Novel and Established CYP2A6 Alleles Impair In Vivo Nicotine Metabolism in a Population of Black African Descent

Transcription

1 HUMAN MUTATION 0,1^10, 2008 RESEARCH ARTICLE Novel and Established CYP2A6 Alleles Impair In Vivo Nicotine Metabolism in a Population of Black African Descent Jill C. Mwenifumbo, 1 Nael Al Koudsi, 1 Man Ki Ho, 1 Qian Zhou, 1 Ewa B. Hoffmann, 1,2 Edward M. Sellers, 1 and Rachel F. Tyndale 1,2 1 Department of Pharmacology, University of Toronto, Toronto, Ontario, Canada; 2 Centre for Addiction and Mental Health, Toronto, Ontario, Canada Communicated by Ian N.M. Day Cytochrome P450 2A6 (CYP2A6) is a human enzyme best known for metabolizing tobacco-related compounds, such as nicotine, cotinine (COT), and nitrosamine procarcinogens. CYP2A6 genetic variants have been associated with smoking status, cigarette consumption, and tobacco-related cancers. Our objective was to functionally characterize four nonsynonymous CYP2A6 sequence variants with respect to their haplotype, allele frequency, and association with in vivo CYP2A6 activity. In vivo, nicotine was administered orally to 281 volunteers of Black African descent. Blood samples were collected for kinetic phenotyping and CYP2A6 genotyping. In vitro, nicotine C-oxidation catalytic efficiencies of heterologously expressed variant enzymes were assessed. The four uncharacterized sequence variants were found in seven novel alleles CYP2A6 * 24A&B, * 25, * 26, * 27, and * 28A&B; most were associated with impaired in vivo CYP2A6 activity. Nicotine metabolism groupings, based on the in vivo data of variant alleles, were created. Mean trans hydroxycotinine/cotinine (3HC/COT) differed (Po0.001) between normal (100%), intermediate (64%), and slow (40%) groups. Systemic exposure to nicotine following oral administration also differed (Po0.001) between normal (100%), intermediate (139%), and slow (162%) metabolism groups. In addition, alleles of individuals with unusual phenotype genotype relationships were sequenced, resulting in the discovery of five novel uncharacterized alleles and at least one novel duplication allele. A total of 7% of this population of Black African descent had at least one of the eight novel characterized alleles and 29% had at least one previously established allele. These findings are important for increasing the accuracy of association studies between CYP2A6 genotype and behavioral, disease, or pharmacological phenotypes. Hum Mutat 0,1 10, r 2008 Wiley-Liss, Inc. KEY WORDS: Black African descent; CYP2A6; genetic variation; nicotine metabolism; 3HC/COT INTRODUCTION Nicotine is the primary psychoactive substance implicated in tobacco dependence [Henningfield et al., 1985] and cytochrome P450 2A6 (CYP2A6) mediates the majority of its metabolic inactivation to cotinine (COT) [Messina et al., 1997; Nakajima et al., 1996a]. Cotinine is often used as a biomarker of tobacco exposure and its hydroxylation to trans-3 0 -hydroxycotinine (3HC) is also mediated, almost exclusively, by CYP2A6 [Dempsey et al., 2004; Nakajima et al., 1996b]. The gene for CYP2A6 is polymorphic ( cyp2a6.htm) (MIM] ). Although advances in the identification and characterization of CYP2A6 genetic variants have been made, gaps in this knowledge still exist, particularly in non- Caucasian and non-asian populations. It has become increasingly apparent that genetic variation in CYP2A6 contributes to the complexity of nicotine pharmacology [Malaiyandi et al., 2006], smoking etiology [Schoedel et al., 2004], and tobacco-related cancer risk [Fujieda et al., 2004]. For example, CYP2A6 variants that result in a decrease or a loss of enzyme function have been associated with smoking-related behaviors such as a decreased likelihood of being a current smoker [Iwahashi et al., 2004; Schoedel et al., 2004], lower cigarette consumption [Malaiyandi et al., 2006; Minematsu et al., 2006; Rao et al., 2000], and increased success in smoking cessation [Gu et al., 2000]. Of note, earlier studies did not uniformly find that CYP2A6 genotype associates with smoking behaviors [Carter et al., 2004]. Multiple The Supplementary Material referred to in this article can be accessed at suppmat. Received 9 May 2007; accepted revised manuscript 8 November Correspondence to: Rachel F.Tyndale, Rm 4326 Medical Sciences Building, 1 King s College Circle, University of Toronto, Toronto, Ontario, Canada, M5S 1A8. r.tyndale@utoronto.ca Grant sponsor: Canadian Institutes of Health Research (CIHR); Grant number: MOP-53248; Grant sponsor: Centre foraddiction and Mental Health. Jill C. Mwenifumbo and Nael Al Koudsi contributed equally to this work. DOI /humu Published online inwiley InterScience ( r 2008 WILEY-LISS, INC.

2 2 HUMAN MUTATION 0,1^10, 2008 factors could have contributed to the disparate findings between studies, such as variable phenotypes used, different outcome measures, and/or the fact that the earlier studies were done before many variant alleles were identified. As more alleles are discovered, we expect that CYP2A6 genotype and smoking behavioral phenotype associations will become stronger and concordance between studies will improve. Investigating CYP2A6 genetic variation is particularly important in populations of Black African descent given that African Americans have significantly higher rates of most smoking-related diseases [USDHHS, 1998] including lung cancer [Haiman et al., 2006]. In addition, this ethnoracial group has been understudied with respect to smoking etiology, nicotine kinetics, and the CYP2A6 gene. We conducted a CYP2A6 genetic and in vivo nicotine kinetic association study in a population of Black African descent. Our primary aim was to characterize four CYP2A6 nonsynonymous sequence variants, namely 594G4C (p.v110l) [Haberl et al., 2005], 1672T4C (p.f118l) [Solus et al., 2004], 2162_2163GC4A (R203frameshift [FS]) [Solus et al., 2004], and 5750G4C (p.e419d) [Saito et al., 2003], with respect to their haplotype, allele frequency, and in vivo functional impact. A secondary aim was to confirm whether established CYP2A6 alleles that have been predominately discovered and characterized in Caucasian and Asian populations have similar pharmacokinetic effects in a population of Black African descent. Overview MATERIALS AND METHODS We conducted a CYP2A6 genetic and nicotine kinetic study in current smokers (smoked at least 5 of 7 days) and nonsmokers (1 99 cigarettes during their lifetime but not during the study period), from a community-based population of Black African descent (N 5 281). The details of study recruitment, procedures, and pharmacokinetic analyses can be found in a previous report [Mwenifumbo et al., 2007]. Briefly, participants were interviewed regarding their smoking history and administered 4 mg of oral nicotine. The resulting nicotine, COT, and 3HC plasma levels were assessed by HPLC [Siu et al., 2006]. Participants received 100 Canadian dollars in compensation for their time. Both the University of Toronto ethics board and the Institutional Review Board Services (Canada) approved the study, which was conducted in accordance with the Declaration of Helsinki. In Vivo CYP2A6 Phenotyping The hydroxylation of COT to 3HC is mediated solely by CYP2A6 as determined in vivo [Dempsey et al., 2004; Yamanaka et al., 2004] and in vitro [Nakajima et al., 1996b]. In vivo, in persons homozygous for the CYP2A6 deletion, no 3HC is detected in the urine [Yamanaka et al., 2004]. The 3HC/COT ratio correlates well with the fractional conversion of nicotine to COT [Dempsey et al., 2004] and is associated with the CYP2A6 genotype in Caucasians [Benowitz et al., 2006b; Malaiyandi et al., 2006]. Among the participants in this study the plasma 3HC/COT ratio derived from ad libitum smoking was highly correlated with the ratio at 270 minutes (Spearman s rho , Po0.001) after 4 mg of oral nicotine [Mwenifumbo and Tyndale, 2007]. The 3HC/ COT ratio (measured at 270 minutes) and the estimated nicotine area under the concentration time curve (AUC) (over 360 minutes) were used as proxy measures of CYP2A6 activity and nicotine disposition kinetics, respectively [Dempsey et al., 2004; Mwenifumbo et al., 2007]. Participant Description Recruitment was stratified to achieve nearly equal numbers with respect to gender (47% male) and smoking status (49% smoker). Participants had a median age of 33 years (range, years). Smokers reported smoking at least 5 of 7 days and a median of eight cigarettes per day (range, 0 35 cigarettes). Nonsmokers had baseline breath CO levels below 10 ppm. Genetic analysis was conducted on 280 of the 281 because one DNA sample failed to amplify in the genotyping assays. Associative genetic/kinetic analyses were conducted on 270 participants with reliable genetic and pharmacokinetic data [Mwenifumbo et al., 2007]. CYP2A6 Genotyping Assays were developed for four uncharacterized nonsynonymous sequence variants found in the literature, namely 594G4C (p.v110l), 1672T4C (p.f118l), 2162_2163GC4A (p.r203fs), and 5750G4C (p.e419d). Alleles that would likely occur at a frequency of 41% and alter nicotine metabolism, CYP2A6 1B, 1B15, 2, 7, 8, 9, 10, 12, 16, 21, and 23, were genotyped as previously described [Al Koudsi et al., 2006; Ho et al., 2008; Mwenifumbo et al., 2005; Mwenifumbo et al., 2008; Schoedel et al., 2004]. We modified the assay for CYP2A6 4A&D and developed the first and second steps of PCR-based genotyping assays for CYP2A6 14, 15, 20, and 2162_2163GC4A (p.r203fs). The first step for CYP2A6 2 was used for 594G4C (p.v110l) and 1672T4C (p.f118l) genotyping assays [Goodz and Tyndale, 2002]. The first step for CYP2A6 1B was used for CYP2A6 17 and 5750G4C (p.e419d) genotyping assays [Mwenifumbo et al., 2008]. Primers and conditions utilized for all modified or novel genotyping assays are shown in Supplementary Tables S1, S2, and S3 (available online at All new PCR-based genotyping assays were developed using cosmids containing genomic clones of CYP2A6 as a positive control and CYP2A7 and CYP2A13 as negative controls [Hoffman et al., 2001; Rao et al., 2000]. Sequencing Genomic DNA was amplified (9.2 kb) according to a long PCR protocol (Supplementary Tables S1, S2, and S3). This region spanned from 1.4 kb upstream to 7.8 kb downstream of the 11 ATG start site, on reference genomic sequence NG_ The long PCR product was subcloned into a pcr-xl-topo vector (TOPO XL PCR Cloning s Kit; Invitrogen, Burlington, Canada) and sequenced utilizing a walk-on strategy (The Centre for Applied Genomics, Toronto, Canada). Sequencing of the long PCR products was used to validate the genotyping assays and to determine the haplotype of alleles containing the uncharacterized sequence variants. The variant CYP2A6 genes, from seven individuals with the uncharacterized sequence variants, were sequenced: two 594G4C (p.v110l), two 1672T4C (p.f118l), the one 2162_2163GC4A (p.r203fs), and two 5750G4C (p.e419d). In addition, the variant gene was fully sequenced from a person with the 6960_6961insGAAAAG, which is found in the 3 0 -flanking region and is the variant detected by the CY- P2A6 1B15 assay. Both alleles from nine individuals with established CYP2A6 alleles were also sequenced as their genotype to phenotype relationships were discordant: two with the genotype CYP2A6 2, four CYP2A6 4, one CYP2A6 4/ 9, one CYP2A6 9, and one CYP2A6 17. Data from these nine individuals was not included in subsequent analyses.

3 HUMAN MUTATION 0,1^10, CYP2A6 Activity Grouping Strategy Our grouping strategy for the normal, intermediate, or slow nicotine metabolism groups was based on the in vivo 3HC/COT ratio as follows. Individuals with one or two CYP2A6 14 alleles were included in the normal group. Alleles were considered decrease-of-function (D) if they were associated with modestly reduced 3HC/COT in vivo. Alleles were considered loss-offunction (L) if they had dramatically reduced 3HC/COT in vivo. Specifically, decrease-of-function alleles were CYP2A6 9, 21, and the novel 25 allele. Loss-of-function alleles were CYP2A6 17, 20, 23, and the novel 24, 26, 27, and 28 alleles. Individuals in the intermediate group had one D allele and the slow group had two D alleles, one or two L alleles, or the combination of one L and one D allele. CYP2A6 Construct Heterologous Expression and Nicotine C-Oxidation Assay Bicistronic constructs encoding hepatic NADPH-cytochrome P450 reductase (hnpr) and CYP2A6.1,.17,.24,.25,.26,.27 or.28 were expressed in Escherichia coli and membrane fractions were prepared as previously described [Ho et al., 2008; Pritchard et al., 1997]. The amount of CYP2A6 protein in the membrane fractions was determined by immunoblotting with a monoclonal CYP2A6 antibody (BD Biosciences, Mississauga, ON, Canada) using supersome expressed CYP2A6 (BD Biosciences) as a positive control for quantification as previously described [Ho et al., in press; Schoedel et al., 2003]. The function of the expression construct was confirmed by immunoblotting for hnpr. Nicotine C-oxidation was determined as previously described [Ho et al., in press; Siu et al., 2006]. Briefly, concentrations of 30 mm (Km) and 300 mm (Vmax) of nicotine were used to screen for catalytic activity and the amount of cotinine formed was detected by HPLC. Statistics Chi-square was used to assess Hardy-Weinberg equilibrium and Fisher s exact test was used when expected cell size was less than or equal to five for the genotype data. The Mann-Whitney U test was used to assess the difference between two groups for the in vitro kinetic data. For in vivo kinetic data, the 3HC/COT ratio and the nicotine AUC were log-transformed for statistical analyses. Univariate analysis of variance (ANOVA) was used to assess the equality of multiple group means and Bonferroni s test was used for multiple-comparison corrections. All P-values are one-tailed. Because smoking status and gender alter CYP2A6 activity, they were included as covariates in statistical analyses [Benowitz et al., 2006a; Dempsey et al., 2004; Mwenifumbo et al., 2007]. In all figures the 3HC/COT ratio was adjusted by smoking status and gender means. The nicotine AUC was adjusted by the smoking status mean. All analyses were done on SPSS software version for Macintosh (SPSS Inc., Chicago, IL). RESULTS Novel CYP2A6 Alleles Genotype assays were developed for four uncharacterized polymorphisms: 594G4C (p.v110l), 1672T4C (p.f118l), 2162_2163GC4A (p.r203fs), and 5750G4C (p.e419d). Eight novel alleles, CYP2A6 24A&B, 25, 26, 27, 28A&B, and 1B17, were found through the sequencing of individuals with at least one of the above-mentioned uncharacterized sequence variants (Table 1A). Sequencing alleles with 594G4C (p.v110l) led to the discovery of two novel alleles, CY- P2A6 24A&B. Both contain 594G4C (p.v110l), 6458A4T (p.n438y), and the 58-bp CYP2A untranslated region (UTR) gene conversion, which is found in all CYP2A6 1B alleles (Table 1A). Of interest, one individual with the CYP2A6 24 allele had at least three copies of the CYP2A6 gene (CY- P2A6 24/ 25; see Table 2). Sequencing alleles containing 1672T4C (p.f118l) resulted in the discovery of two novel alleles, CYP2A6 25 and CYP2A6 26. CYP2A6 25 contains one nonsynonymous sequence variant 1672T4C (p.f118l) while CYP2A6 26 contains three nonsynonymous sequence variants 1672T4C (p.f118l), 1703G4T (p.r128l), and 1711T4G (p.s131a) (Table 1A). Sequencing an allele with 2162_2163GC4A (p.r203fs) lead to the discovery of the novel allele CYP2A6 27 that contains both 1672T4C (p.f118l) and 2162_2163GC4A (p.r203fs) (Table 1A). Alleles positive for 5750G4C (p.e419d) were sequenced and resulted in the finding of two novel alleles CYP2A6 28A&B. CYP2A6 28A consists of two nonsynonymous sequence variants, 5745A4G (p.n418d), 5750G4C (p.e419d), and the 58-bp CYP2A7 gene conversion in the 3 0 -UTR. CYP2A6 28B is similar but also contains the 6960_6961insGAAAAG in the 3 0 -flanking region (Table 1A). Sequencing an allele positive for the 6960_6961insGAAAAG lead to the discovery of another novel allele CYP2A6 1B17 (Table 1A). The frequencies of these novel alleles are reported in Table 3. There was no difference in the in vivo mean 3HC/COT between the three major wild type genotypes CYP2A6 1A/ 1A, 1A/ 1B, and 1B/ 1B, so they were combined as a CY- P2A6 1 reference group (Table 2). CYP2A6 24 heterozygotes had 50% activity, as assessed by the 3HC/COT ratio, CYP2A6 25 heterozygotes had 75% activity, and CY- P2A6 26 heterozygotes had 55% activity (Table 2; Fig. 1). The individual with CYP2A6 27 also had CYP2A6 17 and consequently had very poor activity. CYP2A6 28 heterozygotes had 46% activity, while the CYP2A6 20/ 28 individual had only 18% in vivo activity. Established CYP2A6 Alleles Frequencies of established CYP2A6 alleles are reported in Table 3. CYP2A6 9, 17, 20, 21, and 23 were all associated with lower in vivo CYP2A6 activity (Table 2; Fig. 1). CYP2A6 17 exhibited the predicted gene-dose effect (Table 2). CY- P2A6 14 heterozygotes did not have significantly different CYP2A6 activity compared to the CYP2A6 1 group (Table 2; Fig. 1). CYP2A6 12, 15, and 16 were not detected in this population (Table 3); however, this was not unexpected given their low frequencies in other populations of Black African descent [Nakajima et al., 2006; Schoedel et al., 2004]. Some individuals with established CYP2A6 alleles, particularly those that have been discovered and characterized in Caucasian and Asian populations, had unexpected in vivo pharmacokinetics; thus, sequencing of both alleles from these individuals (two with the genotype CYP2A6 2, four CYP2A6 4, one CY- P2A6 4/ 9, one CYP2A6 9, and one CYP2A6 17) was performed. Several novel alleles were identified through this sequencing approach including, CYP2A6 1K, CYP2A6 31A&B (Table 1B). Substantial sequence variation was found in the five individuals with CYP2A6 4 deletion alleles; we identified the novel CYP2A6 4E and CYP2A6 4F alleles that had extensive sequence variation in both the noncoding and coding sequence (Table 1B). What is more, two CYP2A6 4 heterozygotes with

4 4 HUMAN MUTATION 0,1^10, 2008 TABLE 1. Novel Characterized and Novel Uncharacterized Alleles Novel alleles Genomic nucleotide changes (g.) a change y Amino acid A. Novel Characterized Alleles CYP2A6 1B17 51G4A;1620T4C;1646C4T; 2296C4T; 2483G4A; 2994T4C; 3788C4T; 4071delA; 4636A4C; 4850C4T; 4977C4T; 5668A; 6143C4A; 58bp gene conversion in the 3 UTR; 6782C4G; 6832A4G; 6835C4A; 6935_6936insCACTT; 6960_6961insGAAAAG; 6989A4G; 7160A4G CYP2A6 24A 1301A4C; 1289G4A; 1013A4G; 51G; 578A4G; 594G4C;720G4A;1137C4G;1620T4C; 2483G4A; 3225A4G; 5668A; 6218A4G; 6282A4G; 6293T4C; 6354T4C; 6458A4T; 58-bp gene conversion in the 3Ł UTR; 6782C4G; 7160A4G CYP2A6 24B 1301A4C; 1289G4A; 1013A4G; 51G; 578A4G; 594G4C;720G4A;1137C4G;1381_1382CT4TC; 1481_1486delCTCTCT;1620T4C; 2483G4A; 3225A4G; 5668A; 6218A4G; 6282A4G; 6293T4C; 6354T4C; 6458A4T; 58-bp gene conversion in the 3Ł UTR; 6782C4G; 7160A4G CYP2A A4C; 1289G4A; 745A4G; 22C4T; 51G;768A4T; 1620T4C;1165G4A; 1672T4C;2296C4T; 2483G4A; 2605G4A; 2921G4A; 2994T4C; 4636A4C; 5668A; 6586T4C; 6692C4G; 7160A4G CYP2A A4C; 1289G4A; 745A4G; 22C4T; 51G;1165G4A;1620T4C; 1672T4C;1703G4T; 1710C4T; 1711T4G; 2296C4T; 2483G4A; 2994T4C; 4071delA; 4636A4C; 5668A; 6115C4T; 6586T4C; 6692C4G; 7160A4G CYP2A A4C; 1289G4A; 745A4G; 22C4T; 51G;1620T4C; 1672T4C; 2162_2163GC4A; 2296C4T; 2483G4A; 2994T4C; 3872G4A; 4071delA; 4636A4C; 5668A; 5857T4A; 6586T4C; 6692C4G; 7160A4G CYP2A6 28A 1269T4C; 51G4A;656G4T; 1620T4C; 4681T4G; 5668A; 5738C4T; 5745A4G; 5750G4C;6354T4C; 6361C4A; 6385G4T; 6389C4G; 6390T4C; 58-bp gene conversion in the 3Ł UTR; 6782C4G; 7160A4G CYP2A6 28B 1269T4C; 51G4A;656G4T; 1381_1382CT4TC;1481_1486delCTCTCT;1620T4C; 4681T4G; 5668A; 5738C4T; 5745A4G; 5750G4C; 6354T4C; 6361C4A; 58-bp gene conversion in the 3Ł UTR; 6960_6961insGAAAAG;7160A4G V110L; N438Y V110L; N438Y F118L F118L; R128L; S131A F118L; R203FS N418D; E419D N418D; E419D B. Novel Uncharacterized Alleles CYP2A6 1K CYP2A6 4E b CYP2A6 4F b CYP2A6 31A CYP2A6 31B 1301A4G; 1289G4A; 1199_ 1198ins316bpAluYa5; 686A4G; 51G;431C4T; 1620T4C; 1779G4A; 2483G4A; 2994T4C; 3378C4T; 3904G4A; 4074delA; 5668A; 6354T4C; 6952G4A; 7160A4G 1399A4G; 1394T4C; 933G4A; 911C4T; 908_ 907ins GTTCTTTGTAAATTA; 834C4A; 447T4C; 460T4A; 469T4C; 496T4C; 600C4T; 810G4C; 816C4T; 875C4T;1494G4A;1532C4A;1569C4G; 1572G4C; 1589C4T; 1622T4G; 1629_1630TG4CT; 1696T4G;1834C4G;1907T4C; 1980T4G; 2282G4C; 2316A4C; 2342T4C; 2348A4G; 2382G4A; 2489G4A; 2583C4A; 2586C4T; 2682A4C; 2781G4C; 2984C4T; 3001C4T; 3441A4G; 3479G4A; 3730_3731GA4CC; 4014C4A; 4032A4G; 4317C4T; 4599C4G; 4615T4C; 4738G4T; 4772A4G; 5451C4T; 5461A4C; 5463T4C; 5471C4T; 5499delC; 5504G4T; 5506C4A; 5509_5510insG; 6276C4G; 6469T4G; 6668C4G;7160A4G 1399A4G; 1394T4C; 1242G4C; 933G4A; 911C4T; 908_^907insGTTCTTTGTAAATTA; 834C4A; 823C4T; 447T4C; 726delA; 2342T4C; 2348A4G; 2619T4C; 3166A4C; 3441A4G; 3538G4C; 3730_3731GA4CC; 4032A4G; 4599C4G; 4738G4T; 4772A4G; 5451C4T; 5461A4C; 5463T4C; 5471C4T; 5499delC; 5504G4T; 5506C4A; 5509_5510insG; 6469T4G; 6668C4G;7160A4G;7658T4C 1289G4A; 1013A4G; 492_ 470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGAATCTG; 51G; 16A4C;1339C4G;1620T4C; 2721G4A; 2994T4C; 3225A4G; 3315C4T; 5668A; 6692C4G; 7160A4G; 7568C4T 1289G4A; 1013A4G; 975T4C; 492_ 470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGAATCTG; 16A4C; 51G; 467C4T; 1339C4G;1620T4C; 2721G4A; 2994T4C; 3225A4G; 3315C4T; 4074delA; 5668A; 6692C4G; 7160A4G F61I; C64R; A117V; L128R; A131S; S153A; D169E; H274R; R311C; V479G H274R; V479G M6L M6L y DNA numbering is relative to 11 ATG start site on the reference genomic sequence NG_ as is common for this gene (51G and 5668A are considered wild type). Protein numbering is relative to the CYP2A6 NP_ reference protein sequence. Sequencing gaps in non coding regions may exist. a Genomic nucleotide changes in bold are found in exons. b Numbering is relative to 11 ATG start site on the CYP2A7 reference genomic sequence NG_ and protein numbering is relative to the NP_ reference protein sequence. Genomic nucleotidechanges in italics have numbering based on the CYP2A6 reference genomic sequence in the CYP2A7/CYP2A6 hybrid allele. higher activity both had at least three alleles representing novel duplication alleles. These novel alleles will be characterized in future studies. CYP2A6 Genotype as a Predictor of CYP2A6 Activity and Nicotine Metabolism Due to the large number of low prevalence alleles, the utility of grouping genotypes for gene association studies was examined, as we have done previously for CYP2A6 in Caucasians [Benowitz et al., 2006b] and as is common for CYP genes [Gaedigk et al., 2007]. Based on CYP2A6 genotype and in vivo 3HC/COT phenotype relationships, individuals were grouped in normal, intermediate, or slow nicotine metabolism groups. The three groups were associated with altered CYP2A6 activity, as assessed by 3HC/COT (F , degrees of freedom [df] 5 2, Po0.001) (Fig. 2A). The normal, intermediate, and slow metabolism groups had mean in vivo CYP2A6 activities of (100%), (64%), and (40%), respectively. Moreover, using a difference measure of nicotine metabolism capacity, the three groups were associated with the extent of the body s exposure to nicotine, as assessed by the nicotine AUC (F , df 5 2, Po0.001) (Fig. 2B). The normal, intermediate, and slow metabolism groups had mean nicotine AUCs of 1,38171,115 (100%), 1,92171,169 (139%), and 2,23171,421 (162%) ng/ml/ min, respectively. Novel Variants In Vitro Nicotine Catalytic E ciency To determine the functional impact of the nonsynonymous sequence variants found in the novel characterized alleles, the levels of expressed CYP2A6 and resulting nicotine C-oxidation catalytic efficiency of the variant proteins were assessed. Neither CYP2A6.26 (p.f118l, p.r128l, and p.s131a) nor CYP2A6.27 (p.f118l and p.r203fs) made appreciable levels of cotinine, while clearly expressing hnpr from the bicistronic construct

5 HUMAN MUTATION 0, 1^10, TABLE 2. CYP2A6 Genotypes andtheir Mean InVivo adjusted 3HC/COT y Allele Genotype N Mean 3HC/COT SD % Mean F (P) CYP2A6 1 CYP2A6 9 CYP2A6 14 CYP2A6 17 CYP2A6 20 CYP2A6 21 CYP2A6 23 CYP2A6 24 CYP2A6 25 CYP2A6 26 CYP2A6 28 Two or more di erent variant alleles 1A/ 1A (0.29) 1A/ 1B B/ 1B (o0.001) / (0.36) / 14 a (o0.001) / (0.01) (0.03) a (0.04) / 23 a (0.03) (0.20) (0.02) (0.05) / / / / ^ 9 20/ / ^ 18 24/ 25 b ^ 66 y Genotypes for each allele were found to be in Hardy-Weinberg equilibrium. F represents the F statistic, which is a value used in ANOVA. a If the homozygote group contained N 51 then it was combined with the heterozygote group for statistical analyses. b This individual was found, through sequencing, to have at least three CYP2A6 genes. TABLE 3. CYP2A6 Allele Frequencies Alleles Alleles N (frequency %) Total alleles (N) CYP2A6 1B a 110 (19.8) 556 CYP2A (7.2) 558 CYP2A (0) 560 CYP2A (0.9) 560 CYP2A (0) 560 CYP2A (0) 560 CYP2A (7.3) 560 CYP2A (1.1) 560 CYP2A (0.7) 560 CYP2A (2.0) 560 CYP2A (1.3) 560 CYP2A (0.5) 560 CYP2A (0.7) 560 CYP2A (0.0) 560 CYP2A (0.9) 560 a Four CYP2A6 * 1B17 were found and are included in the CYP2A6 * 1B group. (Fig. 3). Compared to wild type (CYP2A6.1) the rate of cotinine formation per picomole of expressed CYP2A6 at Vmax was 92% for CYP2A6.24 (p.v110l and p.n438y), 90% for CYP2A6.25 (p.f118l), and 91% for CYP2A6.28 (p.e419d and p.n418d) (Fig. 3). CYP2A6 * 28 Confounds SomeTraditional Genotyping Assays CYP2A6 28 confounds some traditional genotyping assays. Specifically, the CYP2A6 28A allele can result in the overestimation of CYP2A6 4A and 4D, which are CYP2A7/CYP2A6 hybrid deletion alleles. Fig. 4 illustrates how this can occur. Fig. 4A is a schematic of CYP2A6 4D, in which the entire 5 0 region is CYP2A7 until midway through exon 9, where CYP2A6 sequence begins. In the original PCR-based CYP2A6 4A&D assay [Oscarson et al., 1999], the first step amplifies both the wild type CYP2A6 and the CYP2A6 4A or 4D deletion alleles (Fig. 4A). The original second step primer 2A7ex8F was intended to specifically identify the CYP2A6 4A or 4D deletion alleles by annealing to CYP2A7 sequence in exon 8 (Fig. 4A). However, the CYP2A6 28 variant nucleotides 5738 T, 5745G, and 5750C are the wild type nucleotides in CYP2A7 and are located where the 2A7ex8F primer anneals (Fig. 4B). Therefore, CYP2A6 28A results in a false-positive amplification for the CYP2A6 4A and 4D alleles (Fig. 4B). In this population, using the original CYP2A6 4A&D assay, eight individuals with the CY- P2A6 4A&D genotype were detected. Two of the eight were actually CYP2A6 28A, meaning initially there was a 33% overestimation of the CYP2A6 4A and 4D alleles. We have redesigned the CYP2A6 4A&D assay as seen in Supplementary Tables S1, S2, and S3. As illustrated in Fig. 4C, the CYP2A6 28B allele also confounds any original genotyping assays, such as CYP2A6 1B, 5, 7, 8, and 10, that use the 2A6R2 primer. A CYP2A7 gene conversion in the 3 0 -flanking region of CYP2A6, found in CYP2A6 28B, results in DNA variation where the 2A6R2 primer is designed to selectively anneal to CYP2A6 sequence. This DNA variation results in amplification failure when using this particular reverse primer. Of note, CYP2A6 1B17 also has this 3 0 -flanking region variation (i.e., 6960_6961insGAAAAG). Consequently, the frequency of one allele is underestimated while the allele on the opposing chromosome is overestimated.

6 6 HUMAN MUTATION 0,1^10, 2008 FIGURE 1. 3HC/COTvaries with CYP2A6 genotype. Open circles represent individual data and lines denote group means. FIGURE 2. Normal, intermediate, and slow metabolism groups were associated with in vivo CYP2A6 activity and the extent of the systemic exposure to oral nicotine. Individuals were grouped in either the normal (white bars) (N 5165), intermediate (gray bars) (N 5 33), or slow (black bars) (N 5 61) metabolism groups. A: In a univariateanova model, in which smoking status and gender were covariates, the normal metabolism group had higher mean 3HC/COTcompared to the intermediate (Po0.001) and slow (Po0.001) metabolism groups. B: The normal metabolism group had lower nicotine AUC compared to the intermediate (Po0.01) and slow (Po0.001) groups in a univariate ANOVA model in which smoking status was a covariate. Po0.01 and Po0.001 compared to normal metabolism group. DISCUSSION In this population of Black African descent, 7% had at least one of the novel alleles characterized here and 29% had at least one established allele (excluding CYP2A6 1B). Our data demonstrates the importance of determining haplotypes for uncharacterized CYP2A6 nonsynonymous sequence variants and highlights the usefulness of reassessing both the genotyping assays and the in vivo functional impact of variant alleles in distinct ethnoracial groups. Moreover, through sequencing, 26 new CYP2A6 DNA sequence variations (Supplementary Table S4) and 13 novel alleles, including two novel deletion hybrid CYP2A7/CYP2A6 alleles, were described (Table 1A and B). The novel CYP2A6 24 allele had two nonsynonymous sequence variants, Val110, which is located within substrate recognition site one (SRS1) and may alter the active site cavity, and Asn438, which is adjacent to the heme binding amino acids Arg437 and Cys439 [Lewis, 2003]. The novel CYP2A6 25 allele

7 HUMAN MUTATION 0,1^10, FIGURE 3. Levels of CYP2A6 and in vitro nicotine C-oxidation catalytic activity for heterologously expressed CYP2A6.24,.25,.26,.27, and.28 compared to wild type CYP2A6.1. A: Immunoblots showing both hnpr and CYP2A6 expression from the bicistronic expression constructs. CYP2A6.27 (the predicted truncated protein) was not detected while the other constructs clearly expressed CYP2A6 protein. B: Per picomole of expressed immunodetected CYP2A6, neither CYP2A6.26 nor.27 formed appreciable amounts of cotinine at either 30 mm (Km) or 300 mm (Vmax), while CYP2A6.24,.25, and.28 were not signi cantly di erent from CYP2A6.1. Po0.05. had one nonsynonymous sequence variant, Phe118, which is predicted to be involved in stabilizing the compact structure of the enzyme and formation of the active site [Yano et al., 2005]. The novel CYP2A6 26 allele had three nonsynonymous sequence variants; of these, Arg128 has been demonstrated to be important in maintaining the holoenzyme s ordered structure [Kitagawa et al., 2001]. The novel CYP2A6 27 allele had two nonsynonymous sequence variants, one of which, 2162_2163GC4A, causes a frameshift and introduces a stop codon in exon five. The novel CYP2A6 28 allele had two nonsynonymous sequence variants. In vivo 3HC/COT data suggests that the novel alleles, CYP2A6 24, 26, 27, and 28, are likely to be loss-of-enzyme function alleles, while CYP2A6 25 results in a decrease of enzyme function. In vitro data suggests that CYP2A6.26 and CYP2A6.27 result in a complete loss of catalytic activity, while CYP2A6.24,.25, and.28 appear to have nicotine C-oxidation catalytic activity similar to the wild type. CYP2A6.27 is predicted to be a truncated form of the enzyme. It was not detected by Western blotting, while hnpr from the same bicistronic construct was. This indicates that the expression system was functional and suggests that the truncated protein was either degraded or that no CYP2A6 antibody epitopes were present. There are several possible explanations for the apparent discordance between in vivo and in vitro data for CYP2A6 24, 25, and 28. First, our in vitro assay is designed to test differences in the catalytic efficiency of nicotine C-oxidation per unit of CYP2A6 detected and not the stability of the holoenzyme. Second, some of the novel alleles contain 5 0 flanking region sequence variants that have been demonstrated to result in decreased expression in a reporter construct system. Specifically, 1013A4G disrupts a putative enhancer region [Pitarque et al., 2004], and 745A4G disrupts a CCAAT box [von Richter et al., 2004]. Both of these sequence variants may result in lower in vivo protein level and thus lower in vivo 3HC/COT ratio. Additionally, it is possible that these amino acid changes in these three alleles may alter substrate metabolism selectively, such that COT hydroxylation to 3HC metabolism is impaired while nicotine C-oxidation is unchanged. CYP2A6 1B contains a 58-bp CYP2A7 gene conversion in the 3 0 UTR and is associated with greater CYP2A6 activity and nicotine clearance in Caucasians [Mwenifumbo et al., in press].

8 8 HUMAN MUTATION 0,1^10, 2008 FIGURE 4. CYP2A6 28A confounds the traditional CYP2A6 4A&D assay. A: This schematic shows the CYP2A6 4D deletion, CYP2A7/CYP2A6 hybrid allele; the 5 0 region is composed of the CYP2A7 sequence until midway through exon 9, where it becomes the CYP2A6 sequence. B: CYP2A6 28A has the 5738C4T, 5745A4G, 5750G4C sequence variants in exon 8 (black bars). C: CY- P2A6 28B also has the 6960_6961insGAAAAG/CYP2A7 gene conversion in the noncoding anking region (gray box). Arrows represent primers.the dashed line between two primers represents the region of the gene that is PCR ampli ed if both primers successfully anneal to the genomic DNA. However, in this population of Black African descent, the CYP2A6 1B allele was not associated with higher activity. One likely possibility is that unidentified decrease-of-function polymorphisms exist in linkage with the CYP2A6 1B allele confounding interpretation; this is currently under investigation. The established alleles CYP2A6 9, 17, 20, 21, and 23 all resulted in decrease- or loss-of-function CYP2A6 activity. CYP2A6 9 contains a T4G sequence variant in the TATA box that decreases transcription by approximately 50% in vitro [Pitarque et al., 2001]. CYP2A6 17 results in an amino acid change p.v365 M in exon 7. In vitro [Fukami et al., 2004] and in vivo [Nakajima et al., 2006], this allele causes impaired nicotine metabolism and our study confirms these findings. CYP2A6 20 results in a p.k196fs that leads to a stop codon, and thus no functional protein is produced [Fukami et al., 2005]. The current study identified six individuals with the CYP2A6 20 allele and demonstrated substantially lower CYP2A6 activity, supporting the predicted loss-of-function. CYP2A6 23 was first discovered in this population of Black African descent [Ho et al., in press]; it results in an amino acid change p.r203c in exon 4 that impairs both in vitro and in vivo CYP2A6 activity. Among individuals with established CYP2A6 alleles but unexpected in vivo 3HC/COT, we report five novel alleles that remain to be characterized with respect to frequency and functional impact. The CYP2A6 1K allele contains a 316-bp AluYa5 repeat inserted into the 5 0 flanking region of the gene. Alu elements can potentially function in regulation of gene expression [Hasler et al., 2007]. The CYP2A6 29 allele contains a nonsynonymous 16A4C (p.m6l) sequence variant in the membrane-anchoring region in exon 1 [Haberl et al., 2005]; this specific nucleotide change has a frequency of 1.2% in a population of Black African descent [Haberl et al., 2005]. CYP2A6 4 is a CYP2A7/CYP2A6 hybrid allele in which most of the CYP2A6 gene is deleted (Fig. 4A) and it is thought to result in a complete loss-of-function due to a lack of functional enzyme production [Yoshida et al., 2002]. CYP2A6 and CYP2A7 are homologous genes and the proteins produced share 93% amino acid identity. CYP2A7 is thought to be a pseudogene because it does not incorporate a heme molecule [Ding et al., 1995] but there is considerable genetic variation in CYP2A7 and consequently it is possible that polymorphisms could result in an active CYP2A7 gene or an active CYP2A6 4 (CYP2A7/CYP2A6 hybrid) allele. CYP2A6 4E&F are examples of the heterogeneity found among the sequenced deletion alleles. In addition, two of the five individuals with deletion alleles sequenced had at least three copies of the CYP2A6 gene. In total, three individuals with more than two copies of the CYP2A6 gene were discovered; these alleles were not the known duplication alleles CYP2A6 1X2A or CYP2A6 1X2B [Fukami et al., 2007; Rao et al., 2000], suggesting that novel duplication alleles exist. As illustrated in Fig. 1, interesting kinetic outliers, with both exceptionally slow and fast CYP2A6 activity, were observed in this population. This is most likely due to a combination of several genetic and nongenetic factors. As convention, the wild type CYP2A6 1 allele is assigned based on the absence of genotyped variants, but it may contain as yet unidentified variants. We believe that much of the variation in the CYP2A6 1 group is due to additional genetic variation in this population, some of which has been identified here, but has not yet been characterized. In addition, several other factors contribute to the interindividual differences in CYP2A6 levels. For instance, levels of the constitutive androstane receptor and hepatocyte nuclear factor 4 alpha have been correlated with CYP2A6 mrna levels [Wortham et al., 2007]. Differential exposure to CYP2A6 inducers (e.g., rifampicin and cadmium) [Pichard-Garcia et al., 2000; Satarug et al., 2004] or inhibitors (e.g., dietary constituents such as broccoli) [Hakooz and Hamdan, 2007] may also modulate CYP2A6 levels. Women have faster nicotine clearance [Benowitz

9 HUMAN MUTATION 0,1^10, et al., 2006a]. Smoking results in slower nicotine metabolic clearance [Benowitz and Jacob, 2000]. All of the above-mentioned likely contribute to the large interindividual variation in nicotine metabolic activity within CYP2A6 genotype groups. Given the large contribution of CYP2A6 to the metabolism of nicotine, higher CYP2A6 activity (3HC/COT ratio) results in increased first-pass nicotine metabolism, as well as faster nicotine clearance, and is reflected in a smaller systemic exposure to oral nicotine (nicotine AUC) [Mwenifumbo et al., 2007]. Here, we confirmed that normal, intermediate, and slow nicotine metabolism groups are associated with both CYP2A6 activity and the systemic exposure to oral nicotine. Confirmation of the genotypic impact on phenotypic nicotine metabolism is valuable because many studies examine the association between CYP2A6 genotypes and behavioral, disease, or pharmacological phenotypes. Clearly, these groupings require further refinement by identifying and characterizing additional novel CYP2A6 genetic variants. Gene conversions, particularly between CYP2A6 and CYP2A7 (which are 95% identical in genomic nucleotide sequence) are proving to be a major challenge to gene- and allele-specific genotyping. In this report, a 33% overestimation of the frequency of CYP2A6 4A&D due to CYP2A6 28A was found. This may be of particular importance in Asian populations because the frequency of CYP2A6 4 is much higher [Schoedel et al., 2004], the frequency of CYP2A6 28A is unknown, and the 5750G4C sequence variant (found in CYP2A6 28A) was first identified in a Japanese population [Saito et al., 2003]. Discovering novel polymorphisms in populations of Black African descent may aid in explaining their paradoxical light smoking and high disease risk. More generally, with the advent of nicotine-replacement therapies for long-term maintenance against tobacco dependence and for treatment of other disorders such as Alzheimer disease, Parkinson s disease, Tourette s syndrome, and ulcerative colitis, CYP2A6 genotype may become particularly important, as it would significantly affect nicotine plasma levels from these sources. ACKNOWLEDGMENTS J.C.M. receives funding from CIHR-funded SPICE and TUSP awards. N.K. receives funding from CHIR-funded STPTR and TUSP awards. M.K.H. receives funding from a Natural Sciences and Engineering Research Council of Canada Canadian Graduate Scholorship Doctoral(NSERC-CGS-D) award. R.F.T. holds a Canada Research Chair in Pharmacogenetics. We also thank Dr. Howard Kaplan for valuable guidance in the statistical analyses, Frankie Lee and Abbas Assadzadeh for their technical excellence in genotyping, Elizabeth Gillam for her generous gift of the CYP2A6 construct, and Eric Siu for his careful review of the manuscript. Drs. R.F. Tyndale and E.M. Sellers hold shares in Nicogen Research Inc., a company focused on novel smoking cessation treatment approaches. None of the data contained in this manuscript alters or improves any commercial aspect of Nicogen, the manuscript was not reviewed by others involved with Nicogen, and no Nicogen funds were used in this work. This study involved two primary research centers. Data collection was conducted at DecisionLine (formerly Ventana) Clinical Research Corporation, 720 King Street West, Toronto, Ontario, Canada M5V 2T3. Data analyses were conducted at Rm 4326 Medical Science Building, 1 King s College Circle, University of Toronto, Ontario, Canada, M5S 1A8. REFERENCES Al Koudsi N, Mwenifumbo JC, Sellers EM, Benowitz NL, Swan GE, Tyndale RF Characterization of the novel CYP2A6 21 allele using in vivo nicotine kinetics. Eur J Clin Pharmacol 62: Benowitz NL, Jacob P 3rd Effects of cigarette smoking and carbon monoxide on nicotine and cotinine metabolism. Clin Pharmacol Ther 67: Benowitz NL, Lessov-Schlaggar CN, Swan GE, Jacob P 3rd. 2006a. Female sex and oral contraceptive use accelerate nicotine metabolism. Clin Pharmacol Ther 79: Benowitz NL, Swan GE, Jacob P 3rd, Lessov-Schlaggar CN, Tyndale RF. 2006b. CYP2A6 genotype and the metabolism and disposition kinetics of nicotine. Clin Pharmacol Ther 80: Carter B, Long T, Cinciripini P A meta-analytic review of the CYP2A6 genotype and smoking behavior. Nicotine Tob Res 6: Dempsey D, Tutka P, Jacob P 3rd, Allen F, Schoedel K, Tyndale RF, Benowitz NL Nicotine metabolite ratio as an index of cytochrome P450 2A6 metabolic activity. Clin Pharmacol Ther 76: Ding S, Lake BG, Friedberg T, Wolf CR Expression and alternative splicing of the cytochrome P-450 CYP2A7. Biochem J 306(Pt 1): Fujieda M, Yamazaki H, Saito T, Kiyotani K, Gyamfi MA, Sakurai M, Dosaka-Akita H, Sawamura Y, Yokota J, Kunitoh H, Kamataki T Evaluation of CYP2A6 genetic polymorphisms as determinants of smoking behavior and tobacco-related lung cancer risk in male Japanese smokers. Carcinogenesis 25: Fukami T, Nakajima M, Yoshida R, Tsuchiya Y, Fujiki Y, Katoh M, McLeod HL, Yokoi T A novel polymorphism of human CYP2A6 gene CYP2A6 17 has an amino acid substitution (V365 M) that decreases enzymatic activity in vitro and in vivo. Clin Pharmacol Ther 76: Fukami T, Nakajima M, Higashi E, Yamanaka H, McLeod HL, Yokoi T A novel CYP2A6 20 allele found in African-American population produces a truncated protein lacking enzymatic activity. Biochem Pharmacol 70: Fukami T, Nakajima M, Yamanaka H, Fukushima Y, McLeod HL, Yokoi T A novel duplication type of CYP2A6 gene in African-American population. Drug Metab Dispos 35: Gaedigk A, Simon SD, Pearce RE, Bradford LD, Kennedy MJ, Leeder JS The CYP2D6 activity score: translating genotype information into a qualitative measure of phenotype. Clin Pharmacol Ther (in press) [Epub ahead of print]. Goodz SD, Tyndale RF Genotyping human CYP2A6 variants. Methods Enzymol 357: Gu DF, Hinks LJ, Morton NE, Day IN The use of long PCR to confirm three common alleles at the CYP2A6 locus and the relationship between genotype and smoking habit. Ann Hum Genet 64(Pt 5): Haberl M, Anwald B, Klein K, Weil R, Fuss C, Gepdiremen A, Zanger UM, Meyer UA, Wojnowski L Three haplotypes associated with CYP2A6 phenotypes in Caucasians. Pharmacogenet Genomics 15: Haiman CA, Stram DO, Wilkens LR, Pike MC, Kolonel LN, Henderson BE, Le Marchand L Ethnic and racial differences in the smokingrelated risk of lung cancer. N Engl J Med 354: Hakooz N, Hamdan I Effects of dietary broccoli on human in vivo caffeine metabolism: a pilot study on a group of Jordanian volunteers. Curr Drug Metab 8:9 15. Hasler J, Samuelsson T, Strub K Useful junk : Alu RNAs in the human transcriptome. Cell Mol Life Sci 64: Henningfield JE, Miyasato K, Jasinski DR Abuse liability and pharmacodynamic characteristics of intravenous and inhaled nicotine. J Pharmacol Exp Ther 234:1 12. Ho MK, Mwenifumbo J, Zhao B, Gillam E, Tyndale R. A novel CYP2A6 allele, CYP2A6 * 23, impairs enzyme function in vitro and in vivo and decreases smoking in a population of Black-African descent. Pharmacogenet Genomics 18: Hoffman SM, Nelson DR, Keeney DS Organization, structure and evolution of the CYP2 gene cluster on human chromosome 19. Pharmacogenetics 11:

10 10 HUMAN MUTATION 0, 1^10, 2008 Iwahashi K, Waga C, Takimoto T Whole deletion of CYP2A6 gene (CYP2A6AST;4C) and smoking behavior. Neuropsychobiology 49: Kitagawa K, Kunugita N, Kitagawa M, Kawamoto T CYP2A6 6, a novel polymorphism in cytochrome P450 2A6, has a single amino acid substitution (R128Q) that inactivates enzymatic activity. J Biol Chem 276: Lewis DF Essential requirements for substrate binding affinity and selectivity toward human CYP2 family enzymes. Arch Biochem Biophys 409: Malaiyandi V, Lerman C, Benowitz NL, Jepson C, Patterson F, Tyndale RF Impact of CYP2A6 genotype on pretreatment smoking behaviour and nicotine levels from and usage of nicotine replacement therapy. Mol Psychiatry 11: Messina ES, Tyndale RF, Sellers EM A major role for CYP2A6 in nicotine C-oxidation by human liver microsomes. J Pharmacol Exp Ther 282: Minematsu N, Nakamura H, Furuuchi M, Nakajima T, Takahashi S, Tateno H, Ishizaka A Limitation of cigarette consumption by CYP2A6 4, 7 and 9 polymorphisms. Eur Respir J 27: Mwenifumbo JC, Myers MG, Wall TL, Lin SK, Sellers EM, Tyndale RF Ethnic variation in CYP2A6 7, CYP2A6 8 and CYP2A6 10 as assessed with a novel haplotyping method. Pharmacogenet Genomics 15: Mwenifumbo JC, Tyndale RF Genetic variability in CYP2A6 and the pharmacokinetics of nicotine. Pharmacogenomics 8: Mwenifumbo JC, Sellers EM, Tyndale RF Nicotine metabolism and CYP2A6 activity in a population of black African descent: impact of gender and light smoking. Drug Alcohol Depend 89: Mwenifumbo JC, Lessov-Schlaggar CN, Zhou Q, Krasnow RE, Swan GE, Benowitz NL, Tyndale RF. Identification of novel CYP2A6 * 1B variants: the CYP2A6 * 1B allele is associated with faster in vivo nicotine metabolism. Clin Pharmacol Ther 83: Nakajima M, Yamamoto T, Nunoya K, Yokoi T, Nagashima K, Inoue K, Funae Y, Shimada N, Kamataki T, Kuroiwa Y. 1996a. Role of human cytochrome P4502A6 in C-oxidation of nicotine. Drug Metab Dispos 24: Nakajima M, Yamamoto T, Nunoya K, Yokoi T, Nagashima K, Inoue K, Funae Y, Shimada N, Kamataki T, Kuroiwa Y. 1996b. Characterization of CYP2A6 involved in 3 0 -hydroxylation of cotinine in human liver microsomes. J Pharmacol Exp Ther 277: Nakajima M, Fukami T, Yamanaka H, Higashi E, Sakai H, Yoshida R, Kwon JT, McLeod HL, Yokoi T Comprehensive evaluation of variability in nicotine metabolism and CYP2A6 polymorphic alleles in four ethnic populations. Clin Pharmacol Ther 80: Oscarson M, McLellan RA, Gullsten H, Yue QY, Lang MA, Bernal ML, Sinues B, Hirvonen A, Raunio H, Pelkonen O, Ingelman-Sundberg M Characterisation and PCR-based detection of a CYP2A6 gene deletion found at a high frequency in a Chinese population. FEBS Lett 448: Pichard-Garcia L, Hyland R, Baulieu J, Fabre JM, Milton A, Maurel P Human hepatocytes in primary culture predict lack of cytochrome P-450 3A4 induction by eletriptan in vivo. Drug Metab Dispos 28: Pitarque M, von Richter O, Oke B, Berkkan H, Oscarson M, Ingelman- Sundberg M Identification of a single nucleotide polymorphism in the TATA box of the CYP2A6 gene: impairment of its promoter activity. Biochem Biophys Res Commun 284: Pitarque M, von Richter O, Rodriguez-Antona C, Wang J, Oscarson M, Ingelman-Sundberg M A nicotine C-oxidase gene (CYP2A6) polymorphism important for promoter activity. Hum Mutat 23: Pritchard MP, Ossetian R, Li DN, Henderson CJ, Burchell B, Wolf CR, Friedberg T A general strategy for the expression of recombinant human cytochrome P450 s in Escherichia coli using bacterial signal peptides: expression of CYP3A4, CYP2A6, and CYP2E1. Arch Biochem Biophys 345: Rao Y, Hoffmann E, Zia M, Bodin L, Zeman M, Sellers EM, Tyndale RF Duplications and defects in the CYP2A6 gene: identification, genotyping, and in vivo effects on smoking. Mol Pharmacol 58: Saito S, Iida A, Sekine A, Kawauchi S, Higuchi S, Ogawa C, Nakamura Y Catalog of 680 variations among eight cytochrome p450 (CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet 48: Satarug S, Nishijo M, Ujjin P, Vanavanitkun Y, Baker JR, Moore MR Effects of chronic exposure to low-level cadmium on renal tubular function and CYP2A6-mediated coumarin metabolism in healthy human subjects. Toxicol Lett 148: Schoedel KA, Sellers EM, Palmour R, Tyndale RF Down-regulation of hepatic nicotine metabolism and a CYP2A6-like enzyme in African green monkeys after long-term nicotine administration. Mol Pharmacol 63: Schoedel KA, Hoffmann EB, Rao Y, Sellers EM, Tyndale RF Ethnic variation in CYP2A6 and association of genetically slow nicotine metabolism and smoking in adult Caucasians. Pharmacogenetics 14: Siu EC, Wildenauer DB, Tyndale RF Nicotine self-administration in mice is associated with rates of nicotine inactivation by CYP2A5. Psychopharmacology (Berl) 184: Solus JF, Arietta BJ, Harris JR, Sexton DP, Steward JQ, McMunn C, Ihrie P, Mehall JM, Edwards TL, Dawson EP Genetic variation in eleven phase I drug metabolism genes in an ethnically diverse population. Pharmacogenomics 5: USDHHS Tobacco use among U.S. racial/ethnic minority groups: African Americans, American Indians and Alaska Natives, Asian Americans and Pacific Islanders, and Hispanics: a report of the Surgeon General. 332 p. Available at: sgr_1998/sgr-min-sgr2.htm. Last accessed: 4 December von Richter O, Pitarque M, Rodriguez-Antona C, Testa A, Mantovani R, Oscarson M, Ingelman-Sundberg M Polymorphic NF-Y dependent regulation of human nicotine C-oxidase (CYP2A6). Pharmacogenetics 14: Wortham M, Czerwinski M, He L, Parkinson A, Wan YJ Expression of constitutive androstane receptor, hepatic nuclear factor 4 alpha, and P450 oxidoreductase genes determines interindividual variability in basal expression and activity of a broad scope of xenobiotic metabolism genes in the human liver. Drug Metab Dispos 35: Yamanaka H, Nakajima M, Nishimura K, Yoshida R, Fukami T, Katoh M, Yokoi T Metabolic profile of nicotine in subjects whose CYP2A6 gene is deleted. Eur J Pharm Sci 22: Yano JK, Hsu MH, Griffin KJ, Stout CD, Johnson EF Structures of human microsomal cytochrome P450 2A6 complexed with coumarin and methoxsalen. Nat Struct Mol Biol 12: Yoshida R, Nakajima M, Watanabe Y, Kwon JT, Yokoi T Genetic polymorphisms in human CYP2A6 gene causing impaired nicotine metabolism. Br J Clin Pharmacol 54: