Splicing analysis of CYP11B1 mutation in a family affected with 11β-hydroxylase deficiency: case report

Transcription

1 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 DOI /s CASE REPORT Open Access Splicing nlysis of CYP11B1 muttion in fmily ffected with 11β-hydroxylse deficiency: cse report Pttrntch Chrnwichi 1,2, Ptr Yeetong 2,3, Kny Suphpeetiporn 2,4, Vichit Supornsilchi 5, Tninee Shkitrungrung 5* nd Vorsuk Shotelersuk 2,4 Abstrct Bckground: Congenitl drenl hyperplsi (CAH) due to steroid 11β-hydroxylse deficiency (11β-OHD) is rre form of CAH ssocited with low renin hypertension, hypoklemi, hyperndrogenemi nd mbiguous genitli in ffected femles. Herein we describe the clinicl, hormonl nd moleculr chrcteristics of two Uzbekistn siblings with 11β-OHD nd nlyze the effects of splicing muttion. Cse presenttion: A 46,XX girl presented with genitl mbiguity nd low renin hypertension; her 46,XY brother presented with precocious puberty. Hormonl studies suggested 11β-OHD. Muttion nlysis ws performed by PCR followed by Snger sequencing of the entire coding regions nd their flnking introns of the CYP11B1 gene. Muttion nlysis showed tht both ptients were compound heterozygous for IVS7 + 1G > A, nd c.421c > T. Although the identified muttions hve been previously described, this is, to our knowledge, the first report of these muttions in compound heterozygotes. A minigene ssy ws used to determine the effects of the splicing muttion. The constructs contining either the wild-type or the splice-site mutnt CYP11B1 genomic DNA of exons-introns 6 9weretrnsfected into COS-7 cells; subsequently, RNA splicing ws ssessed by reversed trnscribed-pcr of CYP11B1 complementry DNA. The minigene ssy reveled tht the IVS7 + 1G > A muttion resulted in two shorter incorrectly spliced products; one skipping the exon 7 nd the other skipping the exons 7 8. The c.421c > T muttion leds to the introduction of premture stop codon t residue 141 (p.r141x). These muttions re expected to code non-functionl proteins. Conclusion: Compound heterozygous muttions (IVS7 + 1G > A nd p.r141x) in the CYP11B1 gene were found to cuse 11β-OHD. The IVS7 + 1G > A muttion cuses berrnt splicing of CYP11B1 leding to exon skipping. This finding could fcilitte the future novel therpies trgeted on splicingmodultiontotrethumndisese. Keywords: CYP11B1, Splicing, Muttion, 11β-hydroxylse deficiency, Congenitl drenl hyperplsi, Cse report Bckground 11β-hydroxylse deficiency (11β-OHD) cused by muttions in the CYP11B1 gene ccounts for pproximtely 5 8 % of congenitl drenl hyperplsi (CAH) in nonconsnguineous popultions, but ccounts for ~15 % of cses in both Muslim nd Jewish Middle Estern popultions [1]. Steroid 11β-hydroxylse (P450c11β, CYP11B1) converts 11-deoxycortisol to cortisol, representing the finl step in cortisol biosynthesis, nd 11-deoxycorticosterone * Correspondence: Tninee.P@chul.c.th 5 Division of Peditric Endocrinology, Deprtment of Peditrics, Fculty of Medicine, Chullongkorn University, Bngkok 10330, Thilnd Full list of uthor informtion is vilble t the end of the rticle (DOC) to corticosterone. Thus, deficient P450c11β ctivity results in impired cortisol synthesis nd ccumultion of 11-deoxycortisol nd the minerlocorticoid precursor DOC, which leds to significnt hypertension, hllmrk feture of this CAH vrint [1]. Accumulted steroid precursors re shunted into the ndrogen synthesis pthwy, leding to ndrogen excess. Clssic 11β-OHD results in viriliztion of the externl genitli in ffected femles (46,XX disorders of sex development) s well s precocious puberty, ccelerted growth nd bone mturtion in both sexes. Ptients with 11β-OHD cn hve elevted concentrtions of 17-hydroxyprogesterone (17OHP), which ccumultes two steps behind the enzymtic block, so tht 11β The Author(s). Open Access This rticle is distributed under the terms of the Cretive Commons Attribution 4.0 Interntionl License ( which permits unrestricted use, distribution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Public Domin Dediction wiver ( pplies to the dt mde vilble in this rticle, unless otherwise stted.

2 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 2 of 7 OHD my be detected by 17OHP newborn screening progrm [2]. The dignosis is estblished by elevted bsl concentrtions of DOC nd 11-deoxycortisol, which hyper respond to ACTH stimultion. CYP11B1 is locted on the long rm of chromosome 8 (8q21), consisting of 9 exons, nd encodes 503 mino cids. To dte, over 80 muttions in CYP11B1 gene re described. Most re missense nd nonsense muttions, but splice-site muttions, smll or gross deletions/insertions, nd complex rerrngements with CYP11B2 hve lso been identified [3 5]. The mjority of CYP11B1 muttions re ssocited with clssic 11β-OHD, nd only few muttions cusing non-clssic 11β-OHD which cn mnifest lter in otherwise symptomtic women with hirsutism, nd menstrul irregulrities [6, 7]. In this report, we describe two siblings with the clinicl nd hormonl phenotypes of 11β-OHD nd identified compound heterozygous muttions in the CYP11B1 gene. The splicing muttion ws studied in vitro for its functionl consequences with minigene experiment nd showed exon-skipping which confirmed the clinicl dignosis. Cse presenttion The ptients were siblings from non-consnguineous Uzbekistn fmily. Ptient 1 ws 3-yr-old 46,XX femle with mbiguous genitli. She ws previously evluted for her bnorml genitl development nd underwent first genitl surgery in Turkey. On n initil evlution t ge 2 y 8 m, her height ws 100 cm (+2.1 SD), her weight ws 15.8 kg, (+1.4 SD), blood pressure (BP) ws 110/70 mmhg (94 th /96 th percentiles). The physicl exmintion reveled tht the phllus ws 5 cm long nd 2 cm wide (Prder grde IV); no gonds were plpble in the inguinl region. The reol nd plmr creses were pigmented bilterlly. An ACTH stimultion test (250 μg) showed grossly elevted bseline ACTH (238 pg/ml) nd bsl cortisol of 4.7 μg/dl with non-response to ACTH nd modertely elevted progesterone nd 17OHP fter 60 min; 11-deoxycortisol nd ndrostenedione concentrtions were mrkedly high (Tble 1). The serum sodium ws 136 mmol/l, potssium 3.1 mmol/l, plsm renin ctivity (PRA) ws very low t 15 ng/dl/h (nl, ), nd ldosterone 2 ng/dl (nl, 3 35). Her totl testosterone levels were 132 ng/dl (nl, <3 10) nd dehydroepindrosterone sulfte (DHEAS) μg/dl (nl, <5-57). She ws followed up t the King Chullongkorn Memoril Hospitl (Bngkok, Thilnd) due to the fmily reloction t ge 3 yr for further mngement. After receiving the results of n ACTH stimultion test, she ws strted tretment with hydrocortisone, 5 mg thrice dily (10 mg/m 2 /d) which improved BP into the norml rnge (90/60 mmhg), suppressed testosterone, nd PRA becme mesurble ( ng/dl/h). Ptient 2 is the younger brother of Ptient 1. He presented t 2 yers of ge with cne nd msculiniztion (isosexul precocious puberty). Physicl exmintion reveled n dvnced mturtion of externl genitli s well s low-pitched voice. His Tnner stges were G3 nd PH1, nd ech of his testes ws 3 ml in volume. His height ws 97 cm (+3.2 SD) nd weight ws 17 kg (+2.9 SD). Height gin ws ccelerted from 12-monthold on the growth chrt (from +2.6 SD to +3.2 SD). Skin pigmenttion ppered consistent with his ethnicity, but no evident mucosl pigmenttion. His BP ws 110/ 65 mmhg (92 th /95 th percentiles). Lbs reveled serum N 136 mmol/l, K 4.3 mmol/l, bicrbonte 24 mmol/l, BUN 12 nd Cr 0.3 mg/dl, respectively. An ACTH stimultion test showed elevted bseline ACTH, low bsl cortisol (2.3 μg/dl) with non-response to ACTH nd modertely elevted 17OHP fter 60 min (Tble 1). 11-deoxycortisol concentrtions were not mesured. PRA ws low t 106 ng/dl/h (nl, ), nd low ldosterone 0.2 ng/dl (nl, 3 35). He ws then treted with hydrocortisone 2.5 mg thrice dily (11 mg/m 2 /d). His blood pressure ws well controlled, nd PRA ws incresed up to 738 ng/dl/h. DNA sequencing Genomic DNA from peripherl blood leucocytes of the ptients nd their prents ws extrcted by using the QIAmp DNA Blood Mini Kit (Qigen, Vlenci, CA) fter tking informed consent. The coding sequence of Tble 1 Bsl nd 60 min post ACTH (250 μg) stimulted drenl steroid profile Steroids Ptient 1 Ptient 2 Reference vlues (ge 2 y 8 m) (ge 2 y) Bsl Stimulted Bsl Stimulted Bsl Stimulted ACTH (pg/ml) Cortisol (μg/dl) OHP (ng/dl) Progesterone (ng/dl) Androstenedione (ng/dl) <10-48 < deoxycortisol (ng/dl) Note: Reference vlues re unvilble

3 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 3 of 7 CYP11B1 gene including exon-intron boundries ws mplified in eight frgments using specific primers (Tble 2). PCR products were treted with ExoSAP-IT (USP Corportion, Clevelnd, OH), nd sent for direct sequencing t Mcrogen Inc. (Seoul, Kore). Anlyses were performed by Sequencher 4.2 (Gene Codes Corportion, Ann Arbor, MI). Minigene construction nd splicing nlysis We performed minigene in vitro experiment of the CYP11B1 splicing muttion. A segment of the wild-type (WT) nd mutnt (IVS7 + 1G > A) genomic DNA (gdna) of CYP11B1 gene consisting of exons 6 to 9 nd their inbetween introns ws mplified by PCR using the oligonucleotides listed in Tble 2. We used the gdna of norml control nd the ptient with IVS7 + 1G > A CYP11B1 muttion s templte of minigene constructs. PCR rections were crried out in 20 μl volume contining 50 ng gdna, 10xPCR buffer, 25 mm MgCl 2,10μM dntps,5 U/μl Tq polymerse nd 10 μm ofechprimer,usingthe following prmeters: 30s t 94 C, 30s t 60 C nd 1.30 min t 72 C. The PCR product ws cleved with BmHI-HF nd XbI enzymes nd cloned into the corresponding sites of pcdna 3.1/myc-His B mmmlin expression vector (Invitrogen, Crlsbd, CA) using T4 DNA ligse (New Englnd BioLbs, UK). The wild-type nd mutnt vectors were confirmed by direct sequencing using NCBI Reference Sequences (RefSeq) NG_ s the genomic reference nd NM_ s the mrna reference. COS-7 cells were cultured in Dulbecco s Modified Egles Medium, High Glucose (HyClone Lbortories, Logn, UT) supplemented with 10 % fetl bovine serum (Sigm- Aldrich, Singpore) nd 0.01 % penicillin/streptomycin (HyClone Lbortories) t 37 C in humidified 5 % CO 2 incubtor. Cells were grown on 6-well pltes nd trnsiently trnsfected with the wild-type nd mutnt minigene constructs (1 μg) using Effectene Trnsfection Regent (Qigen). Cells incubted for 48 h fter trnsfection nd then were wshed 3 times with PBS nd kept frozen t 20 C. Totl cellulr RNA ws extrcted using QIAmp RNA Blood Mini Kit (Qigen) nd treted with DNseI (Qigen). The RNAs were then used s templte for cdna synthesis using ImProm-II Reverse Trnscription System (Promeg Corportion, Mdison, WI). Finlly, both the WT nd mutnt cdnas were mplified by PCR using the sme primers nd conditions s used for the minigene construction. The PCR products were nlyzed by electrophoresis on 1 % grose gel followed by stining with ethidium bromide. Ech PCR product ws confirmed by Snger sequencing fter subcloning into pgem -T Esy vectors (Promeg). Results Muttion nlysis DNA sequencing of the entire coding regions nd their flnking introns of the CYP11B1 gene showed tht both siblings were compound heterozygous for nonsense muttion c.421c > T in its exon 3 (NCBI RefSeq NG_ ), cusing the introduction of premture stop codon t residue 141 (p.r141x); nd splice site muttion, c G > A which is t the 5 donor splice site of the intron 7 (IVS7 + 1G > A). These identified muttions were reported previously [8 10], but their pthogenic mechnisms hve not clerly been elucidted. Sequence nlysis of the prentl gdna demonstrted tht the mother ws heterozygous for the c.421c > T muttion nd the fther, heterozygous for the c G > A muttion (Fig. 1). Minigene nlysis of the splice site muttion We hypothesized tht the c G > A (IVS7 + 1G > A) muttion locted t the splicing donor site of intron 7 would crete n bnorml splicing of the mrna. To exmine this possibility, we constructed expression vectors contining the WT nd the mutnt c G > A CYP11B1 minigene sequence from exons 6 to 9 (Fig. 2). The resultnt minigenes were trnsfected into COS-7 cells. Then, totl RNA ws isolted nd nlyzed by the RT-PCR method. We found tht the mutnt c G > A CYP11B1 minigene ws processed to two mjor incorrectly spliced products which were shorter thn the WT minigene (Fig. 2b). Sequence nlysis of the RT-PCR products fter subcloning into pgem -T Esy vector reveled tht one of the mutnt Tble 2 Sequences of oligonucleotide primers used for PCR mplifiction nd minigene construction Primer Sense Strnd Antisense Strnd CYP11B1_Exon GTTCTCCCATGACGTGATCCCTCT TCCAAAGGATGCAGAGTGCC 3 CYP11B1_Exon 2 5 TGGACAGGAGACACTTTGGAT 3 5 TCGCCGCTTACAGCAAGAAC 3 CYP11B1_Exon TGGGGACAAGGAGGATGGGATAC 3 5 TGGTGGAGAGGGAGAAATTGGG 3 CYP11B1_Exon 4 5 CGTGGGAAGATCCAGCCTCAG 3 5 GGAAGGTGAGGAATCCCCGAC 3 CYP11B1_Exon 5 5 AGGAGGAGGACACTGAAGGATG 3 5 AGGCAGGCTTGGCATCACC 3 CYP11B1_Exon 6 5 GGCTCTGTCGTTCTCAGGGTATGC 3 5 GGCGTTGAAGAGGGATTCCAGAG 3 CYP11B1_Exon 7 8 CYP11B1_Exon 9 CYP11B1_IVS7_construct 5 AGAGAGCACAGGAAGCCCCATC 3 5 GTTCCCCCTTCAGCATAATCTC AGTCGGATCCCTTGCTGATGACGCTCTTTG CAGTCCCACATTGCTCAAGC 3 5 GCCCTCGGGAGTTCCATTT GTACTCTAGAATGGCTCTGAAGGTGAGGAG - 3

4 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 4 of 7 c g>a/wt WT/c.421C>T (p.r141x) b Control Mutnt c g>a c.421c>t (p.r141x) Fig. 1 Muttion nlysis by direct DNA sequencing. Fmily tree. The rrow indictes our probnd. Both siblings crried compound heterozygous muttions; the point muttion t position bp 421 (c.421c > T) leds to the substitution of rginine to stop t mino cid position 141 (p.r141x), nd the bse chnge from G to A t the first position in intron 7 (c G > A or IVS7 + 1G > A). The fther is heterozygous for the c G > A muttion nd the mother is heterozygous for p.r141x. b Electropherogrms of the ptient nd helthy control frgments skipped the entire exon 7, while contining the full-length sequences of exons 6, 8, 9. The other mutnt PCR product skipped the exons 7 nd 8, while retining full-length sequences of exons 6 nd 9 (Fig. 2c). Discussion In this study, we hve described two severe CYP11B1 muttions found in two siblings dignosed with clssic 11β- OHD in fmily from Uzbekistn. Viriliztion nd hypertension re the min clinicl fetures of the clssic 11β- OHD. Despite inbility of ldosterone synthesis, overproduction of DOC, which is less potent minerlocorticoid, cuses slt retention nd hypertension. However, ffected newborns my hve mild, trnsient slt loss presumbly due to reltively high minerlocorticoids resistnce in the newborn period [11]. Signs of minerlocorticoid excess generlly correlte poorly with the degree of viriliztion in ffected girls [3]. Blood pressure is usully norml during infncy nd hypertension is often identified lter in toddlerhood or in childhood, lthough its presence in infncy ws demonstrted [12]. Most of the CYP11B1 muttions described to dte result in the clssic form of 11β-OHD. Unlike 21- hydroxylse deficiency, moleculr-genetic studies of 11β- OHD re reltively fewer, nd number of identified CYP11B1 muttions hve not been functionlly chrcterized [5, 13]. Therefore, the exct genotype-phenotype prediction of 11β-OHD hs not been well estblished. Previous studies showed tht in vitro ctivities less thn 5 % were considered severe nd consistent with clssic 11β-OHD [5, 13]. In this present study, we describe two siblings suffering from clssic 11β-OHD who were compound heterozygous for nonsense nd splice-site CYP11B1 muttions. The nonsense p. R141X is expected

5 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 5 of 7 WT Ex6 Ex7 Ex8 Ex9 IVS6 IVS7 IVS8 Mutnt c g Ex6 Ex7 Ex8 Ex9 IVS6 IVS7 IVS8 c a b WT MT bp -481 bp -283 bp c WT (560 bp) Mutnt (481 bp) Mutnt (283 bp) Fig. 2 (See legend on next pge.)

6 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 6 of 7 (See figure on previous pge.) Fig. 2 Minigene experiment. The scheme shows the set-up of the minigene constructs for the splicing nlysis in the WT nd mutnt expression vectors contining c G > A muttion (rrows). b COS-7 cells were trnsfected with the wild-type (WT)ormutnt(MT)minigeneconstructs. Totl RNA from the trnsfected cells were used for RT-PCR of CYP11B1 cdna. The figure shows the expected 560-bp PCR product from the WT construct nd two shorter incorrectly spliced products from the mutnt, sized 481 nd 283 bp on n grose gel. c Electropherogrms of the minigene PCR products. The 481 bp mutnt frgments skipped the entire exon 7, while contining the full-length sequences of exons 6, 8, 9. The 283 bp mutnt PCR product skipped the exons 7 nd 8, while retining full-length sequences of exons 6 nd 9. Blck lines indicted exon exon boundries to led to premture stop in the exon 3 nd yields truncted enzyme lcking the essentil residues for heme binding domin, consistent with our ptients clinicl phenotypes nd ner-completely bolished in vitro CYP11B1 ctivity in recent study [14]. In ddition, we identified previously described IVS7 + 1G > A muttion in CYP11B1 ffecting the consensus slice donor site of the exon 7. The minigene experiment confirmed tht this splice site muttion cused exon skipping (either complete loss of the exon 7 or both exons 7 nd 8). Most reported CYP11B1 muttions re locted in exons 6, 7, nd 8 nd 70 % of mino cid sequences in these exons re identicl in humn, ox, rt, nd mouse, suggesting tht exons 6 8 re essentil for the enzymtic ctivity of CYP11B1 [15]. Recently, Nguyen et l. [9] studied minigene experiment of this sme muttion. Nonetheless, the uthors designed shorter minigene construct which hd only exon 7, intron 7, nd exon 8. They found tht the IVS7 + 1G > A muttion cused n intron retention. Splicing errors re well recognized cuses of genetic diseses. Previous dt point to n estimted frequency of sequence vritions ffect pre-mrna splicing up to 50 % of the lleles cusing humn disese [16, 17]. Splice site nucleotide substitutions my result in skipping of the involved exon, intron retention, cretion of pseudo-exon within intron, usge of cryptic splice site, or combintion of severl of these [18, 19]. Hence, the design of minigene constructs is importnt to correctly identify the splicing effect of specific splice site muttions. Recent dt hve suggested tht cssette exon skipping is the most common lterntive splicing event in humns [19, 20]. To dte, +1G > A substitution t the 5 -splice donor site hs been identified in number of humn diseses [21]. Functionl studies of other +1G > A 5 -splice site muttions hve shown either recognition of 5 -cryptic splice site or exon skipping [22]. Therefore, we hve designed the minigene constructs including exons 6 9 nd introns 6 8 nd our results confirmed tht the IVS7 + 1G > A mutnt construct resultsinexonskipping.todte,thetherpiestomodulte RNA mis-splicing using ntisense oligonucleotide or smll molecules re emerging [19]. The understnding of definite genetic mechnism could expnd opportunities for gene therpy. Modultion of berrnt splicing trnscripts cn become novel therpeutic pproch for mny diseses cused by splice site defects. Conclusions In summry, we describe two compound heterozygous CYP11B1 muttions tht severely ffect norml protein structure explining severe phenotype of clssic 11βhydroxylse deficiency. Our findings suggest the muttion IVS7 + 1G > A cuses berrnt splicing of CYP11B1 leding to exon skipping. Our findings my help for better understnding of splice site muttion mechnism nd fcilitte the future new therpies trgeted on splicing modultion to tret humn disese. Abbrevitions 11β-OHD, 11β-hydroxylse deficiency; 17OHP, 17-hydroxyprogesterone; ACTH, drenocorticotropic hormone; CAH, congenitl drenl hyperplsi; DHEAS, dehydroepindrosterone sulfte; DOC, 11-deoxycorticosterone; gdna, genomic DNA; mrna, messenger RNA; MT, mutnt; nl, norml; PCR, polymerse chin rection; PRA, plsm renin ctivity; RT-PCR, reverse trnscription polymerse chin rection; WT, wild-type Funding This study ws supported by the Thilnd Reserch Fund grnt no.rsa (to T.S.), RTA (to V.S.), nd the Chullongkorn Acdemic Advncement into Its 2 nd Century Project. P.C. ws supported by the scholrship from the Grdute Scholrship to commemorte the 72 nd Anniversry of His Mjesty King Bhumibol Adulydej, Chullongkorn University. Avilbility of dt nd mterils All dt contined within the rticle. Authors contributions PC crried out the moleculr genetic studies nd drfted the mnuscript. The ptients were under the cre of VS 5. TS conceived the ide of the report nd drfted the mnuscript. PY, KS, TS, nd VS 2 prticipted in the writing, review of the literture, text editing nd finliztion of the mnuscript. All uthors red nd pproved the finl mnuscript. Competing interests The uthors declre tht they hve no competing interests. Consent for publiction Written informed consent ws obtined from the ptient s prent for publiction of this Cse report nd ny ccompnying imges. A copy of the written consent is vilble for review by the Editor of this journl. Ethics pprovl nd consent to prticipte All procedures were performed ccording to the Declrtion of Helsinki nd pproved by the Ethics Committee, Fculty of Medicine, Chullongkorn University. Written informed consent ws obtined from the ptient s prent for prticipte in this study. Author detils 1 Deprtment of Bioscience, Fculty of Science, Chullongkorn University, Bngkok 10330, Thilnd. 2 Excellence Center for Medicl Genetics, Deprtment of Peditrics, Fculty of Medicine, Chullongkorn University, Bngkok 10330, Thilnd. 3 Deprtment of Botny, Fculty of Science, Chullongkorn University, Bngkok 10330, Thilnd. 4 Center of Excellence for

7 Chrnwichi et l. BMC Endocrine Disorders (2016) 16:37 Pge 7 of 7 Medicl Genetics, King Chullongkorn Memoril Hospitl, Bngkok 10330, Thilnd. 5 Division of Peditric Endocrinology, Deprtment of Peditrics, Fculty of Medicine, Chullongkorn University, Bngkok 10330, Thilnd. Received: 17 Februry 2016 Accepted: 6 June 2016 References 1. Miller WL, Auchus RJ. The moleculr biology, biochemistry, nd physiology of humn steroidogenesis nd its disorders. Endocr Rev. 2011;32: Peter M, Jnzen N, Snder S, Korsch E, Riepe FG, Snder J. A cse of 11βhydroxylse deficiency detected in newborn screening progrm by second-tier LC-MS/MS. Horm Res. 2008;69: Nimkrn S, New MI. Steroid 11β-hydroxylse deficiency congenitl drenl hyperplsi. Trends Endocrinol Metb. 2008;19: Zhu YS, Cordero JJ, Cn S, Ci LQ, You X, Herrer C, et l. Muttions in CYP11B1 gene: phenotype-genotype correltions. Am J Med Genet A. 2003; 122A: Zho LQ, Hn S, Tin HM. Progress in moleculr-genetic studies on congenitl drenl hyperplsi due to 11β-hydroxylse deficiency. World J Peditr. 2008;4: Joehrer K, Geley S, Strsser-Wozk EM, Azziz R, Wollmnn HA, Schmitt K, et l. CYP11B1 muttions cusing nonclssic drenl hyperplsi due to 11βhydroxylse deficiency. Hum Mol Genet. 1997;6: Reisch N, Högler W, Prjes S, Rose IT, Dhir V, Götzinger J, et l. A dignosis not to be missed: nonclssic steroid 11β-hydroxylse deficiency presenting with premture drenrche nd hirsutism. J Clin Endocrinol Metb. 2013;98:E Mtsubr K, Ktok N, Ogit S, Sno S, Ogt T, Fukmi M, et l. Uniprentl disomy of chromosome 8 leding to homozygosity of CYP11B1 muttion in ptient with congenitl drenl hyperplsi: impliction for rre etiology of n utosoml recessive disorder. Endocr J. 2014;61: Nguyen HH, Eiden-Plch A, Hnnemnn F, Mlunowicz EM, Hrtmnn MF, Wudy SA, et l. Phenotypic, metbolic, nd moleculr genetic chrcteriztion of six ptients with congenitl drenl hyperplsi cused by novel muttions in the CYP11B1 gene. J Steroid Biochem Mol Biol. 2016; 155(Pt A): Sólyom RK, Péter F, Homoki J, Sippell WG, Peter M. Clinicl, hormonl nd moleculr genetic chrcteriztion of Hungrin ptients with 11βhydroxylse deficiency. J Peditr Endocrinol. 2001;2: Holcombe JH, Keenn BS, Nichols BL, Kirklnd RT, Clyton GW. Neontl slt loss in the hypertensive form of congenitl drenl hyperplsi. Peditrics. 1980;65: Mimouni M, Kufmn H, Roitmn A, Morg C, Sdn N. Hypertension in neonte with 11β-hydroxylse deficiency. Eur J Peditr. 1985;143: Prjes S, Loidi L, Reisch N, Dhir V, Rose IT, Hmpel R, et l. Functionl consequences of seven novel muttions in the CYP11B1 gene: four muttions ssocited with nonclssic nd three muttions cusing clssic 11β-hydroxylse deficiency. J Clin Endocrinol Metb. 2010;95: Zhng M, Liu Y, Sun S, Zhng H, Wng W, Ning G, et l. A prevlent nd three novel muttions in CYP11B1 gene identified in Chinese ptients with 11β-hydroxylse deficiency. J Steroid Biochem Mol Biol. 2013;133: Curnow KM, Slutsker L, Vitek J, Cole T, Speiser PW, New MI, et l. Muttions in the CYP11B1 gene cusing congenitl drenl hyperplsi nd hypertension cluster in exons 6, 7, nd 8. Proc Ntl Acd Sci U S A. 1993;90: Lopez-Bigs N, Audit B, Ouzounis C, Prr G, Guigo R. Are splicing muttions the most frequent cuse of hereditry disese? FEBS Lett. 2005;579: Wrd AJ, Cooper TA. The pthobiology of splicing. J Pthol. 2009;220: Desvit LR, Pérez B, Ugrte M. Minigenes to confirm exon skipping muttions. Methods Mol Biol. 2012;867: Scotti MM, Swnson MS. RNA mis-splicing in disese. Nt Rev Genet. 2016;17: Gerstein MB, Rozowsky J, Yn KK, Wng D, Cheng C, Brown JB, et l. Comprtive nlysis of the trnscriptome cross distnt species. Nture. 2014;512: Merke DP, Tjim T, Chhbr A, Brnes K, Mncill E, Bron J, et l. Novel CYP11B1 muttions in congenitl drenl hyperplsi due to steroid 11βhydroxylse deficiency. J Clin Endocrinol Metb. 1998;83: Smrnch L, Lorenzo-Betncor O, Arbelo JM, Ferrer I, Lorenzo E, Irigoyen J, et l. PINK1-linked prkinsonism is ssocited with Lewy body pthology. Brin. 2010;133(Pt4): Submit your next mnuscript to BioMed Centrl nd we will help you t every step: We ccept pre-submission inquiries Our selector tool helps you to find the most relevnt journl We provide round the clock customer support Convenient online submission Thorough peer review Inclusion in PubMed nd ll mjor indexing services Mximum visibility for your reserch Submit your mnuscript t