Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.
|
|
- Phebe Phoebe Lawrence
- 5 years ago
- Views:
Transcription
1 Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati
2 Background Breast cancer (BCa) The second most common cancer among women in the United States Aberrant DNA methylation is frequently found in BCa Blood DNA methylation as BCa predictive biomarkers High stability of DNA DNA methylation in response to cancer-causing insults offers opportunities to develop predictive biomarkers Molecular lesions early events during cancer development Methylation markers can be expected to be found years before the actual diagnosis of BCa Fernald Medical Monitoring Program A uranium processing plant was built in the 1950s near Fernald, Ohio Uranium exposure in the community residents 71% increased incidence of BCa Blood samples were collected for each participant, along with full physical examination
3 Materials and Methods Group-matched blood DNA samples Cancer group (short interval to cancer) Blood collected 2-3 years before BCa diagnosis Normal group (control, no caner) Blood collected 10 years before without cancer Promoter methylation array To identify differential DNA methylation in gene promoter regions between the two groups Validation of DNA methylation Bisulfite sequencing analysis (gold standard technique)
4 NimbleGen DNA methylation promoter array DNA sonication 100 to 1000 bp Immuoprecipitation Antibody: anti-methylated DNA Amplification and labeling Hybridization on chip Data analysis 2 kb fixed window 750 bp sliding window
5 Bisulfite sequencing PCR TCCCGGGAGGCC m GG Bisulfite modification TUUUGGGAGGUC m GG PCR TTTTGGGAGGTCGG DNA sequencing
6 Results and Discussion Distribution of uranium exposure index scores
7 Blood DNA sample selection Groups UC ID Sample number High exposure with cancer and short interval High exposure with cancer and long interval Low exposure with cancer and short interval U- Exposure Age at entry Age at diagnosis BMI at enrollement Maternal history of Breast Cancer Total number of relatives with BC Total number of first degree relatives with BC BMI at BC Dx Date Age at first mammogram BREAST DENSITY at first Age at last mammogram BREAST DENSITY at last mammogram B26-B Case-Hi No LOW LOW Never B25 Case-Hi No LOW 60.8 ELSE Never B-21 Case-Hi No LOW ELSE Never B-22 Case-Hi No LOW ELSE Never B-24 Case-Hi No LOW LOW Never B-23 Case-Hi No LOW ELSE Never B-13 Case-Low No LOW ELSE Never B-15 Case-Low No ELSE LOW Never B-16 Case-Low No LOW LOW Never HRT use Cancer Group Low exposure with cancer and long interval B-12 Case-Low No ELSE ELSE Never B-11 Case-Low No LOW ELSE Never B-14 Case-Low No LOW 55.7 ELSE Never A-21 Cont-Hi Yes LOW LOW Never High exposure A-22 Cont-Hi No ELSE LOW Never without cancer A-2(A-23) Cont-Hi No LOW LOW Never Low exposure without cancer A-2(A-24) Cont-Hi Yes LOW LOW Never A-11B Cont-Low No 0 0 Never A12B Cont-Low No ELSE ELSE Never A-14 Cont-Low No LOW HIGH Never Normal Group
8 Methylation array: Methylation candidates selection Fold change of the methylation % CpG island in the promoter region P value
9 Methylation candidates selection (2 kb fixed window) Promoter CpG island Hypomethylated Hypomethylated
10 Bisulfite sequencing PCR (2 kb fixed window) ASB3 (primer #4) C18orf55 (primer #5) Sample (-) C18orf55 (primer #5) FBXO15 (primer #6) Sample (-) FBXO15 (primer #6) PCDHA (Primer #7, no amplification) Sample (-)
11 Methylation candidates selection (750 bp sliding window)
12 Bisulfite sequencing PCR (750 bp sliding window) X (-) DNMT3b FAM151A X (-) X FAM151A MAP3K (-) X MAP3K1 MRPS21 51 X (-) X X (-) MRPS21 SLC25A24
13 Methylation status of SlC25A24 gene promoter (hyper-methyalted) Control no cancer 4-G7 4-G8 4-G9 4-G10 4-G11 4-G12 4-H1 4-H2 4-H3 4-H4 4-H5 4-H6 4-H7 4-H8 4-H9 4-H10 4-H11 4-H12 5-A1 5-A2 5-A3 5-A4 5-A5 5-A6 Methylated CpG site Unmethylated CpG site Short interval to Cancer 5-A7 5-A8 5-A9 5-A10 5-A11 5-A12 5-B1 5-B2 5-B3 5-B4 5-B5 5-B6 5-B7 5-B8 5-B9 5-B10 5-B11 5-B12 5-C1 5-C2 5-C3 5-C4 5-C5 5-C6 5-C7 5-C8 5-C9 5-C10 5-C11 5-C12 5-D1 5-D2 5-D4 5-D5 5-D6 5-D7 5-D8 5-D9 5-D10 5-D11 5-D12
14 Methylation status of MRPS21 gene promoter (hypo-methylated) Control no cancer 4-A7 4-A8 4-A9 4-A10 4-A11 4-A12 4-B1 4-B3 4-B4 4-B5 4-B6 4-B7 4-B8 4-B10 4-B11 4-B12 4-C1 4-C11 4-D1 4-D2 4-D3 4-D4 4-D5 4-D6 4-D7 4-D8 4-D9 4-D10 Methylated CpG site Unmethylated CpG site Short interval to Cancer 4-D11 4-D12 4-E4 4-E6 4-E7 4-E8 4-E9 4-E10 4-E12 4-F1 4-F2 4-F4 4-C5 4-C6 4-C7 4-C8 4-C9 4-C10 4-F6 4-F7 4-F8 4-F9 4-F11 4-G1 4-G3 4-G4 4-G5 4-G6
15 Possible explanation Human blood DNA are the most difficult-to-verify samples Human blood>animal tissue>cultured cells Methylation array Methylation array sensitivity and resolution Antibodies for methylated DNA: CpG cluster CpG site DNA size selection: bp bp Alternative approach in the future Improved methylated array Deep bisulfite sequencing
16 Acknowledgement Dr. Susan Pinney Dr. Shuk-mei Ho Dr. Jing Chen Mr. Saikumar Karyala Thank you
Analysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationEpigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma.
Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma Winnie Wan-yee Tang, Ph.D Department of Environmental Health University of
More informationDescription of the Fernald Medical Monitoring Program University of Cincinnati College of Medicine
Description of the Fernald Medical Monitoring Program University of Cincinnati College of Medicine Medical Director: Epidemiologist: Program Coordinator: Robert Wones, MD Department of Internal Medicine
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationGenome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey
More informationForensic epigenetics for human body fluid identification. Sohee Cho, Ph.D. and Bruce R. McCord, Ph.D. Florida International University, Miami, FL
Forensic epigenetics for human body fluid identification Sohee Cho, Ph.D. and Bruce R. McCord, Ph.D. Florida International University, Miami, FL DNA typing of biological materials found at the crime scene
More informationChromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
More informationEpigenetics and Autoimmune Disease
Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX
More informationChromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide
More informationEpigenomics. Ivana de la Serna Block Health Science
Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications
More informationYue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1
Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos
More informationEpigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
More informationBlood Based Screening
Plenary Session 4 CRC screening: The best modality is... Blood Based Screening Molnár, Béla M.D., PhD 2nd Dept. of Medicine Semmelweis Budapest Hungary There is no controversy: screening saves lives Irrefutable
More informationDNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
More informationBarrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation
February 2008 Application Note arrett s Esophagus and Esophageal Adenocarcinoma Epigenetic iomarker Discovery Using Infinium Methylation Contributed by Patricia C. Galipeau, Dennis L. Chao, Xiaohong Li,
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More informationUKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,
University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationSupplementary Information
Supplementary Information Table S1. Donor and sample information for blood samples used in the microarray and gene expression studies. Sample ID Age (Years) Diagnosis Smoking Classification DNA Methylation
More informationAberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer
Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer J. Jin 1,2, L. Xie 2, C.H. Xie 1 and Y.F. Zhou 1 1 Department of Radiation & Medical Oncology, Zhongnan Hospital of Wuhan
More informationHigh resolution melting for methylation analysis
High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells
More informationQuantitative evaluation of DNMT3B promoter methylation in breast cancer patients using differential high resolution melting analysis
Research in Pharmaceutical Sciences, August 213; 8(3): 167-175 Received: Jul 213 Accepted: Sep 213 School of Pharmacy & Pharmaceutical Sciences Isfahan University of Medical Sciences Original Article Quantitative
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationRALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationCarcinogenesis in IBD
Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham
More informationUpdate on Exact Sciences Molecular CRC Screening Test. November 16 th, 2011
Update on Exact Sciences Molecular CRC Screening Test November 16 th, 2011 0 Safe Harbor Statement Certain matters contained in this presentation, other than historical information, consist of forward-looking
More informationMethylMix An R package for identifying DNA methylation driven genes
MethylMix An R package for identifying DNA methylation driven genes Olivier Gevaert May 3, 2016 Stanford Center for Biomedical Informatics Department of Medicine 1265 Welch Road Stanford CA, 94305-5479
More informationIntegrated genomic analysis of human osteosarcomas
Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationsirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
More informationDNA methylation signatures for breast cancer classification and prognosis
REVIEW DNA methylation signatures for breast cancer classification and prognosis Moshe Szyf* Abstract Changes in gene expression that reset a cell program from a normal to a diseased state involve multiple
More informationBack to the Basics: Methyl-Seq 101
Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group
More informationSupplementary Note. Nature Genetics: doi: /ng.2928
Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped
More informationEpigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum
Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,
More informationThe silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
More informationSupplementary Information
Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationQIAGEN Driving Innovation in Epigenetics
QIAGEN Driving Innovation in Epigenetics EpiTect and PyroMark A novel Relation setting Standards for the reliable Detection and accurate Quantification of DNA-Methylation May 2009 Gerald Schock, Ph.D.
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationGenome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines
University of Pennsylvania ScholarlyCommons BBB Major Publications Biological Basis of Behavior Program 9-2010 Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines Jinglan Liu The Children's
More informationDNA methylation Dots(+) CxxC EGFP DAP
a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression
More informationFOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationA panel of genes methylated with high frequency in colorectal cancer
Mitchell et al. BMC Cancer 2014, 14:54 RESEARCH ARTICLE Open Access A panel of genes methylated with high frequency in colorectal cancer Susan M Mitchell 1, Jason P Ross 1, Horace R Drew 1, Thu Ho 1, Glenn
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationA novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
More informationSupplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
More informationMeasuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes
More informationAndrew M. Kaz 1,2,3*, Chao-Jen Wong 2, Vinay Varadan 4, Joseph E. Willis 5, Amitabh Chak 4,6 and William M. Grady 2,3
Kaz et al. Clinical Epigenetics (2016) 8:111 DOI 10.1186/s13148-016-0273-7 RESEARCH Global DNA methylation patterns in Barrett s esophagus, dysplastic Barrett s, and esophageal adenocarcinoma are associated
More informationMeasuring DNA Methylation with the MinION
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other
More informationOverview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects
Use of Emerging Science and Technologies to Explore Epigenetic Mechanisms Underlying the Developmental Basis for Disease NAS, Washington DC, July 2009 Overview of Current Tools and Approaches Used to Demonstrate
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationSupplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationNo evidence of clonally selected somatic genomic alterations in cancer associated
Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,
More informationDNA methylation: a potential clinical biomarker for the detection of human cancers
DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,
More informationTomasz K Wojdacz 1,2*, Johanne A Windeløv 1, Britta B Thestrup 1, Tine E Damsgaard 3, Jens Overgaard 2 and Lise Lotte Hansen 1
Wojdacz et al. Breast Cancer Research 2014, 16:R17 RESEARCH ARTICLE Open Access Identification and characterization of locus-specific methylation patterns within novel loci undergoing hypermethylation
More informationAssociation between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer
JBUON 2018; 23(2): 361-365 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Association between promoter hypermethylation of the DACT2 gene and
More informationEpigenetic regulation of placental gene expression in transcriptional subtypes of preeclampsia
Leavey et al. Clinical Epigenetics (2018) 10:28 https://doi.org/10.1186/s13148-018-0463-6 RESEARCH Epigenetic regulation of placental gene expression in transcriptional subtypes of preeclampsia Open Access
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationDiet, Epigenetics and Breast Cancer
Diet, Epigenetics and Breast Cancer Shuk-Mei Ho Ph.D. Jacob G. Schmidlapp Professor and Chair of Department of Environmental Health Director, Center for Environmental Genetics Director, Microarray and
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationCONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle, WA 98109
AWARD NUMBER: W81XWH-10-1-0711 TITLE: Transgenerational Radiation Epigenetics PRINCIPAL INVESTIGATOR: Christopher J. Kemp, Ph.D. CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle,
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationTrace Metals and Placental Methylation
Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular
More informationInferring causality in observational epidemiology: Breast Cancer Risk as an Example
Inferring causality in observational epidemiology: Breast Cancer Risk as an Example Mary Beth Terry, PhD Department of Epidemiology and Environmental Sciences Cancer Genes vs Environmental Risk Factors
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationEnvironmental Epigenetics Methods and Tools for Human Environmental Health Studies
Powerful ideas for a healthier world Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Environmental Epigenetics Methods and Tools for Human Environmental Health Studies Objective
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationExpert-guided Visual Exploration (EVE) for patient stratification. Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland
Expert-guided Visual Exploration (EVE) for patient stratification Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland Oncoscape.sttrcancer.org Paul Lisa Ken Jenny Desert Eric The challenge Given - patient clinical
More informationTissue of origin determines cancer-associated CpG island promoter hypermethylation patterns
RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationEpigenetic Variation in Human Health and Disease
Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding
More informationAberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of PHD3 in a Diverse Set of Malignant Cells Abstract The prolyl-hydroxylase domain family of enzymes (PHD1-3) plays an important
More informationHypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder
Human Molecular Genetics, 2006, Vol. 15, No. 21 3132 3145 doi:10.1093/hmg/ddl253 Advance Access published on September 19, 2006 Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia
More informationCopyright 2014 The Authors.
n Lund, K., Cole, J., VanderKraats, N. D., McBryan, T., Pchelintsev, N. A., Clark, W., Copland, M., Edwards, J. R., and Adams, P.(214) DNMT inhibitors reverse a specific signature of aberrant promoter
More informationThe 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis
The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics
More informationCorporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
More informationUpcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1-
Upcoming Webinars -1- Keep up to date: Follow Pathway focused biology on Facebook www.facebook.com/pathwaycentral Latest information on, pathway focused research and demos. -2- Understanding Gene Expression
More informationMPS for translocations
MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,
More informationAuthor's response to reviews
Author's response to reviews Title: Hypermethylated 14-3-3-sigma and ESR1 gene promoters in serum as candidate biomarkers for the diagnosis and treatment efficacy of breast cancer metastasis Authors: Mercedes
More informationOverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
More informationEnvironmental programming of respiratory allergy in childhood: the applicability of saliva
Environmental programming of respiratory allergy in childhood: the applicability of saliva 10/12/2013 to study the effect of environmental exposures on DNA methylation Dr. Sabine A.S. Langie Flemish Institute
More informationInactivation of gene expression of some important tumor
GENERAL THORACIC Reduced Acetylated Histone H4 is Associated With Promoter Methylation of the Fragile Histidine Triad Gene in Resected Esophageal Squamous Cell Carcinoma Ching Tzao, MD, PhD, Guang-Huan
More informationExploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation
Rauscher et al. BMC Cancer (2015) 15:816 DOI 10.1186/s12885-015-1777-9 RESEARCH ARTICLE Open Access Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More information