Association between single-nucleotide polymorphisms of DNMT3L and infertility with azoospermia in Chinese men

Transcription

1 Reproductive BioMedicine Online (2012) 24, ARTICLE Association between single-nucleotide polymorphisms of DNMT3L and infertility with azoospermia in Chinese men Jian-Xi Huang a,b, Matthew B Scott c, Xiao-Ying Pu a, Zhou-Cun A a, * a Department of Biology, Dali College, Dali, Yunnan , China; b Department of Basic Medicine, Dali College, Dali , China; c Institute of Eastern Himalaya Biodiversity Research, Dali College, Dali , China * Corresponding author. address: azhoucun@163.com (A Zhou-Cun). Zhou-Cun A, professor of Medical Genetics, is the director of the teaching and research section of the department of biology, Dali College, Dali, China. He received his MSc at West China Medical University, Chengdu, China in 1999 and obtained his PhD in medical genetics at Sichuan University, Chengdu, China in His research interest is the genetic aetiology of male infertility. Abstract The gene for DNA methyltransferase 3-like protein (DNMT3L) is essential for normal spermatogenesis and may be involved with spermatogenetic impairment and male infertility. To explore the possible association between the DNMT3L gene and male infertility, this study investigated allele, genotype and haplotype frequencies of three single nucleotide polymorphism (SNP) loci, rs , rs and rs , of DNMT3L in 233 infertile patients with azoospermia and 249 fertile controls from a population of Chinese men using polymerase chain reaction/restriction fragment length polymorphism. Results showed that the frequencies of allele A (20.6% versus 14.9%; P = 0.022) and the allele A carrier (GA + AA; 37.8% versus 28.1%; P = 0.027) in azoospermic patients were significantly higher than those in controls at the rs locus. The haplotype AAA frequency was significantly higher (18.1% versus 12.4%; P = 0.02) while the haplotype GAA frequency was significantly lower (53.2% versus 62.1%; P = 0.007) in infertile patients compared with fertile controls. These results indicated that SNP rs , as well as haplotypes AAA and GAA, may be associated with male infertility and suggest that DNMT3L may contribute to azoospermia susceptibility in humans. RBMOnline ª 2011, Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. KEYWORDS: azoospermia, DNMT3L, male infertility, single-nucleotide polymorphism Introduction Infertility is a prevalent health problem in humans, affecting about 15% of couples, with half of these cases attributable to infertility of the male (De Kretser and Baker, 1999). Impaired spermatogenesis is a major aetiology of male infertility, in which a large portion of the cases are considered a consequence of genetic factors (Cram et al., 2001; Maduro and Lamb, 2002). Spermatogenesis is a long and complex process comprising regulated cell proliferation, meiosis and differentiation and involves highly regulated expression of numerous genes and DNA methylation (Hisano /$ - see front matter ª 2011, Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. doi: /j.rbmo

2 Single-nucleotide polymorphisms of DNMT3L and male infertility 67 et al., 2003; Li, 2002). DNA methylation of some genes is essential for complete spermatozoa maturation (Marchal et al., 2004). Hypomethylation of DNA can lead to the failure of germ cells to differentiate into spermatocytes and sperm count decrease (Hartmann et al., 2006; Raman and Narayan, 1995). Thus, the genes related to DNA methylation may play a role in, and be good indicators of, male infertility. DNA methylation, catalysed by DNA methyltransferases (DNMT), is crucial in establishing specific DNA methylation patterns during gametogenesis (Rodriguez-Osorio et al., 2010). Defects of the DNA methyltransferase gene, such as dnmt1 and dnmt3a, have been reported to lead to spermatogenic impairment and subsequent male infertility in laboratory tests on mice (Kaned et al., 2004; Takashima et al., 2009). The DNA methyltransferase 3-like protein (DNMT3L) gene is located at chromosome 21p22.3 and its protein product is an enzymatic regulatory factor, homologous to the DNMT3 family (Aapola et al., 2001; Bourc his et al., 2001). Although the DNMT3L protein has no methyltransferase activity, it is an important co-factor for DNMT3A, inducing de-novo DNA methylation by recruitment or activation of DNMT3A (Chedin et al., 2002; Hata et al., 2002; Ooi et al., 2007). DNMT3L is involved in male germ cell development (Bourc his and Bestor, 2004); it is expressed in different cell types at different levels during spermatogenesis and its deficiency could lead to decreased male germ cell counts (La Salle et al., 2007). As it is required for the correct establishment of paternal methylation imprints and methylation of other genomic sequences during spermatogenesis, DNMT3L plays a universal role in genomic methylation (La Salle et al., 2007; Webster et al., 2005). The activity of DNMT3L affects the behaviour of male chromosomes during meiosis. For example, inactivity of DNMT3L causes impaired chromatin compaction and failure of homologous chromosomes to align and form synaptonemal complexes, which can result in developmental arrest and apoptosis of germ cells (Webster et al., 2005). DNMT3L also has a role in regulating the transcriptional expression of a number of meiotic and post-meiotic germ cells (Zamudio et al., 2011). These results suggest that DNMT3L may also be essential for spermatogenesis. Furthermore, in male DNMT3L gene-knockout mice, males with the homozygote for null mutation of the gene showed abnormal DNA methylation during spermatogenesis and were infertile because spermatocytes failed to complete meiosis, providing strong evidence that DNMT3L gene is required for normal DNA methylation during spermatogenesis in mice (La Salle et al., 2007; Webster et al., 2005). Thus, DNMT3L also may play an important role in human spermatogenesis and be involved in spermatogenetic impairment in males. In recent years, some studies on the effect of polymorphisms of DNMT3L have shown that some single-nucleotide polymorphism (SNP) loci may be associated with childhood intelligence and subtelomeric hypomethylation (El-Maarri et al., 2009; Haggarty et al., 2010). However, there is a dearth of data on the effects of polymorphisms of DNMT3L on human male infertility. To redress deficiencies in this field, the current study selected three single nucleotide polymorphism (SNP) loci, namely rs , rs and rs , from the SNP database at NCBI and compared the genotype and allele frequencies of the three SNP between infertile patients with azoospermia and controls to explore possible associations between DNMT3L and azoospermia. Subjects and methods Subjects The patient group consisted of 233 infertile patients with idiopathic azoospermia aged from 25 to 42 years. Patients with a history of orchitis, maldescensus of testis, varicocele and obstruction of the vas deferens were excluded from the survey; patients with chromosomal abnormalities and microdeletions of AZF region on Y chromosome were also excluded by running chromosome and corresponding molecular analyses on individuals (Simoni et al., 2004). All patients underwent at least two semen analyses according to World Health Organization guidelines (1999). The control group included 249 proven fertile men aged from 26 to 45 years. All participants of the study are of Han nationality, which makes up more than 90% of Chinese population. All participants provided informed consent. Choice of SNP Exonic and intronic SNP with high frequencies in the Asian population and near the exon intron boundary according to the dbsnp and the sequence of DNMT3L were selected to study. As a result, three SNP were selected for the present study, including one exonic SNP rs (Gly>Arg) and two intronic SNP rs and rs PCR amplification DNA was extracted from peripheral blood leukocytes of patients and controls using a TIANamp Genomic DNA Kit (TIANGEN, Beijing, China). Three pairs of primers were designed and synthesized to amplify the fragments including the three SNP. The sequences of primers, annealing temperatures and the lengths of the amplification products are shown in Table 1. PCR amplification was carried out in a total volume of 25 ll, containing about 100 ng genomic DNA, 200 lmol/l dntp, 10 pmol each primer, 1.5 mmol/l MgCl 2, 1 U Taq polymerase and 2.5 ll 10 PCR buffer (Takara, Shiga, Japan). The reaction profile was: predenaturation at 94 0 C for 5 min, 35 cycles of denaturation at 94 C for 30 s, annealing at C for 30 s and extension at 72 C for 40 s, with a final extra extension at 72 C for 5 min. Genotyping A restriction fragment length polymorphism (RFLP) assay was used to genotype the SNP rs , for rs and rs PCR products were digested overnight with restriction enzymes (Fermentas, Vilnius, Lithuania) according to the manufacturer s protocol and analysed by electrophoresis on 3% agarose gel. The restriction enzymes and the length of digested fragments are shown in Table 1. The genotypes were further confirmed by DNA sequencing of the PCR products from some samples.

3 68 J-X Huang et al. Table 1 Locus Primer sequences, size of PCR products, restriction enzymes and length of digested fragments for RFLP analysis. Primer sequence (5 3) Annealing temperature ( C) PCR product size (bp) Restriction enzyme Digested fragment lengths (bp) rs F: GGGGTGCATCAGGGATCTGA TseI Allele A: 218 R: CTAAGTGACTGGTCCAATAAGC Allele G: rs F: CAGAGCAGGGATGACACAAG PvuII Allele A: 357 R: ATCACAATCGCCAACCGTAG Allele G: rs F: CTAAAAGGCGGTATTTGTGC SamI Allele A: 468 R: CTCCAGGAAGCGAGATGCG Allele G: Table 2 Allele and genotype distributions of three single-nucleotide polymorphisms of DNMT3L in infertile patients and controls. Locus Genotype/allele Controls (n = 249) Patients (n = 233) P-value rs GG 179 (71.9) 145 (62.2) AG 66 (26.5) 80 (34.3) NS AA 4 (1.6) 8 (3.4) NS AG + AA 70 (28.1) 88 (37.8) G 424 (85.1) 370 (79.4) A 74 (14.9) 96 (20.6) rs AA 147 (59.0) 127 (54.5) AG 91 (36.5) 92 (39.5) NS GG 11 (4.4) 14 (6.0) NS AG + GG 102 (41.0) 106 (45.5) NS A 385 (77.3) 346 (74.2) G 113 (22.7) 120 (25.8) NS rs AA 235 (94.4) 219 (94.0) AG 13 (5.2) 14 (6.0) NS GG 1 (0.4) 0 (0) NS AG + GG 14 (5.6) 13 (5.6) NS A 483 (97.0) 452 (97.0) G 15 (3.0) 14 (3.0) NS Values are n (%). NS = not significant. Statistical analysis Allele and genotype frequencies of studied SNP in patients and controls were counted. The Hardy Weinberg equilibrium was tested using a Hardy Weinberg equilibrium calculator (Rodriguez et al., 2009). Differences in allelic and genotypic frequencies of the studied SNP between patients and controls were evaluated by chi-squared test or Fisher s exact test. Haplotypes were assessed using PHASE software (Stephens and Donnelly, 2003). The Exonic Splicing Enhancer program (ESEfinder; Cartegni et al., 2003) was to predict the potential effect of rs variation on pre-rna splicing. Results Using a PCR-RFLP assay, this study investigated the polymorphism distributions of the SNP rs , rs and rs in DNMT3L in 233 infertile patients with idiopathic azoospermia and 249 fertile men as controls. The allele and genotype frequencies of the three SNP in the patient and control groups are reported in Table 2. The distributions of genotypes in patients and controls followed the Hardy Weinberg equilibrium (data not shown). The frequencies of allele A (20.6% versus 14.9%; P = 0.022) and the allele A carrier (GA + AA; 37.8% versus 28.1%; P = 0.027) in patients were significantly higher than those in controls at the rs locus. No significant differences in frequencies of allele and genotype were observed between the patient and control groups at the rs and rs loci. After estimating the haplotypes of the three SNP with PHASE software, eight kinds of haplotypes were found both in patients and controls. The PHASE case control test revealed a significant association between the haplotypes of the three SNP loci and male infertility with azoospermia (P = 0.02). Haplotype AAA (18.1% versus 12.4, P = 0.02) was significantly higher, whereas haplotype GAA (53.2% versus 62.1%; P = 0.007) was significantly lower in patients compared with controls. Haplotype distributions with more than 1% frequencies are summarized in Table 3.

4 Single-nucleotide polymorphisms of DNMT3L and male infertility 69 Table 3 Haplotype frequencies of three singlenucleotide polymorphisms of DNMT3L in infertile patients and controls. a Haplotype Controls (n = 249) Patients (n = 233) GAA GAG NS GGA NS AAA AGA NS Values are %. P-value for PHASE case control test = a Haplotype for the single-nucleotide polymorphisms rs , rs and rs , respectively. Figure 1 Genotyping of three single-nucleotide polymorphisms in DNMT3L by electrophoresis. (A) rs ; (B) rs ; (C) rs M = DNA size marker (100 bp ladder). Representative genotyping results of SNP rs , rs and rs in DNMT3L by electrophoresis are shown in Figure 1. Discussion With the introduction of the gene-targeting technique that disrupts specific genes in model animals, hundreds of candidate genes were identified in laboratory mice that are related to human spermatogenesis impairment (Maduro and Lamb, 2002; O Bryan and de Kretser, 2006). However, given the wide genetic separation between mice and humans, the question remains as to whether these candidate genes are also related to infertility in male humans. Polymorphisms or genetic variants in these candidate genes are considered potential risk factors of spermatogenesis impairment and may be responsible for idiopathic spermatogenic impairment (Ferlin et al., 2007; Nuti and Krausz, 2008). The investigation of polymorphisms in the candidate genes for spermatogenesis impairment is an important way to research the relationship of these candidate genes with human male infertility. As a candidate gene for male infertility, DNMT3L has been proven to play an important role in spermatogenesis impairment in mice (La Salle et al., 2007; Webster et al., 2005). It is reasonable to speculate that DNMT3L is also involved in human spermatogenesis impairment. To test this speculation, the current case control study tested the association of three SNP, rs , rs and rs , in DNMT3L with male infertility in 233 infertile patients with azoospermia and 249 controls in a Chinese population. No significant differences in frequencies of allele and genotype between patients and controls were observed at rs and rs loci, indicating that these two SNP were not associated with azoospermic male infertility. The SNP rs has less value for the case control study because of its lower frequency of alleles in the Chinese population. At the rs locus, a significant difference in the polymorphism distribution between patients and controls was detected. The frequencies of allele A and the allele A carrier (GA + AA) of rs in patients were significantly higher than those in controls, suggesting that allele A of SNP rs may be a risk factor of male infertility with azoospermia. The SNP rs is a G to A change in intron 1 near to exon 2 in DNMT3L. It is only 3 bp away from the acceptor splice site of pre-rna splice, which suggests that this variation is perhaps related to pre-rna splicing. The results of the ESEfinder analysis showed that this SNP does not change the splice site, but is located in motifs of splicing factors SF2/ASF and RSp55. According to the analysis with ESEfinder, allele A may decrease the activity of pre-rna splicing in comparison to allele G, hence may reduce the expression of DNMT3L. Since DNMT3L is essential for DNA methylation (Chedin et al., 2002; Hata et al., 2002; Ooi et al., 2007), the decreased expression of DNMT3L may affect DNA methylation during spermatogenesis, subsequently leading to the abnormal spermatogenesis. This may be one possible reason why the allele A of SNP rs of DNMT3L increases the risk of male infertility with azoospermia. However, it can not be excluded that the polymorphism may be in linkage disequilibrium with another locus susceptible to spermatogenesis impairment. To further investigate the relationship of the three SNP in DNMT3L and male infertility with azoospermia, this study performed haplotype analysis of them in patient and control groups. The results of haplotype analysis showed that haplotypes of the three SNP are associated with male infertility with azoospermia. Haplotype AAA was significantly higher while haplotype GAA was significantly lower in patients compared with controls, suggesting that haplotype AAA might be a risk factor for male infertility with azoospermia and haplotype GAA might have some protection effect from azoospermia. It is possible that the significantly higher occurrence of haplotype AAA in patients is due to the more

5 70 J-X Huang et al. frequent presence of allele A of the SNP rs in the group, and the G>A mutation of this SNP originated from the allele of AA for the other two SNP. Another possibility is that AA for the other two SNP are in linkage disequilibrium with certain unknown loci also showing effects on spermatogenesis. These findings of the haplotype analysis again provide evidence that the variations of DNMT3L may be involved in susceptibility of males to azoospermia. Of course, this study cannot exclude that the results of haplotype analysis were a theoretical estimate of haplotype distribution using software, which may not represent the true situation of haplotypes. In summary, this study provides data on the association between SNP of DNMT3L and azoospermia in males. Allele A of SNP rs and haplotype AAA of the three SNP in DNMT3L may increase the risk of male infertility in Chinese populations. However, further studies with larger sample sizes and different ethnic populations are necessary to confirm these findings, and further functional analyses of SNP rs are needed to elucidate the role of DNMT3L in pathological male infertility. Acknowledgement This work was supported by National Natural Science Foundation of China (Grant number ). References Aapola, U., Lyle, R., Krohn, K., Antonarakis, S.E., Peterson, P., Isolation and initial characterization of the mouse Dnmt3l gene. Cytogenet. Cell Genet. 92, Bourc his, D., Bestor, T.H., Meiotic catastrophe and retrotransposon reactivation in male germ cells lacking Dnmt3L. Nature 431, Bourc his, D., Xu, G.L., Lin, C.S., Bollman, B., Bestor, T.H., Dnmt3L and the establishment of maternal genomic imprints. Science 294, Cartegni, L., Wang, J., Zhu, Z., Zhang, M.Q., Krainer, A.R., ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Res. 31, Chedin, F., Lieber, M.R., Hsieh, C.L., The DNA methyltransferase-like protein DNMT3L stimulates de novo methylation by Dnmt3a. Proc. Natl. Acad. Sci. USA 99, Cram, D.S., O Bryan, M.K., de Kretser, D.M., Male infertility genetics the future. J. Androl. 22, De Kretser, D.M., Baker, H.W., Infertility in men: recent advances and continuing controversies. J. Clin. Endocrinol. Metab. 84, El-Maarri, O., Kareta, M.S., Mikeska, T., Becker, T., Diaz-Lacava, A., Junen, J., Nusgen, N., Behne, F., Wienker, T., Waha, A., Olderburg, J., Chedin, F., A systematic search for DNA methyltransferase polymorphisms reveals a rare DNMT3L variant associated with subtelomeric hypomethylation. Hum. Mol. Genet. 18, Ferlin, A., Raicu, F., Gatta, V., Zuccarello, D., Palka, G., Foresta, C., Male infertility: role of genetic background. Reprod. Biomed. Online 14, Hartmann, S., Bergmann, M., Bohle, R.M., Weidner, W., Steger, K., Genetic imprinting during impaired spermatogenesis. Mol. Hum. Reprod. 12, Hata, K., Okano, M., Lei, H., Li, E., Dnmt3L co-operates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 129, Haggarty, P., Hoad, G., Harris, S.E., Starr, J.M., Fox, H.C., Deary, I.J., Whalley, L.J., Human intelligence and polymorphisms in the DNA methyltransferase genes involved in epigenetic marking. PLoS One 5, e Hisano, M., Ohta, H., Nishimune, Y., Nozaki, M., Methylation of CpG dinucleotides in the open reading frameof a testicular germcell-specific intronless gene, Tact1/Actl7b, represses its expression in somatic cells. Nucleic Acids Res. 31, Kaned, M., Okano, M., Hata, K., Sado, T., Tsujimoto, N., Li, E., Sasaki, H., Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting. Nature 429, La Salle, S., Oakes, C.C., Neaga, O.R., Bourc his, D., Bestor, T.H., Trasler, J.M., Loss of spermatogonia and wide-spread DNA methylation defects in newborn male mice deficient in DNMT3L. BMC Dev. Biol. 7, 104. Li, E., Chromatin modification and epigenetic reprogramming in mammalian development. Nat. Rev. Genet. 3, Maduro, M.R., Lamb, D.J., Understanding new genetics of male infertility. J. Urol. 168, Marchal, R., Chicheportiche, A., Dutrillaux, B., Bernardino-Sgherri, J., DNA methylation in mouse gametogenesis. Cytogenet. Genome Res. 105, Nuti, F., Krausz, C., Gene polymorphisms/mutations relevant to abnormal spermatogenesis. Reprod. Biomed. Online 16, O Bryan, M.K., de Kretser, D., Mouse models for genes involved in impaired spermatogenesis. Int. J. Androl. 129, Ooi, K.T.S., Qiu, C., Bernstein, E., Li, K., Jia, D., Yang, Z., Erdjument-Bromage, H., Tempst, P., Lin, S.P., Allis, C.D., Cheng, X., Bestor, T.H., DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448, Raman, R., Narayan, G., Aza deoxy cytidine-induced inhibition of differentiation of spermatogonia into spermatocytes in the mouse. Mol. Reprod. Dev. 42, Rodriguez-Osorio, N., Wang, H., Rupinski, J., Bridges, S.M., Memili, E., Comparative functional genomics of mammalian DNA methyltransferases. Reprod. Biomed. Online 20, Rodriguez, S., Gaunt, T.R., Day, I.N., Hardy Weinberg equilibrium testing of biological ascertainment for mendelian randomization studies. Am. J. Epidemiol. 169, Simoni, M., Bakker, E., Krausz, C., EAA/EMQN best practice guidelines for molecular diagnosis of y-chromosomal microdeletions. Int. J. Androl. 27, Stephens, M., Donnelly, P., A comparison of Bayesian methods for haplotype reconstruction from population genotype data. Am. J. Hum. Genet. 73, Takashima, S., Takehashi, M., Lee, J., Chuma, S., Okano, M., Hata, K., Suetake, I., Nakatsuji, N., Miyoshi, H., Tajima, S., Tanaka, Y., Toyokuni, S., Sasaki, H., Kanatsu-Shinohara, M., Shinohara, T., Abnormal DNA methyltransferase expression in mouse germline stem cells results in spermatogenic defects. Biol. Reprod. 81, Webster, K.E., O Bryan, M.K., Fletcher, S., Crewther, P.E., Aapola, U., Craig, J., Harrison, D.K., Aung, H., Phutikanit, N., Lyle, R., Meachem, S.J., Antonarakis, S.E., de Kretser, D.M., Hedger, M.P., Peterson, P., Carroll, B.J., Scott, H.S., Meiotic and epigenetic defects in Dnmt3L-knockout mouse spermatogenesis. Proc. Natl. Acad. Sci. USA 102, World Health Organization, WHO Laboratory Manual for the Examination of Human Semen and Sperm-cervical Mucus Interaction, fourth ed. Cambridge University Press, Cambridge, UK.

6 Single-nucleotide polymorphisms of DNMT3L and male infertility 71 Zamudio, N.M., Scott, H.S., Wolski, K., Lo, C.Y., Law, C., Leong, D., Kinkel, S.A., Chong, S., Jolley, D., Smyth, G.K., de Kretser, D., Whitelaw, E., O Bryan, M.K., DNMT3L is a regulator of X chromosome compaction and post-meiotic gene transcription. PLoS One 6, e Declaration: The authors report no financial or commercial conflicts of interest. Received 14 March 2011; refereed 30 August 2011; accepted 7 September 2011.