Fu MD PhD Professor of Pathology and Immunology UT Southwestern
Tumor targeting antibodies bridge innate to adaptive immunity Yang-Xin Fu MD PhD Professor of Pathology and Immunology UT Southwestern Tumor targeting antibodies are screened and selected to kill tumor
Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert)
Development of a Conditional Replication Competent Adenovirus, Controlled by the Human Telomerase Promoter (htert) Eunhee Kim, Joo-Hang Kim, M.D., Ha-Youn Shin, Han Saem Lee, Joo-Hyuk Sohn, M.D., Jai Myung
The state of affairs of allogenic islet transplantation. William Bennet MD, PhD Fellow Division of Transplant Surgery UCHSC
The state of affairs of allogenic islet transplantation William Bennet MD, PhD Fellow Division of Transplant Surgery UCHSC Global epidemiology of Diabetes Mellitus IDDM NIDDM 1997 3 700 000 120 300 000
This study is currently recruiting participants.
A Two Part, Phase 1/2, Safety, PK and PD Study of TOL101, an Anti-TCR Monoclonal Antibody for Prophylaxis of Acute Organ Rejection in Patients Receiving Renal Transplantation This study is currently recruiting
Andrea s SI Session PCB Practice Test Test 3
Practice Test Test 3 READ BEFORE STARTING PRACTICE TEST: Remember to please use this practice test as a tool to measure your knowledge, and DO NOT use it as your only tool to study for the test, since
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
Mouse Models of Diabetic Nephropathy. Mount Sinai / Jefferson / Einstein / Minnesota Erwin Böttinger, PI Kumar Sharma, Co-PI
Mouse Models of Diabetic Nephropathy Mount Sinai / Jefferson / Einstein / Minnesota Erwin Böttinger, PI Kumar Sharma, Co-PI Group Members Mount Sinai: Phenotyping, Molecular Pathology & Validation Erwin
Using the cost effectiveness of allogeneic islet transplantation to inform induced pluripotent stem cell-derived β-cell therapy reimbursement
For reprint orders, please contact: reprints@futuremedicine.com Using the cost effectiveness of allogeneic islet transplantation to inform induced pluripotent stem cell-derived β-cell therapy reimbursement
Interleukin-20 is associated with delayed healing in diabetic wounds
Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural
Michigan/Chicago unit
Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression
Allogeneic Pancreas Transplant
Protocol Allogeneic Pancreas Transplant (70302) Medical Benefit Effective Date: 07/01/14 Next Review Date: 05/18 Preauthorization Yes Review Dates: 09/09, 09/10, 09/11, 07/12, 05/13, 05/14, 05/15, 05/16,
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic