e-figure 1. The design of the study.
|
|
- Myles Henderson
- 6 years ago
- Views:
Transcription
1 e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli.
2 e-figure 2. Representative H&E (A) and Masson s trichrome staining (B) sections of granulomas with differential degrees of fibrotic encapsulation. Class 1+, reduced perinecrotic fibrosis, more multinucleated giant cells ( <200 M thick ) MNGCs; >3 MNGCs per 10 high power fields, HP >3/10 HP), epithelioid cells and inflammatory cells; Class 2+, moderate perinecrotic fibrosis ( M thick), fewer MNGCs (1 2/10 HP), epithelioid cells and inflammatory cells; Class 3+, severe perinecrotic fibrosis (>500 M thick), collagen hyperplasia, absence of MNGCs (0/10 HP), epithelioid cells and inflammatory cells. C. Representative computed tomography (CT) scans at the time of diagnosis.1. a thin-walled cavity (arrow); 2. a thick-walled cavity ; 3. a tree-in-bud appearance (TIB); 4. lobular consolidations (LC), and 5. a thick-walled cavity with a fibrotic band (FB).
3 e-figure 3. Changes in WBC and RBC indices between NDM-TB and DM-TB groups during TB progression. Horizontal lines represent median values. Gray areas represent normal ranges of the indices. SN, smear negative TB;SP, smear positive TB;WBC, white blood cell;rbc, red blood cell;hgb, hemoglobin;neu/lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio. Differences between groups were analyzed by Mann Whitney tests.
4 e-figure 4. Changes in antibody isotypes, complements and RBC indices between NDM-TB and DM-TB during TB progression. Horizontal lines represent median values. Gray areas represent the normal ranges of the indices. SN, smear negative TB;SP, smear positive TB; C3, complement component 3; MCV, erythrocyte mean corpuscular volume;hct, hematocrit; MCH, Mean corpuscular hemoglobin The differences between groups were analyzed by Mann Whitney tests.
5 e-table 1. CT findings of NDM-TB and DM-TB patients Prevalence of CT findings, No. (%) Prevalence of CT findings, No (%) CT findings SN-NDM-TB SN-DM-TB P-value* SP-NDM-TB SP-DM-TB P-value* (n=40) (n=40) (n=87) (n=92) Centrilobular nodule or 9 (22.50) 15(37.50) (57.47) 68 (73.91) a branching Tree-in-bud appearance 9 (22.50) 13 (32.50) (40.23) 49 (53.26) Poorly defined ( fuzzy ) 9 (22.50) 17 (42.50) (42.53) 51 (55.43) nodule Cavity 6 (15.00) 13 (32.50) (67.82) 80 (86.96) a Thin-walled cavity 0 (0.00 ) 2 (5.00) (10.34) 6 (6.52) Thick-walled cavity 5 (12.50 ) 8 (20.00) (43.68) 64 (69.57) <0.001 a Lobular consolidations 34 (85.00) 33 (82.50) (78.16) 80 (86.96) Bronchovascular distortion 1 (2.50) 2 (5.00) (55.17) 55 (59.78) Fibrotic band 24 (60.00) 10 (25.00) a 47 (54.02) 36 (39.13) a Bronchiectasis 3 (7.50) 1 (2.50) (59.77) 58 (63.04) Miliary nodules 0 (0.00) 1 (2.50) (0.03) 3 (3.26) Hilar and mediastinal adenopathy 11 (27.50) 14 (35.00) (16.09) 68 (73.91) <0.001 a Table notes: CT, computed tomography; DM, diabetes mellitus; DM-TB, TB patients with DM; NDM-TB, TB patients without DM; TB: tuberculosis; SN, smear negative; SP, smear positive. * 2 test a P <0.05.
6 e-table 2. Association of immune, biochemical indices with granuloma caseous necrosis in 67 TB (34NDM, 33DM) patients. Parameters Area of caseous necrosis Odd Ratio (95% CI) P Odd Ratio1 (95% CI) P Odd Ratio 2 (95% CI) P Demographic indices Age (year) (0.860, 0.997) (0.885, 1.046) (0.872, 1.046) Height (cm) (1.000, 1.177) (0.854, 1.114) (0.832, 1.117) Weight (Kg) (1.001, 1.124) (0.818, 1.151) (0.796, 1.150) BMI (0.928, 1.358) (0.889, 1.322) (0.819, 1.254) Immune cells and inflammatory indices WBC ( 10 9 / L) (0.770, 1.437) (0.686, 1.387) (0.619, 1.359) Neu (%) (0.902, 1.046) (0.915, 1.085) (0.907, 1.093) Neu ( 10 9 /L) (0.649, 1.554) (0.590, 1.605) (0.520, 1.600) Mon (%) (0.862, 1.577) (0.793, 1.660) (0.703, 1.504) Mon ( 10 9 /L) (0.159, ) (0.042, ) (0.006, ) Lym (%) (0.927, 1.111) (0.876, 1.088) (0.864, 1.096) Lym ( 10 9 /L) (0.496, 2.645) (0.317, 1.991) (0.246, 1.877) Eo (%) (0.851, 1.283) (0.860, 1.245) (0.881, 1.324) Baso (%) (1.003, ) (0.692, ) (0.554, ) Eo ( 10 9 /L) (0.102, ) (0.075, ) (0.108, ) Baso ( 10 9 /L) (0.000, ) (0.000, ) (0.000, ) Neu/Lym (0.420, 1.778) (0.481, 2.828) (0.440, 3.015) Mon/Lym (0.011, ) (0.004, ) (0.000, ) PLT/Neu (0.974, 1.020) (0.977, 1.024) (0.976, 1.028) PLT/Lym (0.987, 1.008) (0.988, 1.014) (0.989, 1.016) Platelet and coagulation indices PLT ( 10 9 /L) (0.990, 1.005) (0.988, 1.005) (0.989, 1.006) PCT (%) (0.000, 6.366) (0.000, ) (0.000, ) MPV (fl) (0.604, 1.228) (0.619, 1.433) (0.661, 1.977) INR (0.000, 3.406) (0.000, 5.343) (0.000, 4.415) Fibrinogen (g/l) (0.704, 2.200) (0.755, 2.931) (0.443, 2.235) D-Dimer (ng/ml) (0.996, 1.001) (0.996, 1.002) (0.996, 1.003) Glucose and lipid-associated indices TCH (mmol/l) (0.408, 1.243) (0.352, 1.267) (0.363, 1.379) TG (mmol/l) (0.726, 1.975) (0.436, 1.965) (0.301, 1.664) HDL-C (mmol/l) 0.734( 0.217, 2.483) (0.388, ) (0.693, ) ApoA (mmol/l) (0.073, 2.512) (0.165, ) (0.352, ) ApoB (mmol/l) (0.038, 2.625) (0.015, 1.942) (0.013, 2.617) ApoE (mmol/l) (0.946, 1.014) (0.946, 1.028) (0.946, 1.032) LPA (mmol/l) (0.996, 1.001) (0.996, 1.001) (0.995, 1.001) GLU (mmol/l) (0.934, 1.717) (0.828, 1.579) (0.555, 1.250) 0.378
7 Red blood cell-associated indices RBC ( / L) (0.414, 5.246) (0.041, 1.587) (0.031, 1.977) HGB (g/l) (0.971, 1.046) (0.902, 1.011) (0.904, 1.024) HCT (%) (0.000, ) (0.000, ) (0.000, ) MCV (fl) (0.829, 1.101) (0.794, 1.140) (0.794, 1.151) MCH (pg) (0.652, 1.366) (0.532, 1.289) (0.577, 1.513) MCHC (g/l) (0.969, 1.028) (0.941, 1.034) (0.956, 1.051) Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to the 15.2 mm 2 or >15.2 mm 2 caseous necrotic areas of the granuloma under 5 microscope observation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < 0.05.
8 e-table 3. Association analysis of immune and biochemical indices with extent of peri-necrosis fibro-encapsulation of granuloma in 67 TB (34NDM, 33DM) patients. Parameters Fibro-encapsulation Odd Ratio (95% CI) P Odd Ratio1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a (1.082, 9.895) (0.747, 7.526) (0.727, 9.159) Weight (kg) (0.932, 1.024) (0.833, 1.115) (0.806, 1.118) Height (cm) (0.902, 1.039) (0.858, 1.080) (0.828, 1.080) Age (year) (0.951, 1.086) (0.908, 1.053) (0.897, 1.059) BMI (0.883, 1.215) (0.864, 1.195) (0.777, 1.122) Immune cell and inflammatory indices WBC ( 10 9 / L) (0.769, 1.346) (0.747, 1.351) ( 0.654, 1.296) Neu (%) (0.939, 1.078) (0.943, 1.099) (0.936, 1.113) Neu ( 10 9 /L) (0.654, 1.464) (0.685, 1.621) (0.588, 1.579) Lym (%) (0.917, 1.085) (0.874, 1.059) (0.857, 1.066) Lym ( 10 9 /L) (0.453, 1.978) (0.360, 1.719) (0.256, 1.533) Mon (%) (0.775, 1.290) (0.710, 1.250) (0.592, 1.134) Mon ( 10 9 /L) (0.037, ) ( 0.025, ) (0.001, 4.019) Eo (%) (0.791, 1.149) (0.876, 1.278) (0.918, 1.336) Baso (%) (0.557, ) (0.368, ) (0.209, ) Eo ( 10 9 /L) (0.015, 7.588) (0.019, 7.779) (0.220, ) Baso ( 10 9 /L) (0.002, ) (0.000, ) (0.001, ) Neu/Lym (0.457, 1.874) (0.622, 3.198) (0.572, 3.493) Mon/Lym (0.002, ) (0.001, ) (0.000, ) PLT/Neu (0.974, 1.016) (0.976, 1.020) (0.977, 1.027) PLT/Lym (0.986, 1.006) (0.988, 1.010) (0.989, 1.012) Platelet and coagulation indices PLT ( 10 9 /L) (0.990, 1.004) (0.990, 1.005) (0.990, 1.007) PCT (%) (0.000, 6.366) (0.000, ) (0.000, ) MPV (fl) (0.845, 1.591) (0.661, 1.350) (0.726, 1.820) PT (seconds) (0.333, 1.233) (0.308, 1.449) (0.283, 1.527) INR (0.000,74.194) (0.000, ) (0.000, ) Fibrinogen (g/l) (0.863, 2.566) (0.959, 3.272) (0.575, 2.450) D-Dimmer (ng/ml) b (0.994, 1.000) (0.994, 1.000) (0.994, 1.001) Glucose and lipid-associated indices TCH (mmol/l) (0.483, 1.349) (0.485, 1.466) (0.508, 1.678) TG (mmol/l) (0.810, 2.289) (0.674, 2.725) (0.529, 2.568) LDL-C (mmol/l) 0.617(0.328, 1.159) (0.342, 1.273) (0.396, 1.597) ApoB (mmol/l) (0.070, 3.570) (0.060, 4.193) (0.075, 8.345) ApoE (mmol/l) (0.992, 1.059) (0.944, 1.018) (0.940, 1.021) LPA (mmol/l) (0.999, 1.003) (0.997, 1.002) (0.996, 1.002) GLU (mmol/l) (0.946, 1.577) (0.879, 1.475) (0.541, 1.111) 0.165
9 Red blood cell-associated indices RBC ( / L) b (0.221, 2.364) (0.037, 1.004) (0.020, 0.998) HGB (g/l) (0.961, 1.029) (0.921, 1.013) (0.923, 1.025) HCT (%) (0.000, ) (0.000, ) (0.000, ) MCV (fl) (0.806, 1.047) (0.907, 1.249) (0.899, 1.267) MCH (pg) (0.922, 1.842) (0.747, 1.681) (0.878, 2.243) MCHC (g/l) (0.974, 1.027) (0.961, 1.027) (0.979, 1.045) Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/ Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups with slight (1+) and moderate plus severe (2+ plus 3+ ) fibro-encapsulation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < a female as reference. b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to
10 e-table 4. Association of immune and biochemical indices with sputum bacteria counts in 139 SP-TB (67NDM, 72DM) patients. Parameters Sputum bacteria counts Odd Ratio (95% CI) P Odd Ratio 1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a (0.184, 1.117) (0.188, 1.205) (0.154, 1.075) Age (year) (0.975, 1.029) (0.969, 1.026) (0.966, 1.025) Height (cm) (0.955, 1.044) (0.992, 1.148) (0.993, 1.154) Weight (Kg) (0.946, 1.014) (0.975, 1.199) (0.971, 1.204) BMI b (0.825, 1.040) (0.827, 1.049) (0.767, 0.995) Immune cell and inflammatory indices Neu (%) (0.991, 1.064) (0.987, 1.068) (0.982, 1.064) Lym (%) (0.933, 1.013) (0.929, 1.016) (0.929, 1.018) Lym ( 10 9 /L) (0.670, 1.993) (0.784, 2.719) (0.707, 2.600) Mon (%) (0.941, 1.231) (0.956, 1.273) (0.967, 1.310) Eo ( 10 9 /L) (0.001, 1.004) (0.002, 1.409) (0.002, 1.512) Baso ( 10 9 /L) (0.000, 1.020) (0.000, ) (0.000, ) Neu/Lym (0.975, 1.145) (0.955, 1.144) (0.955, 1.143) PLT/Lym (1.000, 1.004) (0.999, 1.004) (0.999, 1.005) PLT/Neu (0.986, 1.010) (0.982, 1.008) (0.985, 1.014) CRP (mg/l) b (1.001, 1.018) (1.002, 1.021) (1.001, 1.020) ESR (mm/h) b (1.006, 1.029) (1.007, 1.032) (1.005, 1.031) Immune globins and complements IGG (g/l) (0.988, 1.181) (0.994, 1.197) (0.971, 1.182) IGA (g/l) (0.897, 1.457) (0.928, 1.567) (0.877, 1.513) IGM (g/l) (0.472, 1.337) (0.443, 1.277) (0.382, 1.204) C3 (g/l) (0.579, 4.995) (0.716, 7.769) (0.362, 4.854) C4 (g/l (0.015, ) (0.014, ) (0.002, 6.252) TRF (g/l) (0.403, 1.269) (0.427, 1.428) (0.305, 1.146) Platelet and coagulation indices PLT ( 10 9 /L) b (1.001, 1.009) (1.002, 1.010) (1.002, 1.010) PT (seconds) (0.703, 1.369) (0.685, 1.385) (0.715, 1.488) INR (0.250, ) (0.200, ) (0.436, ) Fibrinogen (g/l) (0.844, 1.472) (0.872, 1.577) (0.826, 1.541) D-Dimmer (ng/ml) (1.000, 1.000) (1.000, 1.000) (1.000, 1.000) FDP (mg/l) (0.984, 1.089) (0.985, 1.095) (0.990, 1.114) Glucose and lipid-associated indices TCH (mmol/l) (0.676, 1.359) ( 0.695, 1.486) (0.632, 1.425) TG (mmol/l) (0.755, 3.179) (0.839, 4.064) (0.920, 4.845) HDL-C (mmol/l) (0.163, 1.399) (0.113, 1.107) (0.112, 1.137) LDL-C (mmol/l) (0.730, 1.630) (0.774, 1.875) (0.659, 1.698) ApoB (mmol/l) (0.465, 6.929) (0.593, ) (0.429, ) ApoE (mmol/l) (0.986, 1.036) (0.979, 1.032) (0.983, 1.038) LPA (mmol/l) (0.999, 1.001) (0.999, 1.001) (0.998, 1.001) 0.562
11 GLU (mmol/l) (0.956, 1.132) (0.976, 1.187) (0.871, 1.105) GA-L (%) (0.995, 1.086) (1.005, 1.107) (0.944, 1.077) Red blood cell-associated indices RBC ( / L) (0.560, 1.526) (0.612, 2.041) (0.498, 1.767) HGB (g/l) b (0.958, 0.995) (0.955, 1.000) (0.949, 0.996) MCHC (g/l) (0.971, 1.027) (0.976, 1.037) (0.968, 1.031) Table notes: BMI, body mass index; Neu (%), percentage of neutrophil; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Mon (%), percentage of monocyte; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; PLT/Lym, platelet to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; CRP, C- reactionprotein; ESR, erythrocyte sedimentation rate; IGG, Immunoglobulin G; IGA, Immunoglobulin A; IGM, Immunoglobulin M; C3, complement component 3; C4, complement component 4; TRF, transferrin; PLT, counts of platelets; PT, prothrombin time; INR, international normalized ratio; FDP, Fibrinogen degradation product; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; ApoB, apolipoprotein B; ApoE, apolipoprotein E; GLU, fasting glucose level; GA-L (%), percentage of glycosylated hemoglobin; RBC, red blood cell; HGB, hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to less (class 1 and 2) and more (class 3 and 4 ) sputum bacteria amounts. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < a female as reference; b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationChanges of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationLaboratory Testing for the Primary Care Optometrist
General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationNEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016
NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationEDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES
EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationThe Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters
International Archives of Medical Research Volume 9, No. 1, pp.15-23 2017. ORIGINAL RESEARCH The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More informationORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationSupplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining
Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining of PBMCs. Forward scatter area (FSC-A) versus side scatter area (SSC-A) was used to select lymphocytes followed
More informationEvaluation of haematology analyzer CELL-DYN 3700 SL
Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo
More informationBIOCHEMISTRY of BLOOD
BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationSupplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±
More informationHematology Revision. By Dr.AboRashad . Mob
1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found
More informationq,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationHistopathology: granulomatous inflammation, including tuberculosis
Histopathology: granulomatous inflammation, including tuberculosis These presentations are to help you identify basic histopathological features. They do not contain the additional factual information
More informationYear 2003 Paper two: Questions supplied by Tricia
QUESTION 65 A 36-year-old man presents in a post-ictal state after an observed generalised seizure. Full blood investigation shows: haemoglobin 0 g/l [128-175] mean corpuscular volume (MCV) 106 fl [80-7]
More informationBLOOD. Dr. Vedat Evren
BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationClinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationCase study for CME Diabetes up-to-date management
Case study for CME Diabetes up-to-date management Dr Ole Schmiedel, MRCP MD FRACP Physician and Endocrinologist Service Clinical Director Auckland Diabetes Centre GP referral to Auckland Diabetes Centre
More informationComplete Blood Count PSI AP Biology
Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationCavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationHematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
More informationHaematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationCase Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationPreferred Clinical Services for Leading Age Florida August 26-27, 2015
DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationCIERNY CLASSIFICATION CIERNY CLASSIFICATION. Classification of Infection according to Severity LAUTENBACH CLASSIFICATION OF MUSCULO SKELETAL INFECTION
CIERNY CLASSIFICATION Classification of Infection according to Severity E E G LAUTENBACH Division of Orthopaedics Faculty of Health Sciences August 2008 University of Texas staging system for adult osteomyelitis
More informationTEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN
TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN Clinical Utility CA19-9 (CA-GI) 8 hours 48 hours UNDETERMINED CA 19-9 may be ordered along with other tests,
More informationBlood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah
Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:
More informationBlood Cell Identification Graded
BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More information