QIAGEN Epigenetics Webinar

Transcription

1 QIAGEN Epigenetics Webinar Pyrosequencing A New Standard in Epigenetic and Genetic Analysis! Frank Fischinger, MS, MBA Sr. Technical Sales Scientist QIAGEN Inc. Profiling of DNA methylation in uniparental and biparental tissues identifies new imprinted genes Sanaa Choufani, PhD Genetics and Genome Biology Program SickKids Research Institute, Toronto, Canada - 1 -

2 QIAGEN Epigenetics Webinar Pyrosequencing A New Standard in Epigenetic and Genetic Analysis! Frank Fischinger, MS, MBA Sr. Technical Sales Scientist QIAGEN Inc. Profiling of DNA methylation in uniparental and biparental tissues identifies new imprinted genes Sanaa Choufani, PhD Genetics and Genome Biology Program SickKids Research Institute, Toronto, Canada - 2 -

3 Overview What is Pyrosequencing? ḌNA sequencing by synthesis Real-time sequence-based detection No gels, labels or probes Quantitative peak heights Simple and robust Flexible Throughput Assay design Applications Real-Time Pyrophosphate Detection for DNA Sequencing. Ronaghi M., Uhlén M., Nyrén P. (1998) Science 281:

4 Pyrosequencing at a glance Workflow and costs Pyrosequencing chemistry quickly reads the DNA sequence in a quantitative manner by coupling an enzyme cascade to the Polymerase activity. Pyrosequencing is cost effective Per sample cost ranges between $0.80 and $2.80 per reaction well, post PCR Pyrosequencing is rapid and is easy to use Sample prep takes only minutes (post PCR) Sequence reactions typically last between 15 minutes and two hours. Pyrosequencing Cost Cost efficient quantitative sequencing - 4 -

5 Pyrosequencing at a glance Rapid and sensitive results compared to classical sequencing Pyrosequencing offers sensitive, quantitative detection of mutations in a mixed populations Sanger Sequencing is semiquantitative, requiring the sequencing of multiple clones to determine relative abundance in the mixed sample. Limit of detection between a 2% and 5% Sanger Sequencing has a limit of roughly 25% Limit of detection for cloned Sanger Sequencing depends on number of clones sequenced Pyrosequencing Rapid, Rapid, Sensitive, Sequencing - 5 -

6 Pyrosequencing Workflow - 6 -

7 Pyrosequencing workflow Quantitative results in less than 1 hour after PCR Assay Design Bisulfite converion and PCR Sample prep Pyrosequencing ~ 2h ~ 15 min ~ min Easily create your own PCR Primers and Sequencing Primer or use pre-designed assays, e.g. PyroMark CpG Assays Region of interest amplified with a biotinylated primer (~ bp) Separation to singlestranded DNA using streptavidin-coated beads. Annealing of sequencing primer. Sequencing-by-synthesis. Sequence data generated from the first base next to the sequencing primer. Sequence context serves as built-in control - 7 -

8 Pyrosequencing Workflow Assay design options - 8 -

9 Pyrosequencing workflow Assay design and ordering Assay Design Bisulfite converion and PCR Sample prep Pyrosequencing Custom Assay Design PyroMark Assay Design Software 2.0 PyroMark Assay Database* PyroMark Custom Assays NEW Pre-designed Assays PyroMark CpG Assays NEW (genomewide coverage of CpG islands) PyroMark RUO Test (selected CpG or mutation targets) PCR primer Sequencing primer Region of interest PCR primer * Free online access for customers - 9 -

10 Pyrosequencing PyroMark CpG Assays for DNA Methylation Analysis PyroMark Algorithm CpG parameters Assays1 / 2 PyroMark CpG Assays Pre-designed DNA-methylation assays Release Information Human Ver. 1.3 (Nov 2010) Number of assays: over 30,000 Number of CpG Islands with assay: ~12,000 (~80%) Mouse Ver. 1.0 (April 2011) NEW Number of assays: over 30,000 Number of CpG Islands with assay: ~11,000 (>80%) Rat Ver. 1.0 (Nov 2011) coming soon Number of assays: over 24,000 Number of CpG Islands with assay: ~7,500 Human Ver. 2.0 in preparation Common NGS targets planned

11 Pyrosequencing Workflow Bisulfite Conversion and PCR

12 Key steps in DNA Methylation Analysis The importance of bisulfite treatment Assay Design Bisulfite conversion and PCR Sample prep Pyrosequencing Importance Crucial step required to distinguish between methylated and unmethylated cytosines Mistakes can t be corrected without repeating this step G G T C A G T G A m C G Bisulfite Conversion G G T U A G T G A C G PCR EpiTect Plus Bisulfite Kits DNA Protect Technology Ensures complete bisulfite conversion Minimizes DNA fragmentation Highly concentrated DNA EpiTect Plus LyseAll / EpiTect Plus FFPE Bisulfite Kits G T T A G T G A C G G T C A G T G A C G Bisulfite Conversion G T U A G T G A U G PCR G T T A G T G A T G Additional integrated DNA preparation for cells, blood, tissue, or fomalin-fixed Paraffin embedded (FFPE) tissue samples Up to 200-fold higher PCR sensitivity

13 Pyrosequencing workflow PCR Assay Design Bisulfite conversion and PCR Sample prep Pyrosequencing.PCR / RT-PCR Two PCR primers (one is biotinylated) Amplification of a region of 70 bp 500 bp ( bp for bisulfite converted DNA) PyroMark PCR Kit / PyroMark OneStep RT-PCR Kit Biotin-labeled strand is isolated using Vacuum Prep Workstation PCR primer Sequencing primer Region of interest PCR primer, biotinylated If If you you can can run run a PCR, PCR, you you can can sequence with with Pyrosequencing Jon Jon Jonasson, Jonasson, University University Hospital, Hospital, Linköping, Linköping, Sweden Sweden

14 Optimizing PCR conditions Effect on the linearity of CpG methylation results Normal DNA Colon cancer DNA Linear response of methylation measured by Pyrosequencing in PCRamplified products generated from controlled dilutions of in-vitro methylated (IVM) genomic DNA with unmethylated DNA (IVM DNA is 80% methylated). Sequence to analyze: GGGTGGGGYGGATYGYGTGYGTTYGGYGGTTGYGGA

15 Pyrosequencing Workflow Sample preparation

16 Pyrosequencing Workflow Sample preparation Assay Design Bisulfite converion and PCR Sample prep Pyrosequencing Immobilize biotinylated PCR products onto streptavidin coated beads Separate strands by denaturation in NaOH Wash/neutralize the immobilized strand Anneal sequencing primer Vacuum Preparation procedure is compatible with Real Time, Quantitative PCR

17 The Principle of Pyrosequencing Technology Directing the dntp dispensations to sequence a target region

18 SNP and Somatic Mutation Analysis Directed dntp dispensations Allele 1: Allele 2:...TCCTACTCATTCAAGGT......AGGATGAGTAAGTTCGA...-Biotin...TCCTACTCGTTCAAGGT......AGGATGAGCAAGTTCGA...-Biotin CTCATTCAAGC...AGGATGAGTAAGTTCGA...-Biotin CTCGTTCAAGC...AGGATGAGCAAGTTCGA...-Biotin Sequence to analyze: CTCA/GTTCAA

19 The Principle of Pyrosequencing Technology Example: SNP genotyping

20 Pyrosequencing Workflow The principle of the Pyrosequencing reaction Assay Design Bisulfite converion and PCR Sample prep Pyrosequencing One nucleotide (dntp) is added at a time Nucleotide incorporation generates Pyrophosphate (PP i ) Pyrophosphate (PP i ) is converted into light seen as peak in the Pyrogram trace Excess nucleotide is degraded before addition of the next base. The The amount amount of of generated light light is is proportional to to the the amount amount of of incorporated nucleotides

21 Pyrosequencing for DNA Methylation Analysis The PyroMark system

22 Pyrosequencing for DNA Methylation Analysis Analyzing a Pyrogram for DNA methylation Ṣequence to be analyzed: Ạ G T T A C G A C Ạ G T T A C G A C ạnd Ạ G T T A C m G A C Ạfter bisulfite conversion: Ạ G T T A T G A T ạnd Ạ G T T A C G A T Ḅiotinylated PCR strand:

23 Pyrosequencing for DNA Methylation Analysis Analyzing a Pyrogram for DNA methylation Ṣequence to be analyzed: Ạ G T T A C G A C Ạ G T T A C G A C ạnd Ạ G T T A C m G A C Ạfter bisulfite conversion: Ạ G T T A T G A T ạnd Ạ G T T A C G A T Ḅiotinylated PCR strand: Ạnalyzed sequence: CpG methylation level:

24 Pyrosequencing for DNA Methylation Analysis A range of analysis possibilities Any single CpG site A4: TAYGGTTTGTA % Ṃultiple consecutive CpG sites E S A T G A T 5 C G T G B5: GGAAGTTYGGTYGYGGTTAGYGGGGAGGAGGAGYGAAGGGGTTGYGTTTTAGYGTTAGGGAGTTAYGATTYGAGAGAGGGYGGTAAGGGYGTTTTTYGTGGGATTYGGAYGTTTTAAGTAAATTT 97% 97% 96% 91% 96% 94% 88% 83% 100% 96% 94% 92% 100% 78% E SAGATGTCAGTCAGTCGCTA TGTCGGAGAGA TGTCGAGGTA GTCGCT TCATGTCGTCAGAGC TGATCGTA TCGAGAGATGTCGTATGTCAGTTCGTGTA TCGTA TCGT TA One gene at a time Several genes in the same analysis (analyze up to 96 different assays in one run) Global methylation level Estimate the global methylation levels using repetitive elements

25 Pyrosequencing Instruments

26 Instrument Overview Software functionality and application areas PyroMark Q24 & PyroMark Q24 MDx PyroMark Q96 ID PyroMark Q96 MD PyroMark Q96 MD Automated Throughput 1 24 samples 1 96 samples 1 96 samples 1 10 x 96 with automated option Running volume 25 µl 40 µl 12 µl 12 µl PCR requirements 5 10 µl (~0.5 3 pmol of product) µl (2 4 pmol of product) 5 10 µl ( pmol of product) 5 10 µl ( pmol of product) Read lengths SQA ~10 70 bp SNP ~10 70 bp AQ ~10 70 bp SQA ~10 70 bp SNP ~10 70 bp AQ ~10 70 bp SNP ~10 70 bp AQ ~10 70 bp SNP ~10 70 bp AQ ~10 70 bp CpG ~10 80 bp CpG ~10 80 bp CpG ~10 80 bp CpG ~10 80 bp Main applications Genetic testing Epigenetics Genetic testing Epigenetics Genetic testing Epigenetics Genetic testing Epigenetics Microbiology Microbiology (SNP/AQ only in batch mode) Sensitivity 2% mutation 2% mutation 2% mutation 2% mutation 98% wt 98% wt 98% wt 98% wt Additional software Assay Design SW 2.0 PyroMark IdentiFire (SQA) Assay Design SW 2.0 PyroMark IdentiFire (SQA) Assay Design SW 2.0 PyroMark CpG SW Assay Design SW 2.0 PyroMark CpG SW

27 Conclusions

28 Pyrosequencing for DNA Methylation Analysis Summary gdna Isolation Assay Design Bisulfite Conversion PCR Sample prep Pyrosequencing QIAamp Kits DNeasy Kits QIAcube/EZ1 QIAsymphony PyroMark Assay Design SW 2.0 PyroMark CpG Assays (GeneGlobe) EpiTect Bisulfite Plus Kits EpiTect Whole Bisulfitome Kit PyroMark PCR Kit PyroMark Q24 Vacuum Workstation PyroMark Q96 Vacuum Workstation PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD PyroMark Q24 SW PyroMark Gold Reagents Easy to use, rapid, and cost effective workflow Direct quantification of consecutive CpG sites without cloning Quality assessment of individual CpG sites and the surrounding sequence Multiple bisulfite treatment efficiency controls can be added to each reaction well Suitable for analysis of fresh-frozen, fixed and paraffin-embedded specimens Up to 24 or 96 samples can typically be analyzed in parallel in < 2 hour after PCR Over 90,000 designs (Human, Mouse and Rat) are available via GeneGlobe For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at or can be requested from QIAGEN Technical Services or your local distributor

29 QIAGEN Epigenetics Webinar Pyrosequencing A New Standard in Epigenetic and Genetic Analysis! Frank Fischinger, MS, MBA Sr. Technical Sales Scientist QIAGEN Inc. Profiling of DNA methylation in uniparental and biparental tissues identifies new imprinted genes Sanaa Choufani, Ph.D Genetics and Genome Biology Program SickKids Research Institute, Toronto, Canada

30 Profiling of DNA methylation in uniparental and biparental tissues identifies new imprinted genes Sanaa Choufani, PhD Genetics and Genome Biology Program SickKids Research Institute, Toronto, Canada QIAGEN December 8,

31 Outline Genomic Imprinting and imprinted genes Novel approach to identify imprinted genes Validation by Pyrosequencing 31

32 What is genomic imprinting? In mammals, genomic imprinting describes the processes involved in introducing functional inequality between two parental alleles of a gene Genomic imprinting hypothesizes that it is not sufficient to inherit two copies of certain genes and/or chromosomal regions: normal development requires that one copy be paternally derived while the other be maternally derived. 32

33 Imprinted Genes ~100 imprinted genes are identified corresponding to 0.5% of the ~20,000 protein-coding genes Only 30% overlap of imprinted genes between human and mouse Imprinted genes are critical for normal human growth and neurodevelopment 33

34 What are genomic imprints and when are they established? 34

35 Genomic imprints are epigenetic marks (such as DNA methylation) that are established in parental germ cells (egg or sperm), are heritable on parental chromosomes after fertilization, and are used to confer parent-specific gene expression. P M Gene A Biallelic expression Gene B Paternally Expressed Gene C Maternally Expressed 35

36 Imprinted genes respond to regulatory signals in cis from differentially methylated regions (DMRs). P M Gene A Biallelic gene Gene B Paternally Expressed Gene C Maternally Expressed 36

37 Map of the Chromosome 11p15 Imprinting Cluster PAT CDKN1C IC2 KCNQ1 IGF2 IC1 H19 KCNQ1OT1 Domain 2 Domain 1 MAT Cen CDKN1C KCNQ1 KCNQ1OT1 IGF2 H19 Tel Methylation 37

38 Novel Approach to identify New DMRs The objective of the study is to identify new differentially methylated regions that could lead us to the discovery of new imprinted genes using genome-wide DNA methylation arrays. 38

39 Experimental Approach (Failure of embryonic development) (Failure of extraembryonic development) AnCHM: Androgenetic Complete Hydatidiform Mole MCT: Mature Ovarian Cystic Teratoma 39

40 Experimental Approach Bisulfite Conversion Unmethylated C is converted to T Methylated C remains as C Illumina Infinium Human Methylation27 Microarray ~ 2 CpGs per promoter of 14,500 genes/per sample Validation by Qiagen pyrosequencer (2-9 CpGs) 40

41 Experimental Approach Mat. Expressed Methylation % 50% 100% 0% 50% Pat. Expressed Methylation % 50% 0% 100% 50% 41

42 Heatmap of Imprinted Genes from Uni-and Bi- parental Tissues Tissues Maternal DMCpGs Pat. DMCpGs 42

43 Map of the Chromosome 11p15 Imprinting Cluster PAT CDKN1C IC2 KCNQ1 IGF2 IC1 H19 KCNQ1OT1 Domain 2 Domain 1 MAT CDKN1C KCNQ1 KCNQ1OT1 IGF2 H19 Tel IC2-Teratoma A1: TC/ TGGGGTGATC/ TGC/ TGTGAGGATAGC/ TGGTC/ TGT 92% 93% 84% 90% 94% E S G T C G G T G T A T C A G T C G T G A G A C T A T G T C A G T C G IC1-Teratoma Methylation B1: YGGGAYGTTTTTAYG 15% 19% 16% E S A T C G T 5 A T C G T 10 C T G A T 15 C 43

44 Map of the Chromosome 11p15 Imprinting Cluster PAT CDKN1C IC2 KCNQ1 IGF2 IC1 H19 KCNQ1OT1 Domain 2 Domain 1 MAT CDKN1C KCNQ1 KCNQ1OT1 IGF2 H19 Tel IC2-WBC1 A3: TC/ TGGGGTGATC/ TGC/ TGTGAGGATAGC/ TGGTC/ TGT 64% 59% 55% 57% 60% Methylation E S G T C G G 5 T G T A T C A G T C G T G A G A C T A T G T C A G T C G IC1-WBC1 A6: YGGGAYGTTTTTAYG 47% 51% 46% E S A T C G T 5 A T C G T 10 C T G A T 15 C 44

45 Identification of a Maternal DMR for Previously Identified Imprinted Gene, NAP1L5 Map of the imprinted domain on 11p15.5 NAP1L5 DMR-Illumina array NAP1L5 DMR- Pyrosequencing cg CpG=6 N= N= NAP1L5 encodes a nucleosome assembly protein and has been reported to have monoallelic paternal expression (Wood et al. 2007) but no DMR has previously been reported in humans. 45

46 Identification of a Paternal DMR for Previously Identified Imprinted Gene, ZNF597 ZNF597 DMR-Illumina Map of the imprinted arraydomain on 11p15.5 ZNF597 DMR- Pyrosequencing cg CpG=7 N= N= The imprinted gene ZNF597 encodes a zinc finger protein with a reported maternal expression in humans (Pant et al. 2006) 46

47 Identification of a New Paternal DMR For a New Candidate Imprinted Gene, AXL Map of AXL promoter region on chromosome 19q13.2 AXL DMR-Illumina array AXL DMR- Pyrosequencing cg cg CpG=4 CpG=7 N= N= N= N= AXL gene encodes a receptor tyrosine kinase belonging to the TAM subfamily of receptor tyrosine kinases. 47

48 AXL Allelic Expression in Human AXL Allelic expression determined by pyrosequencing 48 AXL demonstrates preferential maternal expression in some individuals suggesting polymorphic imprinting in blood.

49 AXL Allelic Expression in Human AXL Allelic expression determined by pyrosequencing DNA A8: TTAGAAATGTGRATTCTTGGACTCTTAACCATGGTCCT A: 57% G: 43% E S G T A G A 5 T G C T G 10 A T C T cdna A4: TTAGAAATGTGRATTCTTGGACTCTTAACCATGGTCCT A: 82% G: 18% E S G T A G A 5 T G C T G 10 A T C T 49 AXL demonstrates preferential maternal expression in some individuals suggesting polymorphic imprinting in blood.

50 Map of Mouse Imprinted Genes Map of the imprinted domain on 11p

51 Axl Allelic Expression in Mice B = C57BL/6; C=Cast Axl is monoallelically expressed in blastocyst and in extraembryonic tissues from the maternal allele BL-Blastocyst; E-Embryonic tissue; EE- xtra-embryonic tissue; P-Placenta 51

52 Axl Allelic Expression in Mice B = C57BL/6; C=Cast Liver Brain Placenta BL-Blastocyst; E-Embryonic tissue; EE- Extra-embryonic tissue; P-Placenta o Axl is maternally expressed in early embryo and extra-embryonic tissues o Axl is biallelically expressed in mouse tissues 52

53 Axl Allelic Expression in Mice B = C57BL/6; C=Cast Liver Brain Placenta BL-Blastocyst; E-Embryonic tissue; EE- Extra-embryonic tissue; P-Placenta o Axl is maternally expressed in early embryo and extraembryonic tissues o Axl is biallelically expressed in mouse tissues o Axl monoallelic expression is DNA methylation dependent 53

54 Summary We report a successful new strategy for the identification of novel imprinted DMCpG sites. This strategy robustly targeted known imprinted genes, expanded the boundaries of some of their known DMRs, identified new DMRs for known imprinted genes such as NAP1L5, ZNF597 and led to the discovery of a new DMR and a new imprinted gene, AXL in human and subsequently in mouse 54

55 Correlation between pyrosequencing data and the two array platforms. 55

56 High Correlation between Pyrosequencing and Microarray for overlapping CpG sites Pyrosequencing Pyrosequencing 56

57 PAT Identification of Altered DNA Methylation for Chromosome 11p15.5 in DNA from FFPE (Wilms Tumor) Sample Using QIAGEN EpiTect Plus FFPE Bisulfite Kit coupled with Pyrosequencing IC2 IC1 CDKN1C KCNQ1 KCNQ1OT1 IGF2 H19 Domain 2 Domain 1 MAT CDKN1C KCNQ1 KCNQ1OT1 IGF2 H19 A- IC2-LOM A4: TC/ TGGGGTGATC/ TGC/ TGTGAGGATAGC/ TGGTC/ TGT 73% 73% 68% 70% 73% E S G T C G G T G T A T C A G T C G T G A G A C T A T G T C A G T C G 5 10 A3: TC/ TGGGGTGATC/ TGC/ TGTGAGGATAGC/ TGGTC/ TGT 19% 19% 17% 17% 19% B- IC1-GOM C4: YGGGAYGTTTTTAYG 51% 53% 52% E S A T C G T A T C G T C T G A T C3: YGGGAYGTTTTTAYG 90% 90% 91% C E S G T C G G 5 T G T A T C A G T C G T G A G A C T A T G T C A G T C G E S A T C G T 5 A T C G T 10 C T G A T 15 C 57

58 Acknowledgments Weksberg Lab Chunhua Zhao Youliang Lou Imprinting Project Cheryl Shuman Jonathan Shapiro Darci Butcher, PhD. Yi-An Chen Daria Grafodatskaya, PhD. Jose Carlos Ferreira, MD, PhD. Co-Investigators/Collaborators Axl Mouse work : Martha Susiarjo & Marisa S. Bartolomei, PhD., U. Pennsylvania Sch. Medicine Statistical, samples, and HapMap SNP data: Steve Scherer, Ph.D, Dalila Pinto, PhD, and Joseph Beyene, PhD, SickKids/TCAG. Androgenetic moles, UPD 14, placenta samples: Rima Slim, Ph.D, McGill University Philippe Coullin, Ph.D, Université Paris-Sud Isabella Caniggia, Ph.D, MSH Lisa S. Shaffer, Ph.D, Signature Genomics Placenta Bio-Bank at MSH Funding 58

59 Q & A

60 QIAGEN thanks Dr. Sanaa Choufani and our customers for participating in this Webinar. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at or can be requested from QIAGEN Technical Services or your local distributor