ANALYSIS OF THE CILIARY GENES GAS8 AND MKS6 REVEAL CONSERVED ROLES IN CILIA MOTILITY AND TRANSITION ZONE FUNCTION. by: WESLEY R.

Transcription

1 ANALYSIS OF THE CILIARY GENES GAS8 AND MKS6 REVEAL CONSERVED ROLES IN CILIA MOTILITY AND TRANSITION ZONE FUNCTION by: WESLEY R. LEWIS JAMES F. COLLAWN: COMMITTEE CHAIR BRADLEY K. YODER: MENTOR JOHN M. PARANT STEVEN M. ROWE ROSA A. SERRA A DISSERTATION Submitted to the graduate faculty of The University of Alabama at Birmingham, in partial fulfillment of the requirements for the degree of Doctor of Philosophy. BIRMINGHAM, ALABAMA 2016

2 ANALYSIS OF THE CILIARY GENES GAS8 AND MKS6 REVEAL CONSERVED ROLES IN CILIA MOTILITY AND TRANSITION ZONE FUNCTION CELL, MOLECULAR, AND DEVELOPMENTAL BIOLOGY ABSTRACT Cilia are microtubule based cellular appendages that are present throughout the hierarchy of the animal kingdom. These appendages are utilized for a wide array of functions such as motility in single celled organisms to coordinating complex cellular signaling pathways in more complex organisms. Though these appendages are well conserved, the exact function of cilia in many cell types remains unknown. Recently, cilia are tied to a myriad of developmental diseases and diseases of adult homeostasis collectively referred to as ciliopathies. Dysfunction in cilia results in a wide array of phenotypes ranging from retinal degeneration to polydactyly, cystic kidney disease, and obesity. While it is known that cilia are involved in the development of the phenotypes, the underlying molecular mechanisms remain unknown. Hence, it is essential to study the genes involved in these diseases in model systems such as mouse and zebrafish. In the following thesis, I will document the importance of a gene known as Growth Arrest Specific 8 (GAS8) in motile cilia function and the development of a human disease known as Primary Cilia Dyskinesia (PCD). I show that Gas8 is an ii

3 essential component of a motile cilia complex known as the Nexin-Dynein Regulatory Complex (N-DRC) and that loss of Gas8 leads to destabilization of the microtubule ring of motile cilia and dyskinetic cilia. Similarly, I will show that Gas8 is a disease causing gene in humans by using the CRISPR/Cas9 system to mimic in mice a known human mutation and show that this mutation is disease causative. Also, I will show that the ciliary transition zone gene Meckel-Grüber 6 (MKS6) is critical for cilia function. Congenital loss of Mks6 leads to embryonic lethality while conditional loss leads to disruptions such as cystic kidneys and retinal degeneration in development and adult homeostasis. iii

4 ACKNOWLEDGEMENTS I would first and foremost like to thank Dr. Bradley Yoder. Before coming to UAB, I knew very little of the ways of science. Even knowing this, Dr. Yoder took me into his lab and taught me virtually everything I know about science. Though he always confused whether I was from Illinois or Indiana (Illinois for those wondering) he made sure I knew the lab was home here in Birmingham, providing me with a fridge, soft chair to sleep in and access to beer for those days of rough experimental results. I would also like to thank my committee for guidance. Drs. Jim Collawn, John Parant, Rosa Serra, and Steven Rowe always made sure to challenge me throughout every meeting and guide me in the right direction. And Dr. Nicolas Berbari because though he did not serve as a member of my committee, acted as so, guiding me through experiments, helping edit manuscripts, stealing my pipettes and Immu-Mount, and yelling at me when I haven t been productive enough. Thank you, Dr. Berbari. I would also like to thank members of the Yoder lab including Scott, Jack, Kurt, Dustin, Devan, and Mandy for helping to keep me sane and for keeping the laughs rolling in. Of course, I would not be here without the love and support of my parents. Though my father, Doug, will not be able to attend or even know that I am being awarded a PhD, I m sure he would be proud. I also thank my mother, Robin, for caring for the iv

5 family in its time of need and for always asking me to do my best as well as my stepfather, Leon, for caring for the family and keeping my mother happy. I would also like to thank my brother, Brandon, and my sister, Sara, for giving me a lively upbringing that led to the person that I am today. I would also like to thank my beloved, wonderful fiancée, Amanda for keeping me sane through graduate school. I surely would not have made it without her. And for making me laugh every time she says werewoof. As well as our pups, Daphne and Nyx, and the cats, Thor and Seras, for always being there to greet me and brighten my day regardless of what mood I am in. v

6 TABLE OF CONTENTS Page ABSTRACT... ii ACKNOWLEDGEMENTS... iv LIST OF FIGURES... viii INTRODUCTION...1 Biological Relevance of Research and Thesis Organization...1 Introduction to Primary and Motile Cilia...1 Building and Maintaining a Cilium...3 Mechanisms of Cilia Motility...6 Transition Zone Structure and Function...10 Ciliary Signaling...11 Hedgehog Signaling...11 Ciliopathies...15 Primary Ciliary Dyskinesia (PCD)...16 Meckel-Grüber Syndrome (MKS)...17 Polycystic Kidney Disease (PKD)...18 Cilia and Hedgehog Related Diseases...20 Reasons for Research...21 vi

7 Growth Arrest Specific 8 (Gas8)...21 Meckel-Grüber Syndrome 6 (Mks6)...22 MUTATION OF GROWTH ARREST SPECIFIC 8 REVEALS A ROLE IN MOTILE CILIA FUNCTION AND HUMAN DISEASE...23 MUTANT MECKEL-GRÜBER SYNDROME 6 MICE REVEAL A CONSERVED ROLE IN DEVELOPMENT AND ADULT HOMEOSTASIS...67 FUTURE DIRECTIONS AND CONCLUDING REMARKS...99 Mammalian N-DRC Ultrastructure...99 Gas8 at the Primary Cilium Gas8 as a Disease Causing Gene MKS6 and Variable Cystogenesis Analyzing Cyst Progression Transition Zone Function Summary GENERAL LIST OF REFERENCES APPENDIX vii

8 LIST OF FIGURES Figure Page 1 Schematic of a cilium Schematic of motile cilia accessory structures Hierarchy of transition zone components...12 MUTATION OF GROWTH ARREST SPECIFIC 8 REVEALS A ROLE IN MOTILE CILIA FUNCTION AND HUMAN DISEASE 1 Generation of mutant Gas8 GT mice and phenotype description Gas8 mutant embryos have no overt Hh phenotypes Gas8 localizes to cilia Gas8 GT mice present with cilia motility phenotypes PCD patient missense mutations in highly conserved regions of Gas A391V is a potential pathogenic allele...43 S1 DRC4-DK-GFP is expressed and localizes to the axoneme...45 viii

9 LIST OF FIGURES (CONT.) Figure Page MUTANT MECKEL-GRÜBER SYNDROME 6 MICE REVEAL A CONSERVED ROLE IN DEVELOPMENT AND ADULT HOMEOSTASIS 1 Congenital and conditional knockout mouse alleles of Mks Congenital loss of Mks6 is Embryonic Lethal and presents with defects in neural tube development Juvenile loss of Mks6 results in cystic kidneys Comparative analysis of Juvenile Induced mice Mks6 conditional KO mice experience retinal degeneration Mks6 conditional KO mice have shortened outer segments Adult loss of Mks6 does not result in obesity...84 ix

10 INTRODUCTION Biological Relevance of Research and Thesis Organization In this thesis, I will lay out the biological relevance of a cellular appendage known as the cilium and its role in disease. Through multiple genetic models, I specifically look at the roles for the genes Growth Arrest Specific 8 (Gas8) and Meckel- Grüber Syndrome 6 (Mks6) in the function of cilia. I address the role of Gas8 in the mammalian Nexin-Dynein Regulatory Complex (N-DRC) and how dysfunction of this gene results in diseases related to altered ciliary motility. Similarly, I use two genetically engineered mouse models to analyze how loss of Mks6 results in dysfunction of a critical ciliary compartment known as the transition zone and how this leads to disease and developmental abnormalities. This thesis is laid out with a general introduction and the relevant background to cilia, ciliary signaling, and diseases associated with cilia. I will then discuss the rational for choosing to investigate both Gas8 and Mks6. The introduction will be followed by two manuscripts used as chapters and a final conclusion and future directions section that discuss the results in the framework of the overall knowledge about ciliopathies and where the research will be headed. Introduction to Primary and Motile Cilia Cilia are microtubule based cellular appendages. Concerning mammals, there are two types of cilia, primary and motile. Primary cilia are immotile and present on nearly every cell type in the organism. Motile cilia line the airways and ventricles of the brain and are used for sperm motility. There is evidence to suggest both forms of cilia are capable of regulating signaling pathways. Primary cilia are responsible for regulating 1

11 signaling pathways such as Hedgehog, are essential for olfaction and vision, and are essential for signaling in the developing embryo and for adult tissue homeostasis [1,2]. Evidence suggests motile cilia in the airways contain taste receptors and are used in the biflagellated algae Chlamydomonas reinhardtti for mating signals [3-5]. Studies of motile cilia in less complex organisms such Chlamydomonas reinhardtii, Tryponosma brucei, and Tetrahymena thermophila have been ongoing for decades and have elucidated the core structure and function of motile cilia [6]. There are many tools for genetic manipulation in these models and some models such as Chlamydomonas shed their flagella which can then be collected in large numbers for EM studies and biochemistry. In mammals, motile cilia have a well-established role in fluid and mucus movement as well as in determining left-right organ asymmetry [7,8]. Motile cilia lining the ventricles of the brain establish and maintain cerebrospinal fluid flow while cilia in the lungs and trachea are responsible for clearing pathogen containing mucus [9]. Dyskinetic cilia in mammals results in hydrocephalus, bronchiectasis, chronic respiratory infection, and infertility; all symptoms of a disease collectively known as Primary Ciliary Dyskinesia (PCD) [10]. Nodal cilia are a third type of cilia and are a hybrid of motile and primary cilia. In mice, at approximately E7.5, the embryonic node develops and migrates posteriorly by E8.5. The cells of the node contain a single nodal cilium each which establish fluid flow in the right to left direction [11]. An ongoing debate in the field is whether left-right asymmetry is established by ciliary mechanosensation along the edge of the node or 2

12 whether the fluid carries morphogens [12-15]. Motility of this type of cilium is interesting due to the fact that they are solitary cilia that move vortically instead of linearly. Since nodal cilia are angled posteriorly at 40 o, they are able to create a directional fluid flow by moving away from the surface through the fluid in the effective stroke but do not generate any fluid flow in the reverse direction due to their close proximity to the cell surface during the return stroke [16,17]. Defects in nodal cilia that result in altered organ situs are a hallmark of a disease termed Kartagener Syndrome which will be discussed in a later section. Building and Maintaining a Cilium Though these types of cilia serve different functions within an organism, similar mechanisms are used to build and maintain both types. Eukaryotic cilia exhibit a conserved structure consisting of three main components: the ciliary axoneme, the transition zone, and the basal body (Figure 1). The axoneme of immotile or primary cilia consists of nine microtubule doublets arranged in a circle (referred to as a 9+0 axoneme) [18]. Motile cilia share this same basic axoneme structure with the addition of a central pair of microtubules (referred to as a 9+2 axoneme) important for generating motility [19]. Additionally, motile cilia possess several accessory structures such as radial spokes, dynein arms, and the Nexin-Dynein Regulatory Complex (N-DRC) that are necessary for the mechanisms of motility [20,21]. These structures serve very distinct functions within motile cilia. Though primary and motile cilia differ in structures within their respective axonemes, the process by which these axonemes are built is well conserved and well 3

13 Figure 1: Schematic of a cilium. Cilia are built with three main domains, the basal body, the transition zone, and the ciliary axoneme. Note the difference in accessory structures between motile and primary cilia. 4

14 characterized. This bidirectional transport process is known as Intraflagellar Transport (IFT) and consists of two distinct protein complexes responsible for anterograde (IFT-B) and retrograde (IFT-A) transport of components along the cilia axoneme [22,23]. A multimeric kinesin complex is responsible for transport in the anterograde direction while a cytoplasmic dynein is responsible for transport in the retrograde direction [24,25]. IFT- B particles appear to be more important in transport of cargo to the tip of the cilium while IFT-A particles appear to be responsible retrograde transport of cargo [26,27]. Mutations affecting IFT components result in the loss of the ability of the cell to build and/or maintain the cilium. Loss of IFT-B components results in a failure of ciliogenesis or a quick degradation of the cilium if IFT-B components are lost post ciliation [28]. Since IFT-A is responsible for retrograde movement, loss of IFT-A components typically result in an accumulation of components at the tip of the cilium, creating a lollipop like structure before the cilium destabilizes [29]. Similarly, all cilia possess a complex structure known as the transition zone. The transition zone separates the cilium from the rest of the cell and there is much debate about what the actual function of the transition zone is. There is evidence that supports the notion that the transition zone maintains a distinct domain from that of the cytoplasm [30-32]. Other evidence in the literature suggests that it serves as a diffusion barrier [33,34]. A variety of diseases arise from defects in the transition zone and these will be discussed in a later section. All cilia nucleate from a structure known as the basal body. The basal body consists of a modified centriole containing the daughter and mother centriole, the latter of which, serves as the nucleation source for cilia. Each motile cilium nucleates from a 5

15 single basal body. To achieve this, cells with motile cilia undergo de novo basal body duplication driven by transcription factors such as FoxJ1 while primary cilia do not undergo basal body duplication [35-37]. While the ciliary axoneme consists of microtubule doublets, the basal body is constructed from microtubule triplets [38]. It is believed that during cell division, the cilium is deconstructed as the basal body is being utilized as the Microtubule Organizing Center (MTOC) of the cell and once finished dividing, the cilium is constructed off of the basal body once again [39,40]. Though cilia share mechanisms of construction and maintenance, the exact protein composition in the ciliary membrane can differ between specialized cell types. For example, olfactory neurons and photoreceptors have specialized forms of cilia necessary for olfaction and for detection of light in which specific G-protein coupled receptors (GPCRs) accumulate [41-45]. Primary cilia in the kidney on the other hand, do not possess these GPCRs but possess specialized proteins for mechanosensation and calcium signaling [46,47]. There are also many proteins that localize to cilia regardless of specialized cell type. For instance, ADP ribosylation factor like GTPase 13B (Arl13B) is present in almost every cell type [48]. Similarly, many ciliated cells express components of the Hedgehog (Hh) signaling pathway [49]. Mechanisms of Cilia Motility Motile cilia have been best characterized in less complex organisms such as the green algae Chlamydomonas reinhardtii or Tetrahymena thermophila and require a complex system of proteins to maintain proper beat frequency, waveform, and metachrony [6,50]. Many proteins involved in cilia motility are well conserved across 6

16 species, therefore, one can garner much information from less complex organisms where motile cilia are abundant and easy to collect and study. Classically, motile cilia conform to the microtubule doublet sliding model proposed by Peter Satir in the 1970 s [51]. This model suggests that as the cilia bend in their waveform, microtubules conform to the bending by sliding one microtubule doublet along the neighboring microtubule doublet to relieve mechanic stress. Microtubule sliding requires intensive coordination between the radial spokes (RS), outer dynein arms (ODA), inner dynein arms (IDA) and nexin-dynein regulatory complex (N-DRC) of motile cilia (Figure 2). Radial spokes extend from the central pair of motile cilia to each microtubule doublet [52]. The number of radial spokes per 96nm repeat along the axoneme varies depending on the organism [53]. This variation may be due to the necessity for different ciliary waveforms in different organisms and may correlate with complexity of these movements. Studies suggest that radial spokes are necessary for propagation of ciliary wave signals [54]. Recent data in mice suggest that certain radial spoke proteins such as Rsph4a are necessary for microtubule ring stabilization and loss of this protein can change ciliary waveform from a linear beat pattern to a circular beat pattern [55]. Two different dyneins act as the motors of cilia motility. Both of these dyneins belong to the family of axonemal dyneins which are anchored in specific positions in the axoneme. Inner dynein arms (IDAs) and outer dynein arms (ODAs) control the ciliary waveform and the ciliary beat frequency, respectively [56]. There are multiple sets of IDAs and ODAs per 96nm microtubule repeat in motile cilia [57]. In Chlamydomonas the IDA is referred to as the I1 dynein and consist of two motor domains or heads referred to as the 1α and the 1β head and one regulatory complex which is anchored to the 7

17 Figure 2: Schematic of motile cilia accessory structures. A and B denotes microtubule doublets. Nexin-Dynein Regulatory Complex (N-DRC) links the doublets. Outer (ODA) and Inner Dynein Arms (IDA) control beat frequency and waveform, respectively. Radial spokes (RS) extend from the doublets to the central doublets (CD) and transfer the signal for cilia motility. 8

18 microtubule axoneme [58]. The ODAs are much larger and consist of three motor domains with one regulatory complex which is anchored to the microtubule axoneme [59]. Both motors hydrolyze ATP and act in a ratchet-like manner to slide the microtubules past one another and to return them to their original starting position [60]. Another important structure of the motile cilium is known as the Nexin-Dynein Regulatory Complex or N-DRC. This structure is a multi-protein complex that regulates movement between the two dynein arms and helps link the microtubules together as they slide during a wave and is necessary for proper cilia beat [20,61,62]. The N-DRC is extensively studied in Chlamydomonas reinhardtii and is made of seven known proteins, labeled DRC1-DRC7, and several proteins that have yet to be identified [20,63]. Based on these studies, the N-DRC is divided into two main structural components labeled the linker and the base plate. The linker extends between the B tubule of one microtubule doublet and the A tubule of the neighboring doublet and links the dynein arms and the doublets together. The base plate anchors the N-DRC to the A tubule of the originating doublet and holds the N-DRC in place. Mutations in putative N-DRC components in mammals were shown to cause PCD [64,65]. One of the components of the N-DRC, DRC4 (protein product of Chlamydomonas gene pf2) is well conserved between species and loss of this component disrupts N-DRC component structure and causes dyskinetic cilia [66]. Work done with the Trypanosoma brucei homolog of DRC4, trypanin, shows that loss of trypanin leads to impaired movement and detachment of the flagellum running along the length of the organism [67,68]. The vertebrate homolog of pf2 and trypanin, Growth Arrest Specific 8 9

19 or Gas8 (Gas11 in humans), shares 56% protein identity to DRC4. However, even with such high homology, not much is known about the function of this protein in vertebrates. In mammals, Gas8 was originally identified as a gene down regulated in certain breast cancers and upregulated during cell senescence [69]. Recently, Gas8 was implicated in the development of PCD in agreement with its close sequence homology with Chlamydomonas DRC4 and the paralyzed flagella in pf2 mutants [70,71]. However, the role of Gas8 on a molecular level in mammals is still relative unknown. Transition Zone Structure and Function While primary and motile cilia have diverse roles and even structures, one structure that is shared between them is known as the transition zone. The transition zone is an area of intense research and scientific curiosity. It is located just distal to the basal body and is constructed from a myriad of proteins many of which are associated with two human syndromes Nephronophthisis (NPHP) and Meckel-Grüber Syndrome (MKS) [72,73]. The transition zone can be identified by its characteristic ring of Y shape structures seen under transmission EM [74]. The function of the transition zone is thought to be the gate-keeper of cilia, regulating what enters and exits; although the mechanism by which the TZ performs this task is poorly understood [30-34]. Through genetic and transgenic analyses in models such as C. elegans, a hierarchy of proteins involved in the assembly of transition zone has been established [75]. Less is known about this structure in mammalian systems but recent studies have shed some light on the structure and function of the transition zone in mammals. These analyses indicate there are at least two complexes in the TZ that consist largely of MKS 10

20 or NPHP proteins [72]. Key components of these complexes include MKS5 and NPHP4 with mutations in either of these proteins resulting in the loss of their respective complexes [31,34,76]. Less severe is the loss of outer proteins such as MKS3 or NPHP1 [77,78]. MKS6 is a protein that rests in the center of the hierarchy (Figure 3). Little is known about the function of MKS6 so we created a congenital and a conditional mouse mutant to study its effects during development and adult homeostasis. Ciliary Signaling Ciliary signaling pathways are crucial for embryonic development and adult homeostasis. Pathways such as olfactory reception, phototransduction, and a number of other cellular processes such as PDGF, Wnt, and the polycystins function through primary cilia [79-81]. Important to this dissertation, Hedgehog (Hh) signaling is a critical, cilia centric, developmental pathway in which Gas8 is thought to have a positive role. Hedgehog Signaling One of the most well-known signaling pathways regulated by the primary cilium is the Hh pathway. Hh is a signaling pathway in which many of the components dynamically localize to primary cilia and cilia are necessary for proper signal transduction and function of the hedgehog pathway in vertebrates. In vertebrates, there are four main components of the Hh signaling pathway: the Hedgehog (Hh) ligand, the receptor and inhibitor Patched (Ptch), the effector of the pathway Smoothened (Smo), and the Gli transcription factors. All of these factors function in a complex manner, balancing activation, repression, and positive and negative feedback loops. 11

21 Figure 3: Hierarchy of transition zone components. Schematic based on recent data by Masyukova, et. al The transition zone is made up of two distinct, genetically interacting complexes. The NPHP complex (blue) and the MKS complex (green) with MKS5 (orange) thought to be the most important piece of the hierarchy, holding both complexes together. 12

22 In mammals, there are three Hh ligands: Sonic, Desert, and Indian. These three ligands have unique expression patterns and coordinate their own developmental pathways but were shown to be interchangeable [82]. Sonic is the most widely expressed of the ligands and influences most of the developmental pathways that Hh is involved with. Ptch is a 12 pass transmembrane receptor which dynamically localizes to the primary cilium in vertebrates [83,84]. Ptch acts as both the receptor and inhibitor of the pathway. In the absence of ligand, Ptch inhibits the pathway by preventing Smo, in a nonstoichiometric manner, from entering the cilium and regulating processing and activation of the Gli transcription factors [85]. The mechanisms behind the Ptch repression of Smo are under investigation, but data suggests that Ptch is able to modulate cholesterol levels and may be using this method to prevent Smo from being retained [86]. Smo is a 7 pass GPCR-like transmembrane receptor that localizes to the primary cilium to function [87]. Though its ligand remains unknown, recent data suggests that it binds modified cholesterol [88]. The mechanisms surrounding Smo exclusion from the cilium in the absence of Hh ligand are under intense debate. Some hypothesize that Smo can freely enter and leave the cilium in the absence of ligand but cannot be retained or allowed to accumulate while Ptch is present in the cilium. Other research suggests that Smo remains in the membrane, excluded from the cilium until Ptch leaves the cilium after binding ligand and this repression is relieved [89-91]. Regardless, after Ptch leaves the cilium, Smo is then allowed to accumulate in the cilium and alter processing/activation of the Glis [85]. Translocation of Smo into the primary cilium in 13

23 vertebrates is absolutely essential in activating the pathway and turning on Hh target genes [92]. There are three Gli transcription factors in vertebrates, Gli1, Gli2, and Gli3 [93]. These factors serve different roles depending on the presence or absence of Hh ligand. All of the Gli proteins accumulate at the tip of the cilium in response to Hh ligand binding to it receptor [94]. This leads to a modification of the Gli proteins possibly in the primary cilium or at the base, which remains an area of intense investigation [95,96]. In the absence of ligand, Gli3 is thought to be modified at the tip of the cilium and is transported to the base where a processing complex consisting of GSK3β, PKA, and CKI marks Gli3 for transport to the proteasome [97,98]. After transport to the proteasome, Gli3 is processed into a 75kDa transcriptional repressor where it binds to promoter regions in Hh target genes and keeps them repressed [99]. In the presence of Hh ligand, Gli3 is thought to undergo a different, unknown modification where it is not processed into repressor and can exhibit weak activator activity [99-101]. These processing steps are dependent on the presence of the cilium [94]. In the absence of Hh ligand, Gli2 is phosphorylated at the base of the cilium and is marked for degradation [102]. In the presence of ligand Gli2 is stabilized and takes on the role of transcriptional activator. One of Gli2 s target genes is the Gli1 transcription factor. Gli1 is normally absent when the Hh pathway is off but after activation by Gli2, Gli1 serves as a positive feedback in which it amplifies itself as well as other target genes. Interestingly, both Gli1 and Gli2 upregulate the receptor and inhibitor, Ptch, to establish a negative feedback loop and control the pathway [103]. 14

24 Recent data links Gas8 to both primary and motile cilia [104]. The presence of Gas8 was detected at the base of the primary cilium where it is thought to act as a facilitator of Smoothened (Smo) trafficking in a signaling pathway known as Hedgehog signaling which will be discussed in a later chapter [105]. In vitro data suggests that there is a Smoothened Binding Domain (SBD) located at amino acids that is responsible for binding Smo at the base of the primary cilium and facilitating its movement into the cilium. Our mouse model shows that there may not be a connection between Gas8 and Smo at primary cilia. As part of this dissertation work, I generated a mouse mutant affecting Gas8 to explore its role in mammalian biology. These results are discussed in the chapter titled Mutation of Growth Arrest Specific 8 Reveals a Role in Motile Cilia Function and Human Disease. Ciliopathies Defects in both motile and primary cilia result in a class of diseases referred to as ciliopathies. This class of ciliopathies encompasses a wide array of diseases and phenotypes including cleft palate, polydactyly, obesity, retinal degeneration, situs inversus, cystic kidney disease, and mental retardation [106]. Often, loss of cilia results in embryonic lethality, so the possibility that there are more ciliopathies than presently described exists. However, several ciliary pathways have been linked to disease. For instance, disruptions in ciliary signaling pathways such as Hh signaling are responsible for a variety of these phenotypes including cleft palate and polydactyly [103]. Other ciliopathies such as Bardet-Biedl Syndrome (BBS) present with obesity and mental retardation and result from dysfunction in a ciliary trafficking component known as the BBSome and as ciliary chaperones [107]. Though it is known that cilia are involved in 15

25 the manifestation of many of these phenotypes, the mechanisms of dysfunction remain unknown for a number of the ciliopathies such as PCD and Meckel-Grüber Syndrome (MKS). Primary Ciliary Dyskinesia (PCD) PCD is a disease where the primary phenotype is cilia dyskinesia. This disease affects motile cilia specifically. In humans, patients with PCD can present with a wide array of phenotypes such as situs inversus, bronchiectasis, infertility, occasionally hydrocephalus, and chronic respiratory infection [10,108]. PCD can result from a myriad of lesions involving virtually every component of motile cilia [10]. While several genetic lesions that result in PCD have been identified, there are many that remain unidentified [10]. A subset of patients with PCD will also develop Kartagener Syndrome [109]. This syndrome results from the dysfunction of nodal cilia and the mis-establishment of leftright body asymmetry. Most mutations to ciliary core components result in lethal diseases. However, since dysfunction of motile cilia does not typically lead to embryonic lethality and motile cilia possess many accessory structures that are not necessary for the function of primary cilia, mutations in these components are linked to PCD in living human patients. Many mutations in dynein arms components such as DNAI1, DNAH5, DNAH11, and DNAI2 and radial spoke components such as RSPH4A, RSPH9 are linked to PCD in humans [21, ]. Recently, several genes encoding putative mammalian N-DRC components were linked to PCD in humans. The mammalian N-DRC is an understudied, but critical 16

26 component of mammalian motile cilia. Loss of putative N-DRC components such as CCDC164, and CCDC65 show loss of microtubule organization and defects in ciliary waveform [114,115]. Most recently, several truncation mutations in GAS8 were identified in a cohort of PCD patients [70,71]. Electron microscopy, immunofluorescence, and high speed video microscopy using nasal epithelium samples revealed subtle defects in cilia motility in these patients though no in depth analysis with genetic models were done to confirm that these mutations were pathogenic. Meckel-Grüber Syndrome (MKS) MKS is an autosomal recessive, embryonic lethal disease resulting from dysfunction of the ciliary transition zone. MKS patients present with various cilia phenotypes including neural tube closure defects, cleft pallet, left-right body axis asymmetry defects, polydactyly, and cystic kidneys. Mutations in several genes including MKS1, MKS2, MKS3 (TMEM67), MKS4 (CEP290), MKS5 (RPGRIP1L/ftm), MKS6 (CC2D2A), MKS7 (NPHP3), MKS8 (TCTN2), B9D1, B9D2, and TMEM231 lead to the development of MKS; however, there is not a direct phenotype-genotype correlation as mutations in the same MKS genes can lead to different phenotypes and severity and result in classification as another ciliopathy syndrome [ ]. Recent investigations into this phenomenon reveal that there is a complex hierarchy of genetic interactions between ciliopathy gene mutations that may be further influenced by genetic modifiers. Several of these genes have been studied in depth in mouse models and their phenotypes recapitulate those of the human patients. For instance, mice lacking MKS1, B9D1, and B9D2 prove to be embryonic lethal and present with compromised 17

27 ciliogenesis and multiple cilia phenotypes such as polydactyly, cystic kidneys, and neural tube closure defects [125,129]. Similarly, mice lacking RPGRIP1L (MKS5) present with cilia phenotypes reminiscent of mice lacking IFT88, an integral component required for ciliogenesis, and are embryonic lethal [130]. Important to this document, the transition zone component MKS6 (CC2D2A) is implicated in a variety of ciliopathies including Joubert s, retinopathy and Meckel- Grüber Syndrome [131]. Loss of Mks6 in zebrafish results in retinal degeneration. It was shown that Mks6 interacts with Rab8 to promote trafficking of proteins to the rod outer segment [132]. Congenital loss of Mks6 in murine models results in an embryonic lethality and displays multiple ciliopathy like phenotypes such as failure of embryonic turning and neural tube closure defects [77,127,133]. Mks6 associates with the mother centriole during ciliogenesis and promotes formation of subdistal appendage [133]. These data also show that loss of Mks6 results in an accumulation of vesicles at the base of the cilium and an inability of the centriole to dock, preventing the cell from undergoing ciliogenesis. Many of the phenotypes resulting from defects in these genes lead to embryonic lethality. So far, only congenital loss of Mks6 has been studied restricting analysis to embryonic phenotypes. Conditional ablation studies are needed in adult models to evaluate other ciliary mechanisms and phenotypes that result from defects in MKS function in tissue homeostasis and how the ciliary transition zone is affected. Polycystic Kidney Disease (PKD) Cilia are intimately tied to a disease known as PKD [134]. Autosomal dominant PKD (ADPKD) results in cyst development in later stages of life. On the other hand, 18

28 autosomal recessive PKD (ARPKD) results in early stage, severe cysts that lead to end stage renal failure in childhood [135]. Since the discovery of the hypomorphic TG737 allele, numerous studies have been undertaken to discover why ciliary dysfunction leads to cystic kidneys [136]. Early studies link mutations in three known ciliary components to the presentation of cystic kidneys: Polycystin 1 (protein product PC1), Polycystin 2 (protein product PC2), both linked to autosomal dominant PKD, and fibrocystin/polyductin (PKHD1), linked to autosomal recessive PKD [46]. PC1 is a transmembrane protein with a large extracellular domain and is thought to act as a mechanosensor which activates PC2, a calcium channel, upon bending of the cilium due to fluid flow through the kidney [137]. PKHD1 is a large, single pass transmembrane protein. The C-terminal tail of PKHD1 is thought to undergo a notch like cleavage and translocate from the cilium to the nucleus [138]. Of interest to us is how ciliary defects cause mislocalization of these proteins and cause cystic disease. Loss of a critical component of the primary cilium such as IFT88 results in loss of the primary cilium itself and therefore mislocalization of PC1, PC2, and PKHD1, resulting in disease [139]. However, loss of components that do not directly compromise ciliary structure can also result in cystic disease. For instance, loss of transition zone components such as NPHP4 do not directly compromise ciliary structure but result in a cystic disease known as Nephronophthisis (NPHP) in humans but interestingly, not in mouse models [ ]. Similarly, loss of certain BBS components, known to transport proteins in or out of the cilium, results in cytogenesis but does not compromise ciliary structure [143,144]. We show that conditional loss of another transition zone component MKS6 does not cause total cilia loss but results in rapid 19

29 cystogenesis in juveniles. These mutations may all result in mislocalization of the cystins and therefore result in cystic disease. Furthermore, there appears to be a developmental switch as to when loss of cilia will cause cystogenesis. Previous data indicate that loss of cilia before postnatal day 14 (P14) results in rapid cyst progression but loss of cilia after this time point results in very slow progressing cysts. However, injury of the adult kidney after cilia loss leads to rapid cyst progression suggesting a critical role for cilia in early development in the kidney but not during homeostasis [139,145]. To further confound the data, recent studies suggest that while loss of both cilia and PC2 individually result in cysts, loss of these components concomitantly can partially rescue cystogenesis [146]. Studies in transition zone models such as MKS6 will help us to understand the mechanisms behind transport to and retention of proteins such as PC1/2 and how their dysfunction leads to disease. Cilia and Hedgehog Related Diseases Hedgehog signaling is involved in a number of developmental processes. Hence, a number of diseases can result from dysfunction in the hedgehog signaling pathway whether directly related to dysfunction in the pathway itself or related to cilia. Diseases such as neural tube closure defects, cleft palate, and polydactyly result from dysfunction during embryonic development. During development of the neural tube, Hh ligand acts as a long range morphogen, secreted from the dorsal side of the neural tube and creating a gradient ventrally [49,147,148]. Expression patterns of neural precursors are established along this gradient and failure of this gradient to form often results in failure of the neural tube to 20

30 close. Failure of closure results in the developmental diseases exencephaly and spina bifada. Similarly, in limb patterning, Hh ligand is secreted on the anterior side of the limb or what will become digit V and travels posteriorly to digit II. Digit I is established by the total lack of Hh signaling while digits II-V are Hh dependent. Therefore, over activation of the pathway results in extranumerary digits while under activation results in a single digit [149]. These developmental defects are present in nearly every cilia mutant and are prevalent among models with defects in Hh signaling [149,150]. Hedgehog dysfunction in adults most commonly leads to cancer such as melanoma or basal cell carcinoma. Patients with Gorlin-Goltz syndrome present with some developmental abnormalities but develop basal cell carcinoma in adulthood [151]. Gorlin-Goltz results from dysfunction of Hh signaling in renewal of stem cell populations at the base of the hair follicle [152]. Similarly, over activation of the pathway in the cerebellum was found to cause medulloblastoma [153]. Reasons for Research Growth Arrest Specific 8 (Gas8) Gas8 is implicated in a regulatory role in the ciliary signaling pathway known as Hh. A recent in vitro study showed that loss of Gas8 negatively affects the movement of the Hh pathway effector Smo into the cilium upon activation, however, little remains known about whether or not this is the case in vivo. Gas8 is also the vertebrate homolog of an N-DRC component in Chlamydomonas known as DRC4 (protein product of gene pf2). The N-DRC is an understudied component of motile cilia and is essential for proper motility in less complex organisms. Loss of pf2 in Chlamydomonas results in major 21

31 ciliary structural defects and defects in cilia motility. Not much is known about the role of its homolog, Gas8, in mammals. We undertook a study to further investigate the role for Gas8 in the Hh pathway in vivo as well as to investigate how loss of Gas8 affects the mammalian N-DRC. We created a genetrap allele and used cell culture to study the effects of loss of Gas8 on the Hh pathway. We also used high speed microscopy and transmission electron microscopy (TEM) to investigate the motility and ultrastructural defects of motile cilia associated with loss of Gas8. In addition, we used the CRISPR/Cas9 system to mimic a human variant of Gas8 to determine if Gas8 is a pathogenic gene in humans. Meckel-Grüber Syndrome 6 (Mks6) The ciliary transition zone is a complex hierarchy of proteins that regulate ciliary contents. Recent studies show that there are two different complexes that make up the transition zone and that loss of proteins in this complex yield varying phenotypes in mice. While the effects of congenital loss of several of these components are known, few studies show how conditional loss affects development and adult homeostasis. Here, we set out to investigate how loss of a transition zone component Mks6 affects embryonic development. Also, we utilize a conditional allele to investigate how loss of Mks6 affects juvenile development as well as adult homeostasis. 22

32 MUTATION OF GROWTH ARREST SPECIFIC 8 REVEALS A ROLE IN MOTILE CILIA FUNCTION AND HUMAN DISEASE by WESLEY R LEWIS, ERIK B MALARKEY, DOUGLAS TRITSCHLER, RAQUAL BOWER, RAYMOND C PASEK, JONATHAN D PORATH, SUSAN E BIRKET, SOPHIE SAUNIER, CORINNE ANTIGNAC, MICHAEL R KNOWLES, MARGARET W. LEIGH, MAIMOONA A. ZARIWALA, ANIL K CHALLA, ROBERT A KESTERSON, STEVEN M ROWE, IAIN A. DRUMMOND, JOHN M PARANT, FRIEDHELM HILDEBRANDT, MARY E PORTER, BRADLEY K YODER, AND NICOLAS F BERBARI In press at PLOS Genetics Form adapted for dissertation 23

33 ABSTRACT Ciliopathies are genetic disorders arising from dysfunction of microtubule-based cellular appendages called cilia. Different cilia types possess distinct stereotypic microtubule doublet arrangements with non-motile or primary cilia having a 9+0 and motile cilia have a 9+2 array of microtubule doublets. Primary cilia are critical sensory and signaling centers needed for normal mammalian development. Defects in their structure/function result in a spectrum of clinical and developmental pathologies including abnormal neural tube and limb patterning. Altered patterning phenotypes in the limb and neural tube are due to perturbations in the hedgehog (Hh) signaling pathway. Motile cilia are important in fluid movement and defects in motility result in chronic respiratory infections, altered left-right asymmetry, and infertility. These features are the hallmarks of Primary Ciliary Dyskinesia (PCD, OMIM ). While mutations in several genes are associated with PCD in patients and animal models, the genetic lesion in many cases is unknown. We assessed the in vivo functions of Growth Arrest Specific 8 (GAS8). GAS8 shares strong sequence similarity with the Chlamydomonas Nexin-Dynein Regulatory Complex (NDRC) protein 4 (DRC4) where it is needed for proper flagella motility. In mammalian cells, the GAS8 protein localizes not only to the microtubule axoneme of motile cilia, but also to the base of non-motile cilia. Gas8 was recently implicated in the Hh signaling pathway as a regulator of Smoothened trafficking into the cilium. Here, we generate the first mouse with a Gas8 mutation and show that it causes severe PCD phenotypes; however, there were no overt Hh pathway phenotypes. In addition, we identified two human patients with missense variants in Gas8. Rescue experiments in Chlamydomonas revealed a subtle defect in swim velocity compared to controls. Further experiments 24

34 using CRISPR/Cas9 homology driven repair (HDR) to generate one of these human missense variants in mice demonstrated that this allele is likely pathogenic. 25

35 AUTHOR SUMMARY Growth-Arrest Specific 8 (Gas8) is implicated in dual roles at both the primary cilium to regulate hedgehog signaling and in motile cilia to coordinate cilia movement. To investigate these roles in vivo, we created a Gas8 genetrap mutant mouse. Though no overt primary cilia phenotypes were evident in the Gas8 genetrap mutant mice, there were severe motility defects and the mice presented with Primary Ciliary Dyskinesia (PCD) like symptoms including situs inversus and hydrocephalus. We also identified two potential disease causing GAS8 missense variants (A391V and E199K) in humans. Utilizing CRISPR/Cas9 we generated a mouse to mimic the A391V allele. When we crossed the Gas8 AV mutants with the Gas8 GT mutant, the compound Gas8 GT/AV heterozygous animals developed mild hydrocephalus. Rescue experiments using Chlamydomonas with mutations in the Gas8 homolog revealed only a modest decrease in swim velocity raising the possibility that the E199K allele is not pathogenic. 26

36 INTRODUCTION Primary cilia are solitary and immotile cellular appendages that serve as signaling hubs for pathways such as Hedgehog (Hh) during development [1]. Motile cilia initiate and maintain fluid flow and are critical in the brain for cerebral spinal fluid flow and are necessary for mucus transport in the lungs [2]. During development, motile cilia are responsible for initiating flow at the embryonic node which is critical for setting up leftright asymmetry in the mammalian body [3-5]. While all cilia have common core components such as tubulin and intraflagellar transport proteins, motile cilia possess several accessory structures such as inner dynein arms (IDAs), outer dynein arms (ODAs), radial spokes, and the nexin-dynein regulatory complex (N-DRC). In Chlamydomonas reinhardtii, data indicate that the N-DRC functions to link the A microtubule of one doublet with the B microtubule of the adjacent doublet. It coordinates the activities of the outer and inner dynein arms to regulate flagellar beat frequency and waveform [6,7]. Studies in Chlamydomonas have led to the identification of several N-DRC proteins many of which appear to be conserved in mammals [8,9]. As in Chlamydomonas, mutations in putative mammalian N-DRC proteins CCDC164 (DRC1), CCDC65 (DRC2), and most recently, GAS8 (DRC4) are correlated with defects in ciliary motility [10-13]. The human homolog of Gas8 was originally identified in human breast cancer and referred to as Growth Arrest Specific 11 (GAS11) [14]. This gene shares 56% protein identity to an N-DRC component in Chlamydomonas known as DRC4, the protein product of the paralyzed flagella 2 (PF2) gene [15]. Loss of PF2 (DRC4) in 27

37 Chlamydomonas leads to loss of IDAs and the majority of the N-DRC (N-DRC proteins DRC3-7) visible by transmission electron microscopy (TEM) and results in a slower forward swimming velocity and defective waveform [6,16,17]. The function of Gas8 in the mammalian N-DRC remains poorly understood. Gas8 localizes to the axoneme of motile cilia and also to the base of primary cilia in vertebrate cells [18]. This led us to question if Gas8 serves as an N-DRC component in motile cilia and whether it has a separate role in non-motile primary cilia. This possibility is supported by data from knockdown studies of Gas8 in NIH3T3 cells showing defects in Hh pathway responses. Expression of truncated versions of Gas8, after knockdown of endogenous Gas8, revealed that the C-terminal region of Gas8 bound to and facilitated the transport of Smoothened into the cilium in response to Hh pathway activation using the Smoothened agonist (SAG) [18,19]. In mammals, cilia are essential for normal regulation of Hh signaling activity with many of the Hh signaling components such as Smoothened, Patched and Gli transcription factors dynamically localizing in primary cilia [20-22]. Primary Ciliary Dyskinesia (PCD, OMIM #244400) is a human disease characterized by abnormal motile cilia. PCD patients exhibit bronchiectasis, infertility, and chronic respiratory infections, and in some cases can present with hydrocephalus. A subset of PCD patients will also have a reversal of their left-right body axis that includes situs inversus totalis which is referred to as Kartagener syndrome [23]. PCD patients often have changes in cilia axonemal ultrastructure that include defects in the inner or outer dynein arms, central complex, radial spokes, and the N-DRC [24-28]. These structural defects alter ciliary beat frequency (CBF), ciliary waveform, and cilia 28

38 orientation. Recent data indicate that mutations in the putative mammalian N-DRC components CCDC164, CCDC65, and Gas8 correlate with the clinical presentation of PCD. Mutations in these genes lead to dyskinetic cilia with subtle changes in cilia ultrastructure pointing to an importance for these components in ciliary motility. Other proteins such as CCDC39 and CCDC40 are responsible for the assembly and attachment of the IDAs and N-DRC in motile cilia. The absence of these proteins results in severe motility defects [10,11,29-31]. In this study, we investigate a role for Gas8 in both primary and motile cilia in vivo. For this we generated a Gas8 genetrap mutant mouse. Gas8 mutants present with severe hydrocephalus and cilia motility defects on both the ependyma and trachea, as well as a situs inversus phenotype. Given the role for Gas8 in cilia motility and recent data suggesting it is a PCD causing allele, we screened human PCD patients for GAS8 mutations and identified two independent missense variants. The potential pathogenicity of these alleles was tested by rescue experiments in Chlamydomonas PF2 mutants and by generating a mouse model for one of the variants. In contrast to the PCD phenotypes, we did not observe Hh associated defects in any of the mutant mice or cell lines derived from them or other phenotypes typically associated with defects in primary cilia function. These results suggest that GAS8 plays a highly conserved role in ciliary motility and mutations in Gas8 are associated with human disease through their impact on motile cilia. 29

39 RESULTS Generation of Gas8 mutant mice and phenotype description A β-geo cassette containing the β-galactosidase enzyme, a neomycin resistance cassette, an N-terminal splice acceptor and poly-a tail was inserted in intron 7 of the Gas8 mouse allele (Fig 1A, herein referred to as Gas8 GT ). RT-PCR analysis using primers located before the genetrap insertion indicates that the 5 end of the transcript is generated (Fig 1B, left). In contrast, primers located 3 to the insertion failed to detect any Gas8 mrna (Fig 1B, right). Western blot analysis shows a product of expected size (57kDa) in wildtype and heterozygous Gas8 mice. This product is absent in homozygous mutants (Fig 1C). Additionally, the Gas8::β-geo fusion protein is detected (approx. 230kDa) in heterozygous and homozygous mutants indicating that the genetrap allele is being transcribed and translated. Loss of Gas8 led to lethality at approximately postnatal day 14 (P14) with few living to P21. All mutants presented with severe hydrocephalus (Fig 1D). Gas8 GT mutant mice also presented with situs inversus at a rate of 36% (6 of 16 mutants) in live births based on position of the heart and stomach (Fig 1E, F). Both the hydrocephalic and situs inversus phenotypes suggested a defect in the function of motile cilia. 30

40 Fig 1. Generation of mutant Gas8 GT mice and phenotype description. (A) Schematic of the wildtype Gas8 allele (Gas8 WT ) and the Gas8 genetrap allele (Gas8 GT ). The relative position of the β-geo cassette is indicated by the blue box. Arrows indicate the primers used for RT-PCR analysis. (B) RT-PCR expression analysis of Gas8 transcript in Gas8 WT, Gas8 GT/WT, Gas8 GT whole embryos shows the presence of the 5 end of Gas8 transcript (left panels) and absence of the 3 end (right panels). Actin served as a 31

41 positive template control in all samples. Reactions with reverse transcriptase are indicated (+) and negative RT controls (-). (C) Western blot for Gas8 protein on Gas8 WT, Gas8 GT/WT, and Gas8 GT trachea. Wildtype Gas8 is located at 57 kda (Gas8 WT ) while the genetrap allele is at approximately 230kDa (Gas8 GT ). * denotes a spurious band recognized by polyclonal antibody. GAPDH was used as a loading control. (D) Nissl stained coronal section of P21 Gas8 WT and Gas8 GT brain. (E) Gas8 GT mice display situs inversus as noted by the reversed direction of the heart apex (white lines indicate heart axis) and (F) the stomach location in P2 pups (arrow). 32

42 Loss of Gas8 does not result in defective Hh signaling Based on a previous study reporting Gas8 as a positive effector of Hh signaling in mammals, we anticipated Gas8 GT mice would present with phenotypes related to Hh signaling defects, especially since this mutation would lack the putative Smo binding domain (amino acids ). However, we did not observe any hedgehog-associated phenotypes in limb patterning or neural tube formation. To further test a role for Gas8 in the Hh pathway, we isolated Mouse Embryonic Fibroblasts (MEFs) from Gas8 WT and Gas8 GT mutant mice and treated them with 150nM Smoothened agonist (SAG). The MEFs were then immunolabeled for Smo and acetylated tubulin to analyze differences in Smo trafficking into the cilium (Fig 2A). In contrast to the outcome of the knockdown studies, there was no difference between the amounts of Smo present in the cilia of Gas8 GT mutants when compared to Gas8 WT cilia (Fig 2B). These data indicate that a least in the Gas8 GT mutants, Gas8 is not an essential factor involved in regulating Smo cilia trafficking. Similarly, none of the Gas8 GT mutants exhibited defects in dorsal ventral patterning of the neural tube typical of altered Hh signaling (Fig 2C). 33

43 Fig 2. Gas8 mutant embryos have no overt Hh phenotypes. (A) Vehicle (Control) and drug treated (SAG) Gas8 WT and Gas8 GT mutant MEFs stained for Smo (green) and acetylated tubulin (purple). Scale bar is 15μm. (B) Quantification of Smo translocation into the cilium. All bars are normalized to WT CONT. (*=significantly different than WT CONT, #=Significant different than GT CONT p<0.05). (C) Gas8 WT neural tube sections and Gas8 GT sections. The Pax7 and Sonic hedgehog (SHH) domains in the notochord, floor plate and neural tube all appear similar between Gas8 GT and Gas8 WT littermates. Scale is 90μm. 34

44 Gas8 GT mice present with dyskinetic cilia and subtle cilia ultrastructural defects To investigate the hydrocephalus phenotype, cilia morphology, ultrastructure and motility on ependymal and tracheal cells was assessed. DIC analysis and immunofluorescence staining of trachea indicate motile cilia are present on the epithelium, but the Gas8 GT protein fails to localize to these cilia (Fig 3). We counted cilia from trachea TEMs for broken doublet rings and found that about 9% of cilia from Gas8 GT mutants showed disorganization of the arrangement of the microtubule doublets (Fig 4A arrowhead and E). To analyze ultrastructure within the doublets, we averaged 202 doublets of both genotypes to reduce variability due to random sectioning of the 96nm repeat of the microtubule doublet. We did not observe any major structural differences in the inner or outer dynein arms (Fig 4B). However, high speed video and Fourier transformation analysis revealed that cilia are largely static with only a few moving (Fig 4C, D, S1 Movie, S2 Movie). Those cilia that did moved were dyskinetic, resulting in an inability of cilia to propel fluid as seen by tracking of fluorescent beads added to either brain ventricle or trachea preparations (Fig 4F, G). Beat frequency of cilia that remained motile in Gas8 GT mutants was modestly decreased from 17.0Hz in Gas8 WT to 12.7Hz in Gas8 GT (Fig 4H). Cilia length is also affected in Gas8 GT mice, with Gas8 GT motile cilia measuring 0.9μm shorter than Gas8 WT motile cilia (Gas8 WT 5.3μm and Gas8 GT 4.4μm) (Fig 4I). Cilia orientation in Gas8 GT tracheas is also more randomized than in Gas8 WT controls (Fig 4J). These phenotypes observed in the motile cilia of Gas8 GT mutant mice are similar to those observed in PCD patients and animal models. 35

45 Fig 3. Gas8 localizes to cilia. Gas8 immunofluorescence staining on Gas8 WT and Gas8 GT p21 trachea (Scale Bar = 10µm). Gas8 is present in wild-type axonemes but absent from mutant axonemes. DIC images are shown to visualize the cilia on the tracheal epithelium. 36

46 37

47 Fig 4. Gas8 GT mice present with cilia motility phenotypes. (A) TEM of Gas8 WT and Gas8 GT tracheal cilia showing disorganized microtubule doublets in mutants. (B) TEM average of tracheal cilia microtubule doublet showing no major structural defects (Gas8 WT N=202 doublets from 1 trachea, Gas8 GT N=202 doublets from 1 trachea). (C) Representative kymograph measurement of ciliary waveform in Gas8 WT and Gas8 GT tracheal cilia. (D) Schematic depicting waveform defects observed in Gas8 GT cilia. (E) Percentage of cilia with disorganized doublets in wildtype and mutant trachea (Gas8 WT N=77 cilia from 1 trachea, Gas8 GT N=287 cilia from 1 trachea). (F and G) Fluorescent bead tracking of Gas8 mice in ependyma and trachea epithelium respectively. Bead flow is significantly impaired in Gas8 GT versus Gas8 WT Ependyma: Gas8 WT = 147.5μm/sec, Gas8 GT = 10.2μm/sec (Ependyma: Gas8 WT N=4 brains, Gas8 GT N=4 brains). Trachea: Gas8 WT = 24.15μm/sec, Gas8 GT = 0.62μm/sec. (Trachea: Gas8 WT N=3 trachea, Gas8 GT N= 3 trachea). (H) Tracheal cilia beat frequency (CBF) captured by DIC and analyzed using fast Fourier transform test. Gas8 WT CBF = 17.0Hz and Gas8 GT CBF = 12.7Hz (Gas8 WT N=108 cilia from 4 trachea, Gas8 GT N=46 cilia from 3 trachea). (I) Cilia length is decreased in Gas8 GT mutants as measured from DIC images (p<0.01, Gas8 WT N=321 cilia from 3 trachea, Gas8 GT N=343 cilia from 3 trachea). (J) Cilia orientation is significantly altered in Gas8 GT mice (p=0.025) (Gas8 WT N=184 cilia from 1 trachea, Gas8 GT N=375 cilia from 1 trachea). *=p<0.01, **=p<

48 GAS8 is a disease causing gene in humans The phenotypes in the Gas8 GT mutants led us to evaluate whether mutations in GAS8 are associated with PCD in humans. We identified two independent missense variants, c.595g>a E199K and c.1172c>t A391V, in human patients through a previously published screen (Fig 5A) [32]. The E119K patient is of Latino decent and presented with heterotaxy. Unaffected parents of the patient are heterozygotes, and an unaffected female sibling is a homozygote. This allele appears at a frequency of 11% in Latino populations (87 homozygotes and 1279 heterozygotes in a total of alleles sequenced according to ExAC). The prevalence of this allele in the Latino community makes it unlikely to be associated with disease. The A391V patient met the diagnostic criteria for PCD. This allele is infrequent, occurring only 3 times heterozygously and 0 times homozygously in alleles sequenced according to ExAC. Both variants affect highly conserved regions across multiple species (Fig 5B). We utilized the PolyPhen-2 program to predict the pathogenicity of these alleles. The A391V allele had a PolyPhen-2 score of suggesting that it is a potentially damaging mutation while the E199K allele had a score of only 0.082, suggesting that this is a benign mutation. Given the low allele frequency, PolyPhen-2 score, and the confirmation of the PCD diagnosis in the patient carrying the A391V variant, we chose to test potential pathogenicity of this allele in mice. 39

49 Fig 5. PCD patient missense mutations in highly conserved regions of Gas8. (A) Sanger Sequence trace and amino acid sequence of human mutations. (B) ClustalOmega amino acid alignment indicates the high conservation of the missense mutant residues found in patients which are indicated by black boxes. 40

50 To further assess the potential pathogenicity of the human allele, we created a mouse harboring the A391V mutation via homology driven repair with CRISPR/Cas9 technology. Sequencing confirmed the presence of the c.1172 C>T mutation resulting in an A391V amino acid change (Fig 6A). We crossed Gas8 AV mice onto the Gas8 GT background to create compound heterozygous (Gas8 GT/AV ) mice. To determine the impact on motile cilia and test possible cause of the hydrocephalus, we took brains from 6 week old mice and analyzed cilia beat and the ability of motile cilia to move fluid. While there were no differences in beat frequency, bead flow analysis shows a modest decrease in the ability of Gas8 GT/AV cilia to move fluid compared to Gas8 GT/WT cilia (Fig 6B, C). Compound heterozygotes develop mild hydrocephalus at approximately 10 weeks of age (Fig 6D) but there were no evident laterality defects. While all the Gas8 GT/AV mice analyzed (n=6) display hydrocephalus at this age, the severity ranged from mild (arrowhead) to moderate (arrow). The phenotype in the Gas8 GT/AV mice is not as severe as in the Gas8 GT mice and hydrocephalus was not present in any (n=2) of the Gas8 GT/WT or (n=2) of the Gas8 WT/AV mice analyzed. We chose to generate the A391V mouse model because of the PCD symptoms of the patient but given the lack of full PCD symptoms in the E199K patient, we decided to test first whether or not the E199K is pathogenic in Chlamydomonas before proceeding to a potential mammalian model. Alignment of GAS8 and the Chlamydomonas orthologue DRC4 revealed that E199 in GAS8 aligns with D198 in DRC4 (Fig 5B). To better understand the mechanisms underlying these defects, we generated strains expressing the Chlamydomonas equivalent (D198K) of the human E199K alleles in a null mutant background (pf2). Interestingly, transformation with DRC4-DK-GFP rescued the severe 41

51 motility defects seen in the pf2 null mutant, but measurements of forward swimming velocities revealed a subtle defect in the swimming phenotype of the rescued strains (Fig 6E). Furthermore, the DRC4-DK-GFP protein is assembled at wild-type levels in the flagellar axonemes of Chlamydomonas, as assayed by western blot (S1 Fig). These observations show that the D198K DRC4 mutant protein is properly localized in the axoneme and may not correspond to a pathogenic allele. 42

52 Fig 6. A391V is a potential pathogenic allele. (A) Sanger Sequence confirmation of the 1172 C>T point mutation in Gas8 AV mice reproducing the A391V missense mutation found in the human patient. (B) Ciliary beat frequency analysis on tracheal cilia of Gas8 GT/WT and Gas8 GT/AV mice shows no difference between controls and compound heterozygotes (n=86 points from 3 trachea for Gas8 GT/WT (13.04 Hz), n=76 points from 3 tracheas for Gas8 GT/AV (13.34 Hz)). (C) Tracking of red fluorescent latex beads added to lateral ventricles shows a trending but not significant decrease in ability of Gas8 GT/AV cilia to move fluid. (n=3 for Gas8 GT/WT (163.7μm/sec), n=2 for Gas8 GT/AV (135.9μm/sec)). (D) Nissl stained brains of 10 week old Gas8 GT/WT, Gas8 WT/AV, and Gas8 GT/AV mice. Mild to moderate hydrocephalus is present in the Gas8 GT/AV brains. Scale is 1mm (Arrowhead indicates mild, arrow indicates moderate) (n=4). (E) Swim speed quantification of rescue of DRC4-D198K construct in 43

53 pf2 deficient Chlamydomonas. pf2 denotes pf2 deficient Chlamydomonas, DK-GFP denotes pf2 deficient Chlamydomonas expressing the DRC4-D198K-GFP construct, DRC4-GFP denotes pf2 deficient Chlamydomonas expressing the DRC4-GFP wildtype construct. *=significant difference from WT (p<0.05), #=significant difference from pf2 (p<0.05), =significant difference between DK-GFP and DRC4-GFP (p<0.05) (n=390 for WT (123.9μm/sec), n=271 for pf2 (40.1μm/sec), n=180 for DK-GFP (108.3µm/sec), n= 299 for DRC4-GFP (120.9μm/sec)). 44

54 Supplemental Fig 1. DRC4-DK-GFP is expressed and localizes to the axoneme. Western Blot of Chlamydomonas flagellar axonemes showing that pf2 cells transformed with DRC4-DK-GFP (DK) have proper localization of the protein product. The DRC4- GFP fusion proteins are detected by a DRC4 antibody (top panel) and a GFP antibody (bottom panel). An IC69 antibody against an outer arm dynein intermediate chain serves as a loading control for the blot (bottom panel). 45

55 DISCUSSION Defects involving cilia motility cause severe phenotypes in humans including infertility, hydrocephalus, respiratory defects, and reversal of left-right asymmetry. Much of our understanding about cilia motility has come from studies in organisms such as Chlamydomonas. These studies and how defects in cilia motility cause disease are now being extended into mammalian systems. Recently GAS8 was implicated as a cause for Primary Ciliary Dyskinesia (PCD) as well as a positive effector of Smoothened transport into cilia during Hh pathway activation [12,13,19]. To further evaluate the connection between Gas8 and PCD in mammals, we generated a mouse with a β-geo cassette inserted in intron 7 of the Gas8 gene. Insertion of the β-geo genetrap cassette effectively eliminated the presence of wildtype transcript and protein in mutants as verified by RT-PCR and western blot analysis. Though the Gas8 GT mutant allele is translated into a large fusion protein between the N-terminal portion of Gas8 and β-geo, it does not localize to motile cilia. Gas8 GT mutant mice present with hydrocephalus starting at postnatal day 5 (P5) that becomes more pronounced as the mice mature and eventually leads to mortality between P14-P21. Development of hydrocephalus is associated with severe impairment of cilia motility on ependymal cells lining the ventricles of the brain. Previous studies using image average procedures to analyze flagella ultrastructure in Chlamydomonas showed that strains with mutations in PF2/DRC4, the Gas8 homolog, were associated with the loss of the majority of the N-DRC complex along with a subset of the IDAs [6,16,17,33]. In contrast to the Chlamydomonas results, the N-DRC and IDA 46

56 do not appear to be overtly affected in Gas8 mutant mice based on standard thin-section TEM analysis. However, loss of Gas8 does effect microtubule organization, as indicated by a higher percentage of cilia with disorganized microtubule doublets in Gas8 GT mutant mice when compared to Gas8 WT mice. Altered cilia microtubules were recently also recently observed in human Gas8 patients [12,13]. Together these data suggest that defects in the mammalian N-DRC may not always be detectable using traditional TEM averaging of cross-sections. The inability to observe ultrastructural defects in human PCD patients could be attributed to having only one N-DRC per 96nm repeat. Future studies using better imaging approaches such as cryo-electron tomography and image averaging of longitudinal sections to assess the human N-DRC will likely continue to reveal structural and functional differences similar to those described for the radial spokes by Lin, et al Most Gas8 GT mutant cilia failed to move, however those that were observed moving displayed a modest decrease in beat frequency. The most distinguishable phenotype observed in the cilia that moved was a very rigid and short wave pattern. This pattern has also been observed in other cilia motility mutants thought to affect the NDRC [10-12]. These changes in waveform and the lack of overall motility result in the defective fluid flow observed in these mice. Previous data show a complex relationship between planar cell polarity (PCP) and fluid flow in establishing motile cilia orientation [34,35]. Gas8 GT cilia show a more random distribution of cilia orientation than their Gas8 WT counterparts supporting the necessity of proper fluid flow in establishing cilia orientation. 47

57 Variants in Gas8 were recently identified in human PCD patients. These mutations resulted in a similar, albeit not significant, decrease in beat frequency along with an abnormally rigid ciliary waveform [12,13]. This motility phenotype is similar to our observation in the mutant mice. Here we identified an additional independent missense mutation, c.1172c>t A391V, in PCD patients as well as a variant c.595g>a E199K that appears to have minimal effect on cilia motility. The A391V mutations lies in close proximity to the other published mutants, C309*, A334*, and G357* suggesting that this area is critical for GAS8 function. Similarly, the genetrap cassette in the Gas8 GT allele was inserted in close proximity (K337) to the A334* mutation. The E199K mutation also affects a highly conserved region within Gas8 that is proposed to be a Microtubule Association Domain (GMAD) [36]. To test pathogenicity of the A391V allele, we used CRISPR/CAS9 homology driven repair (HDR) to generate a mouse line mimicking the human mutation. Mice compound heterozygous for the Gas8 GT and Gas8 AV mutations develop age dependent, mild hydrocephalus, but did not present with situs defects (n=6 Gas8 GT/AV mice). The phenotype was associated with a reduced ability of ependymal cilia to move fluid. Interestingly, beat frequency was not significantly altered from that of controls, suggesting that the defect lies within a subtle waveform difference or in cilia orientation. These data suggest that the A391V allele is pathogenic though more in-depth analysis of ciliary defects will be necessary to determine the precise mechanism. Data from the Chlamydomonas rescue experiments suggest that the E199K allele may have very subtle effects on motility. The D198K rescued strain in Chlamydomonas showed a small but statistically significant reduction in forward swim velocity of approximately 10 percent. 48

58 While statistically significant, additional work is needed to determine whether such small changes might impact ciliary motility and have pathogenic consequences in different tissues and different organisms. As this variant is commonly found in Latino populations, it seems more likely that this variant is a benign polymorphism. Gas8 was previously implicated as a modulator of the Hh pathway. In vitro data indicated that the C-terminal region of Gas8 binds to Smoothened (Smo) and acts at the base of primary cilia as a regulator of Smo entry into the cilium following Hh pathway activation [19]. These data showed that in the absence of Gas8, Smo accumulation in the cilium is abrogated and that it cannot activate the Gli transcription factors and turn on downstream genes. Based on these in vitro findings, we expected to see Hh defects in our mutant mice. However, the Gas8 mutants survive to birth and have normal digit number and patterning as well as normal neural tube dorsal ventral patterning. Furthermore, there were no significant differences in Smo accumulation in cilia between Gas8 WT and Gas8 GT MEFs after SAG stimulation, suggesting that in this mutant model, Gas8 does not act as a regulator for Smo entry. The role that Gas8 plays at the base of primary cilia remains uncertain; however, we do not see any other pathologies that would suggest there is a defect in primary cilia such as cystic kidney disease. The data presented here solidify GAS8 as a disease causing gene in humans and elucidate the mechanisms by which loss of Gas8 causes disease. We identified new independent, homozygous missense mutations and used model systems to test the pathogenicity of the alleles. Importantly, these results suggest the A391V allele is pathogenic while the E199K variant is not. Our results demonstrate the importance of testing the potential pathogenicity of human alleles in easily amenable model systems 49

59 such as Chlamydomonas and further reveal the ease with which CRISPR/Cas9 has now made it possible to conduct similar tests in mouse models. 50

60 MATERIALS AND METHODS Mice The Gas8 mutant mouse line was generated using embryonic stem cell line CH0760 (BayGenomics) in which a β-galactosidase neomycin resistance fusion cassette was inserted into intron 7 of Gas8. The insertion site was confirmed by genomic PCR and sequence analysis. PCR primers for genotyping were designed based on the insertion site and are as follows 5 -GGGACAAGCAGATTCTGGTC-3, 5 - CAGGGTTACACACAGAGAAACC-3, and 5 -CCGCAAACTCCTATTTCTG-3. The Gas8 GT embryonic stem cells were from the 129P2/OlaHsd genetic background and were injected into C57BL/6 blastocysts using standard procedures. Chimeras were bred with albino C57BL/6 females and germline transmission was confirmed by coat color and subsequent PCR genotyping. Ethics Statement All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) regulations at the University of Alabama at Birmingham under the animal protocol number ( ). RT-PCR RNA was isolated from Gas8 WT, Gas8 GT/WT, and Gas8 GT mouse embryonic fibroblasts using Trizol reagent according to the manufacturer s protocol (cat# , Thermo- Fisher Scientific). cdna was generated using Verso cdna kit (cat# AB-1453/B, Thermo-Fisher Scientific). 5 Gas8 RT-PCR was performed using the following primers 51

61 spanning exons 3 and 4: 5 -GAATCGAAGAATACCACCATC-3 and 5 - CTGAGAAGATGGCTATGTAG-3. 3 Gas8 RT-PCR was performed with primers spanning exons 9 and 10: 5 -CTGGACCCCACAGCATTAAC-3 and 5 - CTTGATGGTGGTATTCTTCG-3. Actin control primers: 5 - ATGGGTCAGAAGGACTCCTA-3 and 5 -GGTGTAAAACGCAGCTCA-3 were used in all samples. Tissue Preparation Animals were anesthetized by a 0.1 ml per 10 g of body weight intraperitoneal injection of 2.5% tribromoethanol (cat# T48402, Sigma Aldrich), killed by cardiac puncture, and perfused with PBS followed by 4% paraformaldehyde (cat# 19943, Thermo-Fisher Scientific). The brains were further fixed in 4% paraformaldehyde 1h at room temperature followed by successive dehydration through 1 hour alcohol incubations at 30% and 50% and placed finally in 70% overnight. Tissues were further dehydrated through 1 hour alcohol incubations at 80%, 95%, and finally 100%. Tissues were placed in xylenes for 1 hour and then placed in a 50/50 xylenes/paraffin mix for 1 hour at 60 o C under vacuum followed by a final paraffin penetration in paraffin at 60 o C under vacuum for 1 hour and then paraffin embedded. The brains were sectioned at 10μm and stained with Cresyl Violet stain as previously described [37]. Immunoblotting Fresh tracheas were extracted from p21 Gas8 WT, Gas8 GT/WT, and Gas8 GT mice. Samples were submerged in ice cold RIPA (10mM Tris ph7.5, 150mM NaCl, 1%NP-40, 1% sodium deoxycholate, 0.1% SDS) mixed with one complete Protease Inhibitor tablet 52

62 (cat# , Roche Diagnostics) per 10mL at 300uL per 5mg of tissue. Tissues were sonicated 3x for 10 seconds each. After sonication, tissues were placed on a rotary agitator for 2 hours at 4 o C and then spun for 20 minutes at 12,000rpm at 4 o C. Supernatant was removed and protein levels were assayed using a BioRad DC protein assay kit (cat# , Bio-Rad). Approximately 20µg per sample was used for SDS-PAGE with a 12% Tris-Glycine gel (cat# , Thermo Fisher Scientific). Proteins were transferred overnight to nitrocellulose. The membrane was blocked for 45 minutes in 5% milk in PBS and incubated with primary antibody in 5% milk in PBS with 0.02% Tween- 20 overnight at 4 o C. Primary rabbit anti-gas8/drc4 antibody was used at 1:20000 [6]. Primary mouse anti-gapdh was used as a loading control at 1:1000 (cat# ab8245, Abcam, Cambridge UK). Blots were washed 5x for 5 minutes each in 0.02% PBS- Tween-20. Secondary antibody in 5% milk in 0.02% PBS-Tween-20 was added and the blot was incubated for 1 hour at room temperature with the following secondary antibodies: anti-mouse IRDye 800CW (cat# , LI-COR, Lincoln NE USA) and anti-rabbit IRDye 680RD (cat# , LI-COR). Blots were washed 5x for 5 min each in 0.02% PBS-Tween-20 and then dried. Images were taken on a LI-COR Odyssey CLx imaging system (LI-COR). Mouse Embryonic Fibroblast Generation Mouse embryonic fibroblasts (MEFs) were generated from E14.5 embryos and cultured in DMEM growth medium with High Glucose, 0.05mg/ml Penicillin/Streptomycin, 2mM L-Glutamine, 0.2mM β-mercaptoethanol, and 20% Fetal Bovine Serum (FBS). Prior to immunolabeling, MEFs were cultured in reduced serum medium containing 0.5% FBS for 48 hours to induce primary cilia formation as previously described [38]. 53

63 Immunofluorescence Cells were fixed in 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS with 2% donkey serum, 0.02% sodium azide and 10 mg/ml bovine serum albumin (BSA). Cells were labeled with anti-acetylated α-tubulin, 1:1000 (cat# T-6793, Sigma- Aldrich), anti-smon, 1:1000 (gift from Dr. Matthew Scott, Stanford University). Sections from E10.5 neural tubes were immunolabeled with the following antibodies from Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, IA): anti- ShhN 1:1000 (5E1), anti-foxa2 1:1000 (74.5a5), anti-mnr2 1:1000 (81.5C10), anti-pax7 1:1000 (Pax7), and anti-msx1+2 1:1000 (4G1) as previously described [38]. Trachea sections were labeled with anti-gas8/drc4, 1:2000 [6]. All incubations and washes were carried out in PBS with 2% normal donkey serum, 0.02% sodium azide and 1% BSA. Primary antibody incubations were performed for hours at 4 C and secondary antibody incubations were performed for 1 hour at room temperature. Secondary antibodies all from Thermo-Fisher Scientific include the following: Alexa Fluor-594 donkey anti-mouse (cat# A21203), Alexa Fluor-488 donkey anti-mouse (cat# A21202), Alexa Fluor-594 donkey anti-rabbit (cat# A21207), and Alexa Fluor-488 donkey antirabbit (cat# A21206). Nuclei were visualized by Hoechst nuclear stain. Coverslips were mounted using Immu-Mount (cat# , Thermo-Fisher Scientific). Fluorescence imaging was performed using a Nikon TE-2000U inverted microscope (Melville, KY) outfitted with a PerkinElmer UltraVIEW ERS 6FE-US spinning disk laser apparatus (Shelton, CT) and a Hamamatsu C

64 DIC images of p14 trachea prepared for IF were used for length analysis. Images were captured with a 40x objective (Plan-Fluor, 1.3NA). Length was measured manually by drawing a line from the tip of the cilium to the base using Volocity v6.3. Smoothened Trafficking Assay Gas8WT and Gas8GT MEFs were grown to confluency on 0.17mm coverslips and serum starved for 48 hours to induce ciliation. Cells were treated with 150nM Smoothened agonist (SAG) (cat#566660, CALBIOCHEM) for 2 hours in low serum media to induce Hedgehog pathway activation and Smoothened translocation. Cells were fixed and stained as described in the immunofluorescence section and imaged by spinning disk confocal. Amount of Smoothened per cilia volume was measured using Volocity v6.3 software. Transmission Electron Microscopy Postnatal day 14 (P14 mice were anesthetized and perfused with PBS followed by a perfusion of 2% glutaraldehyde in 0.1M cacodylate buffer ph 7.4. Tracheas were extracted and fixed overnight at 4 o C in 2% glutaraldehyde in 0.1M cacodylate buffer ph 7.4. Samples were then washed thoroughly four times for 15 minutes each in 0.1M cacodylate Buffer ph 7.4. A post fix in 1% OsO4 in 0.1M cacodylate buffer ph 7.4 was performed. Samples were washed two times for 10 minutes each in 0.1 M cacodylate ph 7.0. Samples were then prepped in 1% tannic acid in 0.1M cacodylate Buffer ph 7.0; 30 minutes followed by 1% NaSO4 in 0.1M cacodylate Buffer ph 7.0; 5 minutes. Dehydrate the samples in 50%, 75%, and 95% at 4 C for 20 minutes each and finally 100% EtOH for 20 minutes; warm to RT. Dehydrate samples totally with four washes of 100% EtOH 55

65 15 minutes each. Infiltrate the sample with Propylene Oxide for 30 minutes. Mix the EMbed 812 according to instructions from EMS and Infiltrate with 25% Embed in propylene oxide for 30 minutes, 50% for 40 minutes, 75% overnight, 100% for four hours, 100% for 1 hour and harden at 60 o C. Samples were sliced at 90nm and imaged on a Phillips CM110 Electron Microscope. TEM averaging of doublets was performed by isolating individual doublets from cilia and importing the doublets into Photoshop CS5. Individual doublets were aligned to a single template doublet and then averaged and flattened. TEMs were used to determine cilia orientation. Cilia orientation was determined by measuring the angle of central pairs by drawing a line across the central doublets and measuring the angle relative to the image. Each angle was normalized to the average (or most common angle) after setting the average angle to 0 o. The frequency of angles in each image was measured and plotted. Bead Flow Analysis Brains of experimental mice were extracted, sliced in half to expose the ependymal of the lateral ventricles and placed in pre-warmed, pre-oxygenated artificial cerebrospinal fluid (125mM NaCl, 2.5mM KCl, 1.25mM NaH 2 PO 4, 2mM CaCl 2, 1mM MgCl 2, 25mM NaHCO 3, 25mM Glucose, ph 7.35). Brains were placed on a Zeiss Axioskop microscope and imaged with a 5x objective (Plan-Neofluor, 0.15NA) and a 10x objective (Fluor, 0.5NA) using a Photometrics CoolSnap HQ CCD camera at 30fps. Red fluorescent latex beads (cat# L3530-1mL, Sigma-Aldrich) were diluted 1:100 from stock and 10µL of 56

66 diluted beads was added to the ventricles. Bead tracking analysis was performed using the MTrack2 plugin in FIJI. High Speed Video Microscopy Mice trachea were dissected out into fresh PBS and cut lengthwise into strips. Trachea were kept in warm media (DMEM F/12, 20% FBS, and Pen-Strep and allowed to adapt for 20 minutes in an environmental chamber (37 o C, 45% relative humidity, and 5% CO 2 ) before imaging with Differential Interference Contrast (DIC). All high speed video was captured at 240fps using a modified Casio Exilim EX-ZR100 attached to a Nikon TE-200 using a 60x water objective (Plan-Apo WI NA=1.2). Videos saved as quick time files were then extracted into individual frames using VirtualDub software and all analysis was performed in ImageJ. Kymographs were created using Metamorph v6.1. A line was drawn from the tip of the cilium to the base and kymographs were made from the results. Generation of Chlamydomonas Lines To make the D198K mutation in Chlamydomonas, the DRC4-GFP plasmid [6] was used as template for PCR with the primers 5 -CAGTGCTGTGAGCCTGACG and 5 - AAACCAAAGCACCTTGAGCG to generate a 1483bp product that contains the restriction sites BclI and ClaI flanking the desired mutation site. The PCR product was cloned into pgem-t-easy (cat# A1360, Promega Corp) to generate the plasmid pf2-y1- A. This plasmid was further digested with KpnI and SpeI to removed repetitive DNA and subcloned into pbluescript to generate the plasmid pf2-y1-b. The D198K mutation was introduced into pf2-y1-b using the primers 5-57

67 GAAGATGCTGCGAGACaAaATGGAGCTGCGGAGAAAG-3 and 5 - CTTCTACGACGCTCTGtTtTACCTCGACGCCTCTTTC-3 and the QuickChange II kit (Agilent Technologies) to generate the plasmid pf2-y1-c. After sequence verification by Genewiz, the pf2-y1-c plasmid was digested with KpnI and SpeI and subcloned back into pf2-y1-a to generate the plasmid pf2-y1-d. The pf2-y1-d plasmid was digested with BclI and ClaI to release the 1483 bp fragment now carrying the D198K mutation. This fragment was subcloned back into the original DRC4-GFP plasmid by Genewiz. The completed plasmid, DRC4-D198K-GFP, was linearized with EcoRI for transformation into the pf2-4 strain [6]. Transformants were screened as described above. RT-PCR confirmed that the D198K mutation was expressed in the rescued strains without any other sequence modification. Forward swimming velocity was recorded and measured as previously described [6]. For transformations with the control DRC4-GFP plasmid, rescued colonies were recovered at a frequency of 5-15% Generation of the Gas8 AV mouse allele CRISPR/sgRNA target sequences were queried using the MIT CRISPR server. Three sites most proximal to the desired SNP change were selected to test nuclease efficiency. CRISPR1: 5 - CTTCTCCACAGCAGCGTTCA GGG-3 (reverse strand), CRISPR2: 5 - GGTGCTGGCCGCCTCCAACC TGG-3 (forward strand), CRISPR3: 5 - GACACAAGCGTTAATGCTGTGGG-3 (reverse strand). Pronuclear injections were performed with Cas9 mrna (100 ng/ul), CRISPR3/sgRNA (50 ng/ul) and ssodn (200 ng/ul). Efficiency of nuclease activity was assessed using a blastocyst assay. In brief, injected zygotes were cultured to the blastocyst stage and lysed to obtain genomic DNA. Genomic DNA was used in PCR and the amplicons (215 bp) were resolved by 58

68 heteroduplex mobility assay (HMA). CRISPR3 was found to be most efficient and was used to generate the SNP edited mouse (C57Bl/6 background). Injected zygotes were cultured to 2-cell stage in KSOM mixed with the NHEJ inhibitor SCR7 at a final concentration of 10 mm. The 2-cell stage embryos were transferred to psuedopregnant recipient female mice, which gave birth to 13 pups. The SNP was introduced with the help of a 154 nt single stranded oligo DNA (ssodn) HDR template. Since the PAM sequence (CCC>Pro) could not be modified without changing the amino acid, multiple silent changes were made in the protospacer (sgrna binding) sequence (indicated by small letters in the sequence below). These changes were made to eliminate the chances of the sgrna binding to the repaired allele. The SNP change introduced a restriction enzyme recognition enzyme site (BsmBI/Esp3I) and the silent changes introduced two new restriction enzyme recognition sites (BtgI and HaeII). HaeII sites were used to distinguish the wildtype and the modified alleles. Specific primers were also designed that can preferentially amplify the modified allele. HDR template (ssodn) 5 - GGCCCTGAACGCTGCTGTGGAGAAGAGAGAGGTTCAGTTCAATGAGGTGCTG GCCGTCTCCAACCTGGACCCCACgGCgcTgACGtTgGTGTCCCGCAAACTTGAG GTAGGTGCCCTCCTGTCCTGTGCTGTGGTACGCCTTCTTGGGTGGCAC-3. After the initial characterization of the F0 litter by PCR, the 215 bp amplicons were cloned, and selected individual clones were subjected to Sanger sequencing. Sequence analysis of the 13 pups revealed that 2 had complete knock-in of the edited/repair sequence, 1 pup had incorporated the silent changes but did not have the desired SNP change, and 1 pup had indels. F0 animals were bred with wildtype C57Bl/6 mice to test germline transmission of the desired alleles. All alleles were successfully transmitted through the germline, and the 59

69 positive F1 animals were used to create homozygous and compound heterozygous F2 animals. Statistical Analysis Cilia length analysis, bead flow tracking, cilia orientation, and cilia beat frequency were tested with Student s t-test and graphed in Microsoft Excel. Smoothened trafficking assay and Chlamydomonas swim speeds were tested by ANOVA followed by Student s t-test with a Bonferroni correction and graphed in Microsoft Excel. All error is represented in Standard Error of Means (SEM). 60

70 ACKNOWLEDGEMENTS We would like to acknowledge Dr. Bonnie Blazer-Yost for critical reading of the manuscript and Dr. Karl Lechtreck for critical reading and experimental design. The authors would also like to acknowledge Jason Sakizadeh (UMN) for work with Chlamydomonas and Mandy J. Croyle and Devan M. Rockwell for technical assistance in manuscript preparation as well as Holly R. Thomas for technical assistance as well as the patients and families for contribution of clinical data. 61

71 Citations 1. Drummond IA (2012) Cilia functions in development. Curr Opin Cell Biol 24: Brooks ER, Wallingford JB (2014) Multiciliated cells. Curr Biol 24: R Nonaka S, Yoshiba S, Watanabe D, Ikeuchi S, Goto T, et al. (2005) De novo formation of left-right asymmetry by posterior tilt of nodal cilia. PLoS Biol 3: e Hirokawa N, Tanaka Y, Okada Y (2012) Cilia, KIF3 molecular motor and nodal flow. Curr Opin Cell Biol 24: Hirokawa N, Tanaka Y, Okada Y (2009) Left-right determination: involvement of molecular motor KIF3, cilia, and nodal flow. Cold Spring Harb Perspect Biol 1: a Bower R, Tritschler D, Vanderwaal K, Perrone CA, Mueller J, et al. (2013) The N- DRC forms a conserved biochemical complex that maintains outer doublet alignment and limits microtubule sliding in motile axonemes. Mol Biol Cell 24: Heuser T, Raytchev M, Krell J, Porter ME, Nicastro D (2009) The dynein regulatory complex is the nexin link and a major regulatory node in cilia and flagella. J Cell Biol 187: Piperno G, Mead K, LeDizet M, Moscatelli A (1994) Mutations in the "dynein regulatory complex" alter the ATP-insensitive binding sites for inner arm dyneins in Chlamydomonas axonemes. J Cell Biol 125: Piperno G, Mead K, Shestak W (1992) The inner dynein arms I2 interact with a "dynein regulatory complex" in Chlamydomonas flagella. J Cell Biol 118:

72 10. Wirschell M, Olbrich H, Werner C, Tritschler D, Bower R, et al. (2013) The nexindynein regulatory complex subunit DRC1 is essential for motile cilia function in algae and humans. Nat Genet 45: Austin-Tse C, Halbritter J, Zariwala MA, Gilberti RM, Gee HY, et al. (2013) Zebrafish Ciliopathy Screen Plus Human Mutational Analysis Identifies C21orf59 and CCDC65 Defects as Causing Primary Ciliary Dyskinesia. Am J Hum Genet 93: Olbrich H, Cremers C, Loges NT, Werner C, Nielsen KG, et al. (2015) Loss-of- Function GAS8 Mutations Cause Primary Ciliary Dyskinesia and Disrupt the Nexin-Dynein Regulatory Complex. Am J Hum Genet 97: Jeanson L, Thomas L, Copin B, Coste A, Sermet-Gaudelus I, et al. (2016) Mutations in GAS8, A Gene Encoding A Nexin-Dynein Regulatory Complex Subunit, Cause Primary Ciliary Dyskinesia With Axonemal Disorganization. Hum Mutat. 14. Whitmore SA, Settasatian C, Crawford J, Lower KM, McCallum B, et al. (1998) Characterization and screening for mutations of the growth arrest-specific 11 (GAS11) and C16orf3 genes at 16q24.3 in breast cancer. Genomics 52: Rupp G, Porter ME (2003) A subunit of the dynein regulatory complex in Chlamydomonas is a homologue of a growth arrest-specific gene product. J Cell Biol 162: Brokaw CJ, Kamiya R (1987) Bending patterns of Chlamydomonas flagella: IV. Mutants with defects in inner and outer dynein arms indicate differences in dynein arm function. Cell Motil Cytoskeleton 8:

73 17. Lin J, Tritschler D, Song K, Barber CF, Cobb JS, et al. (2011) Building blocks of the nexin-dynein regulatory complex in Chlamydomonas flagella. J Biol Chem 286: Colantonio JR, Bekker JM, Kim SJ, Morrissey KM, Crosbie RH, et al. (2006) Expanding the role of the dynein regulatory complex to non-axonemal functions: association of GAS11 with the Golgi apparatus. Traffic 7: Evron T, Philipp M, Lu J, Meloni AR, Burkhalter M, et al. (2011) Growth Arrest Specific 8 (Gas8) and G protein-coupled receptor kinase 2 (GRK2) cooperate in the control of Smoothened signaling. J Biol Chem 286: Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, et al. (2005) Vertebrate Smoothened functions at the primary cilium. Nature 437: Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, et al. (2005) Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for processing and function. PLoS Genet 1: e Rohatgi R, Milenkovic L, Scott MP (2007) Patched1 regulates hedgehog signaling at the primary cilium. Science 317: Horani A, Ferkol TW, Dutcher SK, Brody SL (2016) Genetics and biology of primary ciliary dyskinesia. Paediatr Respir Rev 18: Roy S (2009) The motile cilium in development and disease: emerging new insights. Bioessays 31: King SM (2000) The dynein microtubule motor. Biochim Biophys Acta 1496:

74 26. O'Callaghan C, Rutman A, Williams GM, Hirst RA (2011) Inner dynein arm defects causing primary ciliary dyskinesia: repeat testing required. Eur Respir J 38: Sakakibara H, Takada S, King SM, Witman GB, Kamiya R (1993) A Chlamydomonas outer arm dynein mutant with a truncated beta heavy chain. J Cell Biol 122: Smith EF, Yang P (2004) The radial spokes and central apparatus: mechano-chemical transducers that regulate flagellar motility. Cell Motil Cytoskeleton 57: Merveille AC, Davis EE, Becker-Heck A, Legendre M, Amirav I, et al. (2011) CCDC39 is required for assembly of inner dynein arms and the dynein regulatory complex and for normal ciliary motility in humans and dogs. Nat Genet 43: Becker-Heck A, Zohn IE, Okabe N, Pollock A, Lenhart KB, et al. (2011) The coiledcoil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation. Nat Genet 43: Antony D, Becker-Heck A, Zariwala MA, Schmidts M, Onoufriadis A, et al. (2013) Mutations in CCDC39 and CCDC40 are the major cause of primary ciliary dyskinesia with axonemal disorganization and absent inner dynein arms. Hum Mutat 34: Halbritter J, Porath JD, Diaz KA, Braun DA, Kohl S, et al. (2013) Identification of 99 novel mutations in a worldwide cohort of 1,056 patients with a nephronophthisisrelated ciliopathy. Hum Genet 132:

75 33. Gardner LC, O'Toole E, Perrone CA, Giddings T, Porter ME (1994) Components of a "dynein regulatory complex" are located at the junction between the radial spokes and the dynein arms in Chlamydomonas flagella. J Cell Biol 127: Guirao B, Meunier A, Mortaud S, Aguilar A, Corsi JM, et al. (2010) Coupling between hydrodynamic forces and planar cell polarity orients mammalian motile cilia. Nat Cell Biol 12: Matsuo M, Shimada A, Koshida S, Saga Y, Takeda H (2013) The establishment of rotational polarity in the airway and ependymal cilia: analysis with a novel cilium motility mutant mouse. Am J Physiol Lung Cell Mol Physiol 304: L Bekker JM, Colantonio JR, Stephens AD, Clarke WT, King SJ, et al. (2007) Direct interaction of Gas11 with microtubules: implications for the dynein regulatory complex. Cell Motil Cytoskeleton 64: Bishop GA, Berbari NF, Lewis J, Mykytyn K (2007) Type III adenylyl cyclase localizes to primary cilia throughout the adult mouse brain. J Comp Neurol 505: Berbari NF, Kin NW, Sharma N, Michaud EJ, Kesterson RA, et al. (2011) Mutations in Traf3ip1 reveal defects in ciliogenesis, embryonic development, and altered cell size regulation. Dev Biol 360:

76 MUTANT MECKEL-GRÜBER SYNDROME 6 MICE REVEAL A CONSERVED ROLE IN DEVELOPMENT AND ADULT HOMEOSTASIS by WESLEY R. LEWIS, NICOLAS F. BERBARI, ERIK B. MALARKEY, DAN SHAN, KATIE L. BALES, TIM NAGY, ROBERT A. KESTERSON, ALECIA K. GROSS, MICHAL M. MRUG, BRADLEY K. YODER In preparation for PLOS One Form adapted for dissertation 67

77 ABSTRACT Primary cilia are sensory and signaling structures required for mammalian development and adult tissue homeostasis. Critical to their proper function is their ability to regulate signaling protein localization. However, the precise mechanisms by which cilia achieve this compartmentalized signaling are unclear. Several proteins associated with diseases of cilia dysfunction localize to a region at the base of cilia called the transition zone (TZ), where they are thought to serve both structural and regulatory roles. Data from multiple model systems and approaches has led to the idea that the ultrastructural components of the TZ are involved in regulating entry and exit for the ciliary compartment. To further address these questions we generated both congenital and conditional mutant mouse alleles of the TZ associated Meckel-Grüber Syndrome 6 (Mks6) gene. In the congenital knockout of Mks6 we observe many of the phenotypes associated with complete cilia loss such as neural developmental defects and embryonic lethality. Unlike previously published reports, we are unable to observe primary cilia on cultured mouse embryonic fibroblasts using the same congenital mutant Mks6 allele. Conditional loss of Mks6 in juvenile mice results in cilia loss and rapid but variable renal cyst development and retinal degeneration. Similar to loss of intraflagellar transport proteins in adults, Mks6 loss in adulthood resulted in slow cyst progression and retinal degeneration. However, unlike adult mutant cilia loss mouse models, Mks6 conditionals did not become obese. The absence of obesity in Mks6 mutants also distinguishes this MKS allele from other TZ conditional mutant models like Mks5 (Rpgrip1l). Ultimately, a complete understanding cilia function will not only lead to understanding the rare ciliopathies, such as MKS, but will also help us to understand some of the more common 68

78 clinical features associated with these disorders such as chronic kidney disease, retinal degeneration and obesity. 69

79 INTRODUCTION The primary cilium is a near ubiquitous immotile microtubule based cellular appendage found on most mammalian cells. Cilia are known to be essential to certain signaling and sensory cascades [1]. Since cilia are found on most cell types, defects in cilia formation, structure, and signaling are associated with a spectrum of genetic syndromes collectively called the ciliopathies [2]. Ciliopathies are all rare genetic disorders exhibiting wide-ranging symptoms including: cystic kidney disease, retinal degeneration, obesity, mental retardation, polydactyly, situs inversus, anosmia, and infertility [3]. As the individual proteins and protein complexes associated with disease alleles have been elucidated it has become clear that there are distinct sub-compartments within cilia, such as the basal body, transition zone (TZ), inversin domain and the ciliary tip. In particular, the TZ has been the subject of intense investigation due to localization of several disease gene protein products to this ciliary domain [4,5]. While the precise functions of the TZ remains unclear, it is thought to possess some potential gating capacity, determining what can and cannot enter the cilium and if said proteins remain there or are trafficked back out [6-10]. One commonly studied TZ dysfunction associated ciliopathy is Meckel-Grüber Syndrome (MKS). MKS is a rare, autosomal recessive ciliopathy resulting in perinatal lethality making MKS one of the most severe ciliopathies. MKS fetuses display severe renal cystic disease, microphthalmia, neural tube closure defects, and polydactyly [11]. Extensive genetic profiling of both consanguineous and unrelated MKS families has thus 70

80 far identified 11 genes responsible for instances of MKS: MKS1, MKS2, MKS3 (TMEM67), MKS4 (CEP290), MKS5 (RPGRIP1L), MKS6 (CC2D2A), MKS7 (NPHP3), MKS8 (TCTN2), B9D1, B9D2, and TMEM231 [12-24]. An effort is being made to more clearly model MKS and its manifestations in multiple models to elucidate both the genetic and physical interactions between genes, genetic loci, and gene products responsible for such phenotypes. MKS6 (CC2D2A) was identified in a genetic screen for autosomal-recessive mental retardation with associated retinitis pigmentosa [25]. MKS6 became associated with the MKS program by homozygous mapping of unrelated families with instances of MKS without any previously identified mutation [26]. Further analysis confirmed MKS6 to have genetic and functional interactions with other MKS gene products. The MKS6 protein contains three coiled-coil domains and a C2 domain similar to MKS5 [25,26]. The gene product for MKS4 (CEP290) localizes to the base of the primary cilium where it was found to colocalize with MKS6 [26]. In vitro binding analysis concludes that MKS6 and CEP290 physically interact. Synergy studies using morpholinos in zebrafish for CEP290 in the Mks6 null (snl -/- ) genetic background demonstrate an increased frequency and faster onset of pronephric cysts in the zebrafish; highlighting the importance of TZ stability. Interestingly, snl fish are still able to form primary cilia whereas homozygous mutant MKS6 human fibroblasts indicate that loss of MKS6 leads to defects in ciliogenesis [23]. Similarly, Mks6 was found necessary for subdistal centriole appendage assembly on the ciliary basal body [27]. These conflicting data indicate that multiple model systems are needed to fully understand the complex 71

81 interactions of TZ components and how their dysfunction leads to specific clinical manifestations. Here, we have generated Mks6 mutant mouse models and find that Mks6 deletion results in embryonic lethality and embryos exhibit phenotypes indicative of cilia defects. From our analysis we determine that Mks6 is essential for robust ciliogenesis leading to decreased cilia signaling during development. Since Mks6 loss embryonically results in lethality in both humans and mice, we pursued a conditional model of MKS6 to assess the function of the TZ in juvenile and adult tissues. 72

82 RESULTS Generation of Mks6 congenital and conditional mutants To investigate the role of Mks6 (Cc2d2a) in vivo in a mammalian system, we generated two different mutant alleles. A congenital gene trap null allele (Mks6 GT ) which contains a β-geo cassette between exon 11 and exon 12 (blue rectangle). Since congenital loss of Mks6 results in embryonic lethality, a conditional allele was generated with LoxP sights flanking exons 6 and 7 (Mks6 FL ), deleting these exons upon cre activation (Mks6 Δ ) (Fig. 1A). Both RT-PCR and qrt-pcr analysis show loss of Mks6 message in the Mks6 GT mice (Fig. 1B, C). Loss of Mks6 results in embryonic lethality with ciliogenesis defects and changes in acetylation. Congenital loss of Mks6 leads to variable embryonic phenotypes and lethality. Embryonic lethality ranges from E9.5 to E11.5 (Fig. 1D). Immunoflourescence analysis of cilia in mutants revealed a decreased number of primary cilia in the ventral neural tube (VNT) and lateral plate mesoderm (LPM), suggesting that lethality and the neural developmental phenotypes may be due to loss of the organelle (Fig. 2A). Since loss of cilia has been associated with changes in the cell cytoskeleton such as hyper-acetylation of α-tubulin [28,29] we examined acetylated tubulin levels in Mks6 GT embryos. Mks6 GT embryos display hyper-acetylation in both the VNT and LPM (Fig. 2B). Interestingly, Mks6 mutant mouse embryonic fibroblasts (MEFs) also do not produce cilia and show hyper acetylation (Fig. 2C, D) (p<0.05). 73

83 Fig. 1: Congenital and conditional knockout mouse alleles of Mks6 (A) Mks6 mutant and control mouse alleles.: Wildtype (Mks6 WT ), gene trap allele with a splice acceptor β- galactosidase cassette (β-geo, blue rectangle) in intron 11 (Mks6 GT ), conditional allele with loxp (P, green triangles) sites flanking exons 6 and 7 (Mks6 FL ), conditional mutant allele (Mks6 Δ ). (B) RT-PCR analysis shows loss of the Mks6 transcript in Mks6 GT MEFs. (C) Loss of transcript in Mks6 GT MEFs was verified by qrt-pcr. (D) Mks6 GT embryos presented with variable phenotypes at different embryonic stages. 74

84 Fig. 2: Congenital loss of Mks6 is Embryonic Lethal and presents with defects in neural tube development. (A) Analysis of cilia on ventral neural tubes (VNT) and lateral plate mesenchyme (LPM) of wildtype (Mks6 WT ) and gene trap mutants (Mks6 GT ) at embryonic day 10.5 immunolabeled for the cilia marker Arl13b in red. Control (Mks6 WT ) VNT displays cilia lining the neural tube opening, note the overall disorganization of the Mks6 GT VNT. (B) Mks6 GT embryos display hyper acetylation in both the ventral neural tube (VNT) and lateral plate mesoderm (LPM) of embryonic day 10.5 mice of wildtype (Mks6 WT ) and gene trap mutants (Mks6 GT ) immunolabeled for the cilia marker acetylated α-tubulin (Ac-Tub) in green. Control (Mks6 WT ) VNT and LPM displays cilia and other Ac-Tub positive processes, note the dramatic increase in Ac-Tub staining in Mks6 GT VNT and LPM (Hoechst nuclear stain in blue). Mouse embryonic fibroblasts (MEFs) 75

85 immunolabled for the cilia marker acetylated α-tubulin (Ac-Tub) in green and Hoechst nuclear stain in blue. Scale bar 32µm. (C) Wildtype control (Mks6 WT ) MEFs display cilia, as indicated by arrows, compared to gene trap mutant (Mks6 GT ) MEFs. Note the increase in cytosolic acetylated tubuiln in Mks6 GT cells. Mks6 GT MEFs failed to produce cilia and showed hyper acetylation (green). Arrows point to cilia on Mks6 WT MEFs. (D) Graph indicating the percent of acetylated α-tubulin positive cilia on MEFs after 24 hour serum starvation. MEFs isolated from two Mks6 WT and four Mks6 GT embryos were analyzed. Asterisks indicates p<

86 Conditional loss of Mks6 results in rapid cyst development. We induced Mks6 loss at postnatal day 7 (P7) using a ubiquitously expressed inducible cre recombinase (Cagg-CreER). Loss of Mks6 at this age results in renal cyst formation (Fig. 3A). Interestingly, these cysts and other tubules in the kidney, contain a mix of LTA (green) and DBA (red) positive cells. Mks6 Δ animals display a large and significant increase in cystic index as well (Fig. 3B) (p<0.05). Another interesting aspect to postnatal loss of Mks6 was the large amount of variation in renal cyst severity when cre was induced at a juvenile stage. To further assess this variability we longitudinally tracked cyst developmental in juvenile (P7) induced Mks6 FL mice over an 8 week course utilizing MRI. These data demonstrate similar to the variable embryonic null allele variable phenotypes that both cystogenesis and cyst progression are variable in Mks6 Δ mice (Fig. 4A). While MRI data provided the advantage of tracking cystic progression over time, it also provided reduced resolution when compared to end point analyses such as µct and histology (Fig. 4A). End point data comparing Total Kidney Volume (TKV)/Body weight (BW) also showed a large amount of variability in the cystic phenotype of Mks6 Δ mice. Similarly, serum creatinine levels vary greatly in Mks6 mutant mice and correlated directly with cystic progression (Fig. 4B). Loss of Mks6 results in retinal degeneration. Loss of Mks6 has been previously shown to lead to retinal degeneration in zebrafish [30]. To investigate its role in development and maintenance of photoreceptors, we induced juvenile and adult mice and analyzed retinas. Juvenile mice were induced at 77

87 Fig. 3. Juvenile loss of Mks6 results in cystic kidneys. (A) Immunofluorescence for cilia and collecting and proximal tubules. Cilia are labeled with acetylated α-tubulin (647-Acetylated Tubulin) in white. Dolichos biflorus agglutinin (DBA) positive collecting tubules in red and Lotus tetragonolobus agglutinin (LTA) positive proximal tubules in green. Note the presence of both a cyst and acetylated tubulin positive cilia in the Mks6 Δ section. It is interesting to also note the presence of both DBA and LTA positive cells in the same tubule in the bottom merge panel of the Mks6 MT section. Scale is 15µm. (B) Cystic index from P28 mice induced at P7 show a significant difference between Mks6 FL and Mks6 Δ mice (Mks6 FL =4.92% n=4 and Mks6 Δ =28.9% n=6)(*=p<0.05). 78

88 Fig. 4. Comparative analysis of Juvenile Induced mice. (A) Longitudinal MRI studies of Mks6 mice show variability in cyst progression. MRI allows for longitudinal studies but sacrifices resolution when compared to end point analyses such as µct and histology. Scale bar =1mm. (B). A large amount of phenotypic variability is present in Mks6 Δ juvenile induced mice as seen by TKV, TKV/BW, and serum creatinine. 79

89 P7 and analyzed at P21 and adult mice were induced at P36 and analyzed at 20 weeks of age. The number of nuclei in the outer nuclear layer (ONL) revealed that P21 Mks6Δ mice have a slight reduction in the number of nuclei while 20Wk adult Mks6Δ mice show a significant reduction in number of nuclei when compared to controls (Fig. 5A, B). Outer segment (OS) length was also found to be significantly shortened in the P21 Mks6 Δ mice (Mks6 FL =21.9µm and Mks6 Δ =15.8µm, p<0.05) when compared to their controls and 20Wk Mks6 Δ mice have minimal remaining photoreceptors present (Mks6 FL =18.7 and Mks6 Δ =3.7µm, p<0.05)(fig. 6A, B). 80

90 Fig. 5. Mks6 conditional KO mice experience retinal degeneration. (A) Hematoxylin and Eosin (H&E) stain was performed on wild-type and mks6 conditional mutant mice 12 micron retinal sections at p28 and 20 weeks. (B) Morphometric analysis reveal at P28 Mks6 Δ mice experience slight retinal degeneration compared to Mks6 FL and 20wk mutants experience statistically significant retinal degeneration, which is depicted by the spider graph. Outer segment (OS); inner segment (IS); outer nuclear layer (ONL). 81

91 Fig. 6. Mks6 conditional KO mice have shortened outer segments. (A) Immunofluorescence staining of retinas of Mks6 conditional mice at P28 and 20 weeks post induction. Wheat germ agglutinin staining (WGA; red) was used to visualize outer segments. (B) Quantification of outer segment length (Mks6 FL P28=21.85µm, n=35 measurements from 3 mice, Mks6 Δ P28=15.93µm, n=35 measurements from 3 mice, Mks6 FL 20Wk=21.75µm, n=45 measurements from 5 mice, Mks6 Δ 20Wk=3.19µm, n=55 measurements from 5 mice) (*=p<0.05). 82