MCD-microRNA. WU Hong-quan, LIU Di-chuan *, TONG Xin, CAI Min, HUANG Jing. (LVIDd) A [ ] (2012)
|
|
- Kerry Caldwell
- 6 years ago
- Views:
Transcription
1 MCD-microRNA [ ] A (MCD)-microRNA MCD MCD 4 MCD-microRNA HEK293 PCR MCD mrna ( ) 7 7 ( + ) MCD-microRNA 4 4d 1 28d (LVEF) (FS) (LVIDd)A PCR 1 MCD mrna82% LVEF FS (P 0.05) (P 0.05) (P 0.05) (P 0.05) A (P 0.05) LVIDd (P>0.05) (P 0.05) MCDmicroRNA A [ ] RNAs RNA [ ] [ ] A [ ] (2012) WU Hong-quan, LIU Di-chuan *, TONG Xin, CAI Min, HUANG Jing Department of Cardiology, Second Affiliated Hospital of Chongqing Medical University, Chongqing , China * Corresponding author, ldc670220@163. com This work was supported by the National Natural Science Foundation of China( ) [Abstract] Objective To evaluate the effect of the targeted inhibition of myocardial malonyl-coa decarboxylase (MCD) by ultrasound microbubble mediated MCD-microRNA interference plasmids on cardiac function in rats with myocardial infarction (MI) and its possible mechanism. Methods The MCD expression plasmid and four MCD-microRNA interference plasmids to be screened were co-transfected into HEK293 cells. The levels of MCD mrna were determined by real-time fluorescence quantitative PCR, and interference sequence with the highest rate of suppression was selected. MI model was reproduced by ligating the left anterior descending coronary artery. The 28 rats with myocardial infarction were randomly assigned into four experimental groups: MI + saline (group 1), MI + plasmid (group 2), MI + ultrasound + plasmid (group 3), MI + ultrasound + microbubble + plasmid (group 4), 7 rats in each group. An alternative group of sham-operated + saline served as control. The mixture of the selected interference plasmids and lipid microbubbles were co-transfected once every four days into rats with MI for 4 weeks mediated by ultrasound. After transfection for 28 days, the changes in left ventricular ejection fraction (LVEF), short axis fractional shortening (FS), left ventricular end-diastolic diameter (LVIDd) were examined by echocardiography, and MCD and lactic acid levels were determined by high-performance liquid chromatography method and enzyme-linked immunosorbent assay respectively. Results One MCD-microRNA interference plasmid with the highest inhibition rate, which was 82%, was selected according to the result of real-time fluorescence quantitative PCR. In animal experiments, the levels of LVEF and FS in the group 4 were both higher than those [ ] ( ) [ ] [ ] ( ) [ ] ldc670220@163.com
2 in other MI intervention groups (P<0.05), but significantly lower than those in the control group (P<0.05). The lactic acid level was lower in group 4 than in other MI-intervention groups (all P <0.05), but significantly higher than that in the control group (P<0.05). There was no significant difference in LVIDd level between the intervention groups (P>0.05), but it was significantly lower than that in the control group (P<0.05). Conclusion That MCD-microRNA interference plasmids were targetedly transfected into infarcted myocardium as mediated by ultrasound microbubble, and they are able to increase malonyl CoA level, reduce lactic acid content, and delay the deterioration of cardiac function, although it has no effect to prevent ventricular dilatation. [Key words] myocardial infarction; mirornas; RNA interference A(malonyl-CoA) -1(CPT-1) [1] A (MCD) A [2-3] MCD [4] MCD MCD-microRNA MCD Wistar 200~250g HEK293 Polyjet TM SignaGen RNA SYBR PrimeScript RT Master Mix TaKaRa DMEM Hyclone A 1 4- (DTE) Sigma pires2-dsred-mcd MCD-microRNA Invitrogen HEK293 pires2-dsred-mcd pires2-dsred-mcd (MCDmicroRNA-Negative control) 1 4 pires2-dsred-mcd 4 MCD-microRNA MCD-microRNA-1 MCD-microRNA-2 MCD-microRNA-3 MCD-microRNA-4 microrna microrna-1 5'-TGCTGAGTAGAAGACAGCAGCAGCGAGT TTTGGCCACTGACTGACTCGCTGCTTGTCTTCT ACT-3' 5'-CCTGAGTAGAAGACAAGCAGCG AGTCAGTCAGTGGCCAAAACTCGCTGCTGCTGT CTTCTACTC-3' microrna-2 5'-TGCTGTTCT GAAGCACCTCACAGGGCGTTTTGGCCACTGAC TGACGCCCTGTGGTGCTTCAGAA-3' 5'-CC TGTTCTGAAGCACCACAGGGCGTCAGTCAGTGG CCAAAACGCCCTGTGAGGTGCTTCAGAAC-3' microrna-3 5'-TGCTGAGACTTCGCCCACTCA CCACTGTTTTGGCCACTGACTGACAGTGGTGAG GGCGAAGTCT-3' 5'-CCTGAGACTTCGCCC TCACCACTGTCAGTCAGTGGCCAAAACAGTGGT GAGTGGGCGAAGTCTC-3' microrna-4 5'-TG CTGTTGACCATGAGGCCGCACGAGGTTTTGGC CACTGACTGACCTCGTGCGCTCATGGTCAA-3' 5'-CCTGTTGACCATGAGCGCACGAGGTCAGT CAGTGGCCAAAACCTCGTGCGGCCTCATGGTCA AC-3' 5'-TGCTGAAATGTACTGCGC GTGGAGACGTTTTGGCCACTGACTGACGTCTCC ACGCAGTACATTT-3' 5'-CCTGAAATGTACT GCGTGGAGACGTCAGTCAGTGGCCAAAACGTCT CCACGCGCAGTACATTTC-3' 6 Polyjet TM 1 g:3 l 48h MCD MCD-microRNA MCD-microRNA 48h 1ml TRIpure RNA ( RP2402) RNA cdna 37 15min 85 5s 4 MCD GAPDH TaK ar a MCD 5'-TACTTCTTCTCCCACTGCTCCAC-3' 5'-CTCGTTCCTCCCATACTCCTTTC-3' 5'-GAAGGTGAAGGTCGGAGTC-3' 5'-GAAGATGGTGATGGGATTTC-3' PCR SYBR Premix Ex Taq TMII 10 l
3 0.8 l(0.4mmol/l) ROX Reference Dye(50 ) 0.4 l(0.2mmol/l) cdna 2 l dh 2 O 6 l 20 l 95 30s 95 5s 60 31s 40 Ct 2 Ct mg MCD-microRNA 1.5ml 37 30min 50s PBS 4 10% (300mg/kg) 1.3ml ( 2mg) ie33 1.6MHz 3.2MHz 1.3 4~8 1 28d 4d ~250g Wistar 28 10% (300mg/kg) 70 /min 1:1 10~13ml ml - + MCD-microRNA + + MCD-microRNA ml MCD-microRNA 7 Wista [5] 1.5ml PCR MCD-mRNA 200mg RNA RNA cdna PCR 2 Ct A 5% 50 mol/l DTE ( 1mg:9 l) g 10min 0.22 m A [6] 200mg 1.8ml PBS g 15min 530nm (LVEF) (fractional shortening FS) (LVIDd) 1.3 SPSS 17.0 x±s P PCR MCD-microRNA 48h HEK293 80% ( 1) 1 HEK293 ( 200) Fig.1 Transfected HEK293 cells (Inverted fluorescence microscopy 200) A. Positive control B. Cells transfected with MCD-miroRNA interfering plasmid 2.2 PCR HEK293 MCD mrna HEK293 4 MCD mrna (P 0.05) 1 MCD mrna 82% (P 0.05) MCD-mRNA MCD mrna (P 0.05) 55% LVEF 51.1% 3.7% + (45.7% 2.6%) + (46.3% 2.5%) + + (47.2% 3.0%) (85.5% 3.1% P 0.05) FS 23.7% 1.2% + (21.0% 1.4%) + (21.3% 1.4%) + + (21.4% 1.7%) (50.8% 3.4% P 0.05) LVIDd cm + ( cm) + ( cm) + + ( cm)
4 ( P >0.05) ( cm P 0.05) MCD-microRNA MCD 2.4 A A nmol/g + ( nmol/ g) + ( nmol/g) + + ( nmol/g) ( nmol/g P 0.05) MCD A mmol/gprot + ( mmol/gprot) + ( mmol/gprot) + + ( mmol/gprot) ( mmol/gprot P 0.05) MCD 3 MCDmicroRNA MCD MCD-microRNA HEK293 HEK293 MCD-microRNA [7] [8] 8 LVEF FS LVIDd MCD-microRNA MCD FS MCD 28d [9] MCD ATP [2-3, 10] MCD [11] CPT-1 [12] CPT-1 A CPT-1 CPT-1 [13] microrna A MCD [1] Gao S, Keung W, Serra D, et al. Malonyl-CoA mediates leptin hypothalamic control of feeding independent of inhibition of CPT-1a[J]. Am J Physiol Regul Integr Comp Physiol, 2011, 301(1): R209-R217. [2] Bouzakri K, Austin R, Rune A, et al. Malonyl CoenzymeA decarboxylase regulates lipid and glucose metabolism in human skeletal muscle[j]. Diabetes, 2008, 57(6): [3] Ussher JR, Lopaschuk GD. Targeting malonyl CoA inhibition of mitochondrial fatty acid uptake as an approach to treat cardiac ischemia/reperfusion[ J]. Basic Res Cardiol, 2009, 104(2): [4] Ussher JR, Lopaschuk GD. The malonyl CoA axis as a potential target for treating ischaemic heart disease[j]. Cardiovasc Res, 2008, 79(2): [5] Li RJ, He KL, Li X, et al. Changes in the expression of caspase-12 after acute myocardial infarction in rats[j]. Med J Chin PLA, 2011, 36(3): [,,,. caspase-12 [J]., 2011, 36(3): ] [6] Demoz A, Garras A, Asiedu DK, et al. Rapid method for the separation and detection of tissue short-chain coenzyme A esters by reversed-phase high-performance liquid chromatography[j]. J Chromatogr B Biomed Appl, 1995, 667(1): [7] Hernot S, Klibanov AL. Microbubbles in ultrasound-triggered drug and gene delivery[j]. Adv Drug Deliv Rev, 2008, 60(10): [8] Fujii H, Li SH, Wu J, et al. Repeated and targeted transfer of angiogenic plasmids into the infarcted rat heart via ultrasound targeted microbubble destruction enhances cardiac repair[j]. Eur Heart J, 2011, 32(16): [9] Liu Q, Docherty JC, Rendell JC, et al. High levels of fatty acids delay the recovery of intracellular ph and cardiac efficiency in post-ischemic hearts by inhibiting glucose oxidation[j]. J Am Coll Cardiol, 2002, 39(4): [10] Dyck JR, Hopkins TA, Bonnet S, et al. Absence of malonyl coenzyme A decarboxylase in mice increases cardiac glucose oxidation and protects the heart from ischemic injury[j].
5 Circulation, 2006, 114(16): [11] Xin W, Li XY, Lu XC, et al. Cardiac function improved by sarcoplasmic reticulum Ca 2+ -ATPase overexpression in a heart failure model induced by chronic myocardial ischemia[j]. Med J Chin PLA, 2011, 36(4): [,,,. Ca 2+ -ATP [J]., 2011, 36(4): ]. [12] Lionetti V, Linke A, Chandler MP, et al. Carnitine palmitoyl transferase-i inhibition prevents ventricular remodeling and delays decompensation in pacing-induced heart failure[j]. Cardiovasc Res, 2005, 66(3): [13] Schreurs M, Kuipers F, van der Leij FR. Regulatory enzymes of mitochondrial beta-oxidation as targets for treatment of the metabolic syndrome[j]. Obes Rev, 2010, 11(5): ( ) ( )
Exercise in Adverse Cardiac Remodeling: of Mice and Men
Exercise in Adverse Cardiac Remodeling: of Mice and Men 17-01-2013 Dirk J Duncker Experimental Cardiology, Cardiology, Thoraxcenter Cardiovascular Research Institute COEUR Erasmus MC, University Medical
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationMedical Biochemistry and Molecular Biology department
Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-
More informationFatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders
Deficiency Disorders in Pediatrics Published online: December 9, 216 Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders Gary D. Lopaschuk Department of Pediatrics, University
More informationFuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle
Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP Glucose vs.
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationInteractionofInflammatoryResponseandSympatheticNervousSystemintheCentralRegulationofChronicHeartFailureinRats
: I Surgeries and Cardiovascular System Volume 16 Issue 4 Version 1.0 Year 2016 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Inc. (USA) Online ISSN: 2249-4618
More informationCell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan
Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction Rita Alonaizan Department of Physiology, Anatomy & Genetics St Catherine s College Supervisor:
More informationClinical benefits of trimetazidine in diabetic patients with coronary artery disease
Clinical benefits of trimetazidine in diabetic patients with coronary artery disease Department of Cardiology, Ain Shams University, Cairo, Egypt Correspondence:, Department of Cardiology, Ain Shams University,
More informationEffects of Heat Shock Proteins on Protein Aggregation Induced by Transient Myocardial Ischemia
CN 4321262/ R 2003 11 5 391 [ ] 100723949 (2003) 1120420391206,,,,, (, 410078) [ ] ; ; ; ; ; B2 ; [ ] 70 B2 Wistar 70 B2 : 15 min 30 min 4 h,24 h,72 h, 15 min 4 h 24 h, 24 h 70 70, 15 min 4 h 70, B2 15
More informationRelationship between apoptosis and alteration of the energetic metabolism pathways of hypertrophic cardiomyocytes induced by hypoxia-reoxygenation
636 Acta Physiologica Sinica, October 25, 2005, 57 (5): 636-642 http://www.actaps.com.cn * 400037 0.1 µmol/l 1 µmol/l 95% N 2 5% CO 2 5 mmhg 8 h (pyruvate dehydrogenase, PDH) -1(carnitine palmitoyltransferase
More informationGated blood pool ventriculography: Is there still a role in myocardial viability?
Gated blood pool ventriculography: Is there still a role in myocardial viability? Oliver C. Alix, MD Adult Clinical and Nuclear Cardiology St. Luke s Medical Centre - Global City Case Presentation A 62-year-old
More informationThe presentation based on Propofol infusion syndrome Ne-Hooi Will Loh, MBBS EDIC FRCA FFICM Priya Nair, MBBS FRCA FFICM Contin Educ Anaesth Crit Care
The presentation based on Propofol infusion syndrome Ne-Hooi Will Loh, MBBS EDIC FRCA FFICM Priya Nair, MBBS FRCA FFICM Contin Educ Anaesth Crit Care Pain (2013) 13 (6): 200-202 Risk factors Severe head
More informationCT for Myocardial Characterization of Cardiomyopathy. Byoung Wook Choi, Yonsei University Severance Hospital, Seoul, Korea
CT for Myocardial Characterization of Cardiomyopathy Byoung Wook Choi, Yonsei University Severance Hospital, Seoul, Korea Cardiomyopathy Elliott P et al. Eur Heart J 2008;29:270-276 The European Society
More informationEnergy Metabolism in the Normal and Failing Heart: Potential for Therapeutic Interventions
Heart Failure Reviews, 7, 115 130, 2002 # 2002 Kluwer Academic Publishers. Manufactured in The Netherlands Energy Metabolism in the Normal and Failing Heart: Potential for Therapeutic Interventions William
More informationEffects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
More informationA Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial. Ischemia/Reperfusion Injury
Supporting Information A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial Ischemia/Reperfusion Injury Xiaotian Sun 1 *, Wenshuo Wang 2, Jing Dai 3, Sheng Jin 4, Jiechun Huang
More informationAMPK 2 PGC1. No / E mail
/ PQSAMI AMPK SD 60 28 d 4% AMI 26 13 13 2d PQS PQS 162 mg/ kg d 3.6 mg/ kg d 28 d LVDs LVDd EF AMP 2 AMPK 2 1 PGC1 LVDs LVDd P 0.05 EF P 0.05 LVDs LVDd P 0.05 EF P 0.05 RT PCR AMPK 2 PGC1 P 0.05 AMPK
More informationAbnormal, Autoquant Adenosine Myocardial Perfusion Heart Imaging. ID: GOLD Date: Age: 46 Sex: M John Doe Phone (310)
Background: Reason: preoperative assessment of CAD, Shortness of Breath Symptom: atypical chest pain Risk factors: hypertension Under influence: a beta blocker Medications: digoxin Height: 66 in. Weight:
More informationEvolution of the metabolic approach to heart disease
Evolution of the metabolic approach to heart disease Vaninder K. Sidhu and Gary D. Lopaschuk Cardiovascular Research Centre, Mazankowski Alberta Heart Institute, University of Alberta, Edmonton, Alberta,
More informationRikshospitalet, University of Oslo
Rikshospitalet, University of Oslo Preventing heart failure by preventing coronary artery disease progression European Society of Cardiology Dyslipidemia 29.08.2010 Objectives The trends in cardiovascular
More informationEarlier studies, mainly in rodents, have shown that diabetic
Downregulation of Myocardial Myocyte Enhancer Factor 2C and Myocyte Enhancer Factor 2C Regulated Gene Expression in Diabetic Patients With Nonischemic Heart Failure Peter Razeghi, MD; Martin E. Young,
More informationMyocardial lipid accumulation and lipotoxicity in heart failure
Myocardial lipid accumulation and lipotoxicity in heart failure P. Christian Schulze, MD, PhD New York - Presbyterian Hospital, Columbia University Medical Center, Division of Cardiology, New York, NY,
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Clinical perspective It was recently discovered that small RNAs, called micrornas, circulate freely and stably in human plasma. This finding has sparked interest in the potential
More informationInternational Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
More informationGinkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury
Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury K. Ran 1, D.-L. Yang 1, Y.-T. Chang 1, K.-M. Duan 2, Y.-W. Ou 2, H.-P. Wang 3 and Z.-J. Li 1 1 Department of Anesthesiology,
More informationPrevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang
Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with
More informationC57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment
Original Article C57BL/6 Mice are More Appropriate Acta Cardiol Sin 2012;28:236 240 Heart Failure & Cardiomyopathy C57BL/6 Mice are More Appropriate than BALB/C Mice in Inducing Dilated Cardiomyopathy
More informationORIGINAL. Keywords : multidetector-row computed tomography, myocardial infarction, cardiac function
ORIGINAL Department of Digestive and Cardiovascular Medicine, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima, Japan, Faculty of Integrated Art and Sciences, Department
More informationFull Record.
第 1 頁, 共 2 頁 Full Record Record 1 of 6 (Set #2) Title: Insulin-like growth factor-1 mediates stretch-induced upregulation of myostatin expression in neonatal rat cardiomyocytes Author(s): Shyu KG, Ko WH,
More informationSmall Platform Catheter-Based Left Ventricular Assist Device Support Suppresses Cardioprotective Beta Arrestin- Mediated Signal Transduction
Small Platform Catheter-Based Left Ventricular Assist Device Support Suppresses Cardioprotective Beta Arrestin- Mediated Signal Transduction Keshava Rajagopal, MD PhD, Progyaparamita Saha, PhD, Isa Mohammed,
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationBEDSIDE ASSESSMENT OF PATIENTS WITH STEMI
BEDSIDE ASSESSMENT OF PATIENTS WITH STEMI Prof. Maria Dorobantu, PhD, FESC, FACC Emergency Hospital of Bucharest, Romania Presenter Disclosures There are no conflicts/ grants/ disclosures for this presentation.
More informationDiabetes and the Heart
Diabetes and the Heart Association of Specialty Professors April 4, 2013 Jorge Plutzky, MD Co-Director, Preventive Cardiology Director, The Lipid Clinic Cardiovascular Division Brigham and Women s Hospital
More information2) Patients who are 18 years and older with a diagnosis of CAD or history of cardiac surgery who have a prior myocardial infarction
Measure #7 (NQF 0070): Coronary Artery Disease (CAD): Beta-Blocker Therapy Prior Myocardial Infarction (MI) or Left Ventricular Systolic Dysfunction (LVEF < 40%) National Quality Strategy Domain: Effective
More informationGRK 2 level in peripheral blood lymphocytes of elderly patients with acute myocardial infarction
Journal of Geriatric Cardiology (2013) 10: 281 285 2013 JGC All rights reserved; www.jgc301.com Research Article Open Access GRK 2 level in peripheral blood lymphocytes of elderly patients with acute myocardial
More informationExercise Testing and Training in Heart Failure Patients Robert S. McKelvie, MD, PhD, FRCPC, Hamilton Health Sciences - General Division
Exercise Testing and Training in Heart Failure Patients Robert S. McKelvie, MD, PhD, FRCPC, Hamilton Health Sciences - General Division Studies have demonstrated that there is no relationship between left
More informationMimecan and cardiac extracellular matrix integrity Lucas Van Aelst, MD Department of Internal Medicine, University Hospitals Leuven, Leuven, Belgium
Mimecan and cardiac extracellular matrix integrity Lucas Van Aelst, MD Department of Internal Medicine, University Hospitals Leuven, Leuven, Belgium VIB-Vesalius Research Center, KULeuven, Leuven, Belgium
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationIncreased de novo ceramide synthesis and accumulation in failing myocardium
Increased de novo ceramide synthesis and accumulation in failing myocardium Ruiping Ji, 1 Hirokazu Akashi, 1 Konstantinos Drosatos, 2 Xianghai Liao, 1 Hongfeng Jiang, 4 Peter J. Kennel, 1 Danielle L. Brunjes,
More information2018 OPTIONS FOR INDIVIDUAL MEASURES: REGISTRY ONLY. MEASURE TYPE: Process
Quality ID #7 (NQF 0070): Coronary Artery Disease (CAD): Beta-Blocker Therapy Prior Myocardial Infarction (MI) or Left Ventricular Systolic Dysfunction (LVEF < 40%) National Quality Strategy Domain: Effective
More informationMultiple Gated Acquisition (MUGA) Scanning
Multiple Gated Acquisition (MUGA) Scanning Dmitry Beyder MPA, CNMT Nuclear Medicine, Radiology Barnes-Jewish Hospital / Washington University St. Louis, MO Disclaimers/Relationships Standard of care research
More informationAutomatic External Defibrillators
Last Review Date: April 21, 2017 Number: MG.MM.DM.10dC3v4 Medical Guideline Disclaimer Property of EmblemHealth. All rights reserved. The treating physician or primary care provider must submit to EmblemHealth
More informationSignal-Averaged Electrocardiography (SAECG)
Medical Policy Manual Medicine, Policy No. 21 Signal-Averaged Electrocardiography (SAECG) Next Review: April 2018 Last Review: April 2017 Effective: May 1, 2017 IMPORTANT REMINDER Medical Policies are
More informationEffect of Intravascular Ultrasound- Guided vs. Angiography-Guided Everolimus-Eluting Stent Implantation: the IVUS-XPL Randomized Clinical Trial
Effect of Intravascular Ultrasound- Guided vs. Angiography-Guided Everolimus-Eluting Stent Implantation: the IVUS-XPL Randomized Clinical Trial Myeong-Ki Hong, MD. PhD on behalf of the IVUS-XPL trial investigators
More informationHongyun Chen 1#, Shuang Liu 2#, Cuiting Zhao 2, Zhihong Zong 3, Chunyan Ma 2, Guoxian Qi 1. Introduction
Research Highlights Cardiac contractility modulation improves left ventricular systolic function partially via mir-25 mediated SERCA2A expression in rabbit trans aortic constriction heart failure model
More informationChanges in cardiac metabolism: a critical step from stable angina to ischaemic cardiomyopathy
European Heart Journal Supplements (2001) 3 (Supplement O), O2 O7 Changes in cardiac metabolism: a critical step from stable angina to ischaemic cardiomyopathy W. C. Stanley Department of Physiology and
More informationCABG alone. It s enough? / Μόνο η αορτοστεφανιαία παράκαμψη είναι αρκετή;
LV Aneurysm and VSD in Ischaemic Heart Failure / Στεφανιαία νόσος, ανεύρυσμα αριστεράς κοιλίας και VSD CABG alone. It s enough? / Μόνο η αορτοστεφανιαία παράκαμψη είναι αρκετή; THEODOROS KARAISKOS CONSULTANT
More informationDialysis-Dependent Cardiomyopathy Patients Demonstrate Poor Survival Despite Reverse Remodeling With Cardiac Resynchronization Therapy
Dialysis-Dependent Cardiomyopathy Patients Demonstrate Poor Survival Despite Reverse Remodeling With Cardiac Resynchronization Therapy Evan Adelstein, MD, FHRS John Gorcsan III, MD Samir Saba, MD, FHRS
More informationAcute impairment of basal left ventricular rotation but not twist and untwist are involved in the pathogenesis of acute hypertensive pulmonary oedema
Acute impairment of basal left ventricular rotation but not twist and untwist are involved in the pathogenesis of acute hypertensive pulmonary oedema A.D. Margulescu 1,2, R.C. Sisu 1,2, M. Florescu 2,
More informationMechanisms and role of contrast echocardiography
Mechanisms and role of contrast echocardiography Seol Sang-Hoon Inje University College of Medicine, Haeundae Paik Hospital, Busan, Korea Physical Principles of Contrast Ultrasound Contrast echocardiography
More informationThe metabolic approach to improving prognosis in ischemic heart disease
The metabolic approach to improving prognosis in ischemic heart disease Villa Pini d Abruzzo Clinic, Department of Cardiology, Heart Failure Unit, Chieti, Italy Correspondence: Dr, Dipartimento di Cardiologia,
More informationPharmacologyonline 2: (2010) Newsletter Kakadiya and Shah
ROLE OF CREATINE KINASE MB AND LACTATE DEHYDROGENASE IN CARDIAC FUNCTION A REVIEW Jagdish Kakadiya*, Nehal Shah Department of Pharmacology, Dharmaj Degree Pharmacy College, Petlad- Khambhat Road, Dharmaj,
More informationVentricular Arrhythmias in Acute MI Patients Undergoing Primary PCI
Ventricular Arrhythmias in Acute MI Patients Undergoing Primary PCI Bulent Gorenek MD FACC FESC Eskişehir Osmangazi University Cardiology Department Eskisehir-Turkey I do not have any potential conflict
More information2014 PQRS OPTIONS FOR INDIVIDUAL MEASURES: REGISTRY ONLY
Measure #7 (NQF 0070): Coronary Artery Disease (CAD): Beta-Blocker Therapy Prior Myocardial Infarction (MI) or Left Ventricular Systolic Dysfunction (LVEF < 40%) 2014 PQRS OPTIONS F INDIVIDUAL MEASURES:
More informationCopeptin in heart failure: Associations with clinical characteristics and prognosis
Copeptin in heart failure: Associations with clinical characteristics and prognosis D. Berliner, N. Deubner, W. Fenske, S. Brenner, G. Güder, B. Allolio, R. Jahns, G. Ertl, CE. Angermann, S. Störk for
More informationPathophysiology and Diagnosis of Heart Failure
Pathophysiology and Diagnosis of Heart Failure Francesco Paneni, MD, PhD, FESC Cardiology Unit Karolinska University Hospital Stockholm, Sweden Cardiology University Hospital Zurich Switzerland francesco.paneni@gmail.com
More informationMultimodality Imaging in Cardiac Stem Cell Research
Multimodality Imaging in Cardiac Stem Cell Research IL SUK SOHN, MD, PhD Department of Cardiology Kyung Hee University Hospital at Gangdong Kyung Hee University School of Medicine, Seoul, Korea Stem Cell
More informationDetection and Assessment of MI: Use of Imaging Methods. Robert O. Bonow, M.D.
Detection and Assessment of MI: Use of Imaging Methods Robert O. Bonow, M.D. Detection and Assessment of MI: Use of Imaging Methods Robert O. Bonow, M.D. No Relationships to Disclose Expert Consensus Document
More informationSean Davidson. The Hatter Cardiovascular Institute University College London, UK
Key pathways to ischemia-reperfusion injury Sean Davidson The Hatter Cardiovascular Institute University College London, UK Outline What is ischaemia-reperfusion injury? What causes ischaemia-reperfusion
More informationJournal of the American College of Cardiology Vol. 37, No. 2, by the American College of Cardiology ISSN /01/$20.
Journal of the American College of Cardiology Vol. 37, No. 2, 2001 2001 by the American College of Cardiology ISSN 0735-1097/01/$20.00 Published by Elsevier Science Inc. PII S0735-1097(00)01133-5 Coronary
More informationThere is no conflict of interests for the following presentation
There is no conflict of interests for the following presentation Inflammation and Left Ventricular Diastolic Dysfunction Cho-Kai Wu MD National Taiwan University Hospital, Taipei, Taiwan Diastolic heart
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationCitation Acta medica Nagasakiensia. 1984, 29
NAOSITE: Nagasaki University's Ac Title Author(s) Efficacy of Coenzyme Q10 Administra Aortic Stenosis and Pacemaker Induc Igarashi, Katsuro Citation Acta medica Nagasakiensia. 1984, 29 Issue Date 1984-10-25
More informationVentricular Interactions in the Normal and Failing Heart
Ventricular Interactions in the Normal and Failing Heart Congenital Cardiac Anesthesia Society 2015 Pressure-volume relations Matched Left ventricle to low hydraulic impedance Maximal stroke work limited
More informationIn the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
More informationA Light in the Dark: Cardiac MRI and Risk Mitigation. J. Ronald Mikolich MD Professor of Internal Medicine Northeast Ohio Medical University (NEOMED)
A Light in the Dark: Cardiac MRI and Risk Mitigation J. Ronald Mikolich MD Professor of Internal Medicine Northeast Ohio Medical University (NEOMED) Dr. Mikolich has NO financial disclosures relative to
More informationLentiviral vector carrying the murin Apelin precursor gene, 234-bp cdna, (Lenti-Apelin) was
SUPPLEMENTAL METHODS Construction of recombinant lentiviral vectors Lentiviral vector carrying the murin Apelin precursor gene, 234-bp cdna, (Lenti-Apelin) was constructed. The cdna was inserted into the
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationBioscience Research Print ISSN: Online ISSN:
Available online freely at www.isisn.org Bioscience Research Print ISSN: 1811-9506 Online ISSN: 2218-3973 Journal by Innovative Scientific Information & Services Network RESEARCH ARTICLE BIOSCIENCE RESEARCH,2018
More informationTitle: Automatic External Defibrillators Division: Medical Management Department: Utilization Management
Retired Date: Page 1 of 7 1. POLICY DESCRIPTION: Automatic External Defibrillators 2. RESPONSIBLE PARTIES: Medical Management Administration, Utilization Management, Integrated Care Management, Pharmacy,
More informationChapter 1. General introduction and outline of the thesis. Jeroen Slikkerveer Otto Kamp
Chapter 1 General introduction and outline of the thesis Jeroen Slikkerveer Otto Kamp Chapter 1 Introduction The introduction of microbubbles and the technical development in ultrasound facilitates the
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationThe heart has a high-energy demand that is primarily met
Malonyl Coenzyme A Decarboxylase Inhibition Protects the Ischemic Heart by Inhibiting Fatty Acid Oxidation and Stimulating Glucose Oxidation Jason R.B. Dyck, Jie-Fei Cheng, William C. Stanley, Rick Barr,
More information3/27/2014. Introduction.
Introduction. Myocardial perfusion & contractility becomes abnormal immediately after the onset of ischaemia, even before the development of the symptoms & ST segment changes. 1 Myocardial Wall Motion
More informationThe Effects of Fasudil at Different Doses on Acute Myocardial Infarction in Rats
Original Article Acta Cardiol Sin 2013;29:524 530 Basic Science The Effects of Fasudil at Different Doses on Acute Myocardial Infarction in Rats Lijuan Tan, Nana Pan, Lingfan Yu, Renchao Yu and Bin Yang
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationCoronary Circulation Under normal conditions cardiac muscle metabolism is almost exclusively aerobic depending on oxidative phosorylation to
Coronary Circulation Under normal conditions cardiac muscle metabolism is almost exclusively aerobic depending on oxidative phosorylation to resynthesis the ATP continuously utilized by repetitive, excitation,
More informationRational use of imaging for viability evaluation
EUROECHO and other imaging modalities 2011 Rational use of imaging for viability evaluation Luc A. Pierard, MD, PhD, FESC, FACC Professor of Medicine Head, Department of Cardiology, CHU Liège, Belgium
More informationEvaluation of Anthropometric Indices of Patients with Left Ventricle Dysfunction Fallowing First Acute Anterior Myocardial Infarction
Journal of Cardiovascular and Thoracic Research, 2012, 4(1), 11-15 doi: 10.5681/jcvtr.2012.003 http://jcvtr.tbzmed.ac.ir Evaluation of Anthropometric Indices of Patients with Left Ventricle Dysfunction
More informationEffects of Statins on Endothelial Function in Patients with Coronary Artery Disease
Effects of Statins on Endothelial Function in Patients with Coronary Artery Disease Iana I. Simova, MD; Stefan V. Denchev, PhD; Simeon I. Dimitrov, PhD Clinic of Cardiology, University Hospital Alexandrovska,
More informationLV FUNCTION ASSESSMENT: WHAT IS BEYOND EJECTION FRACTION
LV FUNCTION ASSESSMENT: WHAT IS BEYOND EJECTION FRACTION Jamilah S AlRahimi Assistant Professor, KSU-HS Consultant Noninvasive Cardiology KFCC, MNGHA-WR Introduction LV function assessment in Heart Failure:
More informationCardiology for the Practitioner Advanced Cardiac Imaging: Worth the pretty pictures?
Keenan Research Centre Li Ka Shing Knowledge Institute Cardiology for the Practitioner Advanced Cardiac Imaging: Worth the pretty pictures? Howard Leong-Poi, MD, FRCPC Associate Professor of Medicine St.
More informationAortic Regurgitation and Aortic Aneurysm - Epidemiology and Guidelines -
Reconstruction of the Aortic Valve and Root - A Practical Approach - Aortic Regurgitation and Aortic Aneurysm Wednesday 14 th September - 9.45 Practice must always be founded on sound theory. Leonardo
More informationΒΙΟΔΕΙΚΤΕΣ ΣΤΗΝ ΚΑΡΔΙΑΚΗ ΑΝΕΠΑΡΚΕΙΑ. ΔΗΜΗΤΡΙΟΣ ΤΟΥΣΟΥΛΗΣ Καθηγητής Καρδιολογίας
ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Ά ΚΑΡΔΙΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Διευθυντής: Καθηγητής Δημήτριος Τούσουλης ΒΙΟΔΕΙΚΤΕΣ ΣΤΗΝ ΚΑΡΔΙΑΚΗ ΑΝΕΠΑΡΚΕΙΑ ΔΗΜΗΤΡΙΟΣ ΤΟΥΣΟΥΛΗΣ Καθηγητής Καρδιολογίας
More informationINNOVATION THAT REALLY MATTERS. Prof. Lina Badimon. Institut Català de Ciències Cardiovasculars (ICCC), Barcelona
INNOVATION THAT REALLY MATTERS Prof. Lina Badimon, Barcelona THE INSTITUTION THE INSTITUTION THE ICCC CATALAN INSTITUTE FOR CARDIOVASCULAR SCIENCE (ICCC) Objectives LEADING AN STRATEGIC PLANNING IN CVR
More informationGary D. Lopaschuk, Stephen R. Wall, Peter M. Olley, and Norman J. Davies
1036 Etomoxir, a Carnitine Palmitoyltransferase I Inhibitor, Protects Hearts From Fatty Acid- Induced Ischemic Injury Independent of Changes in Long Chain Acylcamitine Gary D. Lopaschuk, Stephen R. Wall,
More informationXinfuli Granule improves post-myocardial infarction ventricular remodeling and myocardial fibrosis in rats by regulating TGF-β/Smads signaling pathway
Journal of Geriatric Cardiology (2017) 14: 301 307 2017 JGC All rights reserved; www.jgc301.com Research Article Open Access Xinfuli Granule improves post-myocardial infarction ventricular remodeling and
More informationLike mother, like offspring Does maternal overweight predict health outcomes?
Like mother, like offspring Does maternal overweight predict health outcomes? Patricia Iozzo, MD, PhD Institute of Clinical Physiology National Research Council (CNR), Pisa, Italy Brussels 16 October 2017
More informationAngiotensin-Converting Enzyme-2 Overexpression Improves Left Ventricular Remodeling and Function in a Rat Model of Diabetic Cardiomyopathy
Journal of the American College of Cardiology Vol. 59, No. 8, 2012 2012 by the American College of Cardiology Foundation ISSN 0735-1097/$36.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2011.09.071
More informationDELAYED ENHANCEMENT IMAGING IN CHILDREN
NASCI 38 TH ANNUAL MEENG, SEATLE October 3-5, 21 1. DELAYED ENHANCEMENT IN CHILDREN Shi-Joon Yoo, MD Lars Grosse-Wortmann, MD University of Toronto Canada -1. 1. 1. Magnitude image Magnitude images -1.
More information- B [6] (TAC) [DOI] /j.issn
88 216 1 1 41 1 [ ] (TAC) 12 C57BL/6 (N ) ( ) 6 N 22d 16S rdna N [ ] [ ] R543.1 [ ] A [ ] 577-742(216)1-88-5 [DOI] 1.11855/j.issn.577-742.216.1.4 Intestinal flora changes in a mouse model of transverse
More informationStem Cells. Keith Channon. Department of Cardiovascular Medicine University of Oxford John Radcliffe Hospital, Oxford
Stem Cells Keith Channon Department of Cardiovascular Medicine University of Oxford John Radcliffe Hospital, Oxford Adult Stem Cells Unique cells that are capable of self-renewal Have the ability to differentiate
More informationTypical chest pain with normal ECG
Typical chest pain with normal ECG F. Mut, C. Bentancourt, M. Beretta Nuclear Medicine Service, Asociacion Española Montevideo, Uruguay Clinical history Male 41 y.o. Overweight, hypertension, high cholesterol,
More informationCardiovascular Imaging Stress Echo
Cardiovascular Imaging Stress Echo Theodora A Zaglavara, MD, PhD Cardiac Imaging Department INTERBALKAN MEDICAL CENTER Thessaloniki GREECE Evolution of Stress Echo: From Innovation to a Widely Established
More information