aortic thromboembolism : ATE ATE ATE LOGIQ P ATE ECLOS ATE computed tomography fibrin/fibrinogen degradation products : FDP
|
|
- Victor Boyd
- 5 years ago
- Views:
Transcription
1 h h CT ATE.... Dh AST CK ALT Dh ATE Dh ATE Dh aortic thromboembolism : ATE ATE ATE ATE ATE computed tomography : CT ATE Dh fibrin/fibrinogen degradation products : FDP Dh FDP LOGIQ P GE CT ECLOS.... CT h h hh FAX hh kuniya@camic.jp 137
2 /l ASTCK ALT D h.. g/dl FDP CT CT.mg/kg/day KC kg kg kg kg 138 RBC l Hb gdl MCV fl MCHCgdl PCV TP gdl NE WBC l Band Seg Lym Mon Eos Bas Other Plat l TP gdl Alb gdl ALT Ul AST Ul ALP Ul ThBil Ul Glu gdl Thcho gdl BUN gdl Cre gdl Ca mmoldl NE P mmoldl NE Na mmoldl K mmoldl Cl mmoldl CK Ul NE Dhgdl FDPgdl NE NE not examined ATE ATE ATE. h h ATE ATE
3 CT CT mm CT mm h CT ATE X magnetic resonance imaging : MRIh ASTCKALTLDH BUNCre,, Dh ASTCKALT Dh ASTCKALT FDP Dh Dh FDP Dh disseminated intravascular coagulation : DIC FDP Dh, Dh pulmonary thromboembolism : PTEdeep vein thrombosis : DVT DIC PTE, h Dh ATE Dh ATE Dh ATE Dh ATE Dh Dh ATE ATE Dh 139
4 DIC ATE h,,, h ATE, ATE tissue-plasminogen activator : t-pa,,, h t-pa,,,,,, ATE ATE,, ATE QOL ATE ATE ATE ATE ATE Dh Lake-Bakaar GA, Johnson EG, Griffiths LG : Aortic thrombosis in dogs: cases (h), J Am Vet Med Assoc,, h () Ware WA : Thromboembolic Disease, Small Animal Internal Medicine, Nelson RW, ed, th ed, h, Mosby Elesevier () Goncalves R, Penderis J, Chang YP, Mosley J, Anderson TJ : Clinical and neurological characteristics of aortic thromboembolism in dogs, J Small Anim Pract,, h () Brofman PJ, Thrall DE : Magnetic resonance imaging findings in a dog with caudal aortic thromboembolism and icchemic myopathy, Vet Radiol Ultrasound,, h () Boswood A, Lamb CR, White RN : Aortic and iliac thrombosis in six dogs, J Small Anim Pract,, h () Dunn ME : Thrombectomy and thrombolysis: the interventional radiology approach, J Vet Emerg Crit Care,, h () DVT/PE h() DIC h 140
5 Nelson OL, Andreasen C : The utility of plasma D- dimer to identify thromboembolic disease in dogs, J Vet Intern Med,, h () Stokol T : Plasma D-dimer for the diagnosis of thromboembolic disorders in dogs, Vet Clin North Am Small Anim Pract,, h () Caldin M, Furlanello T, Lubas G : Validation of an immunoturbidimetric D-dimer assay in canine citrated plasma, Vet Clin Pathol,, h () Stokol T, Brooks MB, Erb HN, Mauldin GE : D-dimer concentrations in healthy dogs and dogs with disseminated intravascular coagulation, Am J Vet Res,, h () Ridyard AE, Shaw DJ, Milne EM : Evaluation of platelet activation in canine immune-mediated haemolytic anaemia, J Small Anim Pract,, h () Robert G : Pulmpnary thronboembolism, J Vet Emerg Crti Care,, h () Wells R, Guth A, Lappin M, Dow S : Anti-endothelial cell antibodies in dogs with immune-mediated hemolytic anemia and other diseases associated with high risk of thromboembolism, J Vet Intern Med,, h () Jacoby RC, Owings JT, Ortega T, Gosselin R, Feldman EC : Biochemical basis for the hypercoagulable state seen in Cushing syndrome, Arch Surg,, h () Johnson LR, Lappin MR, Baker DC : Pulmonary thromboembolism in dogs: h, J Vet Intern Med,, h () LaRue MJ, Murtaugh RJ : Pulmonary thromboembolism in dogs: cases (h), J Am Vet Med Assoc,, h () Schaub RG, Rawlings CA, Keith JC Jr : Platelet adhesion and myointimal proliferation in canine pulmonary arteries, Am J Pathol,, h () h h Scott KC, Hansen BD, DeFrancesco TC : Coagulation effects of low molecular weight heparin compared with heparin in dogs considered to be at risk for clinically significant venous thrombosis, J Vet Emerg Crit Care,, h () Bliss SP, Bliss SK, Harvey HJ : Use of recombinant tissue-plasminogen activator in a dog with chylothorax secondary to catheter-associated thrombosis of the cranial vena cava, J Am Anim Hosp Assoc,, h () Boudreaux MK, Dillon AR, Ravis WR, Sartin EA, Spano JS : Effects of treatment with aspirin or aspirin/dipyridamole combination in heartworm-negative, heartworm-infected, and embolized heartworm-infected dogs, Am J Vet Res,, h () Calvert CA, Thrall DE : Treatment of canine heartworm disease coexiting with right-side heart failure, J Am Med Assoc,, h () h h Clinical and Clinicopathological Findings in Four Dogs with Aortic Thromboembolism Takashi KUNIYA, Asuka SUBE, Michiya KANEMURA and Naoyuki WATANABE Watanabe Animal Hospital, 825h10 Oyanagi, Shimada, 427h0101, Japan To describe the characteristics of clinical signs and clinicopathological findings in dogs with aortic thromboembolism (ATE), the medical records of four dogs diagnosed with ATE were reviewed retrospectively. The diagnosis of ATE was based on computed tomography (CT) imaging. Four dogs ( years) presented with evaluation of progressive paresis. All the dogs had clinical signs of pelvic limb lameness prior to presentation. The onset of clinical signs was chronic ( days) in all the dogs. Laboratory findings revealed high D-dimer concentration (four dogs), aspartate aminotransferase activity (three dogs), creatine kinase activity (three dogs), alanine aminotransferase (three dogs) and mild thrombocytopenia (three dogs). This result suggests that high D-dimer concentration is correlated with ATE in aged dogs presenting clinical signs of pelvic limb lameness with chronic onset. D-dimer combined with other clinical examinations might be useful to support the diagnosis of ATE in dogs. Key words : aortic thromboembolism, D-dimer, dog. Correspondence to : Takashi KUNIYA (Watanabe Animal Hospital) 825h10 Oyanagi, Shimada, 427h0101, Japan TEL 0547h38h0144 FAX 0547h38h kuniya@camic.jp J. Jpn. Vet. Med. Assoc.,, () 141
VAD. ALT TP Glb Ca CT MRI. . mg/dl X X A CT VAD VAD. GdhDTPA T.
VAD h h h hh ALTTPGlbCa CTMRI MP Ca VAD QOL VAD MP MP VAD MP VAD kg PCV.;RPI.WBC,/l ALT IU/l TP. g/dlglb. g/dl Ca. mg/dl X X A CT MRI CT BCT MRI T T GdhDTPAT T ChF h h hh FAX hh E-mail : sayochan@vet.osakafu-u.ac.jp
More informationCavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
More informationPakistan Veterinary Journal
RESEARCH ARTICLE Pakistan Veterinary Journal ISSN: 0253-8318 (PRINT), 2074-7764 (ONLINE) Accessible at: www.pvj.com.pk Evaluation of D-Dimer Concentrations in Clinically Ill Dogs with High Risk of Thromboembolic
More informationRoyal Animal Medical Center, Seoul 02117, Republic of Korea
Comparison Between a Continuous Rate Infusion Protocol and an Accelerated Dosing Protocol Using tissue Plasminogen Activator for Thrombolysis in Cats and Dogs Ye-In Oh 1, 2 Hye-Jin Hwang 1 Sang-Hun Han
More informationNSAidS & ANticoAgulANtS
Peer reviewed heartworm hotline NSAidS & ANticoAgulANtS Use in Management of Heartworm Infection Clarke Atkins, DVM, Diplomate ACVIM (Internal Medicine & Cardiology) The Heartworm Hotline column is cosponsored
More informationShoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report
J Cardiol 2007 Jun; 49 6 : 361 365 1 Shoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report Yuko Masaki Masaaki Masamichi Takakazu Jun-ichi Tetsuya Toshinari Osamu Fusako Shinsuke Seiki
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationCoronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report
J Cardiol 2005 Mar; 453: 115 121 1 Coronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report Takatomi Eiji Shinya Yasuhiro Kazuo
More informationDisseminated intravascular coagulation (DIC) Dr. Klara Vezendi Szeged University Transfusiology Department
Disseminated intravascular coagulation (DIC) Dr. Klara Vezendi Szeged University Transfusiology Department Disseminated intravascular coagulation (DIC, consumptive coagulopathy) is a clinicopathologic
More informationAcute Thrombocytopenia after Initiating Anticoagulation with Rivaroxaban
CASE REPORT Acute Thrombocytopenia after Initiating Anticoagulation with Rivaroxaban Yohei Mima 1, Yuhei Sangatsuda 2, Masahiro Yasaka 1, Yoshiyuki Wakugawa 1, Shinji Nagata 2 and Yasushi Okada 1 Abstract
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationIMAGING DIAGNOSIS AORTIC THROMBOEMBOLISM ASSOCIATED WITH SPIROCERCOSIS IN A DOG
IMAGING DIAGNOSIS AORTIC THROMBOEMBOLISM ASSOCIATED WITH SPIROCERCOSIS IN A DOG Robert M. Kirberger 1, Anthony Zambelli 1 1 Department of Companion Animal Clinical Studies, Faculty of Veterinary Science,
More informationInterventional Treatment VTE: Radiologic Approach
Interventional Treatment VTE: Radiologic Approach Hae Giu Lee, MD Professor, Dept of Radiology Seoul St. Mary s Hospital The Catholic University of Korea Introduction Incidence High incidence: 250,000-1,000,000/year
More informationTHROMBOEMBOLISM DIAGNOSTIC CRITERIA
THROMBOEMBOLISM Crystal Hoh, DVM Resident, Small Animal Internal Medicine Maureen McMichael, DVM, DACVECC Associate Professor and Section Chief, Emergency/Critical Care Service College of Veterinary Medicine
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationDepartment of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationNodular Muscular Sarcoidosis Extending to All Limb Muscles
47 1997 CD4/8 MRI T1 T2 74.6 IU/l 46.0 µg/ml MRI [ ] MRI Nodular Muscular Sarcoidosis Extending to All Limb Muscles Takahiro Nishitake, Eishi Miyazaki, Masaru Ando, Tetsujiro Fukami, Osamu Matsuno, Takuya
More informationDeep Vein Thrombosis and Pulmonary Embolism: Patient Information
Deep Vein Thrombosis and Pulmonary Embolism: Patient Information A Deep Vein Thrombosis (DVT) and a Pulmonary Embolism (PE) are both disorders of unwanted blood clotting. Unwanted blood clots can occur
More informationTriage D-Dimer Test. Pulmonary embolism? A rapid disposition can be a matter of life or death.
BR9810000EN00.qxp_Layout 1 3/6/18 11:56 AM Page 3 Triage D-Dimer Test Pulmonary embolism? A rapid disposition can be a matter of life or death. SL2713 BR9810000EN00 (03/18) BR9810000EN00.qxp_Layout 1 3/6/18
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationLow Dose versus High Dose Heparinization during Post Cardiotomy ECMO: A Case Control Study Disclosures Introduction
Low Dose versus High Dose Heparinization during Post Cardiotomy ECMO: A Case Control Study Vanessa Arnold, BS Mindy M Blackwell, MS, CCP Perfusion Technology Program College of Health Sciences Rush University
More informationPulmonary embolism? A rapid disposition can be a matter of life or death.
Pulmonary embolism? A rapid disposition can be a matter of life or death. Not all D-dimer tests are created equal. D-dimer assays are known to have varying sensitivities. 8,9,10 ELISA and FIA assays have
More informationAIDS. 1) Mycobacterium avium MRI (T2WI) HTLV-1 AIDS. Key words: Mycobacterium avium AIDS. Mycobacterium. complex MAC M. avium M.
2008 193 AIDS Mycobacterium avium 1) 2) 3) 4) 4) 3) 3) 3) 5) 1) 6) 1) 2) 3) 4) 5) 6) 20 1 30 20 6 13 46 MRI (T2WI) MRI 5 Mycobacterium avium M. avium HIV HTLV-1 AIDS AIDS Key words: Mycobacterium avium
More informationIndex. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Abdominal radiotherapy, toxic effects of, 636 637 Acute promyelocytic leukemia, associated with acquired bleeding problems, 614 615 Acute renal
More informationImmune Mediated Haemolytic Anaemia Secondary to Sheathed Microfilaria A Case Report
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 5 (2017) pp. 603-607 Journal homepage: http://www.ijcmas.com Case Study https://doi.org/10.20546/ijcmas.2017.605.069
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More information10/24/2013. Heparin-Induced Thrombocytopenia (HIT) Anticoagulation Management in ECMO Therapy:
Anticoagulation Management in ECMO Therapy: Heparin-Induced (HIT) Michael H. Creer, MD Professor of Pathology Director, Clinical Laboratories, Medical Co- Director, Hematopathology and Chief, Division
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationThyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation
ISSN 1941-5923 DOI: 10.12659/AJCR.890519 Received: 2014.02.12 Accepted: 2014.03.14 Published: 2014.07.24 Thyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation Authors Contribution:
More informationMultiple studies are available concerning the use of
SPECIAL ARTICLE Evaluation of the Biosite Ò Quantitative Whole Blood D-dimer Assay and Comparison With the biomérieux VIDAS Ò D-dimer Exclusion Test Validation and Utility For Use in the Central Laboratory
More informationProper Diagnosis of Venous Thromboembolism (VTE)
Proper Diagnosis of Venous Thromboembolism (VTE) Whal Lee, M.D. Seoul National University Hospital Department of Radiology 2 nd EFORT Asia Symposium, 3 rd November 2010, Taipei DVT - Risk Factors Previous
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationA Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation
Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA
More informationCirculatory Disturbances 5: Thrombosis, Embolism, Infarction, Shock
Circulatory Disturbances 5: Thrombosis, Embolism, Infarction, Shock Shannon Martinson, Feb 2016 http://people.upei.ca/smartinson/ VPM 152 General Pathology Thrombosis, Embolism, Infarction, Shock Learning
More informationDEEP VENOUS THROMBOSIS A PRACTICAL APPROACH TO IMPROVING CLINICAL OUTCOMES
DEEP VENOUS THROMBOSIS A PRACTICAL APPROACH TO IMPROVING CLINICAL OUTCOMES Jose M. Borromeo M.D. Vascular Surgeon Iowa Heart Center Disclosures: AstraZeneca Pharmaceuticals Cook CVRx LeMaitre Vascular,
More informationPulmonary thromboembolism (PTE) is a complication of
J Vet Intern Med 999;3:338 345 Pulmonary Thromboembolism in 29 Dogs: 985 995 Lynelle R. Johnson, Michael R. Lappin, and Dale C. Baker Pulmonary thromboembolism (PTE) occurs as a complication to a number
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationIVC FILTERS: A CASE REPORT REVIEWING THE INDICATIONS FOR PLACEMENT, RETRIEVAL AND ANTICOAGULATION
IVC FILTERS: A CASE REPORT REVIEWING THE INDICATIONS FOR PLACEMENT, RETRIEVAL AND ANTICOAGULATION Resident(s): George Athanasatos Attending(s): Daniel Golwyn Program/Dept: Interventional Radiology CHIEF
More information,**2 AIDS +, + CMV AIDS : CMV +* :,**,*/,**2 HIV CMV CMV ,**0,,**1 - S -,/ -2.* +.* CMV : *0* *2+/ +/ CMV ,**2 1 +.
**2 The Japanese Society for AIDS Research The Journal of AIDS Research AIDS + + + + + + + - : CMV CMV AIDS : /1 **1 - CMV HIV : CMV CMV : AIDS HIV +* : ** */ **2 CMV AIDS CT + CMV CMV + CRP AST AIDS LDH
More informationBorderline cytopenias. Dr Taku Sugai Consultant Haematologist
Borderline cytopenias Dr Taku Sugai Consultant Haematologist Borderline cytopenias Neutropenia Thrombocytopenia Anaemia with normal haematinics Two recent cases of cytopenias Neutropenia ANC of more than
More informationEAST MULTICENTER STUDY DATA DICTIONARY
EAST MULTICENTER STUDY DATA DICTIONARY Does the Addition of Daily Aspirin to Standard Deep Venous Thrombosis Prophylaxis Reduce the Rate of Venous Thromboembolic Events? Data Entry Points and appropriate
More informationPatients with suspected DVT of the lower limb how to exam the patient
Patients with suspected DVT of the lower limb how to exam the patient Johannes Godt Dep. of Radiology and Nuclear Medicine Oslo University Hospital Ullevål NORDTER 2015, Oslo Content Anatomy and pathophysiology
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationINTRAHEPATIC PSS: AN INTERVENTIONALIST S PERSPECTIVE
INTRAHEPATIC PSS: AN INTERVENTIONALIST S PERSPECTIVE Matthew W. Beal, DVM, DACVECC College of Veterinary Medicine, Michigan State University, East Lansing, MI Key Points: Percutaneous transjugular coil
More information2010 Miniboard Exam- Clinical Pathology
2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)
More informationcm 8 1 / Computed Tomography CT Fig Tel:
12 103 107 2003 1 1 1 1 2 1 25 1.5 1.2cm 8 1 / 3 12 103 107 2003 1 2 5 25 1999 Computed Tomography CT 2000 1Tel: 03-5803-5253 2 113-8519 1-5-45 2002 8 26 2003 4 1 11 16 162.4cm 46kg 37.2 C 102 / 66mmHg72
More informationcgmp RAAS Car Car RAAS Mil Car PDE Mil ISACHC b Car qq
h h h h X CO, RAAS Mil Car Mil PDE PDE Ca Car cgmp RAAS Car Mil Car Mil RAAS Car CO Mil Car ISACHC b Mil Car ml/kg/hr Mil. g/ kg/min Car. g/ h h h h FAX h h E-mail : qq h @image.ocn.ne.jp 728 kg ISACHC
More informationPulmonary Thromboembolism
Pulmonary Thromboembolism James Allen, MD Epidemiology of Pulmonary Embolism 1,500,000 new cases per year in the United States Often asymptomatic 300,000 deaths per year DVT or PE present in 10% of ICU
More informationTHROMBOEMBOLIC EVENTS AFTER IVC FILTER PLACEMENT IN TRAUMA PATIENTS. Lidie Lajoie, MD SUNY Downstate Department of Surgery December 20, 2012
THROMBOEMBOLIC EVENTS AFTER IVC FILTER PLACEMENT IN TRAUMA PATIENTS Lidie Lajoie, MD SUNY Downstate Department of Surgery December 20, 2012 Background Trauma Patients at High Risk for VTE Spain, D.A.,
More informationEKOS. Interventional Vascular 3 February, Imagine where we can go.
EKOS Interventional Vascular 3 February, 2015 Imagine where we can go. Forward-looking statement This presentation and information communicated verbally to you may contain certain projections and other
More informationCLINICAL PRESENTATION AND RADIOLOGY QUIZ QUESTION
Donald L. Renfrew, MD Radiology Associates of the Fox Valley, 333 N. Commercial Street, Suite 100, Neenah, WI 54956 6/23/2012 Radiology Quiz of the Week # 78 Page 1 CLINICAL PRESENTATION AND RADIOLOGY
More informationClinical Implications of the Impact of Serum Tissue Factor Levels after Trauma
Clinical Implications of the Impact of Serum Tissue Factor Levels after Trauma Ian E. Brown, MD, PhD, and Joseph M. Galante MD, FACS Formatted: Font: 16 pt, Bold Formatted: Centered Formatted: Font: Bold
More informationCholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report
J Cardiol 2006 Oct; 48 4 : 221 226 X 1 Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report Tomohiko Mitsunobu Masahiro Kazuyuki IWATA, MD MURATA, MD
More informationESIM 2014 Clinical Case Presentation Israel. Ben-Sasson Maayan Bnei-Zion medical center Haifa
ESIM 2014 Clinical Case Presentation Israel Ben-Sasson Maayan Bnei-Zion medical center Haifa Presentation A 24 YO male,a ping-pong player, presented to the ER with acute onset of right upper extremity
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationThe Use of Thrombolytic Agents
CE Article #2 Illustration by Felecia Paras Megan F. Whelan, DVM Therese E. O Toole, DVM, DACVIM Tufts Cummings School of Veterinary Medicine North Grafton, Massachusetts ABSTRACT: Thrombi and thromboemboli
More informationBard Meridian Filter Fracture
Bard Meridian Filter Fracture The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Wu, Alex et al. Bard
More informationMASSIVE TRANSFUSION DR.K.HITESH KUMAR FINAL YEAR PG DEPT. OF TRANSFUSION MEDICINE
MASSIVE TRANSFUSION DR.K.HITESH KUMAR FINAL YEAR PG DEPT. OF TRANSFUSION MEDICINE CONTENTS Definition Indications Transfusion trigger Massive transfusion protocol Complications DEFINITION Massive transfusion:
More informationPortal vein thrombosis (PVT) refers to partial or
J Vet Intern Med 2012;26:230 237 Portal Vein Thrombosis in 33 Dogs: 1998 2011 M. Respess, T.E. O Toole, O. Taeymans, C.L. Rogers, A. Johnston, and C.R.L. Webster Background: Portal vein thrombosis (PVT)
More informationHematologic Disorders. Assistant professor of anesthesia
Preoperative Evaluation Hematologic Disorders Dr M.Razavi Assistant professor of anesthesia Anemia Evaluation needs to consider the extent and type of surgery, the anticipated blood loss, and the patient's
More informationRecurrent Pulmonary Embolism From Left Subclavian Thrombosis: A Case Report
J Cardiol 2000 ; 36: 191 196 Recurrent Pulmonary Embolism From Left Subclavian Thrombosis: A Case Report Junji Makoto Tetsunori Hideo Junko Toshihide Kunihide Toshio KAWAGOE, MD TAKENAGA, MD ISHIKAWA,
More informationCase Studies. A Complicated Case of Sepsis Involving a Rare Organism in a 46-Year-Old White Woman with Asplenia and a History of Drug Abuse.
A Complicated Case of Sepsis Involving a Rare Organism in a 46-Year-Old White Woman with Asplenia and a History of Drug Abuse Mary Pollard, BS, MLS(ASCP) CM * Lab Med Fall 2015;46:e88-e92 DOI: 10.1309/LMPWIPVWZLQY624S
More informationVENOUS THROMBOEMBOLISM: DURATION OF TREATMENT
VENOUS THROMBOEMBOLISM: DURATION OF TREATMENT OBJECTIVE: To provide guidance on the recommended duration of anticoagulant therapy for venous thromboembolism (VTE). BACKGROUND: Recurrent episodes of VTE
More informationD-dimer Value more than 3.6 μg/ml is Highly Possible Existence Deep Vein Thrombosis
Original Contribution This is Advance Publication Article Kurume Medical Journal, 60, 00-00, 2013 D-dimer Value more than 3.6 μg/ml is Highly Possible Existence Deep Vein Thrombosis SHINICHI NATA, SHINICHI
More informationSlide 1. Slide 2. Slide 3. Outline of This Presentation
Slide 1 Current Approaches to Venous Thromboembolism Prevention in Orthopedic Patients Hujefa Vora, MD Maria Fox, RN June 9, 2017 Slide 2 Slide 3 Outline of This Presentation Pathophysiology of venous
More informationPulmonary Emboli without Leg Symptoms, May-Thurner syndrome. Case Report and Review
ISPUB.COM The Internet Journal of Internal Medicine Volume 9 Number 2 Pulmonary Emboli without Leg Symptoms, May-Thurner syndrome. Case Report and Review A Hamo, M Alyaseen, F Alkhankan, T Gress Citation
More informationA Patient with Severe Pancreatitis Successfully Treated by. Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu,
A Patient with Severe Pancreatitis Successfully Treated by Continuous Peritoneal Dialysis Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu, Kazunobu Yamagami and Naoshi Takeyama Emergency Care
More informationValue of d-dimer test in diabetic patients as predictive marker for coronary artery disease.
Value of d-dimer test in diabetic patients as predictive marker for coronary artery disease. Dr. kudair Hazbr Razzaq M.B.cH. B, DM Specialist of internal medicine (ICMS) Director of diabetic center -The-Qar
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationGlossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013
Glossary of terms used in IEEM Hong Kong College of Emergency Medicine March 2013 The Hong Kong College of Emergency Medicine IEEM uses several terms in examinations that may cause confusion. The following
More informationIndex. Note: Page numbers of article numbers are in boldface type.
Index Note: Page numbers of article numbers are in boldface type. A Abdomen, acute, as cancer emergency, 381 399 in cancer patients, etiologies unique to, 390 392 in perforation, 388 surgery of, portal
More informationSaiseikai Fukuoka General Hospital, Fukuoka, Japan
Original Research Hellenic J Cardiol 211; 52: 123-127 D-Dimer Is Helpful for Differentiating Acute Aortic Dissection and Acute Pulmonary Embolism from Acute Myocardial Infarction Kazuo Sakamoto, Yusuke
More informationPROGNOSIS AND SURVIVAL
CANCER ASSOCIATED THROMBOSIS PROGNOSIS AND SURVIVAL Since French internist Armand Trousseau reported the occurrence of mysterious thrombotic disorders in cancer patients in the mid-19th century, the link
More informationACR Appropriateness Criteria Suspected Lower Extremity Deep Vein Thrombosis EVIDENCE TABLE
. Fowkes FJ, Price JF, Fowkes FG. Incidence of diagnosed deep vein thrombosis in the general population: systematic review. Eur J Vasc Endovasc Surg 003; 5():-5.. Hamper UM, DeJong MR, Scoutt LM. Ultrasound
More informationPULMONARY EMBOLISM (PE): DIAGNOSIS AND TREATMENT
PULMONARY EMBOLISM (PE): DIAGNOSIS AND TREATMENT OBJECTIVE: To provide a diagnostic algorithm and treatment options for patients with acute pulmonary embolism (PE). BACKGROUND: Venous thromboembolism (VTE)
More informationRisk factors for DVT. Venous thrombosis & pulmonary embolism. Anticoagulation (cont d) Diagnosis 1/5/2018. Ahmed Mahmoud, MD
Risk factors for DVT Venous thrombosis & pulmonary embolism Ahmed Mahmoud, MD Surgery ; post op especially for long cases, pelvic operations (THR), Trauma ; long bone fractures, pelvic fractures (posterior
More informationVenous thrombosis & pulmonary embolism. Ahmed Mahmoud, MD
Venous thrombosis & pulmonary embolism Ahmed Mahmoud, MD Risk factors for DVT Surgery ; post op especially for long cases, pelvic operations (THR), Trauma ; long bone fractures, pelvic fractures (posterior
More informationVENOUS THROMBOEMBOLISM AND CORONARY ARTERY DISEASE: IS THERE A LINK?
VENOUS THROMBOEMBOLISM AND CORONARY ARTERY DISEASE: IS THERE A LINK? Ayman El-Menyar (1), MD, Hassan Al-Thani (2),MD (1)Clinical Research Consultant, (2) Head of Vascular Surgery, Hamad General Hospital
More informationJ Jpn Coll Angiol, 2009, 49:
Online publication August 27, 2009 1 2 J Jpn Coll Angiol, 2009, 49: 247 254 deep vein thrombosis, thrombolytic therapy, catheter-directed thrombolysis, inferior vena cava filter, pulmonary thromboembolism
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationJohn Kiefer, BS, DVM Resident in Small Animal Surgery. The Veterinary Forum, Leesburg, VA October 18 th, 2015
John Kiefer, BS, DVM Resident in Small Animal Surgery The Veterinary Forum, Leesburg, VA October 18 th, 2015 www.vscvets.com Facebook.com/AnimalSurgeons Hind Limb Trauma Why this topic matters to you Triaging
More informationChristopher M. Lehman, MD, 1,3 Lori W. Wilson, MT(ASCP), MS, 3 and George M. Rodgers, MD, PhD 1-3. Abstract
Coagulation and Transfusion Medicine / D-DIMER FOR THE DIAGNOSIS OF DIC Analytic Validation and Clinical Evaluation of the STA LIATEST Immunoturbidimetric D-Dimer Assay for the Diagnosis of Disseminated
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationCover Page. The handle holds various files of this Leiden University dissertation
Cover Page The handle http://hdl.handle.net/1887/40114 holds various files of this Leiden University dissertation Author: Exter, Paul L. den Title: Diagnosis, management and prognosis of symptomatic and
More informationThings to never miss in the office. Brett Houston MD FRCPC (PYG-5, hematology) Leonard Minuk MD FRCPC
Things to never miss in the office Brett Houston MD FRCPC (PYG-5, hematology) Leonard Minuk MD FRCPC Presenter Disclosure Faculty / Speaker s name: Brett Houston / Leonard Minuk Relationships with commercial
More informationAcoustic Pulse Thrombolysis Treatment
Acoustic Pulse Thrombolysis Treatment BTGVascular.com SETTING THE STANDARD FOR VASCULAR THERAPIES Quickly & safely dissolve thrombus with the EKOS System. The Acoustic Pulse Difference Acoustic Pulse Thrombolysis
More informationObjectives. Heparin. Heparin & HIT: State of the Art. Acknowledge Heparin (almighty) HIT? Why care? Is it HIT? It is HIT. Now what?
Heparin & HIT: State of the Art Erika R. Ketteler, MD MA NMVAHCS, Vascular Surgery Assistant Professor of Surgery, UNM Objectives Acknowledge Heparin (almighty) HIT? Why care? Is it HIT? It is HIT. Now
More information2013 Coding Changes. Diagnostic Radiology. Nuclear Medicine
2013 Coding Changes The principal coding changes affecting Radiologists in 2013 occur in the Interventional Radiology Section of the AMA/CPT Manual. As in the past, we continue to see the Relative Update
More informationPulmonary Embolism Is it the Greatest Danger in Deep Vein Thrombosis?
Difficult issues in Deep Vein Thrombosis: Pulmonary Embolism Is it the Greatest Danger in Deep Vein Thrombosis? Raluca Dulgheru; C Gherghinescu; B Dorobat; H Muresan; R Darabont; M Cinteza; D Vinereanu
More information