Supplementary Information Diet-dependent, microbiota-independent regulation of IL-10- producing lamina propria macrophages in the small intestine

Transcription

1 Supplementary Information Diet-dependent, microbiota-independent regulation of IL-1- producing lamina propria macrophages in the small intestine Takanori Ochi, Yongjia Feng, Sho Kitamoto, Hiroko Nagao-Kitamoto, Peter Kuffa, Koji Atarashi, Kenya Honda, Daniel H. Teitelbaum, Nobuhiko Kamada

2 a b 1. Water 4Abx Fold difference (16S rdna copies) (.16) - + 4Abx Supplementary Figure 1. Antibiotics treatment efficiently decreases the number of the small intestinal microbes. SPF C57BL/6 mice received an antibiotic cocktail (4Abx) in the drinking water for 7 days. Mice were then switched to sterile water for 5 days before analysis of ileal bacteria. Representative images of cecum from 4Abxtreated and control mice are shown in (a). (b) Luminal contents were isolated from terminal ileum and bacterial genomic DNA was isolated. qpcr was performed and the fold changes of 16S rdna (normalized to host genomic Actb) are shown.

3 a % Ly6C hi CD11b + cells, Spleen AA % Ly6C hi CD11b + cells, BM AA b.8 Ccl mrna AA Supplementary Figure. A lack of dietary amino acids does not affect the number of macrophage precursors and mucosal Ccl expression. (a) Frequencies of Ly6C hi CD11b + monocytes in the spleen and the bone-marrow (BM) isolated from control () diet- or protein-free ( AA) diet-fed mice. Data are given as mean ± s.e.m. (; n=5, AA; n=7)., not significant by Student s t-test. (b) Expression of Ccl mrna in the small intestinal mucosa of diet- or AA diet-fed mice. Data are given as mean ± s.e.m. (n=4)., not significant by Student s t-test.

4 a b % IL-1Venus + cells % IL-1Venus + cells * % IL-1Venus + M s AA AA AA IL-1 Venus IL-1 Venus IL-1 Venus * Rap IL-1 Venus % IL-1Venus + M s 3 * 1 3 *** % IL-1Venus + T cells % IL-1Venus + T cells 1 3 ** Rap 1 1 Rap IL-1 Venus IL-1 Venus Supplementary Figure 3. Dietary amino acid deprivation or rapamycin treatment decreases the number of IL-1-producing macrophages. (a, b) Frequencies of total IL-1-producing leukocytes (CD AAD - ), F4/8 + CD11b + M s and CD3 + CD4 + T cells in the SI LPMCs isolated from control () diet- or protein-free ( AA) diet-fed mice (a), or isolated from rapamycintreated (Rap) or untreated control () mice (b) are shown. Data are given as mean±s.e.m. *, P<.5; **, P<.1; ***, P<.1;, not significant by Student s t-test.

5 Small intestine (7-AAD - cells) Colon (7-AAD - cells) SPF Germ-free SPF Germ-free CD11b F4/8 F4/8 CD13 CD13 CD11b CD11c CD11c Supplementary Figure 4. Gut microbiota is not required for the replenishment of F4/8 + CD11b + macrophages in the small intestine. Lamina propria mononuclear cells were isolated from the small intestine and colon of SPF and germ-free mice. Frequencies of F4/8 + CD11b + cells (monocyte-derived macrophages) and CD13 + CD11c + cells (dendritic cells) within total lamina propria cells (7-AAD - ) are shown. Data are representative of at least independent experiments.

6 .6.15 Csf1 mrna.4. Csf mrna.1.5. SHAM TPN. SHAM TPN Supplementary Figure 5. Expression of Csf1 and Csf mrna in the small intestinal mucosa of TPN-treated mice. Mucosal samples were isolated from the small intestine of TPN- or sham-treated mice. Expression of Csf1 and Csf mrna was analyzed by qpcr. Expression of target genes was normalized to Actb. Data are given as mean±s.e.m. (n=6)., not significant by Student s t-test.

7 a 8 * IL-1 (pg ml -1 ) 6 4 TNF-α (pg ml -1 ) b c IL-1 (pg ml -1 ) IL-1 (pg ml -1 ) * * AA Rap TNF-α (pg ml -1 ) AA Rap AA Gly Arg Asx Asp Cys Glu Gln His Hyp Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val Supplementary Figure 6. Amino acid deprivation leads to a decrease of IL-1 production in bone-marrow derived macrophages. (a) Bone-marrow (BM) derived macrophages (BMDMs) (1 1 6 cells ml -1 ) were differentiated in complete RPMI. Cells were washed and medium was replaced with either an amino acid (AA) containing RPMI () or AA deficient ( AA) medium (formulation of each medium is listed in Supplementary Table 3), and then stimulated with LPS (1ng ml -1 ) for 4 hrs. Cytokine levels were measured by ELISA. Data are given as mean ± s.e.m. (n=3). *, P<.5;, not significant by Student s t-test. (b) BMDMs (in complete RPMI) were pretreated with or without 5 ng ml -1 rapamycin (Rap) for 1 hr followed by stimulation with LPS (1ng ml -1 ) for 4 hrs. Cytokine levels were measured by ELISA. Data are given as mean ± s.e.m. (n=3). *, P<.5;, not significant by Student s t-test. (c) BMDMs were cultured in or AA medium supplemented with indicated individual amino acids (final conc. 1mM). LPS (1ng ml -1 ) for 4 hrs. Secreted IL-1 was measured by ELISA. Data are given as mean ± s.e.m. (n=3). *, P<.5 by Dunnett s test (compared to AA).

8 Supplementary Table 1. Composition of amino acid control diet and protein-free diet. amino acid control diet Formula Amount (g/kg) Sucrose 45. Corn Starch. Corn Oil 54.6 Cellulose Mineral Mix, Ca-P Deficient Calcium Phosphate, dibasic 3.7 Calcium Carbonate.38 Vitamine Mix, Teklad 1. Ethoxyquin, antioxidant.1 L-Alanine 3.5 L-Arginine HCl 1.1 L-Asparagine 6. L-Aspartic Acid 3.5 L-Cystine 3.5 L-Glutamic Acid 4. Glycine 3.3 L-Histidine HCl, monohydrate 4.5 L-Isoleucine 8. L-Leucine 11.1 L-Lysine HCl 18. L-Methionine 8. L-Phenylalanine 7.5 L-Proline 3.5 L-Serine 3.5 L-Threonine 8. L-Tryptophan 1.8 L-Tyrosine 5. L-Valine 8. protein-free diet Formula Amount (g/kg) Sucrose Corn Starch. Corn Oil 54.6 Cellulose Mineral Mix, Ca-P Deficient Calcium Phosphate, dibasic 3.7 Calcium Carbonate.38 Vitamine Mix, Teklad 1. Ethoxyquin, antioxidant.1

9 Supplementary Table. Composition of the TPN solution. Nutrient Intake over 4 h Dextrose, g 1.6 Amino Acids, g.4 Fat, g 3. Sodium, mmol.47 Potassium, mmol.97 Chloride, mmol.34 Acetate, mmol 1.6 Phosphate, mmol.1 Magnesium, mmol.3 Calcium, mmol.6 Sulfate, mmol. Gluconate, mmol.1 Heparin, U MTE-5 Concentrate, ml 4.7 MVI-1, ml 5.7 Energy, kj Hospira, Deerfield, Illinois. FreAmine III (B.Braun) was used as the source of the following amino acids (mg/1ml): Essential: isoleucine 6.6; Leucine 1.; Lysine (acetate) 1.5; methionine 1.7; phenylalanine.98; thronine 4.; tryptophan.; valine 5.. Nonessential: alanine 9.93; arginine 1.18; L-aspartic acid 7.; L-glutamic acid 7.38; histidine 3.; praline 7.; serine 5.3; N-acetyl-L-tyrosine.7; glycine Intravenous fat solution (Intralipid, Baxter Healthcare) is composed of (g/l): safflower oil 5; soybean oil 5; egg phosphatides 1; glycerin in water 5. The major fatty acid components (%) are: linoleic (18:, n-6) 65.8; oleic (18:1, n-9) 17.7; palmitic (16:) 8.8; stearic (18:) 3.4; linolenic (18:3, n-3) American Regent Laboratories, Shirley, NY, MTE-5 (multi-trace 5) contains (amount given per 4 hours): zinc sulfate heptahydrate.155 mg; cupric sulfate pentahydrate.8 mg; manganese sulfate monohydrate.11 mg; chronic chloride hexahydrate.359 mg; selenious acid.686 mg. 5 For MVI-1 (Hospira; amount given per 4 hours): Vitamin A (retinol).14 mg; Vitamin D (ergocalciferol).7 μg; Vitamin E (di-alpha-tocopheryl acetate).14 mg; Vitamin C (ascordbic acid).8 mg; Niacinamide.56 mg; Vitamin B (riboflavin 5-phosphate sodium).5 mg; Vitamin B 1 (thiamine).84 mg; Vitamin B 6 (pyridoxine HCl).84 mg; Dexpanthenol (di-pantothenyl alchol).1 mg; Biotin.84 μg; Folic Acid.84 μg; Vitamin B 1 (cyanocobalamin).7 μg.

10 Supplementary Table 3. Composition of amino acid (AA) RPMI and AA deficient ( AA) RPMI. Type Nutrients Amount (mm) RPMI AA RPMI Amino Acids Glycine L-Arginine L-Asparagine L-Aspartic acid L-Cystine HCl L-Glutamic acid L-Glutamine L-Histidine L-Hydroxyproline L-Isoleucine L-Leucine L-Lysine hydrochloride L-Methionine L-Phenylalanine L-Proline L-Serine L-Threonine L-Tryptophan L-Tyrosine disodium salt dihydrate L-Valine Vitamins Biotin 8.E-4 Choline chloride D-Calcium pantothenate 5.4E-4 Folic Acid Niacinamide Para-Aminobenzoic Acid.7997 Pyridoxine hydrochloride Riboflavin 5.3E-4 Thiamine hydrochloride Vitamin B1 3.69E-6 i-inositol Inorganic Salts Calcium nitrate (Ca(NO3) 4HO) Magnesium Sulfate (MgSO4-7HO).47 Potassium Chloride (KCl) Sodium Bicarbonate (NaHCO3) Sodium Chloride (NaCl) Sodium Phosphate dibasic (NaHPO4-7HO) Other Components D-Glucose (Dextrose) Glutathione (reduced) Phenol Red * Bovine serum albumin (BSA) ( mg ml -1 ) was added instead of FBS.

11 Supplementary Table 4. Primer sequences used in this study. Gene Forward (5 -> 3 ) Reverse (5 -> 3 ) Ccl GTTGGCTCAGCCAGATGCA AGCCTACTCATTGGGATCATCTTG Csf1 GGGGGCCTCCTGTTCTAC CCCACAGAAGAATCCAATGTC Csf ATGCCTGTCACGTTGAATGAAG GCGGGTCTGCACACATGTTA Actb AAGTGTGACGTTGACATCCG GATCCACATCTGCTGGAAGG 16S rdna AGAGTTTGATCCTGGCTCAG TGCTGCCTCCCGTAGGAGT Actb (genome) ATGACCCAGATCATGTTTGA TACGACCAGAGGCATACAG

12 Supplementary Table 5. List of antibodies used for flow cytometry. Anti-Mouse CD11b FITC (ebioscience 11-11) Anti-Mouse CD11b PE (ebioscience 1-11) Anti-Mouse CD13 (Integrin alpha E) PE (ebioscience 1-131) Anti-Mouse CD11c PE-Cyanine7 (ebioscience 5-114) Anti-Mouse CD4 PE-Cyanine7 (ebioscience 5-41) Anti-Mouse F4/8 Antigen APC (ebioscience ) Anti-Mouse CD3 APC (ebioscience 17-3) Anti-Mouse CD45 APC-eFluor 78 (ebioscience ) Anti-Mouse MHC Class II (I-A/I-E) efluor 45 (ebioscience ) Anti-Mouse CD8a efluor 45 (ebioscience ) Anti-Mouse Ly-6C efluor 45 (ebioscience ) 7-AAD Viability Staining Solution (ebioscience )