Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.

Size: px
Start display at page:

Download "Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D."

Transcription

1 Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati

2 Background Breast cancer (BCa) The second most common cancer among women in the United States Aberrant DNA methylation is frequently found in BCa Blood DNA methylation as BCa predictive biomarkers High stability of DNA DNA methylation in response to cancer-causing insults offers opportunities to develop predictive biomarkers Molecular lesions early events during cancer development Methylation markers can be expected to be found years before the actual diagnosis of BCa Fernald Medical Monitoring Program A uranium processing plant was built in the 1950s near Fernald, Ohio Uranium exposure in the community residents 71% increased incidence of BCa Blood samples were collected for each participant, along with full physical examination

3 Materials and Methods Group-matched blood DNA samples Cancer group (short interval to cancer) Blood collected 2-3 years before BCa diagnosis Normal group (control, no caner) Blood collected 10 years before without cancer Promoter methylation array To identify differential DNA methylation in gene promoter regions between the two groups Validation of DNA methylation Bisulfite sequencing analysis (gold standard technique)

4 NimbleGen DNA methylation promoter array DNA sonication 100 to 1000 bp Immuoprecipitation Antibody: anti-methylated DNA Amplification and labeling Hybridization on chip Data analysis 2 kb fixed window 750 bp sliding window

5 Bisulfite sequencing PCR TCCCGGGAGGCC m GG Bisulfite modification TUUUGGGAGGUC m GG PCR TTTTGGGAGGTCGG DNA sequencing

6 Results and Discussion Distribution of uranium exposure index scores

7 Blood DNA sample selection Groups UC ID Sample number High exposure with cancer and short interval High exposure with cancer and long interval Low exposure with cancer and short interval U- Exposure Age at entry Age at diagnosis BMI at enrollement Maternal history of Breast Cancer Total number of relatives with BC Total number of first degree relatives with BC BMI at BC Dx Date Age at first mammogram BREAST DENSITY at first Age at last mammogram BREAST DENSITY at last mammogram B26-B Case-Hi No LOW LOW Never B25 Case-Hi No LOW 60.8 ELSE Never B-21 Case-Hi No LOW ELSE Never B-22 Case-Hi No LOW ELSE Never B-24 Case-Hi No LOW LOW Never B-23 Case-Hi No LOW ELSE Never B-13 Case-Low No LOW ELSE Never B-15 Case-Low No ELSE LOW Never B-16 Case-Low No LOW LOW Never HRT use Cancer Group Low exposure with cancer and long interval B-12 Case-Low No ELSE ELSE Never B-11 Case-Low No LOW ELSE Never B-14 Case-Low No LOW 55.7 ELSE Never A-21 Cont-Hi Yes LOW LOW Never High exposure A-22 Cont-Hi No ELSE LOW Never without cancer A-2(A-23) Cont-Hi No LOW LOW Never Low exposure without cancer A-2(A-24) Cont-Hi Yes LOW LOW Never A-11B Cont-Low No 0 0 Never A12B Cont-Low No ELSE ELSE Never A-14 Cont-Low No LOW HIGH Never Normal Group

8 Methylation array: Methylation candidates selection Fold change of the methylation % CpG island in the promoter region P value

9 Methylation candidates selection (2 kb fixed window) Promoter CpG island Hypomethylated Hypomethylated

10 Bisulfite sequencing PCR (2 kb fixed window) ASB3 (primer #4) C18orf55 (primer #5) Sample (-) C18orf55 (primer #5) FBXO15 (primer #6) Sample (-) FBXO15 (primer #6) PCDHA (Primer #7, no amplification) Sample (-)

11 Methylation candidates selection (750 bp sliding window)

12 Bisulfite sequencing PCR (750 bp sliding window) X (-) DNMT3b FAM151A X (-) X FAM151A MAP3K (-) X MAP3K1 MRPS21 51 X (-) X X (-) MRPS21 SLC25A24

13 Methylation status of SlC25A24 gene promoter (hyper-methyalted) Control no cancer 4-G7 4-G8 4-G9 4-G10 4-G11 4-G12 4-H1 4-H2 4-H3 4-H4 4-H5 4-H6 4-H7 4-H8 4-H9 4-H10 4-H11 4-H12 5-A1 5-A2 5-A3 5-A4 5-A5 5-A6 Methylated CpG site Unmethylated CpG site Short interval to Cancer 5-A7 5-A8 5-A9 5-A10 5-A11 5-A12 5-B1 5-B2 5-B3 5-B4 5-B5 5-B6 5-B7 5-B8 5-B9 5-B10 5-B11 5-B12 5-C1 5-C2 5-C3 5-C4 5-C5 5-C6 5-C7 5-C8 5-C9 5-C10 5-C11 5-C12 5-D1 5-D2 5-D4 5-D5 5-D6 5-D7 5-D8 5-D9 5-D10 5-D11 5-D12

14 Methylation status of MRPS21 gene promoter (hypo-methylated) Control no cancer 4-A7 4-A8 4-A9 4-A10 4-A11 4-A12 4-B1 4-B3 4-B4 4-B5 4-B6 4-B7 4-B8 4-B10 4-B11 4-B12 4-C1 4-C11 4-D1 4-D2 4-D3 4-D4 4-D5 4-D6 4-D7 4-D8 4-D9 4-D10 Methylated CpG site Unmethylated CpG site Short interval to Cancer 4-D11 4-D12 4-E4 4-E6 4-E7 4-E8 4-E9 4-E10 4-E12 4-F1 4-F2 4-F4 4-C5 4-C6 4-C7 4-C8 4-C9 4-C10 4-F6 4-F7 4-F8 4-F9 4-F11 4-G1 4-G3 4-G4 4-G5 4-G6

15 Possible explanation Human blood DNA are the most difficult-to-verify samples Human blood>animal tissue>cultured cells Methylation array Methylation array sensitivity and resolution Antibodies for methylated DNA: CpG cluster CpG site DNA size selection: bp bp Alternative approach in the future Improved methylated array Deep bisulfite sequencing

16 Acknowledgement Dr. Susan Pinney Dr. Shuk-mei Ho Dr. Jing Chen Mr. Saikumar Karyala Thank you

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

Epigenetics and Chromatin Remodeling

Epigenetics and Chromatin Remodeling Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory

More information

DNA methylation & demethylation

DNA methylation & demethylation DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not

More information

PRADER WILLI/ANGELMAN

PRADER WILLI/ANGELMAN SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME

More information

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma.

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma. Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma Winnie Wan-yee Tang, Ph.D Department of Environmental Health University of

More information

Description of the Fernald Medical Monitoring Program University of Cincinnati College of Medicine

Description of the Fernald Medical Monitoring Program University of Cincinnati College of Medicine Description of the Fernald Medical Monitoring Program University of Cincinnati College of Medicine Medical Director: Epidemiologist: Program Coordinator: Robert Wones, MD Department of Internal Medicine

More information

MRC-Holland MLPA. Description version 52; 22 July 2015

MRC-Holland MLPA. Description version 52; 22 July 2015 SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data

Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey

More information

Forensic epigenetics for human body fluid identification. Sohee Cho, Ph.D. and Bruce R. McCord, Ph.D. Florida International University, Miami, FL

Forensic epigenetics for human body fluid identification. Sohee Cho, Ph.D. and Bruce R. McCord, Ph.D. Florida International University, Miami, FL Forensic epigenetics for human body fluid identification Sohee Cho, Ph.D. and Bruce R. McCord, Ph.D. Florida International University, Miami, FL DNA typing of biological materials found at the crime scene

More information

Chromatin-Based Regulation of Gene Expression

Chromatin-Based Regulation of Gene Expression Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism

More information

Epigenetics and Autoimmune Disease

Epigenetics and Autoimmune Disease Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX

More information

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide

More information

Epigenomics. Ivana de la Serna Block Health Science

Epigenomics. Ivana de la Serna Block Health Science Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications

More information

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1 Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos

More information

Epigenetic programming in chronic lymphocytic leukemia

Epigenetic programming in chronic lymphocytic leukemia Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:

More information

Blood Based Screening

Blood Based Screening Plenary Session 4 CRC screening: The best modality is... Blood Based Screening Molnár, Béla M.D., PhD 2nd Dept. of Medicine Semmelweis Budapest Hungary There is no controversy: screening saves lives Irrefutable

More information

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias

More information

Barrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation

Barrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation February 2008 Application Note arrett s Esophagus and Esophageal Adenocarcinoma Epigenetic iomarker Discovery Using Infinium Methylation Contributed by Patricia C. Galipeau, Dennis L. Chao, Xiaohong Li,

More information

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for

More information

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of

More information

UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,

UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky, University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

Supplementary Information

Supplementary Information Supplementary Information Table S1. Donor and sample information for blood samples used in the microarray and gene expression studies. Sample ID Age (Years) Diagnosis Smoking Classification DNA Methylation

More information

Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer

Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer J. Jin 1,2, L. Xie 2, C.H. Xie 1 and Y.F. Zhou 1 1 Department of Radiation & Medical Oncology, Zhongnan Hospital of Wuhan

More information

High resolution melting for methylation analysis

High resolution melting for methylation analysis High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells

More information

Quantitative evaluation of DNMT3B promoter methylation in breast cancer patients using differential high resolution melting analysis

Quantitative evaluation of DNMT3B promoter methylation in breast cancer patients using differential high resolution melting analysis Research in Pharmaceutical Sciences, August 213; 8(3): 167-175 Received: Jul 213 Accepted: Sep 213 School of Pharmacy & Pharmaceutical Sciences Isfahan University of Medical Sciences Original Article Quantitative

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more

More information

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration

More information

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A

More information

Carcinogenesis in IBD

Carcinogenesis in IBD Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham

More information

Update on Exact Sciences Molecular CRC Screening Test. November 16 th, 2011

Update on Exact Sciences Molecular CRC Screening Test. November 16 th, 2011 Update on Exact Sciences Molecular CRC Screening Test November 16 th, 2011 0 Safe Harbor Statement Certain matters contained in this presentation, other than historical information, consist of forward-looking

More information

MethylMix An R package for identifying DNA methylation driven genes

MethylMix An R package for identifying DNA methylation driven genes MethylMix An R package for identifying DNA methylation driven genes Olivier Gevaert May 3, 2016 Stanford Center for Biomedical Informatics Department of Medicine 1265 Welch Road Stanford CA, 94305-5479

More information

Integrated genomic analysis of human osteosarcomas

Integrated genomic analysis of human osteosarcomas Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

sirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome

sirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats

More information

DNA methylation signatures for breast cancer classification and prognosis

DNA methylation signatures for breast cancer classification and prognosis REVIEW DNA methylation signatures for breast cancer classification and prognosis Moshe Szyf* Abstract Changes in gene expression that reset a cell program from a normal to a diseased state involve multiple

More information

Back to the Basics: Methyl-Seq 101

Back to the Basics: Methyl-Seq 101 Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group

More information

Supplementary Note. Nature Genetics: doi: /ng.2928

Supplementary Note. Nature Genetics: doi: /ng.2928 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped

More information

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,

More information

The silence of the genes: clinical applications of (colorectal) cancer epigenetics

The silence of the genes: clinical applications of (colorectal) cancer epigenetics The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical

More information

Supplementary Information

Supplementary Information Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

QIAGEN Driving Innovation in Epigenetics

QIAGEN Driving Innovation in Epigenetics QIAGEN Driving Innovation in Epigenetics EpiTect and PyroMark A novel Relation setting Standards for the reliable Detection and accurate Quantification of DNA-Methylation May 2009 Gerald Schock, Ph.D.

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA

More information

Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines

Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines University of Pennsylvania ScholarlyCommons BBB Major Publications Biological Basis of Behavior Program 9-2010 Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines Jinglan Liu The Children's

More information

DNA methylation Dots(+) CxxC EGFP DAP

DNA methylation Dots(+) CxxC EGFP DAP a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression

More information

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

A panel of genes methylated with high frequency in colorectal cancer

A panel of genes methylated with high frequency in colorectal cancer Mitchell et al. BMC Cancer 2014, 14:54 RESEARCH ARTICLE Open Access A panel of genes methylated with high frequency in colorectal cancer Susan M Mitchell 1, Jason P Ross 1, Horace R Drew 1, Thu Ho 1, Glenn

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

A novel and universal method for microrna RT-qPCR data normalization

A novel and universal method for microrna RT-qPCR data normalization A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,

More information

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,

More information

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes

More information

Andrew M. Kaz 1,2,3*, Chao-Jen Wong 2, Vinay Varadan 4, Joseph E. Willis 5, Amitabh Chak 4,6 and William M. Grady 2,3

Andrew M. Kaz 1,2,3*, Chao-Jen Wong 2, Vinay Varadan 4, Joseph E. Willis 5, Amitabh Chak 4,6 and William M. Grady 2,3 Kaz et al. Clinical Epigenetics (2016) 8:111 DOI 10.1186/s13148-016-0273-7 RESEARCH Global DNA methylation patterns in Barrett s esophagus, dysplastic Barrett s, and esophageal adenocarcinoma are associated

More information

Measuring DNA Methylation with the MinION

Measuring DNA Methylation with the MinION Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other

More information

Overview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects

Overview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects Use of Emerging Science and Technologies to Explore Epigenetic Mechanisms Underlying the Developmental Basis for Disease NAS, Washington DC, July 2009 Overview of Current Tools and Approaches Used to Demonstrate

More information

Integrated Analysis of Copy Number and Gene Expression

Integrated Analysis of Copy Number and Gene Expression Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose

More information

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,

More information

Most severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).

Most severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment). SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:

More information

No evidence of clonally selected somatic genomic alterations in cancer associated

No evidence of clonally selected somatic genomic alterations in cancer associated Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,

More information

DNA methylation: a potential clinical biomarker for the detection of human cancers

DNA methylation: a potential clinical biomarker for the detection of human cancers DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,

More information

Tomasz K Wojdacz 1,2*, Johanne A Windeløv 1, Britta B Thestrup 1, Tine E Damsgaard 3, Jens Overgaard 2 and Lise Lotte Hansen 1

Tomasz K Wojdacz 1,2*, Johanne A Windeløv 1, Britta B Thestrup 1, Tine E Damsgaard 3, Jens Overgaard 2 and Lise Lotte Hansen 1 Wojdacz et al. Breast Cancer Research 2014, 16:R17 RESEARCH ARTICLE Open Access Identification and characterization of locus-specific methylation patterns within novel loci undergoing hypermethylation

More information

Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer

Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer JBUON 2018; 23(2): 361-365 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Association between promoter hypermethylation of the DACT2 gene and

More information

Epigenetic regulation of placental gene expression in transcriptional subtypes of preeclampsia

Epigenetic regulation of placental gene expression in transcriptional subtypes of preeclampsia Leavey et al. Clinical Epigenetics (2018) 10:28 https://doi.org/10.1186/s13148-018-0463-6 RESEARCH Epigenetic regulation of placental gene expression in transcriptional subtypes of preeclampsia Open Access

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Diet, Epigenetics and Breast Cancer

Diet, Epigenetics and Breast Cancer Diet, Epigenetics and Breast Cancer Shuk-Mei Ho Ph.D. Jacob G. Schmidlapp Professor and Chair of Department of Environmental Health Director, Center for Environmental Genetics Director, Microarray and

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle, WA 98109

CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle, WA 98109 AWARD NUMBER: W81XWH-10-1-0711 TITLE: Transgenerational Radiation Epigenetics PRINCIPAL INVESTIGATOR: Christopher J. Kemp, Ph.D. CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle,

More information

MSI positive MSI negative

MSI positive MSI negative Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

More information

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

Trace Metals and Placental Methylation

Trace Metals and Placental Methylation Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular

More information

Inferring causality in observational epidemiology: Breast Cancer Risk as an Example

Inferring causality in observational epidemiology: Breast Cancer Risk as an Example Inferring causality in observational epidemiology: Breast Cancer Risk as an Example Mary Beth Terry, PhD Department of Epidemiology and Environmental Sciences Cancer Genes vs Environmental Risk Factors

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

Environmental Epigenetics Methods and Tools for Human Environmental Health Studies

Environmental Epigenetics Methods and Tools for Human Environmental Health Studies Powerful ideas for a healthier world Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Environmental Epigenetics Methods and Tools for Human Environmental Health Studies Objective

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

Expert-guided Visual Exploration (EVE) for patient stratification. Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland

Expert-guided Visual Exploration (EVE) for patient stratification. Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland Expert-guided Visual Exploration (EVE) for patient stratification Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland Oncoscape.sttrcancer.org Paul Lisa Ken Jenny Desert Eric The challenge Given - patient clinical

More information

Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns

Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Epigenetic Variation in Human Health and Disease

Epigenetic Variation in Human Health and Disease Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding

More information

Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of

Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of PHD3 in a Diverse Set of Malignant Cells Abstract The prolyl-hydroxylase domain family of enzymes (PHD1-3) plays an important

More information

Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder

Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder Human Molecular Genetics, 2006, Vol. 15, No. 21 3132 3145 doi:10.1093/hmg/ddl253 Advance Access published on September 19, 2006 Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia

More information

Copyright 2014 The Authors.

Copyright 2014 The Authors. n Lund, K., Cole, J., VanderKraats, N. D., McBryan, T., Pchelintsev, N. A., Clark, W., Copland, M., Edwards, J. R., and Adams, P.(214) DNMT inhibitors reverse a specific signature of aberrant promoter

More information

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas

More information

Upcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1-

Upcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1- Upcoming Webinars -1- Keep up to date: Follow Pathway focused biology on Facebook www.facebook.com/pathwaycentral Latest information on, pathway focused research and demos. -2- Understanding Gene Expression

More information

MPS for translocations

MPS for translocations MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: Hypermethylated 14-3-3-sigma and ESR1 gene promoters in serum as candidate biomarkers for the diagnosis and treatment efficacy of breast cancer metastasis Authors: Mercedes

More information

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.

More information

Environmental programming of respiratory allergy in childhood: the applicability of saliva

Environmental programming of respiratory allergy in childhood: the applicability of saliva Environmental programming of respiratory allergy in childhood: the applicability of saliva 10/12/2013 to study the effect of environmental exposures on DNA methylation Dr. Sabine A.S. Langie Flemish Institute

More information

Inactivation of gene expression of some important tumor

Inactivation of gene expression of some important tumor GENERAL THORACIC Reduced Acetylated Histone H4 is Associated With Promoter Methylation of the Fragile Histidine Triad Gene in Resected Esophageal Squamous Cell Carcinoma Ching Tzao, MD, PhD, Guang-Huan

More information

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation Rauscher et al. BMC Cancer (2015) 15:816 DOI 10.1186/s12885-015-1777-9 RESEARCH ARTICLE Open Access Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events

More information

The Epigenome Tools 2: ChIP-Seq and Data Analysis

The Epigenome Tools 2: ChIP-Seq and Data Analysis The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview

More information