e-figure 1. The design of the study.

Size: px
Start display at page:

Download "e-figure 1. The design of the study."

Transcription

1 e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli.

2 e-figure 2. Representative H&E (A) and Masson s trichrome staining (B) sections of granulomas with differential degrees of fibrotic encapsulation. Class 1+, reduced perinecrotic fibrosis, more multinucleated giant cells ( <200 M thick ) MNGCs; >3 MNGCs per 10 high power fields, HP >3/10 HP), epithelioid cells and inflammatory cells; Class 2+, moderate perinecrotic fibrosis ( M thick), fewer MNGCs (1 2/10 HP), epithelioid cells and inflammatory cells; Class 3+, severe perinecrotic fibrosis (>500 M thick), collagen hyperplasia, absence of MNGCs (0/10 HP), epithelioid cells and inflammatory cells. C. Representative computed tomography (CT) scans at the time of diagnosis.1. a thin-walled cavity (arrow); 2. a thick-walled cavity ; 3. a tree-in-bud appearance (TIB); 4. lobular consolidations (LC), and 5. a thick-walled cavity with a fibrotic band (FB).

3 e-figure 3. Changes in WBC and RBC indices between NDM-TB and DM-TB groups during TB progression. Horizontal lines represent median values. Gray areas represent normal ranges of the indices. SN, smear negative TB;SP, smear positive TB;WBC, white blood cell;rbc, red blood cell;hgb, hemoglobin;neu/lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio. Differences between groups were analyzed by Mann Whitney tests.

4 e-figure 4. Changes in antibody isotypes, complements and RBC indices between NDM-TB and DM-TB during TB progression. Horizontal lines represent median values. Gray areas represent the normal ranges of the indices. SN, smear negative TB;SP, smear positive TB; C3, complement component 3; MCV, erythrocyte mean corpuscular volume;hct, hematocrit; MCH, Mean corpuscular hemoglobin The differences between groups were analyzed by Mann Whitney tests.

5 e-table 1. CT findings of NDM-TB and DM-TB patients Prevalence of CT findings, No. (%) Prevalence of CT findings, No (%) CT findings SN-NDM-TB SN-DM-TB P-value* SP-NDM-TB SP-DM-TB P-value* (n=40) (n=40) (n=87) (n=92) Centrilobular nodule or 9 (22.50) 15(37.50) (57.47) 68 (73.91) a branching Tree-in-bud appearance 9 (22.50) 13 (32.50) (40.23) 49 (53.26) Poorly defined ( fuzzy ) 9 (22.50) 17 (42.50) (42.53) 51 (55.43) nodule Cavity 6 (15.00) 13 (32.50) (67.82) 80 (86.96) a Thin-walled cavity 0 (0.00 ) 2 (5.00) (10.34) 6 (6.52) Thick-walled cavity 5 (12.50 ) 8 (20.00) (43.68) 64 (69.57) <0.001 a Lobular consolidations 34 (85.00) 33 (82.50) (78.16) 80 (86.96) Bronchovascular distortion 1 (2.50) 2 (5.00) (55.17) 55 (59.78) Fibrotic band 24 (60.00) 10 (25.00) a 47 (54.02) 36 (39.13) a Bronchiectasis 3 (7.50) 1 (2.50) (59.77) 58 (63.04) Miliary nodules 0 (0.00) 1 (2.50) (0.03) 3 (3.26) Hilar and mediastinal adenopathy 11 (27.50) 14 (35.00) (16.09) 68 (73.91) <0.001 a Table notes: CT, computed tomography; DM, diabetes mellitus; DM-TB, TB patients with DM; NDM-TB, TB patients without DM; TB: tuberculosis; SN, smear negative; SP, smear positive. * 2 test a P <0.05.

6 e-table 2. Association of immune, biochemical indices with granuloma caseous necrosis in 67 TB (34NDM, 33DM) patients. Parameters Area of caseous necrosis Odd Ratio (95% CI) P Odd Ratio1 (95% CI) P Odd Ratio 2 (95% CI) P Demographic indices Age (year) (0.860, 0.997) (0.885, 1.046) (0.872, 1.046) Height (cm) (1.000, 1.177) (0.854, 1.114) (0.832, 1.117) Weight (Kg) (1.001, 1.124) (0.818, 1.151) (0.796, 1.150) BMI (0.928, 1.358) (0.889, 1.322) (0.819, 1.254) Immune cells and inflammatory indices WBC ( 10 9 / L) (0.770, 1.437) (0.686, 1.387) (0.619, 1.359) Neu (%) (0.902, 1.046) (0.915, 1.085) (0.907, 1.093) Neu ( 10 9 /L) (0.649, 1.554) (0.590, 1.605) (0.520, 1.600) Mon (%) (0.862, 1.577) (0.793, 1.660) (0.703, 1.504) Mon ( 10 9 /L) (0.159, ) (0.042, ) (0.006, ) Lym (%) (0.927, 1.111) (0.876, 1.088) (0.864, 1.096) Lym ( 10 9 /L) (0.496, 2.645) (0.317, 1.991) (0.246, 1.877) Eo (%) (0.851, 1.283) (0.860, 1.245) (0.881, 1.324) Baso (%) (1.003, ) (0.692, ) (0.554, ) Eo ( 10 9 /L) (0.102, ) (0.075, ) (0.108, ) Baso ( 10 9 /L) (0.000, ) (0.000, ) (0.000, ) Neu/Lym (0.420, 1.778) (0.481, 2.828) (0.440, 3.015) Mon/Lym (0.011, ) (0.004, ) (0.000, ) PLT/Neu (0.974, 1.020) (0.977, 1.024) (0.976, 1.028) PLT/Lym (0.987, 1.008) (0.988, 1.014) (0.989, 1.016) Platelet and coagulation indices PLT ( 10 9 /L) (0.990, 1.005) (0.988, 1.005) (0.989, 1.006) PCT (%) (0.000, 6.366) (0.000, ) (0.000, ) MPV (fl) (0.604, 1.228) (0.619, 1.433) (0.661, 1.977) INR (0.000, 3.406) (0.000, 5.343) (0.000, 4.415) Fibrinogen (g/l) (0.704, 2.200) (0.755, 2.931) (0.443, 2.235) D-Dimer (ng/ml) (0.996, 1.001) (0.996, 1.002) (0.996, 1.003) Glucose and lipid-associated indices TCH (mmol/l) (0.408, 1.243) (0.352, 1.267) (0.363, 1.379) TG (mmol/l) (0.726, 1.975) (0.436, 1.965) (0.301, 1.664) HDL-C (mmol/l) 0.734( 0.217, 2.483) (0.388, ) (0.693, ) ApoA (mmol/l) (0.073, 2.512) (0.165, ) (0.352, ) ApoB (mmol/l) (0.038, 2.625) (0.015, 1.942) (0.013, 2.617) ApoE (mmol/l) (0.946, 1.014) (0.946, 1.028) (0.946, 1.032) LPA (mmol/l) (0.996, 1.001) (0.996, 1.001) (0.995, 1.001) GLU (mmol/l) (0.934, 1.717) (0.828, 1.579) (0.555, 1.250) 0.378

7 Red blood cell-associated indices RBC ( / L) (0.414, 5.246) (0.041, 1.587) (0.031, 1.977) HGB (g/l) (0.971, 1.046) (0.902, 1.011) (0.904, 1.024) HCT (%) (0.000, ) (0.000, ) (0.000, ) MCV (fl) (0.829, 1.101) (0.794, 1.140) (0.794, 1.151) MCH (pg) (0.652, 1.366) (0.532, 1.289) (0.577, 1.513) MCHC (g/l) (0.969, 1.028) (0.941, 1.034) (0.956, 1.051) Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to the 15.2 mm 2 or >15.2 mm 2 caseous necrotic areas of the granuloma under 5 microscope observation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < 0.05.

8 e-table 3. Association analysis of immune and biochemical indices with extent of peri-necrosis fibro-encapsulation of granuloma in 67 TB (34NDM, 33DM) patients. Parameters Fibro-encapsulation Odd Ratio (95% CI) P Odd Ratio1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a (1.082, 9.895) (0.747, 7.526) (0.727, 9.159) Weight (kg) (0.932, 1.024) (0.833, 1.115) (0.806, 1.118) Height (cm) (0.902, 1.039) (0.858, 1.080) (0.828, 1.080) Age (year) (0.951, 1.086) (0.908, 1.053) (0.897, 1.059) BMI (0.883, 1.215) (0.864, 1.195) (0.777, 1.122) Immune cell and inflammatory indices WBC ( 10 9 / L) (0.769, 1.346) (0.747, 1.351) ( 0.654, 1.296) Neu (%) (0.939, 1.078) (0.943, 1.099) (0.936, 1.113) Neu ( 10 9 /L) (0.654, 1.464) (0.685, 1.621) (0.588, 1.579) Lym (%) (0.917, 1.085) (0.874, 1.059) (0.857, 1.066) Lym ( 10 9 /L) (0.453, 1.978) (0.360, 1.719) (0.256, 1.533) Mon (%) (0.775, 1.290) (0.710, 1.250) (0.592, 1.134) Mon ( 10 9 /L) (0.037, ) ( 0.025, ) (0.001, 4.019) Eo (%) (0.791, 1.149) (0.876, 1.278) (0.918, 1.336) Baso (%) (0.557, ) (0.368, ) (0.209, ) Eo ( 10 9 /L) (0.015, 7.588) (0.019, 7.779) (0.220, ) Baso ( 10 9 /L) (0.002, ) (0.000, ) (0.001, ) Neu/Lym (0.457, 1.874) (0.622, 3.198) (0.572, 3.493) Mon/Lym (0.002, ) (0.001, ) (0.000, ) PLT/Neu (0.974, 1.016) (0.976, 1.020) (0.977, 1.027) PLT/Lym (0.986, 1.006) (0.988, 1.010) (0.989, 1.012) Platelet and coagulation indices PLT ( 10 9 /L) (0.990, 1.004) (0.990, 1.005) (0.990, 1.007) PCT (%) (0.000, 6.366) (0.000, ) (0.000, ) MPV (fl) (0.845, 1.591) (0.661, 1.350) (0.726, 1.820) PT (seconds) (0.333, 1.233) (0.308, 1.449) (0.283, 1.527) INR (0.000,74.194) (0.000, ) (0.000, ) Fibrinogen (g/l) (0.863, 2.566) (0.959, 3.272) (0.575, 2.450) D-Dimmer (ng/ml) b (0.994, 1.000) (0.994, 1.000) (0.994, 1.001) Glucose and lipid-associated indices TCH (mmol/l) (0.483, 1.349) (0.485, 1.466) (0.508, 1.678) TG (mmol/l) (0.810, 2.289) (0.674, 2.725) (0.529, 2.568) LDL-C (mmol/l) 0.617(0.328, 1.159) (0.342, 1.273) (0.396, 1.597) ApoB (mmol/l) (0.070, 3.570) (0.060, 4.193) (0.075, 8.345) ApoE (mmol/l) (0.992, 1.059) (0.944, 1.018) (0.940, 1.021) LPA (mmol/l) (0.999, 1.003) (0.997, 1.002) (0.996, 1.002) GLU (mmol/l) (0.946, 1.577) (0.879, 1.475) (0.541, 1.111) 0.165

9 Red blood cell-associated indices RBC ( / L) b (0.221, 2.364) (0.037, 1.004) (0.020, 0.998) HGB (g/l) (0.961, 1.029) (0.921, 1.013) (0.923, 1.025) HCT (%) (0.000, ) (0.000, ) (0.000, ) MCV (fl) (0.806, 1.047) (0.907, 1.249) (0.899, 1.267) MCH (pg) (0.922, 1.842) (0.747, 1.681) (0.878, 2.243) MCHC (g/l) (0.974, 1.027) (0.961, 1.027) (0.979, 1.045) Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/ Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups with slight (1+) and moderate plus severe (2+ plus 3+ ) fibro-encapsulation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < a female as reference. b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to

10 e-table 4. Association of immune and biochemical indices with sputum bacteria counts in 139 SP-TB (67NDM, 72DM) patients. Parameters Sputum bacteria counts Odd Ratio (95% CI) P Odd Ratio 1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a (0.184, 1.117) (0.188, 1.205) (0.154, 1.075) Age (year) (0.975, 1.029) (0.969, 1.026) (0.966, 1.025) Height (cm) (0.955, 1.044) (0.992, 1.148) (0.993, 1.154) Weight (Kg) (0.946, 1.014) (0.975, 1.199) (0.971, 1.204) BMI b (0.825, 1.040) (0.827, 1.049) (0.767, 0.995) Immune cell and inflammatory indices Neu (%) (0.991, 1.064) (0.987, 1.068) (0.982, 1.064) Lym (%) (0.933, 1.013) (0.929, 1.016) (0.929, 1.018) Lym ( 10 9 /L) (0.670, 1.993) (0.784, 2.719) (0.707, 2.600) Mon (%) (0.941, 1.231) (0.956, 1.273) (0.967, 1.310) Eo ( 10 9 /L) (0.001, 1.004) (0.002, 1.409) (0.002, 1.512) Baso ( 10 9 /L) (0.000, 1.020) (0.000, ) (0.000, ) Neu/Lym (0.975, 1.145) (0.955, 1.144) (0.955, 1.143) PLT/Lym (1.000, 1.004) (0.999, 1.004) (0.999, 1.005) PLT/Neu (0.986, 1.010) (0.982, 1.008) (0.985, 1.014) CRP (mg/l) b (1.001, 1.018) (1.002, 1.021) (1.001, 1.020) ESR (mm/h) b (1.006, 1.029) (1.007, 1.032) (1.005, 1.031) Immune globins and complements IGG (g/l) (0.988, 1.181) (0.994, 1.197) (0.971, 1.182) IGA (g/l) (0.897, 1.457) (0.928, 1.567) (0.877, 1.513) IGM (g/l) (0.472, 1.337) (0.443, 1.277) (0.382, 1.204) C3 (g/l) (0.579, 4.995) (0.716, 7.769) (0.362, 4.854) C4 (g/l (0.015, ) (0.014, ) (0.002, 6.252) TRF (g/l) (0.403, 1.269) (0.427, 1.428) (0.305, 1.146) Platelet and coagulation indices PLT ( 10 9 /L) b (1.001, 1.009) (1.002, 1.010) (1.002, 1.010) PT (seconds) (0.703, 1.369) (0.685, 1.385) (0.715, 1.488) INR (0.250, ) (0.200, ) (0.436, ) Fibrinogen (g/l) (0.844, 1.472) (0.872, 1.577) (0.826, 1.541) D-Dimmer (ng/ml) (1.000, 1.000) (1.000, 1.000) (1.000, 1.000) FDP (mg/l) (0.984, 1.089) (0.985, 1.095) (0.990, 1.114) Glucose and lipid-associated indices TCH (mmol/l) (0.676, 1.359) ( 0.695, 1.486) (0.632, 1.425) TG (mmol/l) (0.755, 3.179) (0.839, 4.064) (0.920, 4.845) HDL-C (mmol/l) (0.163, 1.399) (0.113, 1.107) (0.112, 1.137) LDL-C (mmol/l) (0.730, 1.630) (0.774, 1.875) (0.659, 1.698) ApoB (mmol/l) (0.465, 6.929) (0.593, ) (0.429, ) ApoE (mmol/l) (0.986, 1.036) (0.979, 1.032) (0.983, 1.038) LPA (mmol/l) (0.999, 1.001) (0.999, 1.001) (0.998, 1.001) 0.562

11 GLU (mmol/l) (0.956, 1.132) (0.976, 1.187) (0.871, 1.105) GA-L (%) (0.995, 1.086) (1.005, 1.107) (0.944, 1.077) Red blood cell-associated indices RBC ( / L) (0.560, 1.526) (0.612, 2.041) (0.498, 1.767) HGB (g/l) b (0.958, 0.995) (0.955, 1.000) (0.949, 0.996) MCHC (g/l) (0.971, 1.027) (0.976, 1.037) (0.968, 1.031) Table notes: BMI, body mass index; Neu (%), percentage of neutrophil; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Mon (%), percentage of monocyte; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; PLT/Lym, platelet to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; CRP, C- reactionprotein; ESR, erythrocyte sedimentation rate; IGG, Immunoglobulin G; IGA, Immunoglobulin A; IGM, Immunoglobulin M; C3, complement component 3; C4, complement component 4; TRF, transferrin; PLT, counts of platelets; PT, prothrombin time; INR, international normalized ratio; FDP, Fibrinogen degradation product; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; ApoB, apolipoprotein B; ApoE, apolipoprotein E; GLU, fasting glucose level; GA-L (%), percentage of glycosylated hemoglobin; RBC, red blood cell; HGB, hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to less (class 1 and 2) and more (class 3 and 4 ) sputum bacteria amounts. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < a female as reference; b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

Laboratory Testing for the Primary Care Optometrist

Laboratory Testing for the Primary Care Optometrist General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für

More information

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

FBC interpretation. Dr. Gergely Varga

FBC interpretation. Dr. Gergely Varga FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters International Archives of Medical Research Volume 9, No. 1, pp.15-23 2017. ORIGINAL RESEARCH The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Date Time By Code Description Qty (Variance) Photo

Date Time By Code Description Qty (Variance) Photo Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.

More information

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9 ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti

More information

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

INFECTION/ INFLAMMATION

INFECTION/ INFLAMMATION HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital

More information

Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining

Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining of PBMCs. Forward scatter area (FSC-A) versus side scatter area (SSC-A) was used to select lymphocytes followed

More information

Evaluation of haematology analyzer CELL-DYN 3700 SL

Evaluation of haematology analyzer CELL-DYN 3700 SL Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±

More information

Hematology Revision. By Dr.AboRashad . Mob

Hematology Revision. By Dr.AboRashad  . Mob 1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found

More information

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Histopathology: granulomatous inflammation, including tuberculosis

Histopathology: granulomatous inflammation, including tuberculosis Histopathology: granulomatous inflammation, including tuberculosis These presentations are to help you identify basic histopathological features. They do not contain the additional factual information

More information

Year 2003 Paper two: Questions supplied by Tricia

Year 2003 Paper two: Questions supplied by Tricia QUESTION 65 A 36-year-old man presents in a post-ictal state after an observed generalised seizure. Full blood investigation shows: haemoglobin 0 g/l [128-175] mean corpuscular volume (MCV) 106 fl [80-7]

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Case study for CME Diabetes up-to-date management

Case study for CME Diabetes up-to-date management Case study for CME Diabetes up-to-date management Dr Ole Schmiedel, MRCP MD FRACP Physician and Endocrinologist Service Clinical Director Auckland Diabetes Centre GP referral to Auckland Diabetes Centre

More information

Complete Blood Count PSI AP Biology

Complete Blood Count PSI AP Biology Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease

Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

Hematology & Coagulation Practicum Objectives CLS - 647

Hematology & Coagulation Practicum Objectives CLS - 647 Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor

More information

Haematology Comparability Document

Haematology Comparability Document South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

LabDriver Audit Trail Example

LabDriver Audit Trail Example LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered

Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information

Step 2. Common Blood Tests, and the Coulter Counter Readout

Step 2. Common Blood Tests, and the Coulter Counter Readout Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their

More information

Preferred Clinical Services for Leading Age Florida August 26-27, 2015

Preferred Clinical Services for Leading Age Florida August 26-27, 2015 DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

CIERNY CLASSIFICATION CIERNY CLASSIFICATION. Classification of Infection according to Severity LAUTENBACH CLASSIFICATION OF MUSCULO SKELETAL INFECTION

CIERNY CLASSIFICATION CIERNY CLASSIFICATION. Classification of Infection according to Severity LAUTENBACH CLASSIFICATION OF MUSCULO SKELETAL INFECTION CIERNY CLASSIFICATION Classification of Infection according to Severity E E G LAUTENBACH Division of Orthopaedics Faculty of Health Sciences August 2008 University of Texas staging system for adult osteomyelitis

More information

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN Clinical Utility CA19-9 (CA-GI) 8 hours 48 hours UNDETERMINED CA 19-9 may be ordered along with other tests,

More information

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:

More information

Blood Cell Identification Graded

Blood Cell Identification Graded BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range 5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information