World Journal of Gastroenterology

Transcription

1 ISSN (print) ISSN (online) World Journal of Gastroenterology World J Gastroenterol 2014 March 21; 20(11):

2 Editorial Board The World Journal of Gastroenterology Editorial Board consists of 1339 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 67 countries, including Albania (1), Argentina (7), Australia (31), Austria (9), Belgium (10), Brazil (20), Brunei Darussalam (1), Bulgaria (2), Cambodia (1), Canada (25), Chile (4), China (158), Croatia (1), Cuba (1), Czech (6), Denmark (2), Egypt (9), Estonia (2), Finland (5), France (17), Germany (56), Greece (31), Guatemala (1), Hungary (14), Iceland (1), India (32), Indonesia (2), Iran (9), Ireland (9), Israel (17), Italy (193), Japan (151), Jordan (1), Kuwait (1), Lebanon (7), Lithuania (1), Malaysia (1), Mexico (10), Morocco (1), Netherlands (5), New Zealand (4), Nigeria (3), Norway (6), Pakistan (6), Poland (12), Portugal (8), Puerto Rico (1), Qatar (1), Romania (9), Russia (3), Saudi Arabia (2), Singapore (7), Slovenia (2), South Korea (63), Spain (51), Sri Lanka (1), Sudan (1), Sweden (12), Switzerland (5), Thailand (7), Trinidad and Tobago (1), Tunisia (2), Turkey (56), United Kingdom (47), United States (171), Venezuela (1), and Vietnam (1). EDITORS-IN-CHIEF Stephen C Strom, Stockholm Saleh A Naser, Orlando Andrzej S Tarnawski, Long Beach Damian Garcia-Olmo, Madrid GUEST EDITORIAL BOARD MEMBERS Jia-Ming Chang, Taipei Jane CJ Chao, Taipei Kuen-Feng Chen, Taipei Tai-An Chiang, Tainan Yi-You Chiou, Taipei Seng-Kee Chuah, Kaohsiung Wan-Long Chuang, Kaohsiung How-Ran Guo, Tainan Ming-Chih Hou, Taipei Po-Shiuan Hsieh, Taipei Ching-Chuan Hsieh, Chiayi county Jun-Te Hsu, Taoyuan Chung-Ping Hsu, Taichung Chien-Ching Hung, Taipei Chao-Hung Hung, Kaohsiung Chen-Guo Ker, Kaohsiung Yung-Chih Lai, Taipei Teng-Yu Lee, Taichung City Wei-Jei Lee, Taoyuan Jin-Ching Lee, Kaohsiung Jen-Kou Lin, Taipei Ya-Wen Lin, Taipei Hui-kang Liu, Taipei Min-Hsiung Pan, Taipei Bor-Shyang Sheu, Tainan Hon-Yi Shi, Kaohsiung Fung-Chang Sung, Taichung Dar-In Tai, Taipei Jung-Fa Tsai, Kaohsiung Yao-Chou Tsai, New Taipei City Chih-Chi Wang, Kaohsiung Liang-Shun Wang, New Taipei City Hsiu-Po Wang, Taipei Jaw-Yuan Wang, Kaohsiung Yuan-Huang Wang, Taipei Yuan-Chuen Wang, Taichung Deng-Chyang Wu, Kaohsiung Shun-Fa Yang, Taichung Hsu-Heng Yen, Changhua MEMBERS OF THE EDITORIAL BOARD Albania Saadi Berkane, Algiers Argentina N Tolosa de Talamoni, Córdoba Eduardo de Santibanes, Buenos Aires Bernardo Frider, Capital Federal Guillermo Mazzolini, Pilar Carlos Jose Pirola, Buenos Aires Bernabé Matías Quesada, Buenos Aires María Fernanda Troncoso, Buenos Aires Australia Golo Ahlenstiel, Westmead Minoti V Apte, Sydney Jacqueline S Barrett, Melbourne Michael Beard, Adelaide Filip Braet, Sydney Guy D Eslick, Sydney Christine Feinle-Bisset, Adelaide Mark D Gorrell, Sydney Michael Horowitz, Adelaide Gordon Stanley Howarth, Roseworthy Seungha Kang, Brisbane Alfred King Lam, Gold Coast Ian C Lawrance, PerthFremantle Barbara Anne Leggett, Brisbane Daniel A Lemberg, Sydney Rupert W Leong, Sydney Finlay A Macrae, Victoria Vance Matthews, Melbourne David L Morris, Sydney Reme Mountifield, Bedford Park Hans J Netter, Melbourne Nam Q Nguyen, Adelaide Liang Qiao, Westmead Rajvinder Singh, Adelaide Ross Cyril Smith, StLeonards Kevin J Spring, Sydney Debbie Trinder, Fremantle Daniel R van Langenberg, Box Hill David Ian Watson, Adelaide Desmond Yip, Garran Li Zhang, Sydney Austria Felix Aigner, Innsbruck Gabriela A Berlakovich, Vienna Herwig R Cerwenka, Graz Peter Ferenci, Wien I January 22, 2014

3 Alfred Gangl, Vienna Kurt Lenz, Linz Markus Peck-Radosavljevic, Vienna Markus Raderer, Vienna Stefan Riss, Vienna Belgium Michael George Adler, Brussels Benedicte Y De Winter, Antwerp Mark De Ridder, Jette Olivier Detry, Liege Denis Dufrane Dufrane, Brussels Nikos Kotzampassakis, Liège Geert KMM Robaeys, Genk Xavier Sagaert, Leuven Peter Starkel, Brussels Eddie Wisse, Keerbergen Brazil SMP Balzan, Santa Cruz do Sul JLF Caboclo, Sao jose do rio preto Fábio Guilherme Campos, Sao Paulo Claudia RL Cardoso, Rio de Janeiro Roberto J Carvalho-Filho, Sao Paulo Carla Daltro, Salvador José Sebastiao dos Santos, Ribeirao Preto Eduardo LR Mello, Rio de Janeiro Sthela Maria Murad-Regadas, Fortaleza Claudia PMS Oliveira, Sao Paulo Júlio C Pereira-Lima, Porto Alegre Marcos V Perini, Sao Paulo Vietla Satyanarayana Rao, Fortaleza Raquel Rocha, Salvador AC Simoes e Silva, Belo Horizonte Mauricio F Silva, Porto Alefre Aytan Miranda Sipahi, Sao Paulo Rosa Leonôra Salerno Soares, Niterói Cristiane Valle Tovo, Porto Alegre Eduardo Garcia Vilela, Belo Horizonte Brunei Darussalam Vui Heng Chong, Bandar Seri Begawan Bulgaria Tanya Kirilova Kadiyska, Sofia Mihaela Petrova, Sofia Cambodia Francois Rouet, Phnom Penh Canada Brian Bressler, Vancouver Frank J Burczynski, Winnipeg Wangxue Chen, Ottawa Francesco Crea, Vancouver Mirko Diksic, Montreal Jane A Foster, Hamilton Hugh J Freeman, Vancouver Shahrokh M Ghobadloo, Ottawa Yuewen Gong, Winnipeg Philip H Gordon, Quebec Rakesh Kumar, Edmonton Wolfgang A Kunze, Hamilton Patrick Labonte, Laval Zhikang Peng, Winnipeg Jayadev Raju, Ottawa Maitreyi Raman, Calgary Giada Sebastiani, Montreal Maida J Sewitch, Montreal Eldon A Shaffer, Alberta Christopher W Teshima, Edmonton Jean Sévigny, Québec Pingchang Yang, Hamilton Pingchang Yang, Hamilton Eric M Yoshida, Vancouver Bin Zheng, Edmonton Chile Marcelo A Beltran, La Serena Flavio Nervi, Santiago Adolfo Parra-Blanco, Santiago Alejandro Soza, Santiago China Zhao-Xiang Bian, Hong Kong San-Jun Cai, Shanghai Guang-Wen Cao, Shanghai Long Chen, Nanjing Ru-Fu Chen, Guangzhou George G Chen, Hong Kong Li-Bo Chen, Wuhan Jia-Xu Chen, Beijing Hong-Song Chen, Beijing Lin Chen, Beijing Yang-Chao Chen, Hong Kong Zhen Chen, Shanghai Ying-Sheng Cheng, Shanghai Kent-Man Chu, Hong Kong Zhi-Jun Dai, Xi an Jing-Yu Deng, Tianjin Yi-Qi Du, Shanghai Zhi Du, Tianjin Hani El-Nezami, Hong Kong Bao-Ying Fei, Hangzhou Chang-Ming Gao, Nanjing Jian-Ping Gong, Chongqing Zuo-Jiong Gong, Wuhan Jing-Shan Gong, Shenzhen Yong-Song Guan, Chengdu Mao-Lin Guo, Luoyang Jun-Ming Guo, Ningbo Yan-Mei Guo, Shanghai Xiao-Zhong Guo, Shenyang Guo-Hong Han, Xi an Ming-Liang He, Hong Kong Peng Hou, Xi an Zhao-Hui Huang, Wuxi Feng Ji, Hangzhou Simon Law, Hong Kong Yu-Yuan Li, Guangzhou Meng-Sen Li, Haikou Shu-De Li, Shanghai Zong-Fang Li, Xi an Qing-Quan Li, Shanghai Kang Li, Lasa Han Liang, Tianjin Xing e Liu, Hangzhou Zheng-Wen Liu, Xi an Xiao-Fang Liu, Yantai Bin Liu, Tianjin Quan-Da Liu, Beijing Hai-Feng Liu, Beijing Fei Liu, Shanghai Ai-Guo Lu, Shanghai He-Sheng Luo, Wuhan Xiao-Peng Ma, Shanghai Yong Meng, Shantou Ke-Jun Nan, Xi an Siew Chien Ng, Hong Kong Simon SM Ng, Hong Kong Zhao-Shan Niu, Qingdao Bo-Rong Pan, Xi an Di Qu, Shanghai Rui-Hua Shi, Nanjing Bao-Min Shi, Shanghai Xiao-Dong Sun, Hangzhou Guang-Hong Tan, Haikou Wen-Fu Tang, Chengdu Anthony YB Teoh, Hong Kong Wei-Dong Tong, Chongqing Eric Tse, Hong Kong Hong Tu, Shanghai Rong Tu, Haikou Jian-She Wang, Shanghai Kai Wang, Jinan Xiao-Ping Wang, Xianyang Dao-Rong Wang, Yangzhou De-Sheng Wang, Xi an Chun-You Wang, Wuhan Ge Wang, Chongqing Xi-Shan Wang, Harbin Wei-hong Wang, Beijing Wai Man Raymond Wong, Hong Kong Chun-Ming Wong, Hong Kong Jian Wu, Shanghai Sheng-Li Wu, Xi an Wu-Jun Wu, Xi an Bing Xia, Wuhan Qing Xia, Chengdu Yan Xin, Shenyang Dong-Ping Xu, Beijing Jian-Min Xu, Shanghai Wei Xu, Changchun Ming Yan, Jinan Xin-Min Yan, Kunming Yi-Qun Yan, Shanghai Feng Yang, Shanghai Yong-Ping Yang, Beijing He-Rui Yao, Guangzhou Thomas Yau, Hong Kong Winnie Yeo, Hong Kong Jing You, Kunming Jian-Qing Yu, Wuhan Ying-Yan Yu, Shanghai Wei-Zheng Zeng, Chengdu Zong-Ming Zhang, Beijing Dian-Liang Zhang, Qingdao Ya-Ping Zhang, Shijiazhuang You-Cheng Zhang, Lanzhou Jian-Zhong Zhang, Beijing Ji-Yuan Zhang, Beijing Hai-Tao Zhao, Beijing Jian Zhao, Shanghai Jian-Hong Zhong, Nanning II January 22, 2014

4 Ying-Qiang Zhong, Guangzhou Ping-Hong Zhou, Shanghai Yan-Ming Zhou, Xiamen Tong Zhou, Nanchong Li-Ming Zhou, Chengdu Guo-Xiong Zhou, Nantong Feng-Shang Zhu, Shanghai Jiang-Fan Zhu, Shanghai Zhao-Hui Zhu, Beijing Croatia Tajana Filipec Kanizaj, Zagreb Cuba Damian Casadesus, Havana Czech Jan Bures, Hradec Kralove Marcela Kopacova, Hradec Kralove Otto Kucera, Hradec Kralove Marek Minarik, Prague Pavel Soucek, Prague Miroslav Zavoral, Prague Denmark Vibeke Andersen, Odense E Michael Danielsen, Copenhagen Egypt Mohamed MM Abdel-Latif, Assiut Hussein Atta, Cairo Ashraf Elbahrawy, Cairo Mortada Hassan El-Shabrawi, Cairo Mona El Said El-Raziky, Cairo Elrashdy M Redwan, New Borg Alrab Zeinab Nabil Ahmed Said, Cairo Ragaa HM Salama, Assiut Maha Maher Shehata, Mansoura Estonia Margus Lember, Tartu Tamara Vorobjova, Tartu Finland Marko Kalliomäki, Turku Thomas Kietzmann, Oulu Kaija-Leena Kolho, Helsinki Eija Korkeila, Turku Heikki Makisalo, Helsinki France Armando Abergel Clermont, Ferrand Elie K Chouillard, Polssy Pierre Cordelier, Toulouse Pascal P Crenn, Garches Catherine Daniel, Lille Fanny Daniel, Paris Cedric Dray, Toulouse Benoit Foligne, Lille Jean-Noel Freund, Strasbourg Nathalie Janel, Paris Majid Khatib, Bordeaux Jacques Marescaux, Strasbourg Jean-Claude Marie, Paris Hang Nguyen, Clermont-Ferrand Hugo Perazzo, Paris Alain L Servin, Chatenay-Malabry Chang Xian Zhang, Lyon Germany Stavros A Antoniou, Monchengladbach Erwin Biecker, Siegburg Hubert E Blum, Freiburg Thomas Bock, Berlin Katja Breitkopf-Heinlein, Mannheim Elke Cario, Essen Güralp Onur Ceyhan, Munich Angel Cid-Arregui, Heidelberg Michael Clemens Roggendorf, München Christoph F Dietrich, Bad Mergentheim Valentin Fuhrmann, Hamburg Nikolaus Gassler, Aachen Andreas Geier, Wuerzburg Markus Gerhard, Munich Anton Gillessen, Muenster Thorsten Oliver Goetze, Offenbach Daniel Nils Gotthardt, Heidelberg Robert Grützmann, Dresden Thilo Hackert, Heidelberg Joerg Haier, Muenster Claus Hellerbrand, Regensburg Harald Peter Hoensch, Darmstadt Jens Hoeppner, Freiburg Richard Hummel, Muenster Jakob Robert Izbicki, Hamburg Gernot Maximilian Kaiser, Essen Matthias Kapischke, Hamburg Michael Keese, Frankfurt Andrej Khandoga, Munich Jorg Kleeff, Munich Alfred Koenigsrainer, Tuebingen Peter Christopher Konturek, Saalfeld Michael Linnebacher, Rostock Stefan Maier, Kaufbeuren Oliver Mann, Hamburg Marc E Martignoni, Munic Thomas Minor, Bonn Oliver Moeschler, Osnabrueck Jonas Mudter, Eutin Sebastian Mueller, Heidelberg Matthias Ocker, Berlin Andreas Ommer, Essen Albrecht Piiper, Frankfurt Esther Raskopf, Bonn Christoph Reichel, Bad Brückenau Elke Roeb, Giessen Udo Rolle, Frankfurt Karl-Herbert Schafer, Zweibrücken Andreas G Schreyer, Regensburg Manuel A Silva, Penzberg Georgios C Sotiropoulos, Essen Ulrike S Stein, Berlin Dirk Uhlmann, Leipzig Michael Weiss, Halle Hong-Lei Weng, Mannheim Karsten Wursthorn, Hamburg Greece Alexandra Alexopoulou, Athens Nikolaos Antonakopoulos, Athens Stelios F Assimakopoulos, Patras Grigoris Chatzimavroudis, Thessaloniki Evangelos Cholongitas, Thessaloniki Gregory Christodoulidis, Larisa George N Dalekos, Larissa Maria Gazouli, Athens Urania Georgopoulou, Athens Eleni Gigi, Thessaloniki Stavros Gourgiotis, Athens Leontios J Hadjileontiadis, Thessaloniki Thomas Hyphantis, Ioannina Ioannis Kanellos, Thessaloniki Stylianos Karatapanis, Rhodes Michael Koutsilieris, Athens Spiros D Ladas, Athens Theodoros K Liakakos, Athens Emanuel K Manesis, Athens Spilios Manolakopoulos, Athens Gerassimos John Mantzaris, Athens Athanasios D Marinis, Piraeus Nikolaos Ioannis Nikiteas, Athens Konstantinos X Papamichael, Athens George Sgourakis, Athens Konstantinos C Thomopoulos, Patras Konstantinos Triantafyllou, Athens Christos Triantos, Patras Georgios Zacharakis, Athens Petros Zezos, Alexandroupolis Demosthenes E Ziogas, Ioannina Guatemala Carlos Maria Parellada, Guatemala Hungary Mihaly Boros, Szeged Tamás Decsi, Pécs Gyula Farkas, Szeged Andrea Furka, Debrecen Y vette Mandi, Szeged Peter L Lakatos, Budapest Pal Miheller, Budapest Tamás Molnar, Szeged Attila Olah, Gyor Maria Papp, Debrecen Zoltan Rakonczay, Szeged Ferenc Sipos, Budapest Miklós Tanyi, Debrecen Tibor Wittmann, Szeged Iceland Tryggvi Bjorn Stefánsson, Reykjavík III January 22, 2014

5 India Brij B Agarwal, New Delhi Deepak N Amarapurkar, Mumbai Shams ul Bari, Srinagar Sriparna Basu, Varanasi Devendra C Desai, Mumbai Nutan D Desai, Mumbai Suneela Sunil Dhaneshwar, Pune Radha K Dhiman, Chandigarh Pankaj Garg, Mohali Uday C Ghoshal, Lucknow Kalpesh Jani, Vadodara Premashis Kar, New Delhi Jyotdeep Kaur, Chandigarh Rakesh Kochhar, Chandigarh Pradyumna K Mishra, Mumbai Asish K Mukhopadhyay, Kolkata Imtiyaz Murtaza, Srinagar P Nagarajan, New Delhi Samiran Nundy, Delhi Gopal Pande, Hyderabad Benjamin Perakath, Vellore Arun Prasad, New Delhi D Nageshwar Reddy, Hyderabad Lekha Saha, Chandigarh Sundeep Singh Saluja, New Delhi Mahesh Prakash Sharma, New Delhi Sadiq Saleem Sikora, Bangalore Sarman Singh, New Delhi Rajeev Sinha, Jhansi Rupjyoti Talukdar, Hyderabad Rakesh Kumar Tandon, New Delhi Narayanan Thirumoorthy, Coimbatore Indonesia David Handojo Muljono, Jakarta Andi Utama, Jakarta Iran Arezoo Aghakhani, Tehran Seyed Mohsen Dehghani, Shiraz Hossein Khedmat, Tehran Sadegh Massarrat, Tehran Marjan Mohammadi, Tehran Roja Rahimi, Tehran Farzaneh Sabahi, Tehran Majid Sadeghizadeh, Tehran Farideh Siavoshi, Tehran Ireland Gary Alan Bass, Dublin David J Brayden, Dublin Ronan A Cahill, Dublin Glen A Doherty, Dublin Liam J Fanning, Cork Barry Philip McMahon, Dublin RossMcManus, Dublin Dervla O Malley, Cork Sinead M Smith, Dublin Israel Dan Carter, Ramat Gan Eli Magen, Ashdod Nitsan Maharshak, Tel Aviv Shaul Mordechai, Beer Sheva Menachem Moshkowitz, Tel Aviv William Bahij Nseir, Nazareth Shimon Reif, Jerusalem Ram Reifen, Rehovot Ariella Bar-Gil Shitrit, Jerusalem Noam Shussman, Jerusalem Igor Sukhotnik, Haifa Nir Wasserberg, Petach Tiqwa Jacob Yahav, Rehovot Doron Levi Zamir, Gedera Shira Zelber-Sagi, Haifa Romy Zemel, Petach-Tikva Italy Ludovico Abenavoli, Catanzaro Luigi Elio Adinolfi, Naples Carlo Virginio Agostoni, Milan Anna Alisi, Rome Piero Luigi Almasio, Palermo Donato Francesco Altomare, Bari Amedeo Amedei, Florence Pietro Andreone, Bologna Imerio Angriman, Padova Vito Annese, Florence Paolo Aurello, Rome Salavtore Auricchio, Naples Gian Luca Baiocchi, Brescia Gianpaolo Balzano, Milan Antonio Basoli, Rome Gabrio Bassotti, San Sisto Mauro Bernardi, Bologna Alberto Biondi, Rome Ennio Biscaldi, Genova Massimo Bolognesi, Padua Luigi Bonavina, Milano Aldo Bove, Chieti Raffaele Bruno, Pavia Luigi Brusciano, Napoli Giuseppe Cabibbo, Palermo Carlo Calabrese, Bologna Daniele Calistri, Meldola Vincenza Calvaruso, Palermo Lorenzo Camellini, Reggio Emilia Marco Candela, Bologna Raffaele Capasso, Naples Lucia Carulli, Modena Renato David Caviglia, Rome Luigina Cellini, Chieti Giuseppe Chiarioni, Verona Claudio Chiesa, Rome Michele Cicala, Roma Rachele Ciccocioppo, Pavia Sandro Contini, Parma Gaetano Corso, Foggia Renato Costi, Parma Alessandro Cucchetti, Bologna Rosario Cuomo, Napoli Giuseppe Currò, Messina Paola De Nardi, Milano Giovanni D De Palma, Naples Raffaele De Palma, Napoli Giuseppina De Petro, Brescia Valli De Re, Aviano Paolo De Simone, Pisa Giuliana Decorti, Trieste Emanuele Miraglia del Giudice, Napoli Isidoro Di Carlo, Catania Matteo Nicola Dario Di Minno, Naples Massimo Donadelli, Verona Mirko D Onofrio, Verona Maria Pina Dore, Sassari Luca Elli, Milano Massimiliano Fabozzi, Aosta Massimo Falconi, Ancona Ezio Falletto, Turin Silvia Fargion, Milan Matteo Fassan, Verona Gianfranco Delle Fave, Roma Alessandro Federico, Naples Francesco Feo, Sassari Davide Festi, Bologna Natale Figura, Siena Vincenzo Formica, Rome Mirella Fraquelli, Milan Marzio Frazzoni, Modena Walter Fries, Messina Gennaro Galizia, Naples Andrea Galli, Florence Matteo Garcovich, Rome Eugenio Gaudio, Rome Paola Ghiorzo, Genoa Edoardo G Giannini, Genova Luca Gianotti, Monza Maria Cecilia Giron, Padova Alberto Grassi, Rimini Gabriele Grassi, Trieste Francesco Greco, Bergamo Luigi Greco, Naples Antonio Grieco, Rome Fabio Grizzi, Rozzano Laurino Grossi, Pescara Salvatore Gruttadauria, Palermo Simone Guglielmetti, Milan Tiberiu Hershcovici, Jerusalem Calogero Iacono, Verona Enzo Ierardi, Bari Amedeo Indriolo, Bergamo Raffaele Iorio, Naples Paola Iovino, Salerno Angelo A Izzo, Naples Loreta Kondili, Rome Filippo La Torre, Rome Giuseppe La Torre, Rome Giovanni Latella, L Aquila Salvatore Leonardi, Catania Massimo Libra, Catania Anna Licata, Palermo C armela Loguercio, Naples Amedeo Lonardo, Modena Carmelo Luigiano, Catania Francesco Luzza, Catanzaro Giovanni Maconi, Milano Antonio Macrì, Messina Mariano Malaguarnera, Catania Francesco Manguso, Napoli Tommaso Maria Manzia, Rome Daniele Marrelli, Siena Gabriele Masselli, Rome IV January 22, 2014

6 Sara Massironi, Milan Giuseppe Mazzarella, Avellino Michele Milella, Rome Giovanni Milito, Rome Antonella d Arminio Monforte, Milan Fabrizio Montecucco, Genoa Giovanni Monteleone, Rome Mario Morino, Torino Vincenzo La Mura, Milan Gerardo Nardone, Naples Riccardo Nascimbeni, Brescia Gabriella Nesi, Florence Giuseppe Nigri, Rome Erica Novo, Turin Veronica Ojetti, Rome Michele Orditura, Naples Fabio Pace, Seriate Lucia Pacifico, Rome Omero Alessandro Paoluzi, Rome Valerio Pazienza, San Giovanni Rotondo Rinaldo Pellicano, Turin Adriano M Pellicelli, Rome Nadia Peparini, Ciampino Mario Pescatori, Rome Antonio Picardi, Rome Alberto Pilotto, Padova Alberto Piperno, Monza Anna Chiara Piscaglia, Rome Maurizio Pompili, Rome Francesca Romana Ponziani, Rome Cosimo Prantera, Rome Girolamo Ranieri, Bari Carlo Ratto, Tome Barbara Renga, Perugia Alessandro Repici, Rozzano Maria Elena Riccioni, Rome Lucia Ricci-Vitiani, Rome Luciana Rigoli, Messina Mario Rizzetto, Torino Ballarin Roberto, Modena Roberto G Romanelli, Florence Claudio Romano, Messina Luca Roncucci, Modena Cesare Ruffolo, Treviso L ucia Sacchetti, Napoli Rodolfo Sacco, Pisa Romina Salpini, Rome Giulio Aniello, Santoro Treviso Armando Santoro, Rozzano Edoardo Savarino, Padua Marco Senzolo, Padua Annalucia Serafino, Rome Giuseppe S Sica, Rome Pierpaolo Sileri, Rome Cosimo Sperti, Padua Vincenzo Stanghellini, Bologna Cristina Stasi, Florence Gabriele Stocco, Trieste Roberto Tarquini, Florence Mario Testini, Bari Guido Torzilli, Milan Guido Alberto Massimo, Tiberio Brescia Alberto Tommasini, Trieste Francesco Tonelli, Florence Cesare Tosetti Porretta, Terme Lucio Trevisani, Cona Guglielmo M Trovato, Catania Mariapia Vairetti, Pavia Luca Vittorio Valenti, Milano Mariateresa T Ventura, Bari Giuseppe Verlato, Verona Alessandro Vitale, Padova Marco Vivarelli, Ancona Giovanni Li Volti, Catania Giuseppe Zanotti, Padua Vincenzo Zara, Lecce Gianguglielmo Zehender, Milan Anna Linda Zignego, Florence Rocco Antonio Zoccali, Messina Angelo Zullo, Rome Japan Yasushi Adachi, Sapporo Takafumi Ando, Nagoya Masahiro Arai, Tokyo Makoto Arai, Chiba Takaaki Arigami, Kagoshima Itaru Endo,Yokohama Munechika Enjoji, Fukuoka Shunji Fujimori, Tokyo Yasuhiro Fujino, Akashi Toshiyoshi Fujiwara, Okayama Yosuke Fukunaga, Tokyo Toshio Fukusato, Tokyo Takahisa Furuta, Hamamatsu Osamu Handa, Kyoto Naoki Hashimoto, Osaka Yoichi Hiasa, Toon Masatsugu Hiraki, Saga Satoshi Hirano, Sapporo Keiji Hirata, Fukuoka Toru Hiyama, Higashihiroshima Akira Hokama, Nishihara Shu Hoteya, Tokyo Masao Ichinose, Wakayama Tatsuya Ide, Kurume Masahiro Iizuka, Akita Toshiro Iizuka, Tokyo Kenichi Ikejima, Tokyo Tetsuya Ikemoto, Tokushima Hiroyuki Imaeda, Saitama Atsushi Imagawa, Kan-onji Hiroo Imazu, Tokyo Akio Inui, Kagoshima Shuji Isaji, Tsu Toru Ishikawa, Niigata Toshiyuki Ishiwata, Tokyo Soichi Itaba, Kitakyushu Yoshiaki Iwasaki, Okayama Tatehiro Kagawa, Isehara Satoru Kakizaki, Maebashi Naomi Kakushima, Shizuoka Terumi Kamisawa, Tokyo Akihide Kamiya, Isehara Osamu Kanauchi, Tokyo Tatsuo Kanda, Chiba Shin Kariya, Okayama Shigeyuki Kawa, Matsumoto Takumi Kawaguchi, Kurume Takashi Kawai, Tokyo Soo Ryang Kim, Kobe Shinsuke Kiriyama, Gunma Tsuneo Kitamura, Urayasu Masayuki Kitano, Osakasayama Hirotoshi Kobayashi, Tokyo Hironori Koga, Kurume Takashi Kojima, Sapporo Satoshi Kokura, Kyoto Shuhei Komatsu, Kyoto Tadashi Kondo, Tokyo Yasuteru Kondo, Sendai Yasuhiro Kuramitsu, Yamaguchi Yukinori Kurokawa, Osaka Shin Maeda, Yokohama Koutarou Maeda, Toyoake Hitoshi Maruyama, Chiba Atsushi Masamune, Sendai Hiroyuki Matsubayashi, Suntogun Akihisa Matsuda, Inzai Hirofumi Matsui, Tsukuba Akira Matsumori, Kyoto Yoichi Matsuo, Nagoya Y Matsuzaki, Ami Toshihiro Mitaka, Sapporo Kouichi Miura, Akita Shinichi Miyagawa, Matumoto Eiji Miyoshi, Suita Toru Mizuguchi, Sapporo Nobumasa Mizuno, Nagoya Zenichi Morise, Nagoya Tomohiko Moriyama, Fukuoka Kunihiko Murase, Tusima Michihiro Mutoh, Tsukiji Akihito Nagahara, Tokyo Hikaru Nagahara, Tokyo Hidenari Nagai, Tokyo Koichi Nagata, Shimotsuke-shi Masaki Nagaya, Kawasaki Hisato Nakajima, Nishi-Shinbashi Toshifusa Nakajima, Tokyo Hiroshi Nakano, Kawasaki Hiroshi Nakase, Kyoto Toshiyuki Nakayama, Nagasaki Takahiro Nakazawa, Nagoya Shoji Natsugoe, Kagoshima City Tsutomu Nishida, Suita Shuji Nomoto, Naogya Sachiyo Nomura, Tokyo Takeshi Ogura, Takatsukishi Nobuhiro Ohkohchi, Tsukuba Toshifumi Ohkusa, Kashiwa Hirohide Ohnishi, Akita Teruo Okano, Tokyo Satoshi Osawa, Hamamatsu Motoyuki Otsuka, Tokyo Michitaka Ozaki, Sapporo Satoru Saito, Yokohama Chouhei Sakakura, Kyoto Naoaki Sakata, Sendai Ken Sato, Maebashi Toshiro Sato, Tokyo Tomoyuki Shibata, Toyoake H Shimada, Tokyo Tomohiko Shimatani, Kure Yukihiro Shimizu, Nanto Tadashi Shimoyama, Hirosaki Masayuki Sho, Nara Ikuo Shoji, Kobe Atsushi Sofuni, Tokyo Takeshi Suda, Niigata M Sugimoto, Hamamatsu Ken Sugimoto, Hamamatsu Haruhiko Sugimura, Hamamatsu Shoichiro Sumi, Kyoto Hidekazu Suzuki, Tokyo Masahiro Tajika, Nagoya Hitoshi Takagi, Takasaki Toru Takahashi, Niigata Yoshihisa Takahashi, Tokyo Shinsuke Takeno, Fukuoka Akihiro Tamori, Osaka Kyosuke Tanaka, Tsu Shinji Tanaka, Hiroshima V January 22, 2014

7 Atsushi Tanaka, Tokyo Yasuhito Tanaka, Nagoya Shinji Tanaka, Tokyo Minoru Tomizawa, Yotsukaido City Kyoko Tsukiyama-Kohara, Kagoshima Takuya Watanabe, Niigata Kazuhiro Watanabe, Sendai Satoshi Yamagiwa, Niigata Takayuki Yamamoto, Yokkaichi Hiroshi Yamamoto, Otsu Kosho Yamanouchi, Nagasaki Ichiro Yasuda, Gifu Yutaka Yata, Maebashi-city Shin-ichi Yokota, Sapporo Norimasa Yoshida, Kyoto Hiroshi Yoshida, Tama-City Hitoshi Yoshiji, Kashihara Kazuhiko Yoshimatsu, Tokyo Kentaro Yoshioka, Toyoake Nobuhiro Zaima, Nara Jordan Khaled Ali Jadallah, Irbid Kuwait Islam Khan, Kuwait Lebanon Bassam N Abboud, Beirut Kassem A Barada, Beirut Marwan Ghosn, Beirut Iyad A Issa, Beirut Fadi H Mourad, Beirut AIa Sharara, Beirut Rita Slim, Beirut Lithuania Antanas Mickevicius, Kaunas Malaysia Huck Joo Tan, Petaling Jaya Mexico Richard A Awad, Mexico City Carlos R Camara-Lemarroy, Monterrey Norberto C Chavez-Tapia, Mexico City Wolfgang Gaertner, Mexico City Diego Garcia-Compean, Monterrey Arturo Panduro, Guadalajara OT Teramoto-Matsubara, Mexico City Felix Tellez-Avila, Mexico City Omar Vergara-Fernandez, Mexico City Saúl Villa-Trevino, Cuidad de México Morocco Samir Ahboucha, Khouribga Netherlands Robert J de Knegt, Rotterdam Tom Johannes Gerardus Gevers, Nijmegen Menno Hoekstra, Leiden BW Marcel Spanier, Arnhem Karel van Erpecum, Utrecht New Zealand Leo K Cheng, Auckland Andrew Stewart Day, Christchurch Jonathan Barnes Koea, Auckland Max Petrov, Auckland Nigeria Olufunmilayo Adenike Lesi, Lagos Jesse Abiodun Otegbayo, Ibadan Stella Ifeanyi Smith, Lagos Norway Trond Berg, Oslo Trond Arnulf Buanes, Krokkleiva Thomas de Lange, Rud Magdy El-Salhy, Stord Rasmus Goll, Tromso Dag Arne Lihaug Hoff, Aalesund Pakistan Zaigham Abbas, Karachi Usman A Ashfaq, Faisalabad Muhammad Adnan Bawany, Hyderabad Muhammad Idrees, Lahore Saeed Sadiq Hamid, Karachi Yasir Waheed, Islamabad Poland Thomas Brzozowski, Cracow Magdalena Chmiela, Lodz Krzysztof Jonderko, Sosnowiec Anna Kasicka-Jonderko, Sosnowiec Michal Kukla, Katowice Tomasz Hubert Mach, Krakow Agata Mulak, Wroclaw Danuta Owczarek, Kraków Piotr Socha, Warsaw Piotr Stalke, Gdansk Julian Teodor Swierczynski, Gdansk Anna M Zawilak-Pawlik, Wroclaw Portugal Marie Isabelle Cremers, Setubal Ceu Figueiredo, Porto Ana Isabel Lopes, LIsbon M Paula Macedo, Lisboa Ricardo Marcos, Porto Rui T Marinho, Lisboa Guida Portela-Gomes, Estoril Filipa F Vale, Lisbon Puerto Rico Caroline B Appleyard, Ponce Qatar Abdulbari Bener, Doha Romania Mihai Ciocirlan, Bucharest Dan LucianDumitrascu, Cluj-Napoca Carmen Fierbinteanu-Braticevici, Bucharest Lucian Negreanu, Bucharest Adrian Saftoiu, Craiova Andrada Seicean, Cluj-Napoca Ioan Sporea, Timisoara Letiţia Adela Maria Streba, Craiova Anca Trifan, Iasi Russia Victor Pasechnikov, Stavropol Vasiliy Ivanovich Reshetnyak, Moscow Vitaly Skoropad, Obninsk Saudi Arabia Abdul-Wahed N Meshikhes, Dammam M Ezzedien Rabie, Khamis Mushait Singapore Brian KP Goh, Singapore Richie Soong, Singapore Ker-Kan Tan, Singapore Kok-Yang Tan, Singapore Yee-Joo Tan, Singapore Mark Wong, Singapore Hong Ping Xia, Singapore Slovenia Matjaz Homan, Ljubljana Martina Perse, Ljubljana South Korea Sang Hoon Ahn, Seoul Soon Koo Baik, Wonju Soo-Cheon Chae, Iksan Byung-Ho Choe, Daegu Suck Chei Choi, Iksan Hoon Jai Chun, Seoul Yeun-Jun Chung, Seoul Young-Hwa Chung, Seoul Ki-Baik Hahm, Seongnam Sang Young Han, Busan VI January 22, 2014

8 Seok Joo Han, Seoul Seung-Heon Hong, Iksan Jin-Hyeok Hwang, Seoungnam Jeong Won Jang, Seoul Jin-Young Jang, Seoul Dae-Won Jun, Seoul Young Do Jung, Kwangju Gyeong Hoon Kang, Seoul Sung-Bum Kang, Seoul Koo Jeong Kang, Daegu Ki Mun Kang, Jinju Chang Moo Kang, Seodaemun-gu Sang Soo Kim, Goyang-si Jin Cheon Kim, Seoul Tae Il Kim, Seoul Jin Hong Kim, Suwon Kyung Mo Kim, Seoul Kyongmin Kim, Suwon Hyung-Ho Kim, Seongnam Seoung Hoon Kim, Goyang Sang Il Kim, Seoul Hyun-Soo Kim, Wonju Jung Mogg Kim, Seoul Dong Yi Kim, Gwangju Kyun-Hwan Kim, Seoul Jong-Han Kim, Ansan Ja-Lok Ku, Seoul Kyu Taek Lee, Seoul Hae-Wan Lee, Chuncheon Inchul Lee, Seoul Jung Eun Lee, Seoul Sang Chul Lee, Daejeon Song Woo Lee, Ansan-si Hyuk-Joon Lee, Seoul Seong-Wook Lee, Yongin Kil Yeon Lee, Seoul Jong-Inn Lee, Seoul Kyung A Lee, Seoul Jong-Baeck Lim, Seoul Eun-Yi Moon, Seoul SH Noh, Seoul Seung Woon Paik, Seoul Won Sang Park, Seoul Sung-Joo Park, Iksan Kyung Sik Park, Daegu Se Hoon Park, Seoul Yoonkyung Park, Gwangju Seung-Wan Ryu, Daegu Dong Wan Seo, Seoul Il Han Song, Cheonan Myeong Jun Song, Daejeon Yun Kyoung Yim, Daejeon Dae-Yeul Yu Daejeon Spain Mariam Aguas, Valencia Raul J Andrade, Málaga Antonio Arroyo, Elche Josep M Bordas, Barcelona Lisardo Boscá, Madrid Ricardo Robles Campos, Murcia Jordi Camps, Reus Carlos Cervera Barcelona Alfonso Clemente, Granada Pilar Codoner-Franch, Valencia Fernando J Corrales, Pamplona Fermin Sánchez de Medina, Granada Alberto Herreros de Tejada, Majadahonda Enrique de-madaria, Alicante JE Dominguez-Munoz, Santiago de Compostela Vicente Felipo, Valencia CM Fernandez-Rodriguez, Madrid Carmen Frontela-Saseta, Murcia Julio Galvez, Granada Maria Teresa García, Vigo MI Garcia-Fernandez, Málaga Emilio Gonzalez-Reimers, La Laguna Marcel Jimenez, Bellaterra Angel Lanas, Zaragoza Juan Ramón Larrubia, Guadalajara Antonio Lopez-Sanroman, Madrid Vicente Lorenzo-Zuniga, Badalona Alfredo J Lucendo, Tomelloso Vicenta Soledad Martinez-Zorzano, Vigo José Manuel Martin-Villa, Madrid Julio Mayol, Madrid Manuel Morales-Ruiz, Barcelona Alfredo Moreno-Egea, Murcia Albert Pares, Barcelona Maria Pellise, Barcelona José Perea, Madrid Miguel Angel Plaza, Zaragoza María J Pozo, Cáceres Enrique Quintero, La Laguna Jose M Ramia, Madrid Francisco Rodriguez-Frias, Barcelona Silvia Ruiz-Gaspa, Barcelona Xavier Serra-Aracil, Barcelona Vincent Soriano, Madrid Javier Suarez, Pamplona Carlos Taxonera, Madrid M Isabel Torres, Jaén Manuel Vazquez-Carrera, Barcelona Benito Velayos, Valladolid Silvia Vidal, Barcelona Sri Lanka Arjuna Priyadarsin De Silva, Colombo Sudan Ishag Adam, Khartoum Sweden Roland G Andersson, Lund Bergthor Björnsson, Linkoping Johan Christopher Bohr, Örebro Mauro D Amato, Stockholm Thomas Franzen, Norrkoping Evangelos Kalaitzakis, Lund Riadh Sadik, Gothenburg Per Anders Sandstrom, Linkoping Ervin Toth, Malmö Konstantinos Tsimogiannis, Vasteras Apostolos V Tsolakis, Uppsala Switzerland Gieri Cathomas, Liestal Jean Louis Frossard, Geneve Christian Toso, Geneva Stephan Robert Vavricka, Zurich Dominique Velin, Lausanne Thailand Thawatchai Akaraviputh, Bangkok P Yoysungnoen Chintana, Pathumthani Veerapol Kukongviriyapan, Muang Vijittra Leardkamolkarn, Bangkok Varut Lohsiriwat, Bangkok Somchai Pinlaor, Khaon Kaen D Wattanasirichaigoon, Bangkok Trinidad and Tobago B Shivananda Nayak, Mount Hope Tunisia Ibtissem Ghedira, Sousse Lilia Zouiten-Mekki, Tunis Turkey Sami Akbulut, Diyarbakir Inci Alican, Istanbul Mustafa Altindis, Sakarya Mutay Aslan, Antalya Oktar Asoglu, Istanbul Yasemin Hatice Balaban, Istanbul Metin Basaranoglu, Ankara Yusuf Bayraktar, Ankara Süleyman Bayram, Adiyaman Ahmet Bilici, Istanbul Ahmet Sedat Boyacioglu, Ankara Züleyha Akkan Cetinkaya, Kocaeli Cavit Col, Bolu Yasar Colak, Istanbul Cagatay Erden Daphan, Kirikkale Mehmet Demir, Hatay Ahmet Merih Dobrucali, Istanbul Gülsüm Ozlem Elpek, Antalya Ayse Basak Engin, Ankara Eren Ersoy, Ankara Osman Ersoy, Ankara Yusuf Ziya Erzin, Istanbul Mukaddes Esrefoglu, Istanbul Levent Filik, Ankara Ozgur Harmanci, Ankara Koray Hekimoglu, Ankara Abdurrahman Kadayifci, Gaziantep Cem Kalayci, Istanbul Selin Kapan, Istanbul Huseyin Kayadibi, Adana Sabahattin Kaymakoglu, Istanbul Metin Kement, Istanbul Mevlut Kurt, Bolu Resat Ozaras, Istanbul Elvan Ozbek, Adapazari Cengiz Ozcan, Mersin Hasan Ozen, Ankara Halil Ozguc, Bursa Mehmet Ozturk, Izmir Orhan V Ozkan, Sakarya Semra Paydas, Adana Ozlem Durmaz Suoglu, Istanbul Ilker Tasci, Ankara VII January 22, 2014

9 Müge Tecder-ünal, Ankara Mesut Tez, Ankara Serdar Topaloglu, Trabzon Murat Toruner, Ankara Gokhan Tumgor, Adana Oguz Uskudar, Adana Mehmet Yalniz, Elazig Mehmet Yaman, Elazig Veli Yazisiz, Antalya Yusuf Yilmaz, Istanbul Ozlem Yilmaz, Izmir Oya Yucel, Istanbul Ilhami Yuksel, Ankara United Kingdom Nadeem Ahmad Afzal, Southampton Navneet K Ahluwalia, Stockport Yeng S Ang, Lancashire Ramesh P Arasaradnam, Coventry John Beynon, Swansea Barbara Braden, Oxford Simon Bramhall, Birmingham Geoffrey Burnstock, London Ian Chau, Sutton Thean Soon Chew, London Helen G Coleman, Belfast Anil Dhawan, London Sunil Dolwani, Cardiff Piers Gatenby, London Anil T George, London Pasquale Giordano, London Paul Henderson, Edinburgh Georgina Louise Hold, Aberdeen Stefan Hubscher, Birmingham Robin D Hughes, London Nusrat Husain, Manchester Matt W Johnson, Luton Konrad Koss, Macclesfield Anastasios Koulaouzidis, Edinburgh Simon Lal, Salford John S Leeds, Aberdeen Hongxiang Liu, Cambridge Michael Newton Marsh, Oxford Michael Joseph McGarvey, London Michael Anthony Mendall, London Alexander H Mirnezami, Southampton J Bernadette Moore, Guildford Claudio Nicoletti, Norwich Savvas Papagrigoriadis, London David Mark Pritchard, Liverpool James A Ross, Edinburgh Kamran Rostami, Worcester Xiong Z Ruan, London Dina Tiniakos, Newcastle upon Tyne Frank I Tovey, London Dhiraj Tripathi, Birmingham Vamsi R Velchuru, Great Yarmouth Nicholas T Ventham, Edinburgh Diego Vergani, London Jack Westwood Winter, Glasgow Terence Wong, London Ling Yang, Oxford United States Daniel E Abbott, Cincinnati Ghassan K Abou-Alfa, New York Julian Abrams, New York David William Adelson, Los Angeles Jonathan Steven Alexander, Shreveport Tauseef Ali, Oklahoma City Mohamed R Ali, Sacramento Rajagopal N Aravalli, Minneapolis Hassan Ashktorab, Washington Shashi Bala, Worcester Charles F Barish, Raleigh P Patrick Basu, New York Robert L Bell, Berkeley Heights David Bentrem, Chicago Henry J Binder, New Haven Joshua Bleier, Philadelphia Wojciech Blonski, Johnson City Kenneth Boorom, Corvallis Brian Boulay, Chicago Carla W Brady, Durham Kyle E Brown, Iowa City Adeel AButt, Pittsburgh Weibiao Cao, Providence Andrea Castillo, Cheney Fernando J Castro, Weston Adam S Cheifetz, Boston Adam S Cheifetz, Boston Xiaoxin Luke Chen, Durham Ramsey Cheung, Palo Alto Parimal Chowdhury, Little Rock Edward John Ciaccio, New York Dahn L Clemens, Omaha Yingzi Cong, Galveston Laura Iris Cosen-Binker, Boston Joseph John Cullen, Lowa Mark J Czaja, Bronx Mariana D Dabeva, Bronx Christopher James Damman, Seattle Isabelle G De Plaen, Chicago Abhishek Deshpande, Cleveland Punita Dhawan, Nashville Hui Dong, La Jolla Wael El-Rifai, Nashville Sukru H Emre, New Haven Paul Feuerstadt, Hamden Josef E Fischer, Boston Laurie N Fishman, Boston Temitope Foster, Atlanta AmyEFoxx-Orenstein, Scottsdale Daniel E Freedberg, New York Shai Friedland, Palo Alto Virgilio George, Indianapolis Ajay Goel, Dallas Oliver Grundmann, Gainesville Stefano Guandalini, Chicago Chakshu Gupta, St. Joseph Grigoriy E Gurvits, New York Xiaonan Han, Cincinnati Mohamed Hassan, Jackson Martin Hauer-Jensen, Little Rock Koichi Hayano, Boston Yingli Hee, Atlanta Samuel B Ho, San Diego Jason Ken Hou, Houston Lifang Hou, Chicago K-Qin Hu, Orange Jamal A Ibdah, Columbia Robert Thomas Jensen, Bethesda Huanguang Charlie Jia, Gainesville Rome Jutabha, Los Angeles Andreas M Kaiser, Los Angeles Avinash Kambadakone, Boston David Edward Kaplan, Philadelphia Randeep Kashyap, Rochester Rashmi Kaul, Tulsa Ali Keshavarzian, Chicago Amir Maqbul Khan, Marshall Nabeel Hasan Khan, New Orleans Sahil Khanna, Rochester Kusum K Kharbanda, Omaha Hyun Sik Kim, Pittsburgh Joseph Kim, Duarte Jae S Kim, Gainesville Miran Kim, Providence Timothy R Koch, Washington Burton I Korelitz, New York Betsy Kren, Minneapolis Shiu-Ming Kuo, Buffalo Michelle Lai, Boston Andreas Larentzakis, Boston Edward Wolfgang Lee, Los Angeles Daniel A Leffler, Boston Michael Leitman, New York Suthat Liangpunsakul, Indianapolis Joseph K Lim, New Haven Elaine Y Lin, Bronx Henry C Lin, Albuquerque Rohit Loomba, La Jolla James David Luketich, Pittsburgh Mohammad F Madhoun, Oklahoma City Thomas C Mahl, Buffalo Ashish Malhotra, Bettendorf Pranoti Mandrekar, Worcester John Marks, Wynnewood Wendy M Mars, Pittsburgh Julien Vahe Matricon, San Antonio Craig J McClain, Louisville George K Michalopoulos, Pittsburgh Tamir Miloh, Phoenix Ayse Leyla Mindikoglu, Baltimore Huanbiao Mo, Denton Klaus Monkemuller, Birmingham John Morton, Stanford Adnan Muhammad, Tampa Michael J Nowicki, Jackson Patrick I Okolo, Baltimore Giusepp Orlando, Winston Salem Natalia A Osna, Omaha Virendra N Pandey, Newark Mansour A Parsi, Cleveland Michael F Picco, Jacksonville Daniel S Pratt, Boston Xiaofa Qin, Newark Janardan K Reddy, Chicago Victor E Reyes, Galveston Jon Marc Rhoads, Houston Giulia Roda, New York Jean-Francois Armand Rossignol, Tampa Paul A Rufo, Boston Madhusudana Girija Sanal, New York Miguel Saps, Chicago Sushil Sarna, Galveston Ann O Scheimann, Baltimore Bernd Schnabl, La Jolla Matthew J Schuchert, Pittsburgh Ekihiro Seki, La Jolla Chanjuan Shi, Nashville David Quan Shih, Los Angeles William B Silverman, Iowa City Shashideep Singhal, New York Bronislaw L Slomiany, Newark Steven F Solga, Bethlehem Byoung-Joon Song, Bethesda Dario Sorrentino, Roanoke Scott R Steele, Fort Lewis VIII January 22, 2014

10 Branko Stefanovic, Tallahassee Arun Swaminath, New York Kazuaki Takabe, Richmond Naoki Tanaka, Bethesda Hans Ludger Tillmann, Durham George Triadafilopoulos, Stanford John Richardson Thompson, Nashville Andrew Ukleja, Weston Miranda AL van Tilburg, Chapel Hill Gilberto Vaughan, Atlanta Vijayakumar Velu, Atlanta Gebhard Wagener, New York Kasper Saonun Wang, Los Angeles Xiangbing Wang, New Brunswick Daoyan Wei, Houston Theodore H Welling, Ann Arbor C Mel Wilcox, Birmingham Jacqueline Lee Wolf, Boston Harry Hua-Xiang Xia, East Hanover Wen Xie, Pittsburgh Guang Yu Yang, Chicago Michele T Yip-Schneider, Indianapolis Kezhong Zhang, Detroit Huiping Zhou, Richmond Xiao-Jian Zhou, Cambridge Richard Zubarik, Burlington Venezuela Miguel Angel Chiurillo, Barquisimeto Vietnam Van Bang Nguyen, Hanoi IX January 22, 2014

11 S Contents Weekly Volume 20 Number 11 March 21, 2014 TOPIC HIGHLIGHT 2735 Adjuncts to colonic cleansing before colonoscopy Park S, Lim YJ 2741 What is the best strategy for successful bowel preparation under special conditions? Lim YJ, Hong SJ 2746 Bowel preparations as quality indicators for colonoscopy Jang JY, Chun HJ 2751 Helicobacter pylori infection in gastric mucosa-associated lymphoid tissue lymphoma Park JB, Koo JS 2760 Efficacy of Helicobacter pylori eradication for the prevention of metachronous gastric cancer after endoscopic resection for early gastric cancer Jang JY, Chun HJ 2765 Helicobacter pylori infection following partial gastrectomy for gastric cancer Park S, Chun HJ 2771 Challenges in managing hepatitis C virus infection in cancer patients Borchardt RA, Torres HA 2777 Role of macrophages and monocytes in hepatitis C virus infections Revie D, Salahuddin SZ 2785 Establishment of chronic hepatitis C virus infection: Translational evasion of oxidative defence Chan SW 2801 Kidney transplantation from donors with hepatitis C infection Veroux M, Corona D, Sinagra N, Giaquinta A, Zerbo D, Ekser B, Giuffrida G, Caglià P, Gula R, Ardita V, Veroux P March 21, 2014 Volume 20 Issue 11

12 Contents World Journal of Gastroenterology Volume 20 Number 11 March 21, Histopathological evaluation of recurrent hepatitis C after liver transplantation: A review Vasuri F, Malvi D, Gruppioni E, Grigioni WF, D Errico-Grigioni A 2825 Hepatitis C virus and metabolic disorder interactions towards liver damage and atherosclerosis Vespasiani-Gentilucci U, Gallo P, De Vincentis A, Galati G, Picardi A 2839 Individualization of chronic hepatitis C treatment according to the host characteristics Gatselis NK, Zachou K, Saitis A, Samara M, Dalekos GN 2854 Non-invasive diagnosis of liver fibrosis in chronic hepatitis C Schiavon LL, Narciso-Schiavon JL, Carvalho-Filho RJ 2867 Chronic hepatitis C genotype 1 virus: Who should wait for treatment? Tovo CV, Alves de Mattos A, Lerias de Almeida PR 2876 Hepatitis C-related liver cirrhosis - strategies for the prevention of hepatic decompensation, hepatocarcinogenesis, and mortality Toshikuni N, Arisawa T, Tsutsumi M 2888 Interaction between hepatitis C virus and metabolic factors Kawaguchi Y, Mizuta T 2902 Hepatitis C virus NS5A inhibitors and drug resistance mutations Nakamoto S, Kanda T, Wu S, Shirasawa H, Yokosuka O 2913 Understanding the interaction of hepatitis C virus with host DEAD-box RNA helicases Upadya MH, Aweya JJ, Tan YJ 2927 Hepatitis C virus genotype 6: Virology, epidemiology, genetic variation and clinical implication VO TD, Akkarathamrongsin S, Poovorawan K, Tangkijvanich P, Poovorawan Y 2941 Medicinal plants against hepatitis C virus Ashfaq UA, Idrees S 2948 Current testing strategies for hepatitis C virus infection in blood donors and the way forward Marwaha N, Sachdev S II March 21, 2014 Volume 20 Issue 11

13 Contents World Journal of Gastroenterology Volume 20 Number 11 March 21, Updates on the treatment and outcomes of dual chronic hepatitis C and B virus infection Liu CJ, Chen PJ 2962 Useful biomarkers for assessment of hepatitis C virus infection-associated autoimmune disorders Yang DH, Ho LJ, Lai JH MINIREVIEWS 2971 Host RNA circles and the origin of hepatitis delta virus Taylor JM ORIGINAL ARTICLE 2979 Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines Khan S, Cameron S, Blaschke M, Moriconi F, Naz N, Amanzada A, Ramadori G, Malik IA BRIEF ARTICLE 2995 Frequency and prognostic role of mucosal healing in patients with Crohn's disease and ulcerative colitis after one-year of biological therapy Farkas K, Lakatos PL, Szűcs M, Pallagi-Kunstár É, Bálint A, Nagy F, Szepes Z, Vass N, Kiss LS, Wittmann T, Molnár T 3002 A randomized trial of iron depletion in patients with nonalcoholic fatty liver disease and hyperferritinemia Valenti L, Fracanzani AL, Dongiovanni P, Rovida S, Rametta R, Fatta E, Pulixi EA, Maggioni M, Fargion S 3011 Hyperoxia accelerates progression of hepatic fibrosis by up-regulation of transforming growth factor-β expression Lee SH, Do SI, Kim HS 3018 Midkine promotes perineural invasion in human pancreatic cancer Yao J, Li WY, Li SG, Feng XS, Gao SG 3025 Mass spectrometry-based serum peptide profiling in hepatocellular carcinoma with bone metastasis He J, Zeng ZC, Xiang ZL, Yang P SYSTEMATIC REVIEW 3033 Reappraisal of xenobiotic-induced, oxidative stress-mediated cellular injury in chronic pancreatitis: A systematic review Siriwardena AK III March 21, 2014 Volume 20 Issue 11

14 Contents World Journal of Gastroenterology Volume 20 Number 11 March 21, 2014 CASE REPORT 3044 Acute hepatitis B of genotype H resulting in persistent infection Yamada N, Shigefuku R, Sugiyama R, Kobayashi M, Ikeda H, Takahashi H, Okuse C, Suzuki M, Itoh F, Yotsuyanagi H, Yasuda K, Moriya K, Koike K, Wakita T, Kato T 3050 Classifying extrahepatic bile duct metachronous carcinoma by de novo neoplasia site Kwon HJ, Kim SG, Chun JM, Hwang YJ 3056 Valsalva retinopathy following esophagogastroduodenoscopy under propofol sedation: A case report Park JH, Sagong M, Chang W IV March 21, 2014 Volume 20 Issue 11

15 Contents World Journal of Gastroenterology Volume 20 Number 11 March 21, 2014 APPENDIX I-VI Instructions to authors ABOUT COVER Editorial Board Member of World Journal of Gastroenterology, Gabriele Grassi, MD, PhD, Associate Professor, Department of Life Sciences, University Hospital of Cattinara, Trieste, Italy AIMS AND SCOPE World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1339 experts in gastroenterology and hepatology from 67 countries. The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. INDEXING/ABSTRACTING World Journal of Gastroenterology is now indexed in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Journal Citation Reports, Gastroenterology and Hepatology, 2012 Impact Factor: (34/74); Total Cites: (6/74); Current Articles: 944 (1/74); and Eigenfactor Score: (6/74). FLYLEAF I-IX Editorial Board EDITORS FOR THIS ISSUE Responsible Assistant Editor: Xin-Xin Che Responsible Electronic Editor: Xiao-Mei Liu Proofing Editor-in-Chief: Lian-Sheng Ma Responsible Science Editor: Su-Xin Gou Proofing Editorial Office Director: Xiu-Xia Song NAME OF JOURNAL World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) LAUNCH DATE October 1, 1995 FREQUENCY Weekly EDITORS-IN-CHIEF Damian Garcia-Olmo, MD, PhD, Doctor, Professor, Surgeon, Department of Surgery, Universidad Autonoma de Madrid; Department of General Surgery, Fundacion Jimenez Diaz University Hospital, Madrid 28040, Spain Saleh A Naser, PhD, Professor, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL 32816, United States Stephen C Strom, PhD, Professor, Department of Laboratory Medicine, Division of Pathology, Karolinska Institutet, Stockholm , Sweden Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States EDITORIAL OFFICE Jin-Lei Wang, Director Xiu-Xia Song, Vice Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: bpgoffice@wjgnet.com PUBLISHER Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: bpgoffice@wjgnet.com PUBLICATION DATE March 21, 2014 COPYRIGHT 2014 Baishideng Publishing Group Co., Limited. Articles published by this Open-Access journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. SPECIAL STATEMENT All articles published in this journal represent the viewpoints of the authors except where indicated otherwise. INSTRUCTIONS TO AUTHORS Full instructions are available online at wjgnet.com/ /g_info_ htm ONLINE SUBMISSION V March 21, 2014 Volume 20 Issue 11

16 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor Adjuncts to colonic cleansing before colonoscopy TOPIC HIGHLIGHT Sanghoon Park, Yun Jeong Lim Sanghoon Park, Department of Internal Medicine, KEPCO Medical Center, KEPCO Medical Foundation, Seoul , South Korea Yun Jeong Lim, Department of Internal Medicine, Dongguk University Ilsan Hospital, Goyang , South Korea Author contributions: Park S and Lim YJ performed the literature review and analyzed the collected data; Park S wrote the manuscript; Lim YJ supervised the review project. Correspondence to: Yun Jeong Lim, MD, Professor of Medicine, Department of Internal Medicine, Dongguk University Ilsan Hospital, 814 Siksa-dong, Ilsandong-gu, Goyang , South Korea. limyj@dongguk.ac.kr Telephone: Fax: Received: August 8, 2013 Revised: January 25, 2014 Accepted: February 20, 2014 Published online: March 21, 2014 Abstract Pre-procedural cleansing of the bowel can maximize the effectiveness and efficiency of colonoscopy. Yet, efficacy of the current gold standard colonic preparation method - high-volume oral administration of purgative agents h prior to the procedure - is limited by several factors, such as patient compliance (due to poor palatability and inconvenience of the dosing regimen) and risks of complications (due to drug interactions or intolerance). Attempts to resolve these limitations have included providing adjunctive agents and methods to promote the colonic cleansing ability of the principal purgative agent, with the aim of lessening unpleasant side effects (such as bloating) and reducing the large ingested volume requirement. Several promising adjunctive agents are bisacodyl, magnesium citrate, senna, simethicone, metoclopramide, and prokinetics, and each are being investigated for their potential. This review provides an up to date summary of the reported investigations into the potencies and weaknesses of the key adjuncts currently being applied in clinic as supplements to the traditional bowel preparation agents. While the comparative analysis of these adjuncts showed that no single agent or method has yet achieved the goal of completely overcoming the limitations of the current gold standard preparation method, they at least provide endoscopists with an array of alternatives to help improve the suboptimal efficacy of the main cleansing solutions when used alone. To aid in this clinical endeavor, a subjective grade was assigned to each adjunct to indicate its practical value. In addition, the systematic review of the currently available agents and methods provides insight into the features of each that may be overcome or exploited to create novel drugs and strategies that may become adopted as effective bowel cleansing adjuncts or alternatives Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Colonoscopy; Cathartics; Adjuncts; Purgative agents; Bowel preparation Core tip: Fair bowel cleansing is a prerequisite for unobstructed visualization in colonoscopy. Since the gold standard self-managed preparation procedure and purgative agent-related complications can limit thorough cleansing, several adjunctive agents and methods have been developed. Clinical experience with these adjuncts have led to some being advocated by endoscopists as useful accessory drugs and to others being criticized for causing further adverse effects or providing insufficient additional benefit. In this article, we reviewed several of the agents that are currently used as colonic cleansing adjuncts and provide a subjective evaluation of their practical value based on their evidentiary strengths and drawbacks. Park S, Lim YJ. Adjuncts to colonic cleansing before colonoscopy. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: March 21, 2014 Volume 20 Issue 11

17 Park S et al. Adjuncts to colonic cleansing INTRODUCTION A number of purgative agents are currently in clinical use for bowel preparation prior to colonoscopy. While none has provided optimal safety and efficacy profiles, each represents unique strengths and weaknesses (in terms of efficiency, ingested volume, taste, and time required for preparation) that may help to improve the chances of achieving more thorough bowel cleansing. For instance, polyethylene glycol (PEG) is generally considered an adequate colonic cleansing agent, but its salty taste is highly impalatable and cited by patients as a key reason for not completing the dosing regimen; the resultant inadequate bowel preparation has led to these patients frequently requiring repeat colonoscopy, with the extent of unremoved fecal obstruction sometimes completely inhibiting visualization [1]. To overcome the limitations of the main colonic cleansing agents, several adjunct purgative agents and methods have been developed. While some adjuncts have potential for use as independent colonic cleansing agents, they have typically been applied in clinical practice as additive means to complement the main agent; although, some reports exist in the literature of their use as a surrogate under narrow indications. In this article, we review the evidentiary information for several of the agents and methods that are currently used as colonic cleansing adjuncts and discuss the potential of each to facilitate or substitute the cleansing function of the main regimen. COMMONLY USED ADJUNCTS OF COLONIC CLEANSING AGENTS Bisacodyl Bisacodyl is an unabsorbable diphenylmethane derivative with stimulant laxative properties. Adjunct administration of bisacodyl is routinely carried out to facilitate bowel preparation by high-volume balanced purgative solutions, such as PEG. However, systematic evaluations of bisacodyl s efficacy when used with full-volume PEG have yielded inconsistent results. One study showed that a bisacodyl regimen of 20 mg over a 2 d period shortened the duration of the main gut irrigation procedure and produced no side-effects [2]. However, a study of the effective benefit of bisacodyl to the PEG-based regimen found that it provided no significant improvement in cleansing quality as compared with a PEG-only regimen [3]. Another study suggested that the benefit of providing bisacodyl adjunct to the main regimens based on isosmotic solutions (such as PEG) was a reduction in the volume of purgative agent that needed to be ingested to achieve effective bowel cleansing [4]. Similarly, when 15 mg of bisacodyl was administered with a PEGbased regimen not only was a lower volume of the main solution required (down to 2 L from the 4 L required for the PEG-only regimen) but the patients showed a better compliance rate and reported experiencing less nausea during the preparative period [5]. Comparative analysis of the adjunctive benefits of bisacodyl to another common adjunctive agent - magnesium citrate (MC, discussed below) - confirmed the positive feature of bisacodyl substantially reducing the PEG volume necessary for complete cleaning but indicated that patients preferred MC, likely due to its lower rate of side-effects [6]. Indeed, bisacodyl administration carries a risk of inducing the life-threatening condition of ischemic colitis [7,8], and this potential complication, though rare, is a serious consideration for cautious application. Further research is needed to determine the precise indications for bisacodyl use that will correspond with maximal efficacy and safety profiles of this adjunctive agent. MC and MC-adjunctive regimens (oral sodium picosulfate/mc) MC is a salt compound that functions as an osmotic laxative and is administered as a hyperosmolar saline solution. The solution draws water into the colonic lumen, thereby increasing intraluminal fecal volume and stimulating gut motility. Clinical application of MC as an adjunctive agent to the main isosmotic purgative solution regimens has been reported to provide effective cleansing with substantially reduced volumes. Similar to the volume-reducing effects of bisacodyl, MC adjunctive application increased cleansing efficacy of the main PEG solution so that only 2 L of the main agent was required (vs 4 L) and significantly enhanced patient tolerance of the cleansing regimen [9]. As cited above, MC was also indicated by patients as preferable to bisacodyl, likely because of fewer unwanted side-effects [6]. The osmotic laxative action of MC is enhanced by co-administration of a stimulant laxative agent. Sodium picosulfate/mc combination preparations (marketed under the trade names Picolax, Picoprep, Prepopik, Picolax, Citrafleet, and Picolight) are well-established in clinical practice in the United Kingdom and Korea, and have recently been approved for use in the United States [10]. Several studies have compared the efficacies of sodium picosulfate/mc preparations with conventional isosmotic cleansing agents, such as PEG, as well as another common saline laxative (sodium phosphate). In one comparative analysis of single-regimens of sodium phosphate, PEG, and sodium picosulfate/mc, the latter two agents were found to have similar bowel cleansing performance (as indicated by the Ottawa bowel preparation assessment tool) [11]. Yet, another comparative analysis of single-regimen sodium picosulfate/mc (Picolax) and PEG showed the two to be comparable in preparation efficacy but indicated that the former was superior in promoting patient compliance since it produced significantly less nausea/vomiting and posed less difficulty for patient consumption [12]. The lower level of nausea/ vomiting was confirmed by another comparative analysis of a generic sodium picosulfate/mc preparation and PEG, but in this study former was shown to produce superior bowel cleansing than the 3 L of PEG [13]. Still 2736 March 21, 2014 Volume 20 Issue 11

18 Park S et al. Adjuncts to colonic cleansing another study revealed a higher rate of patient preference for the sodium picosulfate/mc preparation when repetitive administrations were required among subjects who experienced similar clinical side effects to the different regimens evaluated [14]. In an attempt to gain a better understanding of the efficacy and safety profiles of sodium picosulfate/mc preparations as an independent cleansing regimen, a meta-analysis was performed by Tan and Tjandra [15]. The sodium picosulfate/mc preparations were found to be superior to PEG-based regimens, as they produced the statistically significant benefit of fewer adverse events and a comparable level of bowel cleansing. Indeed, the European Society of Gastrointestinal Endoscopy (ESGE) guidelines for bowel preparation for endoscopy published in 2013 cited the comparable levels of bowel cleansing achieved between the different regimens, as reported in the collective literature [16]. Despite the promising findings related to the bowel cleansing efficacy of MC, this osmotic laxative has some drawbacks. MC should be cautiously applied to patients with renal insufficiency or failure, who risk detrimental accumulation of magnesium due to inefficient clearance by the impaired kidney [17]. Moreover, concurrent medications or medical conditions that can influence renal and intestinal function may also lead to elevated magnesium levels in serum, a condition known as hypermagnesemia that is accompanied fluid and electrolyte imbalance. Hypermagnesemia itself is a risk factor for cardiovascular and neuromuscular complications [18], and particular caution should be taken in elderly patients who are already at risk for these types of disorders and have worse prognoses related to them. Indeed, age-related increases in blood levels of sodium, potassium, and urea have been shown following MC administration [19] ; it is theorized that these potentially detrimental responses may stem from age-related decrement of renal function and reduced intestinal peristalsis, as well as concurrent medications [20]. Senna Extracts from the Senna genus of plants have well-established stimulant laxative properties. The collective investigations into the various known senna glycosides have revealed that upon ingestion these derivatives are activated by intestinal flora and directly interact with the gut mucosa to stimulate bowel movement and to inhibit electrolyte and water absorption. Senna has proven useful as a bowel preparative agent when applied at high doses, both alone and as an adjunct. However, the sideeffect of considerable abdominal pain has limited its use, and in the meantime balanced solution-type cleansing agents have largely substituted its role as a colonoscopy preparative agent [21,22]. As an adjunct, senna is commonly applied with PEG, and the collective clinical experience has led to its being generally characterized as an effective agent to intensify the main agent s cleansing ability. Adjunct senna has been shown to decrease the volume of PEG required to achieve effective bowel cleansing and to be associated with higher rate of patient tolerance than full-dose (4 L) PEG [23]. Another study also reported improved compliance of subjects with senna adjuvant and low-volume PEG, but demonstrated it was less effective at bowel cleansing than full-dose PEG alone [24]. It is important to note that senna is not widely used in the United States and has not gained approval from the nation s federal drug administration for its use as a colonic cleansing agent [17] ; as such, fewer studies on its efficacy and safety profiles are available, especially when compared to the extensive research findings that have been published for bisacodyl. Nonetheless, the collective findings on senna suggest that it is an adequate adjunct colonic cleansing agent in that it lessens the volume of PEG solution but may not be an effective bowel cleansing agent in isolation due to its side effect of abdominal pain. Comparative analyses with other adjuncts should be carried out in order to gain a better understanding of its efficacy and safety. Simethicone As an anti-gas and anti-flatulent agent, simethicone has been suggested (and applied in clinic) as an accessory agent of colonic preparation using the standard bowel preparation regimens [15]. When combined with the traditional PEG preparatory solution, simethicone significantly decreases the formation of foam and patients have less complaints of gas-related side-effects [25,26]. Adjunctive administration also has been shown to eliminate bubbles and improve the cleansing quality of the sodium phosphate preparation [27]. However, a meta-analysis of the overall studies of simethicone adjunctive efficacy failed to demonstrate a superior colonic cleansing ability [26]. There is still no consensus in the field as to whether simethicone should be recommended for adjuvant use; for example, the American Society for Gastrointestinal Endoscopy recommended its use and the ESGE recommended against its routine application as part of the standard pre-procedural preparation [28]. Undoubtedly, further investigations are needed to confirm the usefulness of simethicone as an adjunct agent for colonoscopy preparation. Metoclopramide and other prokinetics Metoclopramide is a well-established dopamine antagonist, which sensitizes tissues to the action of acetylcholine. This agent exerts an appreciable influence on peristalsis of the upper gastrointestinal regions but has no appreciable effect on the colon [29]. Therefore, the clinical utility of adjunctive metoclopramide is limited to improvement of nausea or bloating side-effects related to the main colonic cleansing agent, but it is not itself a colonic preparation per se [30]. Some investigators have expressed skepticism concerning the action of metoclopramide, reporting no apparent influence of this adjunct on the abdominal symptoms [31,32]. In general, however, metoclopramide use is limited by its associated risk of 2737 March 21, 2014 Volume 20 Issue 11

19 Park S et al. Adjuncts to colonic cleansing Table 1 Summary of the currently used colonic preparation adjuncts reviewed in this study Adjunct Substance/functions/ mechanism Strengths Weakness Conclusion Bisacodyl 1 Diphenylmethane; stimulant laxative Useful for bowel preparation with Rare complication risk of ischemic low-volume polyethylene glycol (PEG) colitis [7,8] solution; reduces nausea and provides comparable cleansing potency [4,5] Magnesium citrate 2 Osmotic laxative Useful for bowel preparation with low-volume PEG solution; superior to other adjuncts in efficacy [9] Senna (sennoside) 2 Pod or leaf of Senna alexandrina, stimulant laxatives Cleansing effect is comparable to PEG; has fair patient compliance [12] Useful for bowel preparation with low-volume PEG solution [23] Simethicone 1 Anti-gas, anti-flatulent May be useful for lessening bubble formation [25] Prokinetics 1 Sports drink ingredient (Gatorade) Metoclopramide (dopamine antagonist) Mosapride (5-HT4 receptor agonist), itopride (dopamine D2 receptor antagonist) MiraLAX/Gatorade Anti-emetic, anti-bloating effects Use with caution in patients with poor renal function, due to increased risk of hypermagnesemia [17] Risk of abdominal pain with highdose; possible complication risk of ischemic colitis Controversial results on its efficacy as an adjunct May be used to reduce the large-volume dose of PEG solution; generally considered a useful substitute to the main bowel cleansing agents [15] Generally considered an adequate adjunctive agent Limited usefulness for strengthening colonic preparation [26] ; some Not widely used as an adjunct experts do not recommend its use [28] No apparent influence on colonic May be useful for preventing cleansing [29] ; extrapyramidal symptoms occur with high-dose ing or relieving nausea and bloat- sensation Stimulates colonic peristalsis [33,34] Unknown Potential as an alternative adjunct in geographic regions with market availability Superior palatability and higher bowel preparation rates (i.e., cleaner bowel) [35,36] Risk of inducing fluid- electrolyte disturbances due to its non-isoosmolarity Potential alternative in available area 1 Recommendable agent; 2 Fairly recommendable agent based on the collective findings from this literature review. causing extrapyramidal symptoms. New prokinetic drugs have been developed and introduced to the market over the past decades and systematic investigations into their usefulness as adjuncts for bowel preparation are beginning to accumulate in the literature. A study of mosapride, a selective 5-hydroxytryptamine-4 receptor agonist, administered at a dose of 15 mg immediately prior to ingestion of the 2 L of PEG solution provided superior colonic cleansing than the same PEG regimen administered with placebo [33]. Itopride, another prokinetic, was also reported to decrease uncomfortable abdominal symptoms when used as an adjunctive to the standard PEG or MC colonic preparations [34]. Others Gatorade sports drink has been combined with PEG 3350 powder (MiraLAX ) to provide better tolerability of the PEG solution by decreasing the volume required. Gatorade is not an isosmotic solution and represents a risk of inducing electrolyte imbalance. Clinical studies have addressed its potential as a safe and effective adjunct and have shown that a split-dose of MiraLAX/ Gatorade is an effective option for achieving adequate colonic cleansing [35,36]. CONCLUSION Adjunctive agents are used mainly to facilitate the cleansing efficacy of colon preparation performed by the main purgative regimens applied in current clinical practice, such as those involving PEG or sodium phosphate solution. To aid in decision-making by treating endoscopists, the various adjunctive agents and methods described herein are summarized in Table 1. In addition, a grade has been assigned to each agent according to the collective findings from this literature review, with two asterisks indicating fairly recommendable and one asterisk indicating recommendable agents. The sodium picosulfate/mc regimen is gradually being accepted as a major bowel cleansing regimen, with its efficacy and safety profiles being maximized according to the individual patients indications (primarily, adequate renal function). Senna, metoclopramide, and bisacodyl have the advantage of reducing volume of the large-amount balanced solution that is required for bowel cleansing, thereby enhancing patients compliance with the preparation procedure. However, the exact efficacy and safety profiles of these agents remain to be definitely established and cautious selection of adjuncts by endoscopists with ample experience remains necessary. REFERENCES 1 Lebwohl B, Neugut AI. Post-colonoscopy recommendations after inadequate bowel preparation: all in the timing. Dig Dis Sci 2013; 58: [PMID: DOI: / s y] 2 Rings EH, Mulder CJ, Tytgat GN. The effect of bisacodyl on whole-gut irrigation in preparation for colonoscopy. Endoscopy 1989; 21: [PMID: DOI: / 2738 March 21, 2014 Volume 20 Issue 11

20 Park S et al. Adjuncts to colonic cleansing s ] 3 Brady CE, Dipalma JA, Beck DE. Effect of bisacodyl on gut lavage cleansing for colonoscopy. Ann Clin Res 1987; 19: [PMID: ] 4 DiPalma JA, Wolff BG, Meagher A, Cleveland Mv. Comparison of reduced volume versus four liters sulfate-free electrolyte lavage solutions for colonoscopy colon cleansing. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 5 Adams WJ, Meagher AP, Lubowski DZ, King DW. Bisacodyl reduces the volume of polyethylene glycol solution required for bowel preparation. Dis Colon Rectum 1994; 37: ; discussion [PMID: ] 6 Sharma VK, Chockalingham SK, Ugheoke EA, Kapur A, Ling PH, Vasudeva R, Howden CW. Prospective, randomized, controlled comparison of the use of polyethylene glycol electrolyte lavage solution in four-liter versus twoliter volumes and pretreatment with either magnesium citrate or bisacodyl for colonoscopy preparation. Gastrointest Endosc 1998; 47: [PMID: DOI: / S (98) ] 7 Bechtold ML, Choudhary A. Bowel preparation prior to colonoscopy: a continual search for excellence. World J Gastroenterol 2013; 19: [PMID: DOI: / wjg.v19.i2.155] 8 Ajani S, Hurt RT, Teeters DA, Bellmore LR. Ischaemic colitis associated with oral contraceptive and bisacodyl use. BMJ Case Rep 2012; 2012: pii: bcr [PMID: DOI: /bcr ] 9 Sharma VK, Steinberg EN, Vasudeva R, Howden CW. Randomized, controlled study of pretreatment with magnesium citrate on the quality of colonoscopy preparation with polyethylene glycol electrolyte lavage solution. Gastrointest Endosc 1997; 46: [PMID: ] 10 Hoy SM, Scott LJ, Wagstaff AJ. Sodium picosulfate/magnesium citrate: a review of its use as a colorectal cleanser. Drugs 2009; 69: [PMID: DOI: / ] 11 Lawrance IC, Willert RP, Murray K. Bowel cleansing for colonoscopy: prospective randomized assessment of efficacy and of induced mucosal abnormality with three preparation agents. Endoscopy 2011; 43: [PMID: DOI: /s ] 12 Hamilton D, Mulcahy D, Walsh D, Farrelly C, Tormey WP, Watson G. Sodium picosulphate compared with polyethylene glycol solution for large bowel lavage: a prospective randomised trial. Br J Clin Pract 1996; 50: [PMID: ] 13 Regev A, Fraser G, Delpre G, Leiser A, Neeman A, Maoz E, Anikin V, Niv Y. Comparison of two bowel preparations for colonoscopy: sodium picosulphate with magnesium citrate versus sulphate-free polyethylene glycol lavage solution. Am J Gastroenterol 1998; 93: [PMID: DOI: /j x] 14 Worthington J, Thyssen M, Chapman G, Chapman R, Geraint M. A randomised controlled trial of a new 2 litre polyethylene glycol solution versus sodium picosulphate + magnesium citrate solution for bowel cleansing prior to colonoscopy. Curr Med Res Opin 2008; 24: [PMID: DOI: / X260844] 15 Tan JJ, Tjandra JJ. Which is the optimal bowel preparation for colonoscopy - a meta-analysis. Colorectal Dis 2006; 8: [PMID: DOI: /j x] 16 Hassan C, Bretthauer M, Kaminski MF, Polkowski M, Rembacken B, Saunders B, Benamouzig R, Holme O, Green S, Kuiper T, Marmo R, Omar M, Petruzziello L, Spada C, Zullo A, Dumonceau JM. Bowel preparation for colonoscopy: European Society of Gastrointestinal Endoscopy (ESGE) guideline. Endoscopy 2013; 45: [PMID: DOI: /s ] 17 Adamcewicz M, Bearelly D, Porat G, Friedenberg FK. Mechanism of action and toxicities of purgatives used for colonoscopy preparation. Expert Opin Drug Metab Toxicol 2011; 7: [PMID: DOI: / ] 18 Nyberg C, Hendel J, Nielsen OH. The safety of osmotically acting cathartics in colonic cleansing. Nat Rev Gastroenterol Hepatol 2010; 7: [PMID: DOI: / nrgastro ] 19 Ryan F, Anobile T, Scutt D, Hopwood M, Murphy G. Effects of oral sodium picosulphate Picolax on urea and electrolytes. Nurs Stand 2005; 19: [PMID: ] 20 Dillon CE, Laher MS. The rapid development of hyponatraemia and seizures in an elderly patient following sodium picosulfate/magnesium citrate (Picolax). Age Ageing 2009; 38: 487 [PMID: DOI: /ageing/afp054] 21 Amato A, Radaelli F, Paggi S, Terruzzi V. Half doses of PEG- ES and senna vs. high-dose senna for bowel cleansing before colonoscopy: a randomized, investigator-blinded trial. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 22 Radaelli F, Meucci G, Imperiali G, Spinzi G, Strocchi E, Terruzzi V, Minoli G. High-dose senna compared with conventional PEG-ES lavage as bowel preparation for elective colonoscopy: a prospective, randomized, investigator-blinded trial. Am J Gastroenterol 2005; 100: [PMID: DOI: /j x] 23 Iida Y, Miura S, Asada Y, Fukuoka K, Toya D, Tanaka N, Fujisawa M. Bowel preparation for the total colonoscopy by 2,000 ml of balanced lavage solution (Golytely) and sennoside. Gastroenterol Jpn 1992; 27: [PMID: ] 24 Hookey LC, Depew WT, Vanner SJ. Combined low volume polyethylene glycol solution plus stimulant laxatives versus standard volume polyethylene glycol solution: a prospective, randomized study of colon cleansing before colonoscopy. Can J Gastroenterol 2006; 20: [PMID: ] 25 Lazzaroni M, Petrillo M, Desideri S, Bianchi Porro G. Efficacy and tolerability of polyethylene glycol-electrolyte lavage solution with and without simethicone in the preparation of patients with inflammatory bowel disease for colonoscopy. Aliment Pharmacol Ther 1993; 7: [PMID: ] 26 Matro R, Tupchong K, Daskalakis C, Gordon V, Katz L, Kastenberg D. The effect on colon visualization during colonoscopy of the addition of simethicone to polyethylene glycol-electrolyte solution: a randomized single-blind study. Clin Transl Gastroenterol 2012; 3: e26 [PMID: DOI: /ctg ] 27 Tongprasert S, Sobhonslidsuk A, Rattanasiri S. Improving quality of colonoscopy by adding simethicone to sodium phosphate bowel preparation. World J Gastroenterol 2009; 15: [PMID: ] 28 Mathus-Vliegen E, Pellisé M, Heresbach D, Fischbach W, Dixon T, Belsey J, Parente F, Rio-Tinto R, Brown A, Toth E, Crosta C, Layer P, Epstein O, Boustiere C. Consensus guidelines for the use of bowel preparation prior to colonic diagnostic procedures: colonoscopy and small bowel video capsule endoscopy. Curr Med Res Opin 2013; 29: [PMID: DOI: / ] 29 Wexner SD, Beck DE, Baron TH, Fanelli RD, Hyman N, Shen B, Wasco KE. A consensus document on bowel preparation before colonoscopy: prepared by a task force from the American Society of Colon and Rectal Surgeons (ASCRS), the American Society for Gastrointestinal Endoscopy (ASGE), and the Society of American Gastrointestinal and Endoscopic Surgeons (SAGES). Gastrointest Endosc 2006; 63: [PMID: DOI: /j.gie ] 30 Rhodes JB, Engstrom J, Stone KF. Metoclopramide reduces the distress associated with colon cleansing by an oral electrolyte overload. Gastrointest Endosc 1978; 24: [PMID: ] 31 Golub RW, Kerner BA, Wise WE, Meesig DM, Hartmann RF, Khanduja KS, Aguilar PS. Colonoscopic bowel prepara March 21, 2014 Volume 20 Issue 11

21 Park S et al. Adjuncts to colonic cleansing tions--which one? A blinded, prospective, randomized trial. Dis Colon Rectum 1995; 38: [PMID: ] 32 Brady CE, DiPalma JA, Pierson WP. Golytely lavage-- is metoclopramide necessary? Am J Gastroenterol 1985; 80: [PMID: ] 33 Tajika M, Niwa Y, Bhatia V, Kawai H, Kondo S, Sawaki A, Mizuno N, Hara K, Hijioka S, Matsumoto K, Kobayashi Y, Saeki A, Akabane A, Komori K, Yamao K. Efficacy of mosapride citrate with polyethylene glycol solution for colonoscopy preparation. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 34 Mishima Y, Amano Y, Okita K, Takahashi Y, Moriyama N, Ishimura N, Furuta K, Ishihara S, Adachi K, Kinoshita Y. Efficacy of prokinetic agents in improving bowel preparation for colonoscopy. Digestion 2008; 77: [PMID: DOI: / ] 35 Samarasena JB, Muthusamy VR, Jamal MM. Split-dosed MiraLAX/Gatorade is an effective, safe, and tolerable option for bowel preparation in low-risk patients: a randomized controlled study. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ] 36 Shieh FK, Gunaratnam N, Mohamud SO, Schoenfeld P. MiraLAX-Gatorade bowel prep versus GoLytely before screening colonoscopy: an endoscopic database study in a community hospital. J Clin Gastroenterol 2012; 46: e96-e100 [PMID: DOI: /MCG.0b013e bfb] P- Reviewers: Tajika M, Velayos B S- Editor: Gou SX L- Editor: A E- Editor: Liu XM 2740 March 21, 2014 Volume 20 Issue 11

22 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor TOPIC HIGHLIGHT What is the best strategy for successful bowel preparation under special conditions? Yun Jeong Lim, Su Jin Hong Yun Jeong Lim, Department of Internal Medicine, College of Medicine, Dongguk University, Gyeonggi-Do , South Korea Su Jin Hong, Digestive Disease Center and Research Institute, Department of Internal Medicine, Soonchunhyang University College of Medicine, Bucheon, Gyeonggi-Do , South Korea Author contributions: Lim YJ searched the literature, collected the relevant studies and data, and wrote the manuscript; Hong SJ contributed intellectual discussions and supervised the review design and construction. Correspondence to: Su Jin Hong, MD, PhD, Digestive Disease Center and Research Institute, Department of Internal Medicine, Soonchunhyang University College of Medicine, Bucheon Hospital, 1174 Jung-Dong, Wonmi-Gu, Bucheon, Gyeonggi-Do , South Korea. sjhong@schmc.ac.kr Telephone: Fax: Received: August 8, 2013 Revised: October 18, 2013 Accepted: November 3, 2013 Published online: March 21, 2014 Abstract Adequate bowel preparation is important for successful colonoscopic examination. Several effective colonic cleansing agents are available and routinely prescribed, but each carries its own limitations and benefits from particular dosing regimens. The most frequently prescribed colonic cleansing agent, the polyethylene glycol (PEG) cathartic solution, suffers from low patient compliance in general, due to its unpalatable taste and smell coupled with the large ingested volumes required. However, PEG is preferred over other cathartics for use in individuals of advanced age, sufferers of chronic kidney disease, heart failure and inflammatory bowel disease, and women who are pregnant or lactating. The laxative agents sodium phosphate (NaP) and sodium picosulfate plus magnesium citrate have been applied and have improved patient compliance and tolerance. NaP, however, should be avoided in individuals with impaired renal function or plasma clearance, such as those with chronic kidney disease, who are taking drugs that affect renal function, or who suffer from heart failure. Other special conditions that may affect an individual s tolerance of the cathartic agent or ability to complete the administration routine include stroke, severe constipation, hematochezia, suspicious lower gastrointestinal bleeding, and mental disorders such as dementia. All ingestible bowel preparation solutions can be instilled into the stomach and duodenum through nasogastric tube or esophagogastroduodenoscope with the aid of a water irrigation pump for patients with difficulties swallowing or ingesting the large volumes of fluid required. In addition, dietary regimens based on clear liquids and low-residue foods for 1-4 d prior to the colonoscopy may be supplemental bowel preparation strategies. Achieving an effective and safe cleansing of the bowel is important for successful colonoscopy in all patients, so full knowledge of the individual s condition and capabilities is necessary to select the most appropriate colonic cleansing agent and delivery regimen Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Colonoscopy; Preparation; Polyethylene glycols; Special conditions; Cathartic agent Core tip: Adequate bowel preparation is important for successful colonoscopic examination. A patient s general health condition or concurrent medications may impair their ability to tolerate a certain cathartic agent, and mental or physical disabilities may preclude their ability to complete the ingestion regimen. While impaired health increases the risk of agent-related complications, failure to comply with bowel preparation instructions in general limits adequate cleansing of the bowel. Unremoved fecal matter occludes the colonoscopic view, necessitating repeat examination. This review discusses the special conditions encountered most frequently in the endoscopic clinic so that effective and safe bowel 2741 March 21, 2014 Volume 20 Issue 11

23 Lim YJ BL et al. Bowel preparation under special conditions preparation agents/regimens can be chosen. Lim YJ, Hong SJ. What is the best strategy for successful bowel preparation under special conditions? World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2741.htm DOI: org/ /wjg.v20.i INTRODUCTION Bowel preparation for colonoscopy was designed as a means to improve the diagnostic and therapeutic accuracy and safety of this semi-invasive visualization procedure. The most common method of bowel preparation involves oral ingestion of a large volume of a cathartic agent with laxative properties over a defined period of time. The most commonly prescribed cathartic regimen is 4 L of polyethylene glycol (PEG; an osmotically balanced electrolyte lavage solution). Unfortunately, the regimen suffers from poor compliance rates, for which patients have cited the unpalatable taste and smell of the PEG solution, as well as difficulty of consuming such a large volume. Complimenting the PEG regimen with other laxative agents, such as sodium phosphate (NaP) and sodium picosulfate plus magnesium citrate, has proven useful in helping to improve the compliance [1-5]. A patient s age (i.e., the elderly and pediatric populations), general health condition [(i.e., pregnancy or lactation, renal or cardiac insufficiency or failure, severe constipation, and hematochezia or suspicious lower gastrointestinal (GI) bleeding)] or concurrent medications (i.e., drugs that impair renal function) may lower their tolerance to a certain cathartic agent, and mental or physical disabilities (i.e., dementia or stroke) may preclude their ability to complete the ingestion regimen. While impaired health increases the risk of agent-related complications, failure to comply with bowel preparation instructions in general limits adequate cleansing of the bowel. Unremoved fecal matter occludes the colonoscopic view, resulting in missed lesions, cancelled procedures, increased procedural time, and a potential increase in procedure-related complications, such as perforation, hemorrhaging and infection. Repeated colonoscopy may be unavoidable. This review discusses the special conditions encountered most frequently in the endoscopic clinic so that effective and safe bowel preparation agents/regimens can be chosen. SPECIAL CONDITIONS AFFECTING BOWEL PREPARATION FOR COLONSCOPY Elderly patients Elderly patients ( 80-year-old) show higher rates of inadequate colon cleansing for colonoscopy by the common preparation strategies [6]. Application of the NaP- PEG combination (or NaP as an alternative single agent) is generally not recommended in elderly patients, due to the decrease in renal function that accompanies advanced age and represents an increases risk of agent-related toxic side effects [7]. However, when Seinela et al [8] performed a comparative analysis of the efficacy and safety profiles of NaP and PEG solution in elderly patients no differences were detected; the study s small sample size and in-patient character limit the generalizability of these findings, and the fact that confounding variables (such as education level of the treating healthcare team and occurrences of hypovolemia and electrolyte imbalance) were not evaluated limits the statistical strength of the findings. Recent investigations have provided insights into the effects of age-related renal failure on oral NaP and aimed to design safe dosing regimens or effective alternatives [9-16]. Since NaP use in the elderly has been reported to induce serious electrolyte abnormalities, assessing and monitoring the levels of serum electrolytes, phosphorus, potassium, and calcium is recommended when the agent is considered superior to all other potential agents/regimens for a particular patient. Practice of a dietary regimen including clear liquids and low-residue foods over the course of 1-4 d prior to the main preparation procedure or colonoscopy is helpful in the difficult bowel preparation. While comparative analyses of efficacy and tolerability of split-dose and single-dose regimens have yielded inconsistent findings, consumption of the PEG solution less than at least 5 h before the procedure has shown superior bowel cleansing, particularly for the right colon. Pediatric patients No standardized guidelines for bowel cleansing prior to colonoscopy have been established for the pediatric patient population. The most widely reported regimen in children is 1.25 mg/kg PEG administered over a 4 d period with a liquid diet given on the fourth day [9]. The lack of evidence from systematic investigations leaves the possibility open for a shorter and simpler regimen, such as that used in adults of PEG only over a 6-8 h period prior to the colonoscopy [9,10,17]. In pediatric cases, delivery of the PEG solution through a nasogastric tube is commonly used when the patient cannot tolerate the oral ingestion method. The common dosage for nasogastric administration is ml/min delivered over a h period [16] ; however, as with adult patients, it is important to modulate the speed of administration via nasogastric tube according to subject s situation. Enemas have also been reported as alternative bowel cleansing strategies in pediatric patients, but their effect is limited to the distal colon. Pregnant and lactating/breastfeeding women PEG and NaP solutions are Pregnancy Category C drugs, as designated by the Food and Drug Administration according to their potential benefit to the gravida and inconclusive risk to the fetus [10]. Although the need 2742 March 21, 2014 Volume 20 Issue 11

24 Lim YJ BL et al. Bowel preparation under special conditions Table 1 Bowel preparation under special conditions Special condition Considerations for appropriate bowel preparation Elderly Avoid NaP to reduce risk of electrolyte imbalance and phosphate accumulation Childhood 1.25 mg/kg PEG for 4 d with liquid diet on the fourth day Pregnancy PEG may be preferable to NaP Breastfeeding Interrupt breastfeeding during and after bowel preparation Severe/chronic constipation Extend the liquid diet requirement Alternate the bowel preparation agent (PEG or NaP) Provide adjunctive laxative agents (magnesium citrate, bisacodyl, or senna) Apply a combined bowel preparation agent (both PEG and NaP) or double the dosage of PEG solution Stroke, dementia If patients have difficulty swallowing, provide the bowel preparation agent via endoscopic irrigation pump or nasogastric tube IBD NaP and sodium picosulfate plus magnesium citrate should be avoided because of mucosal damage and irritation Diabetes Appropriate dose and proper tempo of fluid intake is important because of delayed colonic transit time NaP should be avoided due to possible risk of hyperphosphatemia, metabolic acidosis, and renal failure Hypertension NaP should be cautiously applied in patients taking a drug that affects renal function (diuretics, ARB, ACEi) Chronic kidney disease NaP preparation is not recommended because of increased risk of renal dysfunction Congestive heart failure PEG solution should be cautiously applied because of an association with increased intravascular volume NaP preparation is not recommended because of electrolyte imbalance and volume loss Lower GI bleeding PEG solution may be more effective than enema If a rectal bleeding focus is suspected or severe bleeding is present, enema can be useful NaP: Sodium phosphate; PEG: Polyethylene glycol; ARB: Angiotensin receptor blockers; ACEi: Angiotensin converting enzyme inhibitors; IBD: Inflammatory bowel disease; GI: Gastrointestinal. for colonoscopy is rare during pregnancy and no wellcontrolled studies of pregnant women have been reported, PEG is generally preferred over NaP because small amounts of PEG safely control constipation in pregnancy [10]. In addition, no study in the publicly available literature has yet reported the safety profiles of the various bowel preparation agents/regimens in lactating patients. Interrupting breastfeeding during and after bowel preparation with cathartic agents or application of a tap water enema for sigmoidoscopy have been suggested as cautionary options [9]. Severe constipation Delayed colon transit time from severe or chronic constipation resistant to laxatives can cause inadequate bowel cleansing. Several approaches have been recommended to help overcome this challenge. First, a longer period of liquid diet has shown promising results. Second, consecutive application of alternating bowel preparations (i.e., switching from PEG to NaP or vice versa) has been reported as a good option if the cleansing regimen will be completed within 48 h. Third, use of an adjunctive laxative, such as magnesium citrate, bisacodyl or senna, may help to improve the efficacy of the main full-dose regimen. The PEG-NaP combination preparation showed reasonable efficacy but may not be repeated within 24 h because of NaP-related toxicity [10]. Fourth, a double-dose of PEG solution has provided successful bowel preparations. Stroke and dementia Patients who have suffered stroke may have physical difficulties swallowing, and patients with dementia may also be physically incapable of completing the preparation regimen, especially of ingesting the large amounts of fluid required. In such cases, it is preferable to instill the bowel preparation solution directly into the stomach or duodenum through an esophagogastroduodenoscope with the aid of a water irrigation pump or nasogastric tube [9,10]. Dietary regimens including clear liquids and lowresidue foods 1-4 d before colonoscopy and enema can sometimes be helpful in these patients as well. Inflammatory bowel disease NaP and sodium picosulfate plus magnesium citrate may cause mucosal abnormalities that manifest symptoms mimicking colitis [18] ; thus, when an initial colonoscopic evaluation is ordered for suspicious inflammatory bowel disease, especially Crohn s disease or colitis, NaP and sodium picosulfate plus magnesium citrate regimens should be avoided. NaP, in particular, can cause aphthoid lesions, erosions, or ulcers. The mucosal lesions caused by both NaP and sodium picosulfate plus magnesium citrate often occur as multiples and are predominantly located in the rectum and distal sigmoid colon [10,18] (Table 1). Diabetes The level of colon cleansing achieved by the common cathartic drug-based regimens was shown to be less efficient in diabetics than their non-diabetic counterparts in a prospective study [19]. Specifically, up to 40% of the endoscopic visualization field was occluded by unremoved fecal matter in the diabetics (vs 97% in the nondiabetics) and approximately 10% of the diabetic patients examined were characterized as having very poor bowel preparation. The inadequate cleaning in diabetic patients has been attributed to delayed colonic transit time and constipation [20]. This diabetes-related delay in GI transit time is also associated with more rapid and severe manifestation of nausea and vomiting in response to the ingested PEG [21] ; therefore, diabetics may benefit from a more flexible dose and timing regimen of the cathartic 2743 March 21, 2014 Volume 20 Issue 11

25 Lim YJ BL et al. Bowel preparation under special conditions agent(s). Diabetic patients have also been reported to be at higher risk of developing acute renal failure following the oral NaP bowel preparation regimen [22] ; thus, it is recommended that NaP be avoided in diabetics to reduce the potential risk of hyperphosphatemia and metabolic acidosis related to effects on kidney function (Table 1). Hypertension Many of the hypertension drugs are known to affect renal function; these include diuretics, angiotensin receptor blockers, and angiotensin converting enzyme inhibitors [9]. Therefore, the medication history and current medications of patients with hypertension should be carefully considered when choosing a bowel preparation strategy. In particular, NaP should be avoided to decrease the risk of complications due to renal insufficiency. Chronic kidney disease The renal insufficiency that accompanies chronic kidney disease is a significant risk factor for acute phosphate nephropathy [23], such as may be induced upon impaired clearance of the NaP bowel cleansing agent [24,25]. The higher risk of NaP for aggravating renal dysfunction in patients with preexisting renal disease, compared to PEG, is well established [25]. Thus, it is recommended to measure a patient s creatinine clearance by the estimated glomerular filtration rate (egfr) prior to prescribing NaP in order to avoid its use in patients with renal disease. The specific contraindication for NaP bowel preparation is an egfr of < 60 ml/min/1.73 m 2 (corresponding to stage 3-5 chronic kidney disease) [25]. Congestive heart failure PEG solution cannot be absorbed into the colon mucosa. Yet, a case of a 73-year-old heart failure patient who experienced aggravated respiratory symptoms after administration of PEG solution was reported [26], and a subsequent study comparing plasma volumes before and after administration of the PEG bowel preparation using an isotope dilution technique showed that mean plasma volume was increased after PEG bowel preparation, supporting the theory that PEG solution may be capable of aggravating heart failure via absorption [27]. Although only two cases of worsened heart failure following administration of PEG solutions have been reported, careful use is advocated in these patients. The alternative cathartic NaP, another non-absorbable osmotic laxative, can also induce volume loss and electrolyte imbalance, and is generally not recommended for use in heart failure patients. Hematochezia or lower GI bleeding Although the role of emergency colonoscopy in lower gastrointestinal bleeding remains controversial, urgent colonoscopy within h of admission can improve diagnostic yields and reduce the rates of both rebleeding and surgery [9]. Adequate bowel preparation is considered beneficial for identification of the bleeding focus of hematochezia, but a standardized method for emergency conditions has not yet been established. Lim et al [28] performed a comparative analysis of the clinical effectiveness of enema and PEG bowel preparation methods in hematochezia patients and demonstrated that the latter yielded a higher diagnostic rate and a lower rate of repeat colonoscopy. Similarly, Saito et al [29] showed that PEG solution was associated with better outcome of acute lower intestinal bleeding. In general, when the amount of bleeding is presumed to be small, bowel preparation using PEG solution may be effective in hematochezia patients; in contrast, if the bleeding focus is suspected to involve the rectal area or if the amount of bleeding is severe, an enema may be more useful and convenient. CONCLUSION Adequate bowel preparation is important for effective colonoscopy but can be limited by an individual s particular physical- and health-related conditions, such as age, pregnancy and comorbidities, or even mental states that inhibit the ability to comply with bowel preparation instructions. Therefore, it is necessary for the endoscopic healthcare team to identify a patient s specific conditions and select an appropriate bowel preparation agent and method in order to maximize the efficacy and safety of both the preparation procedure and the subsequent colonoscopy. REFERENCES 1 DiPalma JA, Wolff BG, Meagher A, Cleveland Mv. Comparison of reduced volume versus four liters sulfate-free electrolyte lavage solutions for colonoscopy colon cleansing. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 2 Hamilton D, Mulcahy D, Walsh D, Farrelly C, Tormey WP, Watson G. Sodium picosulphate compared with polyethylene glycol solution for large bowel lavage: a prospective randomised trial. Br J Clin Pract 1996; 50: [PMID: ] 3 Regev A, Fraser G, Delpre G, Leiser A, Neeman A, Maoz E, Anikin V, Niv Y. Comparison of two bowel preparations for colonoscopy: sodium picosulphate with magnesium citrate versus sulphate-free polyethylene glycol lavage solution. Am J Gastroenterol 1998; 93: [PMID: DOI: /j x] 4 Worthington J, Thyssen M, Chapman G, Chapman R, Geraint M. A randomised controlled trial of a new 2 litre polyethylene glycol solution versus sodium picosulphate + magnesium citrate solution for bowel cleansing prior to colonoscopy. Curr Med Res Opin 2008; 24: [PMID: DOI: / X260844] 5 Rings EH, Mulder CJ, Tytgat GN. The effect of bisacodyl on whole-gut irrigation in preparation for colonoscopy. Endoscopy 1989; 21: [PMID: DOI: / s ] 6 Jafri SM, Monkemuller K, Lukens FJ. Endoscopy in the elderly: a review of the efficacy and safety of colonoscopy, esophagogastroduodenoscopy, and endoscopic retrograde cholangiopancreatography. J Clin Gastroenterol 2010; 44: [PMID: DOI: /MCG.0b013e3181c64d64] 7 Beloosesky Y, Grinblat J, Weiss A, Grosman B, Gafter U, Chagnac A. Electrolyte disorders following oral sodium phosphate administration for bowel cleansing in elderly patients. Arch Intern Med 2003; 163: [PMID: ] 2744 March 21, 2014 Volume 20 Issue 11

26 Lim YJ BL et al. Bowel preparation under special conditions 8 Seinelä L, Pehkonen E, Laasanen T, Ahvenainen J. Bowel preparation for colonoscopy in very old patients: a randomized prospective trial comparing oral sodium phosphate and polyethylene glycol electrolyte lavage solution. Scand J Gastroenterol 2003; 38: [PMID: ] 9 Connor A, Tolan D, Hughes S, Carr N, Tomson C. Consensus guidelines for the safe prescription and administration of oral bowel-cleansing agents. Gut 2012; 61: [PMID: ] 10 Wexner SD, Beck DE, Baron TH, Fanelli RD, Hyman N, Shen B, Wasco KE. A consensus document on bowel preparation before colonoscopy: prepared by a Task Force from the American Society of Colon and Rectal Surgeons (ASCRS), the American Society for Gastrointestinal Endoscopy (ASGE), and the Society of American Gastrointestinal and Endoscopic Surgeons (SAGES). Surg Endosc 2006; 20: 1161 [PMID: ] 11 Lebwohl B, Neugut AI. Post-colonoscopy recommendations after inadequate bowel preparation: all in the timing. Dig Dis Sci 2013; 58: [PMID: DOI: / s y] 12 Bechtold ML, Choudhary A. Bowel preparation prior to colonoscopy: a continual search for excellence. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19. i2.155] 13 Tan JJ, Tjandra JJ. Which is the optimal bowel preparation for colonoscopy - a meta-analysis. Colorectal Dis 2006; 8: [PMID: DOI: /j x] 14 Hassan C, Bretthauer M, Kaminski MF, Polkowski M, Rembacken B, Saunders B, Benamouzig R, Holme O, Green S, Kuiper T, Marmo R, Omar M, Petruzziello L, Spada C, Zullo A, Dumonceau JM. Bowel preparation for colonoscopy: European Society of Gastrointestinal Endoscopy (ESGE) guideline. Endoscopy 2013; 45: [PMID: DOI: /s ] 15 Mathus-Vliegen E, Pellisé M, Heresbach D, Fischbach W, Dixon T, Belsey J, Parente F, Rio-Tinto R, Brown A, Toth E, Crosta C, Layer P, Epstein O, Boustiere C. Consensus guidelines for the use of bowel preparation prior to colonic diagnostic procedures: colonoscopy and small bowel video capsule endoscopy. Curr Med Res Opin 2013; 29: [PMID: DOI: / ] 16 Panton ON, Atkinson KG, Crichton EP, Schulzer M, Beaufoy A, Germann E. Mechanical preparation of the large bowel for elective surgery. Comparison of whole-gut lavage with the conventional enema and purgative technique. Am J Surg 1985; 149: [PMID: ] 17 Hunter A, Mamula P. Bowel preparation for pediatric colonoscopy procedures. J Pediatr Gastroenterol Nutr 2010; 51: [PMID: DOI: /MPG.0b013e3181eb6a1c] 18 Lawrance IC, Willert RP, Murray K. Bowel cleansing for colonoscopy: prospective randomized assessment of efficacy and of induced mucosal abnormality with three preparation agents. Endoscopy 2011; 43: [PMID: DOI: /s ] 19 Taylor C, Schubert ML. Decreased efficacy of polyethylene glycol lavage solution (golytely) in the preparation of diabetic patients for outpatient colonoscopy: a prospective and blinded study. Am J Gastroenterol 2001; 96: [PMID: ] 20 Hammer J, Howell S, Bytzer P, Horowitz M, Talley NJ. Symptom clustering in subjects with and without diabetes mellitus: a population-based study of 15,000 Australian adults. Am J Gastroenterol 2003; 98: [PMID: ] 21 Hayes A, Buffum M, Hughes J. Diabetic colon preparation comparison study. Gastroenterol Nurs 2011; 34: [PMID: DOI: /SGA.0b013e31822c3a24] 22 Ma RC, Chow CC, Yeung VT, So WY, Kong AP, Tong PC, Cockram CS, Chan JC. Acute renal failure following oral sodium phosphate bowel preparation in diabetes. Diabetes Care 2007; 30: [PMID: ] 23 Desmeules S, Bergeron MJ, Isenring P. Acute phosphate nephropathy and renal failure. N Engl J Med 2003; 349: [PMID: ] 24 Russmann S, Lamerato L, Marfatia A, Motsko SP, Pezzullo JC, Olds G, Jones JK. Risk of impaired renal function after colonoscopy: a cohort study in patients receiving either oral sodium phosphate or polyethylene glycol. Am J Gastroenterol 2007; 102: [PMID: ] 25 Russmann S, Lamerato L, Motsko SP, Pezzullo JC, Faber MD, Jones JK. Risk of further decline in renal function after the use of oral sodium phosphate or polyethylene glycol in patients with a preexisting glomerular filtration rate below 60 ml/min. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 26 Parikh K, Weitz H. Can a bowel preparation exacerbate heart failure? Cleve Clin J Med 2011; 78: [PMID: DOI: /ccjm.77a.10025] 27 Turnage RH, Guice KS, Gannon P, Gross M. The effect of polyethylene glycol gavage on plasma volume. J Surg Res 1994; 57: [PMID: ] 28 Lim DS, Kim HG, Jeon SR, Shim KY, Lee TH, Kim JO, Ko BM, Cho JY, Lee JS. Comparison of clinical effectiveness of the emergent colonoscopy in patients with hematochezia according to the type of bowel preparation. J Gastroenterol Hepatol 2013; 28: [PMID: DOI: /jgh.12264] 29 Saito K, Inamori M, Sekino Y, Akimoto K, Suzuki K, Tomimoto A, Fujisawa N, Kubota K, Saito S, Koyama S, Nakajima A. Management of acute lower intestinal bleeding: what bowel preparation should be required for urgent colonoscopy? Hepatogastroenterology 2009; 56: [PMID: ] P- Reviewers: Linnebacher M, Roy PK, Sung J S- Editor: Gou SX L- Editor: A E- Editor: Wang CH 2745 March 21, 2014 Volume 20 Issue 11

27 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor TOPIC HIGHLIGHT Bowel preparations as quality indicators for colonoscopy Jae Young Jang, Hoon Jai Chun Jae Young Jang, Hoon Jai Chun, Division of Gastroenterology, Department of Internal Medicine, College of Medicine, Kyung Hee University, Seoul , South Korea Hoon Jai Chun, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, Seoul , South Korea Author contributions: Jang JY wrote the paper; Chun HJ designed and edited the paper. Correspondence to: Hoon Jai Chun, MD, PhD, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, 73 Inchon-ro, Seongbuk-gu, Seoul , South Korea. drchunhj@chol.com Telephone: Fax: Received: August 8, 2013 Revised: February 1, 2014 Accepted: February 20, 2014 Published online: March 21, 2014 Abstract Colonoscopy is the principal investigative procedure for colorectal neoplasms because it can detect and remove most precancerous lesions. The effectiveness of colonoscopy depends on the quality of the examination. Bowel preparation is an essential part of high-quality colonoscopies because only an optimal colonic cleansing allows the colonoscopist to clearly view the entire colonic mucosa and to identify any polyps or other lesions. Suboptimal bowel preparation not only prolongs the overall procedure time, decreases the cecal intubation rate, and increases the costs associated with colonoscopy but also increases the risk of missing polyps or adenomas during the colonoscopy. Therefore, a repeat examination or a shorter colonoscopy follow-up interval may be suitable strategies for a patient with suboptimal bowel preparation Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Colonoscopy; Colorectal neoplasm; Bower preparation; Quality Core tip: Bowel preparation is one of the most frequent reasons why patients object to participating in screening colonoscopies, and inadequate preparation is a major obstacle to achieving a high-quality colonoscopy. Furthermore, the two most important quality indicators of colonoscopy, the adenoma detection rate and cecal intubation rate, are associated with the quality of bowel preparation. Therefore, bowel preparation is critical for high-quality colonoscopies because only optimal colonic cleansing allows the colonoscopist to view clearly the entire colonic mucosa. A greater awareness of the importance of adequate preparation will lead to the improved quality of colonoscopies. Jang JY, Chun HJ. Bowel preparations as a quality indicator for colonoscopy. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/2746.htm DOI: i INTRODUCTION In 2008, the worldwide estimate of the number of new cases of colorectal cancer was , with an estimated mortality of [1]. Colonoscopy is currently considered the gold standard diagnostic method for colonic disease and the most effective procedure to screen for colorectal cancer (CRC) [2] for the following reasons: (1) colonoscopy can detect and remove all suspicious colorectal lesions; and (2) if any of the other three recommended screening tests (fecal occult blood test, flexible sigmoidoscopy and double contrast barium enema) are positive, they must be followed by a diagnostic colonoscopy [3,4]. However, approximately 3% to 6% of colorectal cancers are diagnosed between the screening and post-screening surveillance examinations [5-7], and the majority of these interval cancers are believed to origi March 21, 2014 Volume 20 Issue 11

28 Jang JY et al. Bowel preparation for colonoscopy Table 1 Quality indicators that can be impacted by bowel preparation in colonoscopy Indicator Definition Acceptable level Bowel preparation Proportion of procedures in which colon cleansing is considered excellent or good > 90% Adenoma detection rate Proportion of colonoscopies performed in asymptomatic individuals over 50 in which at least one adenoma has been detected > 20% (men > 25% and women > 15%) Withdrawal time Mean time from cecal intubation to colonoscopy extraction through the anus > 6 min Cecal intubation rate Proportion of procedures in which cecal intubation is achieved > 95% nate from missed lesions that were overlooked during the screening colonoscopy [8,9]. According to emerging evidence, the effectiveness of a colonoscopy depends on the quality of the examination [10-12]. Bowel preparation is an essential part of a high-quality colonoscopy because only optimal colonic cleansing allows the colonoscopist to clearly view the entire colonic mucosa (from the anal verge to the ileocecal valve) and to identify any polyps or other lesions. Even small amounts of residual stool could prevent the visualization of clinically important lesions. However, reports show that bowel preparation is inadequate in up to 25% of patients undergoing a colonoscopy [13,14]. It is clear that poor preparation prolongs the overall procedure time, decreases the cecal intubation rates, reduces the detection of colorectal neoplasms and increases the costs associated with colonoscopy. The American Society for Gastrointestinal Endoscopy (ASGE) and American College of Gastroenterology (ACG) guidelines include quality indicators to measure the performance of colonoscopies [10,11]. A number of factors were selected to establish competence in the performance of a colonoscopy and to help define areas for continuous quality improvement. The factors that can be affected by the quality of bowel preparation include (1) cecal intubation, which should be achieved in 90% of all cases and in 95% of screening procedures performed on healthy adults; (2) photo documentation of the cecum and its landmarks (the appendiceal orifice, cecal strap, ileocecal valve); and (3) adenoma detection, that is, adenomas, should be detected by a screening colonoscopy in 25% and 15% of healthy men and women, respectively, who are aged 50 years or older (Table 1). In addition, the ASGE-ACG Task Force recommends that the quality of the bowel preparation should be documented in the procedure report. Currently, there is no standardized system to describe the bowel preparation. The US Multi-Society Task Force on Colorectal Cancer suggests the use of the terms, adequate or inadequate ; an adequate examination is one that allows for the detection of mass lesions other than small (5 mm) polyps, which are generally not obscured by the preparation [15]. Many clinical studies have used the terms excellent, good, fair and poor to rate the quality of bowel preparation [16]. Excellent is typically defined as no or minimal solid stool and only small amounts of clear fluid that require suctioning. Good is typically used to describe no or minimal solid stool with large amounts of clear fluid that require suctioning. Fair generally refers to collections of semisolid debris that are cleared with difficulty. Poor generally refers to solid or semisolid debris that cannot be cleared effectively (Figure 1) [16]. BOWEL PREPARATION AND COLONOSCOPY EFFICIENCY The quality of bowel preparation is an important determinant of procedural success. A prospective study of 9223 colonoscopies performed in the United Kingdom that was published in 2004 found that one in five incomplete colonoscopies (failures) was caused by poor bowel preparation [17]. A prospective study of 693 consecutive outpatient colonoscopies identified poor bowel preparation as a significant predictor of prolonged cecal intubation time ( 20 min, P = ) [18]. A prospective study of 909 patients undergoing colonoscopy performed by a single endoscopist reported that an inadequate bowel preparation (fair or poor vs good) was a significantly predicted by a prolonged ( 10 min) insertion time [OR = 2.80, 95%CI: , P = 0.003] [19]. Similarly, another prospective, multicenter study of screening colonoscopy, performed in 3196 individuals aged from 50 to 75 years, reported that a poor-quality bowel preparation was the only variable significantly related to incomplete colonoscopy. Procedural failure rates were significantly higher in patients with poor-quality cleansing (19%) than in patients with an adequate bowel preparation (2%, P = 0.001) [20]. In a retrospective review of 5477 colonoscopies performed by 10 gastroenterologists at a university hospital, Aslinia et al [21] reported that inadequate bowel preparation was a significant predictor of the inability to reach the cecal base (OR = 0.15, 95%CI: , P < 0.001) (Table 2). The quality of bowel preparation also greatly influences the cost of the colonoscopy; notably, it was estimated that inadequate bowel preparation increased the cost of the colonoscopy by 12%-22% (which is attributable to the increased duration of the examination as well as the need for repeated procedures or anticipated surveillance) [22]. Another variable related to the efficiency and quality of the colonoscopy is the colonoscope withdrawal time. A study of 99 patients undergoing colonoscopy reported a shorter mean withdrawal time when the quality of colon cleansing was adequate (4.4 min vs 5.8 min for an inadequate preparation, P < 0.001) [23]. Similarly, Froehlich et al [13] reported a significantly shorter mean withdrawal time in patients with high-quality colon cleansing (n = 3445) than in patients with a poor preparation (n = 360; 2747 March 21, 2014 Volume 20 Issue 11

29 Jang JY et al. Bowel preparation for colonoscopy A B C D Figure 1 Representative endoscopic image according to the bowel preparation scale. A: Excellent, there are no or minimal solid stool and only small amount of clear fluid that require suctioning; B: Good, it is used to describe no or minimal solid stool with large amounts of clear fluid that require suctioning; C: Fair, it means the presence of semisolid debris that are cleared with difficulty; D: Poor, it is impossible to observe the colonic mucosa because of solid or semisolid stools. Table 2 Summary of studies demonstrates an association between bowel preparation and procedural success Study Subjects (n ) Perspective Outcomes Results Bowles et al [17] 9223 Prospective Cecal intubation rate Poor bowel preparation (19.6%) Bernstein et al [18] 693 Prospective Predictor of cecal intubation time ( 20 min) Poor bowel preparation (P = ) Kim et al [19] 909 Prospective Prolonged insertion time (> 10 min) Inadequate bowel cleaning (OR = 2.8, 95%CI: , P = 0.003) Nelson et al [20] 3196 Prospective Predictor of incomplete colonoscopy Poor bowel preparation (failure rate = 19.3%, P = 0.001) Aslinia et al [21] 5477 Retrospective Cecal intubation rate Inadequate bowel preparation (OR = 0.17, 95%CI: , P < 0.001) OR: Odd ratio. 9.8 min vs 11.3 min, P < 0.001). In this study, the shorter withdrawal time did not adversely affect the efficacy of the colonoscopy because the detection of polyps was more frequent in patients with a high-quality vs a lowquality cleansing. BOWEL PREPARATION AND DIAGNOSTIC YIELD In addition to affecting the speed and the completeness of a colonoscopy, the quality of colon cleansing can affect the detection of adenomas and CRCs. In a retrospective evaluation of more than 5000 colonoscopies performed over a 3.5-year period, Leaper et al [24] identified 17 patients with a missed CRC. Poor bowel preparation was noted in six of these patients, which suggested that cleansing quality might influence the diagnostic yield of a colonoscopy. In a larger retrospective study, Harewood et al [14] analyzed the impact of the quality of the bowel preparation on the detection of polypoid lesions in approximately colonoscopies recorded in the Clinical Outcome Research Initiative database. Suspected neoplasms were identified in colonoscopies (29%) overall; detection rates were higher in cases with adequate preparation (rated excellent or good by the endoscopist) than in those with inadequate preparation (fair or poor) (29% vs 26%, P < ). Although significant lesions (polyps > 9 mm or mass lesions) were detected in approximately 7% of these colonoscopies regardless of the preparation quality (P = 0.82), smaller lesions, 9 mm, were more likely to be detected when bowel preparation was adequate [15615 cases (22%)] than when it was inadequate [4092 cases (19%), P < ]. Thus, 2748 March 21, 2014 Volume 20 Issue 11

30 Jang JY et al. Bowel preparation for colonoscopy the detection of a suspected neoplasia was critically dependent on the adequacy of the preparation (OR = 1.21, 95%CI: ) [14]. These findings were supported by another study of 5832 patients. These investigators reported that the detection of neoplasms, including polyps of any size as well as large lesions (> 10 mm), was associated with the quality of bowel preparation; polyps were detected more frequently in patients with high-quality cleansing than in patients with low-quality cleansing (29% vs 24%, P < 0.007). The identification of polyps of any size was significantly associated with cleansing quality (intermediate-quality vs low-quality preparation: OR = 1.73, 95%CI: ; high-quality vs low-quality preparation: OR = 1.46, 95%CI: ). For polyps 10 mm in size, the OR was 1.83 (95%CI: ) for intermediate-quality cleansing and 1.72 (95%CI: ) for high-quality cleansing [13]. Flat and depressed neoplasms, which are common among Japanese populations, are increasingly reported in Western countries [25,26]. Although flat and depressed lesions are rarer than protruding lesions, they more frequently contain advanced neoplasia, including invasive carcinoma [26,27]. In one study, the number of flat lesions detected in patients with inadequate bowel preparation was significantly fewer than in patients with adequate bowel preparation (9 vs 28, P = 0.002) [28]. Medico-legal risks, which are due to colon cancers that are missed due to an improperly performed colonoscopy, are another important consequence of inadequate bowel preparation. Of note, the accurate description and documentation of good colon cleansing are important issues in the malpractice litigation of CRCs discovered after apparently negative total colonoscopies [29]. Although guidelines advocate a repeat colonoscopy when a suboptimal bowel preparation is detected [30,31], in practice, shortening the interval to the next colonoscopy is often recommended despite the lack of evidence to support this management approach [32]. To assess the validity of such an approach, the relationship between bowel preparation quality and the risk of missing polyps, adenomas and advanced adenomas during the screening colonoscopy should be investigated. CONCLUSION In summary, it is clear that suboptimal bowel preparation not only prolongs the overall procedure time, decreases the cecal intubation rate and increases the costs associated with colonoscopy but also increases the risk of missing polyps or adenomas during the colonoscopy. Bowel preparation is one of the most frequent reasons why patients object to participating in screening colonoscopies, and inadequate preparation is a major obstacle to achieving a high-quality colonoscopy. Therefore, a repeat examination or shorter colonoscopy follow-up interval may be suitable strategies for patients with suboptimal bowel preparations. In the future, large-scale multicenter studies will be needed to evaluate the frequency of missing polyps and adenomas according to the bowel preparation status in average-risk patients undergoing screening colonoscopy and to further describe the risk of developing interval cancer as well as to compare the cost-effectiveness of repeat colonoscopy to the shortening of the colonoscopy follow-up interval in patients with suboptimal bowel preparations. REFERENCES 1 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011; 61: [PMID: DOI: /caac.20107] 2 Ransohoff DF. Colon cancer screening in 2005: status and challenges. Gastroenterology 2005; 128: [PMID: DOI: /j.gastro ] 3 Winawer S, Fletcher R, Rex D, Bond J, Burt R, Ferrucci J, Ganiats T, Levin T, Woolf S, Johnson D, Kirk L, Litin S, Simmang C. Colorectal cancer screening and surveillance: clinical guidelines and rationale-update based on new evidence. Gastroenterology 2003; 124: [PMID: DOI: /gast ] 4 Pignone M, Saha S, Hoerger T, Mandelblatt J. Cost-effectiveness analyses of colorectal cancer screening: a systematic review for the U.S. Preventive Services Task Force. Ann Intern Med 2002; 137: [PMID: DOI: / ] 5 Farrar WD, Sawhney MS, Nelson DB, Lederle FA, Bond JH. Colorectal cancers found after a complete colonoscopy. Clin Gastroenterol Hepatol 2006; 4: [PMID: DOI: /j.cgh ] 6 Bressler B, Paszat LF, Chen Z, Rothwell DM, Vinden C, Rabeneck L. Rates of new or missed colorectal cancers after colonoscopy and their risk factors: a population-based analysis. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 7 Hosokawa O, Shirasaki S, Kaizaki Y, Hayashi H, Douden K, Hattori M. Invasive colorectal cancer detected up to 3 years after a colonoscopy negative for cancer. Endoscopy 2003; 35: [PMID: DOI: /s ] 8 Bond JH. Should the quality of preparation impact postcolonoscopy follow-up recommendations? Am J Gastroenterol 2007; 102: [PMID: DOI: / j x] 9 Pabby A, Schoen RE, Weissfeld JL, Burt R, Kikendall JW, Lance P, Shike M, Lanza E, Schatzkin A. Analysis of colorectal cancer occurrence during surveillance colonoscopy in the dietary Polyp Prevention Trial. Gastrointest Endosc 2005; 61: [PMID: DOI: /S (04) ] 10 Rex DK, Petrini JL, Baron TH, Chak A, Cohen J, Deal SE, Hoffman B, Jacobson BC, Mergener K, Petersen BT, Safdi MA, Faigel DO, Pike IM. Quality indicators for colonoscopy. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 11 Rex DK, Petrini JL, Baron TH, Chak A, Cohen J, Deal SE, Hoffman B, Jacobson BC, Mergener K, Petersen BT, Safdi MA, Faigel DO, Pike IM. Quality indicators for colonoscopy. Gastrointest Endosc 2006; 63: S16-S28 [PMID: DOI: /j.gie ] 12 Kaminski MF, Regula J, Kraszewska E, Polkowski M, Wojciechowska U, Didkowska J, Zwierko M, Rupinski M, Nowacki MP, Butruk E. Quality indicators for colonoscopy and the risk of interval cancer. N Engl J Med 2010; 362: [PMID: DOI: /NEJMoa ] 13 Froehlich F, Wietlisbach V, Gonvers JJ, Burnand B, Vader JP. Impact of colonic cleansing on quality and diagnostic yield of colonoscopy: the European Panel of Appropriateness of Gastrointestinal Endoscopy European multicenter study. Gastrointest Endosc 2005; 61: [PMID: DOI: 2749 March 21, 2014 Volume 20 Issue 11

31 Jang JY et al. Bowel preparation for colonoscopy /S (04) ] 14 Harewood GC, Sharma VK, de Garmo P. Impact of colonoscopy preparation quality on detection of suspected colonic neoplasia. Gastrointest Endosc 2003; 58: [PMID: DOI: /mge ] 15 Rex DK, Bond JH, Winawer S, Levin TR, Burt RW, Johnson DA, Kirk LM, Litlin S, Lieberman DA, Waye JD, Church J, Marshall JB, Riddell RH. Quality in the technical performance of colonoscopy and the continuous quality improvement process for colonoscopy: recommendations of the U.S. Multi-Society Task Force on Colorectal Cancer. Am J Gastroenterol 2002; 97: [PMID: DOI: / j x] 16 Burke CA, Church JM. Enhancing the quality of colonoscopy: the importance of bowel purgatives. Gastrointest Endosc 2007; 66: [PMID: DOI: /j.gie ] 17 Bowles CJ, Leicester R, Romaya C, Swarbrick E, Williams CB, Epstein O. A prospective study of colonoscopy practice in the UK today: are we adequately prepared for national colorectal cancer screening tomorrow? Gut 2004; 53: [PMID: DOI: /gut ] 18 Bernstein C, Thorn M, Monsees K, Spell R, O Connor JB. A prospective study of factors that determine cecal intubation time at colonoscopy. Gastrointest Endosc 2005; 61: [PMID: DOI: /S (04) ] 19 Kim WH, Cho YJ, Park JY, Min PK, Kang JK, Park IS. Factors affecting insertion time and patient discomfort during colonoscopy. Gastrointest Endosc 2000; 52: [PMID: DOI: /mge ] 20 Nelson DB, McQuaid KR, Bond JH, Lieberman DA, Weiss DG, Johnston TK. Procedural success and complications of large-scale screening colonoscopy. Gastrointest Endosc 2002; 55: [PMID: DOI: /mge ] 21 Aslinia F, Uradomo L, Steele A, Greenwald BD, Raufman JP. Quality assessment of colonoscopic cecal intubation: an analysis of 6 years of continuous practice at a university hospital. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 22 Rex DK, Imperiale TF, Latinovich DR, Bratcher LL. Impact of bowel preparation on efficiency and cost of colonoscopy. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 23 Kössi J, Kontula I, Laato M. Sodium phosphate is superior to polyethylene glycol in bowel cleansing and shortens the time it takes to visualize colon mucosa. Scand J Gastroenterol 2003; 38: [PMID: DOI: / ] 24 Leaper M, Johnston MJ, Barclay M, Dobbs BR, Frizelle FA. Reasons for failure to diagnose colorectal carcinoma at colonoscopy. Endoscopy 2004; 36: [PMID: DOI: /s ] 25 Tsuda S, Veress B, Tóth E, Fork FT. Flat and depressed colorectal tumours in a southern Swedish population: a prospective chromoendoscopic and histopathological study. Gut 2002; 51: [PMID: DOI: /gut ] 26 Ross AS, Waxman I. Flat and depressed neoplasms of the colon in Western populations. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 27 O'brien MJ, Winawer SJ, Zauber AG, Bushey MT, Sternberg SS, Gottlieb LS, Bond JH, Waye JD, Schapiro M. Flat adenomas in the National Polyp Study: is there increased risk for high-grade dysplasia initially or during surveillance? Clin Gastroenterol Hepatol 2004; 2: [PMID: ] 28 Parra-Blanco A, Nicolas-Perez D, Gimeno-Garcia A, Grosso B, Jimenez A, Ortega J, Quintero E. The timing of bowel preparation before colonoscopy determines the quality of cleansing, and is a significant factor contributing to the detection of flat lesions: a randomized study. World J Gastroenterol 2006; 12: [PMID: ] 29 Rex DK, Bond JH, Feld AD. Medical-legal risks of incident cancers after clearing colonoscopy. Am J Gastroenterol 2001; 96: [PMID: DOI: /j x] 30 Winawer SJ, Zauber AG, Fletcher RH, Stillman JS, O Brien MJ, Levin B, Smith RA, Lieberman DA, Burt RW, Levin TR, Bond JH, Brooks D, Byers T, Hyman N, Kirk L, Thorson A, Simmang C, Johnson D, Rex DK. Guidelines for colonoscopy surveillance after polypectomy: a consensus update by the US Multi-Society Task Force on Colorectal Cancer and the American Cancer Society. Gastroenterology 2006; 130: [PMID: DOI: / j.gastro ] 31 Levin B, Lieberman DA, McFarland B, Andrews KS, Brooks D, Bond J, Dash C, Giardiello FM, Glick S, Johnson D, Johnson CD, Levin TR, Pickhardt PJ, Rex DK, Smith RA, Thorson A, Winawer SJ. Screening and surveillance for the early detection of colorectal cancer and adenomatous polyps, 2008: a joint guideline from the American Cancer Society, the US Multi-Society Task Force on Colorectal Cancer, and the American College of Radiology. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 32 Ben-Horin S, Bar-Meir S, Avidan B. The impact of colon cleanliness assessment on endoscopists recommendations for follow-up colonoscopy. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] P- Reviewers: Rodrigo L, Redondo-Cerezo E, Tanaka S S- Editor: Gou SX L- Editor: A E- Editor: Liu XM 2750 March 21, 2014 Volume 20 Issue 11

32 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor TOPIC HIGHLIGHT Helicobacter pylori infection in gastric mucosa-associated lymphoid tissue lymphoma Jeong Bae Park, Ja Seol Koo Jeong Bae Park, Department of Internal Medicine, College of Medicine, Dongguk University, Gyeongju , South Korea Ja Seol Koo, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Korea University Ansan Hospital, Ansan , South Korea Author contributions: Park JB and Koo JS contributed equally to this work; all authors approved the final version of the manuscript. Correspondence to: Dr. Ja Seol Koo, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Korea University Ansan Hospital, 123, Jeokgeum-ro, Danwon-gu, Ansan , South Korea. jskoo@korea.ac.kr Telephone: Fax: Received: August 16, 2013 Revised: October 15, 2013 Accepted: November 1, 2013 Published online: March 21, 2014 Abstract Gastrointestinal lymphoma is the most common type of extranodal lymphoma, and most commonly affects the stomach. Marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT) and diffuse large B-cell lymphoma are the most common histologic types of gastric lymphoma. Despite its increasing incidence, diagnosis of gastric lymphoma is difficult at an earlier stage due to its nonspecific symptoms and endoscopic findings, and, thus, a high index of suspicion, and multiple, deep, repeated biopsies at abnormally and normally appearing sites in the stomach are needed. In addition, testing for Helicobacter pylori (H. pylori ) infection and endoscopic ultrasonography to determine the depth of tumor invasion and involvement of regional lymph nodes is essential for predicting response to H. pylori eradication and for assessment of disease progression. In addition, H. pylori infection and MALT lymphoma development are associated, and complete regression of low-grade MALT lymphomas after H. pylori eradication has been demonstrated. Radiotherapy and/or chemotherapy can be used in cases that show poor response to H. pylori eradication, negativity for H. pylori infection, or high-grade lymphoma Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Mucosa-associated lymphoid tissue; Lymphoma; Helicobacter pylori ; Eradication; Remission Core tip: The incidence of gastric mucosa-associated lymphoid tissue (MALT) lymphoma is increasing; however, early diagnosis is still difficult. Early detection and accurate stage workup is essential for treatment of MALT lymphoma. If gastric lymphoma is verified, testing for Helicobacter pylori infection, bone marrow biopsy, chest radiographs, endoscopic ultrasonography, and computed tomography scans should be performed for staging. We reviewed the most recent literature and provide a comprehensive summary of the diagnosis, treatment according to each stage, and follow-up on this topic. Park JB, Koo JS. Helicobacter pylori infection in gastric mucosaassociated lymphoid tissue lymphoma. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2751.htm DOI: org/ /wjg.v20.i INTRODUCTION Helicobacter pylori (H. pylori) infection, one of the most common chronic infections, has a worldwide distribution. Infection rates differ by country; however, more than half of the world s population is infected. In addition, H. pylori infection is the primary pathologic cause of development of low-grade, mucosa-associated lymphoid tissue (MALT) lymphoma of the stomach. International 2751 March 21, 2014 Volume 20 Issue 11

33 Park JB et al. H. pylori and MALT lymphoma guidelines strongly recommend bacterial eradication in all gastric MALT lymphoma patients [1-4]. In fact, during the early stages low-grade MALT lymphoma can be cured by H. pylori eradication in 60%-80% of cases [5-7]. Primary gastrointestinal lymphoma accounts for 30%-40% of all extranodal lymphomas. In addition, the incidence of primary gastric lymphoma has increased in recent decades [8], however, it is still a rare disease. Its lack of specific symptoms and various or nonspecific endoscopic findings make early detection and diagnosis difficult. Therefore, sufficient experience and endoscopic skill are needed in order to determine an accurate pathologic diagnosis and macroscopic lesion range. Here, we provide a review of the characteristics, diagnosis and treatment of primary gastric MALT lymphoma. PATHOLOGIC CHARACTERISTICS OF GASTRIC MALT LYMPHOMA Based on histologic characteristics, primary gastric lymphomas are classified as diffuse large B-cell lymphoma, marginal zone B-cell lymphoma of the MALT type (MALT lymphoma), follicular lymphoma, mantle cell lymphoma, plasmacytoma, Burkitt s lymphoma, and T-cell lymphoma. Diffuse large B-cell lymphoma and MALT lymphoma account for approximately 60% and 40% of all gastric lymphomas, respectively [9]. MALT lymphoma is defined as a diffuse proliferation of centrocyte-like cells with lymphoepithelial lesions [10], whereas diffuse large B-cell lymphomas are divided into two entities according to the presence or absence of areas of MALT lymphoma [11]. H. pylori infection plays an important role in development of almost all MALT lymphomas. Gastric tissue normally does not contain MALT, but may acquire it in response to chronic H. pylori infection [12]. Chronic inflammation causes proliferation of T-cells and B-cells due to antigen presentation. Malignant transformation occurs in a small percentage of B-cells and results in lymphoma, and the malignant process appears to be driven to a large degree by chronic H. pylori infection, because H. pylori eradication causes lymphoma regression in most cases [5]. However, four main chromosomal translocations, that is t (11; 18) (q21; q21), t (14; 18) (q32; q21), t (1; 14) (p22; q32), and t (3; 14) (p14.1; q32), reduce the response to H. pylori eradication [13,14] and are found in 30% of cases. The most common translocation type is t (11; 18) (q21; q21). This type is more common in cases involving the lung or stomach, and is significantly associated with infections by CagA-positive strains [14]. DIAGNOSIS OF GASTRIC MALT LYMPHOMA Median age at diagnosis is approximately 60 years and no gender predominance is shown. The most common presenting symptoms of MALT lymphoma are nonspecific dyspepsia and epigastric pain, whereas constitutional B symptoms and gastric bleeding are rare [15]. Other less common symptoms include nausea, vomiting, anorexia, weight loss, and early satiety [16]. Because these symptoms are nonspecific and are observed in other gastrointestinal diseases, final diagnosis is made by endoscopic biopsy. Endoscopic evaluation Gastric MALT lymphomas are evaluated by esophagogastroduodenoscopy. The most common sites of involvement in the stomach are the pyloric antrum, corpus, and cardia; however, due to the possibility of multifocal involvement, biopsies should be taken from all abnormal and random sites, including the stomach, gastroesophageal junction, and duodenum [17,18]. Endoscopic appearances of MALT lymphoma varies, including erythema, erosions, and ulcers (Figure 1). Diffuse superficial infiltration is common, whereas masses are more common in diffuse large B-cell lymphoma [19]. Unlike benign ulcers and early gastric cancer, the erosions and ulcers of MALT lymphoma have an irregular or geographic appearance and multifocal characteristics. They may also exhibit irregular mucosal nodularities or only color changes. Thus, if lymphoma is doubted, biopsy is needed. Because some lymphomas infiltrate the submucosal layer without mucosal layer involvement, biopsies should be sufficiently deep and large enough for histopathologic and immunohistochemical analysis. Evaluations of H. pylori infection should include histology, rapid urease testing, urea breath testing, monoclonal stool antigen testing, or serologic studies. Pathologic evaluation Histologic diagnosis of primary gastric lymphoma is somewhat difficult because the endoscopic findings of lymphomas are indistinguishable from those of benign gastritis, and because they can involve the submucosal layer without mucosal involvement [20,21]. A correct histologic diagnosis after first endoscopy is made in 75% of low-grade and 79% of high-grade cases [19] ; thus, suspicion is most important during endoscopic examinations, and multiple biopsies, including normal mucosa, are needed due to the possibility of multifocal lesions or combined cases of low and high-grade lymphoma. The histologic characteristics of the low-grade MALT lymphoma are: centrocyte-like cell proliferation; plasma cell infiltration; and lymphoepithelial lesions defined as the unequivocal invasion and partial destruction of gastric glands or crypts. The key histologic feature of low-grade MALT lymphoma is the presence of a lymphoepithelial lesion [22,23] (Figure 2). However, lymphoepithelial lesions can sometimes be seen in the context of florid chronic gastritis, and can be present in other sites of both native and acquired MALT [24]. The tumor cells of low-grade MALT lymphoma are usually small- to medium-sized lymphocytes with moderately abundant cytoplasm and irregularly shaped nuclei resembling those of follicular center cells (centrocytes) and have been designated centrocyte-like (CCL) cells [23]. There is a continuous spectrum of lesions during the transition from H. pylori-associated gastritis to low-grade MALT lymphoma. The histologic 2752 March 21, 2014 Volume 20 Issue 11

34 Park JB et al. H. pylori and MALT lymphoma A B C D E F Figure 1 Variable endoscopic findings of gastric mucosa-associated lymphoid tissue lymphoma. A: Single erosive type; B: Ulcerative type; C: Atrophic type; D: Cobblestone-mucosa type; E: Nodular type; F: IIc-like type. A B Figure 2 Histopathological and immunohistochemical features of gastric mucosa-associated lymphoid tissue lymphoma. A: Histopathological finding. Gastric MALT lymphoma shows many lymphoepithelial lesions formed by the invasion of glands by centrocyte-like cells [hematoxylin and eosin (HE) stain, 400]; B: Immunohistochemical finding. Centrocyte-like cells show strong positive signals for CD20 ( 400). scoring system of the Wotherspoon criteria is widely used in diagnosis of MALT lymphoma [5] and immunoglobulin heavy chain gene rearrangement analyses by polymerase chain reaction (PCR) are also used [25]. Southern blot or PCR for immunoglobulin heavy chain rearrangement can assist in revealing monoclonality and in prediction of later lymphoma development; however the presence of monoclonality alone does not allow for a diagnosis of lymphoma. Accordingly, molecular tests should always be considered in the context of histologic findings [26-31]. CCL cells of gastric MALT lymphoma and marginal zone B cells in spleen, Peyer s patches and lymph nodes have almost the same immunophenotype. Both types of cells are positive for surface immunoglobulins and pan-b antigens (CD19, CD20, and CD79a) and lack CD5, CD10, CD23, and cyclin D1 expression [24,32]. Other evaluations If gastric MALT lymphoma is verified, other examinations, such as endoscopic ultrasound (EUS), bone marrow biopsy, standard posteroanterior and lateral chest radiographs, upper airway examination, and CT scans of chest, abdomen and pelvis, should be performed for staging. Of these, EUS is recognized as valuable for diagnosis and treatment of gastric MALT lymphoma. The EUS findings of MALT lymphoma are superficially spreading, diffusely 2753 March 21, 2014 Volume 20 Issue 11

35 Park JB et al. H. pylori and MALT lymphoma Stage ⅠE1 Stage ⅠE2/ⅡE1 Stage ⅡE2/ⅢE/ⅣE H. pylori test (+) H. pylori test (-) H. pylori test (+) H. pylori test (-) Frist-line treatment H. pylori test eradication Radiation Radiation and H. pylori eradication Radiation If failed Second-line treatment Radiation Chemotherapy (or surgery) Chemotherapy Chemotherapy Chemotherapy and/or H. pylori eradication Figure 3 Ann Arbor staging system modified by Musshoff and suggested therapeutic algorithm for gastric mucosa-associated lymphoid tissue lymphoma. H.pylori: Helicobacter pylori. Table 1 Staging systems of gastric mucosa-associated lymphoid tissue lymphoma Lugano staging system for gastrointestinal lymphoma Ⅰ = Confined to GI tract (single primary or multiple, noncontiguous) TNM staging system modified for gastric lymphoma Ann Arbor staging system modified by Musshoff Tumor involvement T1 N0 M0 ⅠE1 Mucosa, submucosa T2 N0 M0 ⅠE2 Muscularis propria Serosa T3 N0 M0 Ⅱ = Extending into abdomen Ⅱ1 = Local nodal involvement T1-3 N1 M0 ⅡE1 Perigastric lymph nodes Ⅱ2 = Distant nodal involvement T1-3 N2 M0 ⅡE2 More distant regional lymph nodes ⅡE = Penetration of serosa to involve adjacent organs or tissues T4 N0 M0 ⅠE Invasion of adjacent structures Ⅳ = Disseminated extra-nodal involvement or concomitant supradiaphragmatic nodal involvement T1-4 N3 M0 ⅢE Lymph nodes on both sides of the diaphragm T1-4 N0-3 M1 ⅣE Distant metastases (e.g., bone marrow or additional extranodal sites) GI: Gastrointestinal; TNM: Tumor node metastasis. infiltrating, mass forming, and mixed types. Superficially spreading and diffusely infiltrative types are unique forms of low-grade MALT lymphoma [33]. In addition, EUS-guided biopsies are helpful for histologic evaluations when endoscopic biopsies are insufficient [34,35] and for supplementation of false negative endoscopic biopsies [36,37]. EUS can determine depth of infiltration and detect the presence of enlarged perigastric lymph nodes [38-42]. In one study, EUS produced a correct diagnosis of lymphoma with a sensitivity of 89%, specificity of 97%, and diagnostic accuracy of 95% and evaluation of lymphoma depth invasion with a sensitivity of 44%, specificity of 100%, and diagnostic accuracy of 77% [43,44]. In addition, EUS can be used for assessment of complete regression of MALT lymphoma after eradication of H. pylori. However, in this context, the effectiveness of EUS is controversial when verification of the presence or absence of a lesion is difficult due to atrophic changes caused by MALT lymphoma after H. pylori eradication [40]. Computed tomography is helpful for evalu- ation of lymph nodes on both sides of the diaphragm, but shows low sensitivity for detection of perigastric lymph node invasion [45]. Due to low fluorodeoxyglucose uptake, small lesion sizes, and slow progression, PET is not usually helpful [46-48]. TREATMENT OF GASTRIC MALT LYMPHOMA Low-grade MALT lymphoma (stage IE1 by Musshoff s modification of the Ann Arbor classification [49,50], that is, infiltration limited to mucosa and submucosa) can show complete regression after H. pylori eradication, and thus, surgery and chemotherapy options are held in abeyance until the effects of H. pylori eradication are known (Figure 3) [42,51]. Therefore, accurate diagnosis and staging are essential before initiation of treatment (Table 1). Most lowgrade MALT lymphomas are limited to the mucosal or submucosal layers, and response to H. pylori eradication is 2754 March 21, 2014 Volume 20 Issue 11

36 Park JB et al. H. pylori and MALT lymphoma decreased in cases of deeper involvement. Accordingly, evaluations of gastric wall involvement by EUS are important [42,52,53]. In general, MALT lymphoma shows slow progression and its prognosis is good when the disease is localized, before the terminal stage [54]. However, rate of progression to high-grade lymphoma accelerates with time; thus, early diagnosis and treatment is important. H. pylori eradication Numerous studies have confirmed that gastric MALT lymphoma can show complete regression according to endoscopic, histologic, and molecular criteria after H. pylori eradication [52,55-58] ; since the first such report was issued [5], other studies evaluating the effectiveness of H. pylori eradication in stage IE1 have reported complete remission rates of 60%-92% [5-7,59-64]. In general, patients who are positive for H. pylori are administered triple or quadruple H. pylori therapy for 1-2 wk [52,59,60], and then retested 4-8 wk later. If this first-line therapy fails, bismuthbased quadruple therapy (excluding antibiotics previously taken) is recommended [1,2,65]. Reported prevalence rates of H. pylori negativity in gastric MALT lymphoma range from 0% to 38% [66,67]. However, several factors should be kept in mind, such as after H. pylori eradication, recovery after H. pylori infection, non-h. pylori infection such as Helicobacter heilmannii or Helicobacter felis, or autoimmune effects can cause false negative results for H. pylori in early gastric MALT lymphoma. Thus, overlapping tests for H. pylori infection and detailed history taking are needed. Although five patients showing negative test results for H. pylori who were cured after H. pylori eradication have been reported [68-70], it is controversial. Successfully treated cases after radiotherapy only have been reported [71], however further studies are needed. Treatment of high-grade MALT lymphoma Changes to high-grade MALT lymphoma result in proliferation regardless of H. pylori antigen, and correlation between increase of stage or histologic grade and decrease of H. pylori infection rates has been reported [11]. More than 80% of patients with stage IIE disease (lymphoma additionally infiltrating lymph nodes on the same side of the diaphragm) were reported to be cured after total gastrectomy [72] ; however, this technique has a marked effect on quality of life [73]. On the other hand, involved field radiotherapy at Gy delivered in four weeks to the stomach and perigastric nodes was found to result in a complete remission rate of 90%-100% and a 5-year disease-free survival rate of approximately 80% [74-76]. Radiotherapy is preferred in patients with advanced disease negative for H. pylori and in those with persistent disease after H. pylori eradication [77]. Other treatments include chemotherapy, immunotherapy, or combined chemoimmunotherapy. Immunotherapy with rituximab, a chimeric monoclonal antibody directed against B-cellspecific antigen CD20, was first demonstrated in patients with follicular lymphomas [78]. In addition, the therapeutic use of this antibody has been extended over recent years to other types of non-hodgkin lymphomas, and it has shown good results as a single agent [78-80] or in combination with chemotherapy [81-84]. Rituximab is also effective in gastric MALT lymphoma resistant or refractory to antibiotics and negative for H. pylori infection [85,86]. If highgrade MALT lymphoma is positive for H. pylori infection, H. pylori eradication treatment should be administered because the presence of H. pylori could aid recurrence, although the usefulness of eradication in such cases has been questioned. Follow-up Complete remission of low-grade MALT lymphoma after H. pylori eradication takes considerable time; thus, regular endoscopic follow-up is needed. Regression may be indicated by an area of whitish or discolored mucosa with a granular pattern [87,88]. Nevertheless, endoscopic findings can be nonspecific in recurrent cases; thus, endoscopic biopsies of normal and abnormal-looking gastric areas are needed. Median time to remission is 5 mo, and is usually achieved within 12 mo; however, in some cases, time to remission has been reported to be as long as 45 mo [55,61,77]. Endoscopic examination with biopsies, tests for H. pylori infection, and EUS are recommended every 3 mo until remission, and then every 6 mo or annually for two years; however, the length of follow-up needed has not been determined [57,89]. Histologic remission of MALT lymphoma does not mean cure due to the possibility of false-negative results and of the survival of some malignant cells. Unfortunately, there is no unequivocal indicator of cure. A PCR test was recently devised for detection of tumor clones, and 50% of patients in clinical remission were found to have tumor clones by PCR. Furthermore, a decrease in clone counts was observed during continued follow-up [90]. In another study, these remnant malignant clones detected by PCR had disappeared at 12 mo [91]. Accordingly, a positive PCR result after achievement of histologic remission does not predict for subsequent relapse; thus, a long follow-up period is needed [58]. REFERENCES 1 Malfertheiner P, Megraud F, O Morain CA, Atherton J, Axon AT, Bazzoli F, Gensini GF, Gisbert JP, Graham DY, Rokkas T, El-Omar EM, Kuipers EJ. Management of Helicobacter pylori infection--the Maastricht IV/ Florence Consensus Report. Gut 2012; 61: [PMID: DOI: / gutjnl ] 2 Chey WD, Wong BC. American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] 3 Fujioka T, Yoshiiwa A, Okimoto T, Kodama M, Murakami K. Guidelines for the management of Helicobacter pylori infection in Japan: current status and future prospects. J Gastroenterol 2007; 42 Suppl 17: 3-6 [PMID: DOI: /s ] 4 Caselli M, Zullo A, Maconi G, Parente F, Alvisi V, Casetti T, Sorrentino D, Gasbarrini G. Cervia II Working Group Report 2006 : guidelines on diagnosis and treatment of Helico March 21, 2014 Volume 20 Issue 11

37 Park JB et al. H. pylori and MALT lymphoma bacter pylori infection in Italy. Dig Liver Dis 2007; 39: [PMID: DOI: /j.dld ] 5 Wotherspoon AC, Doglioni C, Diss TC, Pan L, Moschini A, de Boni M, Isaacson PG. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993; 342: [PMID: DOI: / (93) F] 6 Chen LT, Lin JT, Tai JJ, Chen GH, Yeh HZ, Yang SS, Wang HP, Kuo SH, Sheu BS, Jan CM, Wang WM, Wang TE, Wu CW, Chen CL, Su IJ, Whang-Peng J, Cheng AL. Long-term results of anti-helicobacter pylori therapy in early-stage gastric high-grade transformed MALT lymphoma. J Natl Cancer Inst 2005; 97: [PMID: DOI: /jnci/ dji277] 7 Stathis A, Chini C, Bertoni F, Proserpio I, Capella C, Mazzucchelli L, Pedrinis E, Cavalli F, Pinotti G, Zucca E. Longterm outcome following Helicobacter pylori eradication in a retrospective study of 105 patients with localized gastric marginal zone B-cell lymphoma of MALT type. Ann Oncol 2009; 20: [PMID: DOI: /annonc/ mdn760] 8 Nakamura S, Matsumoto T, Iida M, Yao T, Tsuneyoshi M. Primary gastrointestinal lymphoma in Japan: a clinicopathologic analysis of 455 patients with special reference to its time trends. Cancer 2003; 97: [PMID: DOI: /cncr.11415] 9 Ferrucci PF, Zucca E. Primary gastric lymphoma pathogenesis and treatment: what has changed over the past 10 years? Br J Haematol 2007; 136: [PMID: DOI: /j x] 10 Isaacson P, Wright DH. Malignant lymphoma of mucosa-associated lymphoid tissue. A distinctive type of B-cell lymphoma. Cancer 1983; 52: [PMID: ] 11 Nakamura S, Matsumoto T, Takeshita M, Kurahara K, Yao T, Tsuneyoshi M, Iida M, Fujishima M. A clinicopathologic study of primary small intestine lymphoma: prognostic significance of mucosa-associated lymphoid tissue-derived lymphoma. Cancer 2000; 88: [PMID: ] 12 Nagai S, Mimuro H, Yamada T, Baba Y, Moro K, Nochi T, Kiyono H, Suzuki T, Sasakawa C, Koyasu S. Role of Peyer s patches in the induction of Helicobacter pylori-induced gastritis. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 13 Liu H, Ye H, Ruskone-Fourmestraux A, De Jong D, Pileri S, Thiede C, Lavergne A, Boot H, Caletti G, Wündisch T, Molina T, Taal BG, Elena S, Thomas T, Zinzani PL, Neubauer A, Stolte M, Hamoudi RA, Dogan A, Isaacson PG, Du MQ. T(11; 18) is a marker for all stage gastric MALT lymphomas that will not respond to H. pylori eradication. Gastroenterology 2002; 122: [PMID: DOI: / gast ] 14 Ye H, Liu H, Attygalle A, Wotherspoon AC, Nicholson AG, Charlotte F, Leblond V, Speight P, Goodlad J, Lavergne- Slove A, Martin-Subero JI, Siebert R, Dogan A, Isaacson PG, Du MQ. Variable frequencies of t(11; 18)(q21; q21) in MALT lymphomas of different sites: significant association with CagA strains of H pylori in gastric MALT lymphoma. Blood 2003; 102: [PMID: DOI: / blood ] 15 Zucca E, Bertoni F, Roggero E, Cavalli F. The gastric marginal zone B-cell lymphoma of MALT type. Blood 2000; 96: [PMID: ] 16 Koch P, del Valle F, Berdel WE, Willich NA, Reers B, Hiddemann W, Grothaus-Pinke B, Reinartz G, Brockmann J, Temmesfeld A, Schmitz R, Rübe C, Probst A, Jaenke G, Bodenstein H, Junker A, Pott C, Schultze J, Heinecke A, Parwaresch R, Tiemann M. Primary gastrointestinal non-hodgkin s lymphoma: I. Anatomic and histologic distribution, clinical features, and survival data of 371 patients registered in the German Multicenter Study GIT NHL 01/92. J Clin Oncol 2001; 19: [PMID: ] 17 Kahl BS. Update: gastric MALT lymphoma. Curr Opin Oncol 2003; 15: [PMID: DOI: / ] 18 Wotherspoon AC, Doglioni C, Isaacson PG. Low-grade gastric B-cell lymphoma of mucosa-associated lymphoid tissue (MALT): a multifocal disease. Histopathology 1992; 20: [PMID: DOI: /j tb00912.x] 19 Taal BG, Boot H, van Heerde P, de Jong D, Hart AA, Burgers JM. Primary non-hodgkin lymphoma of the stomach: endoscopic pattern and prognosis in low versus high grade malignancy in relation to the MALT concept. Gut 1996; 39: [PMID: DOI: /gut ] 20 Seifert E, Schulte F, Weismüller J, de Mas CR, Stolte M. Endoscopic and bioptic diagnosis of malignant non-hodgkin s lymphoma of the stomach. Endoscopy 1993; 25: [PMID: DOI: /s ] 21 Caletti G, Barbara L. Gastric lymphoma: difficult to diagnose, difficult to stage? Endoscopy 1993; 25: [PMID: DOI: /s ] 22 Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf-Peeters C, Falini B, Gatter KC. A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 1994; 84: [PMID: ] 23 Isaacson PG, Spencer J. Malignant lymphoma of mucosaassociated lymphoid tissue. Histopathology 1987; 11: [PMID: DOI: /j tb02654.x] 24 Chan JK. Gastrointestinal lymphomas: an overview with emphasis on new findings and diagnostic problems. Semin Diagn Pathol 1996; 13: [PMID: ] 25 Hummel M, Oeschger S, Barth TF, Loddenkemper C, Cogliatti SB, Marx A, Wacker HH, Feller AC, Bernd HW, Hansmann ML, Stein H, Möller P. Wotherspoon criteria combined with B cell clonality analysis by advanced polymerase chain reaction technology discriminates covert gastric marginal zone lymphoma from chronic gastritis. Gut 2006; 55: [PMID: DOI: /gut ] 26 Aiello A, Giardini R, Tondini C, Balzarotti M, Diss T, Peng H, Delia D, Pilotti S. PCR-based clonality analysis: a reliable method for the diagnosis and follow-up monitoring of conservatively treated gastric B-cell MALT lymphomas? Histopathology 1999; 34: [PMID: DOI: / j x] 27 Diss TC, Peng H, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J Pathol 1993; 169: [PMID: DOI: /path ] 28 Pan LX, Diss TC, Peng HZ, Isaacson PG. Clonality analysis of defined B-cell populations in archival tissue sections using microdissection and the polymerase chain reaction. Histopathology 1994; 24: [PMID: DOI: / j tb00532.x] 29 Bertoni F, Cotter FE, Zucca E. Molecular genetics of extranodal marginal zone (MALT-type) B-cell lymphoma. Leuk Lymphoma 1999; 35: [PMID: DOI: / ] 30 de Mascarel A, Dubus P, Belleannée G, Megraud F, Merlio JP. Low prevalence of monoclonal B cells in Helicobacter pylori gastritis patients with duodenal ulcer. Hum Pathol 1998; 29: [PMID: DOI: / S (98) ] 31 Diss TC, Pan L. Polymerase chain reaction in the assessment of lymphomas. Cancer Surv 1997; 30: [PMID: ] 32 Pileri SA, Sabattini E. A rational approach to immunohistochemical analysis of malignant lymphomas on paraffin wax sections. J Clin Pathol 1997; 50: 2-4 [PMID: DOI: /jcp ] 2756 March 21, 2014 Volume 20 Issue 11

38 Park JB et al. H. pylori and MALT lymphoma 33 Mehra M, Agarwal B. Endoscopic diagnosis and staging of mucosa-associated lymphoid tissue lymphoma. Curr Opin Gastroenterol 2008; 24: [PMID: DOI: /MOG.0b013e32830bf80f] 34 Toyoda H, Ono T, Kiyose M, Toyoda M, Yamaguchi M, Shiku H, Tonouchi H. Gastric mucosa-associated lymphoid tissue lymphoma with a focal high-grade component diagnosed by EUS and endoscopic mucosal resection for histologic evaluation. Gastrointest Endosc 2000; 51: [PMID: DOI: /mge ] 35 Queneau PE, Helg C, Brundler MA, Frossard JL, Spahr L, Girardet C, Armenian B, Hadengue A. Diagnosis of a gastric mucosa-associated lymphoid tissue lymphoma by endoscopic ultrasonography-guided biopsies in a patient with a parotid gland localization. Scand J Gastroenterol 2002; 37: [PMID: DOI: / ] 36 Fujishima H, Misawa T, Maruoka A, Chijiiwa Y, Sakai K, Nawata H. Staging and follow-up of primary gastric lymphoma by endoscopic ultrasonography. Am J Gastroenterol 1991; 86: [PMID: ] 37 Lévy M, Hammel P, Lamarque D, Marty O, Chaumette MT, Haioun C, Blazquez M, Delchier JC. Endoscopic ultrasonography for the initial staging and follow-up in patients with low-grade gastric lymphoma of mucosa-associated lymphoid tissue treated medically. Gastrointest Endosc 1997; 46: [PMID: DOI: /S (97) ] 38 Fischbach W, Goebeler-Kolve ME, Greiner A. Diagnostic accuracy of EUS in the local staging of primary gastric lymphoma: results of a prospective, multicenter study comparing EUS with histopathologic stage. Gastrointest Endosc 2002; 56: [PMID: DOI: / S (02) ] 39 Caletti G, Zinzani PL, Fusaroli P, Buscarini E, Parente F, Federici T, Peyre S, De Angelis C, Bonanno G, Togliani T, Pileri S, Tura S. The importance of endoscopic ultrasonography in the management of low-grade gastric mucosaassociated lymphoid tissue lymphoma. Aliment Pharmacol Ther 2002; 16: [PMID: DOI: / j x] 40 Nakamura S, Matsumoto T, Suekane H, Takeshita M, Hizawa K, Kawasaki M, Yao T, Tsuneyoshi M, Iida M, Fujishima M. Predictive value of endoscopic ultrasonography for regression of gastric low grade and high grade MALT lymphomas after eradication of Helicobacter pylori. Gut 2001; 48: [PMID: DOI: /gut ] 41 Pavlick AC, Gerdes H, Portlock CS. Endoscopic ultrasound in the evaluation of gastric small lymphocytic mucosaassociated lymphoid tumors. J Clin Oncol 1997; 15: [PMID: ] 42 Sackmann M, Morgner A, Rudolph B, Neubauer A, Thiede C, Schulz H, Kraemer W, Boersch G, Rohde P, Seifert E, Stolte M, Bayerdoerffer E. Regression of gastric MALT lymphoma after eradication of Helicobacter pylori is predicted by endosonographic staging. MALT Lymphoma Study Group. Gastroenterology 1997; 113: [PMID: DOI: /gast.1997.v113.pm ] 43 Caletti G, Ferrari A, Brocchi E, Barbara L. Accuracy of endoscopic ultrasonography in the diagnosis and staging of gastric cancer and lymphoma. Surgery 1993; 113: [PMID: ] 44 Palazzo L, Roseau G, Ruskone-Fourmestraux A, Rougier P, Chaussade S, Rambaud JC, Couturier D, Paolaggi JA. Endoscopic ultrasonography in the local staging of primary gastric lymphoma. Endoscopy 1993; 25: [PMID: DOI: /s ] 45 Grau E, Gomez A, Cuñat A, Oltra C. Computed tomography in staging of primary gastric lymphoma. Lancet 1996; 347: 1261 [PMID: DOI: /S (96)90776-X] 46 Elstrom R, Guan L, Baker G, Nakhoda K, Vergilio JA, Zhuang H, Pitsilos S, Bagg A, Downs L, Mehrotra A, Kim S, Alavi A, Schuster SJ. Utility of FDG-PET scanning in lymphoma by WHO classification. Blood 2003; 101: [PMID: DOI: /blood ] 47 Cheson BD, Pfistner B, Juweid ME, Gascoyne RD, Specht L, Horning SJ, Coiffier B, Fisher RI, Hagenbeek A, Zucca E, Rosen ST, Stroobants S, Lister TA, Hoppe RT, Dreyling M, Tobinai K, Vose JM, Connors JM, Federico M, Diehl V. Revised response criteria for malignant lymphoma. J Clin Oncol 2007; 25: [PMID: DOI: / JCO ] 48 Alinari L, Castellucci P, Elstrom R, Ambrosini V, Stefoni V, Nanni C, Berkowitz A, Tani M, Farsad M, Franchi R, Fanti S, Zinzani PL. 18F-FDG PET in mucosa-associated lymphoid tissue (MALT) lymphoma. Leuk Lymphoma 2006; 47: [PMID: DOI: / ] 49 Musshoff K. [Clinical staging classification of non-hodgkin s lymphomas (author s transl)]. Strahlentherapie 1977; 153: [PMID: ] 50 Carbone PP, Kaplan HS, Musshoff K, Smithers DW, Tubiana M. Report of the Committee on Hodgkin s Disease Staging Classification. Cancer Res 1971; 31: [PMID: ] 51 Ahmad A, Govil Y, Frank BB. Gastric mucosa-associated lymphoid tissue lymphoma. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 52 Neubauer A, Thiede C, Morgner A, Alpen B, Ritter M, Neubauer B, Wündisch T, Ehninger G, Stolte M, Bayerdörffer E. Cure of Helicobacter pylori infection and duration of remission of low-grade gastric mucosa-associated lymphoid tissue lymphoma. J Natl Cancer Inst 1997; 89: [PMID: DOI: /jnci/ ] 53 Nobre-Leitão C, Lage P, Cravo M, Cabeçadas J, Chaves P, Alberto-Santos A, Correia J, Soares J, Costa-Mira F. Treatment of gastric MALT lymphoma by Helicobacter pylori eradication: a study controlled by endoscopic ultrasonography. Am J Gastroenterol 1998; 93: [PMID: ] 54 Radaszkiewicz T, Dragosics B, Bauer P. Gastrointestinal malignant lymphomas of the mucosa-associated lymphoid tissue: factors relevant to prognosis. Gastroenterology 1992; 102: [PMID: ] 55 Steinbach G, Ford R, Glober G, Sample D, Hagemeister FB, Lynch PM, McLaughlin PW, Rodriguez MA, Romaguera JE, Sarris AH, Younes A, Luthra R, Manning JT, Johnson CM, Lahoti S, Shen Y, Lee JE, Winn RJ, Genta RM, Graham DY, Cabanillas FF. Antibiotic treatment of gastric lymphoma of mucosa-associated lymphoid tissue. An uncontrolled trial. Ann Intern Med 1999; 131: [PMID: DOI: / ] 56 Montalban C, Santon A, Boixeda D, Redondo C, Alvarez I, Calleja JL, de Argila CM, Bellas C. Treatment of low grade gastric mucosa-associated lymphoid tissue lymphoma in stage I with Helicobacter pylori eradication. Long-term results after sequential histologic and molecular follow-up. Haematologica 2001; 86: [PMID: ] 57 Fischbach W, Goebeler-Kolve ME, Dragosics B, Greiner A, Stolte M. Long term outcome of patients with gastric marginal zone B cell lymphoma of mucosa associated lymphoid tissue (MALT) following exclusive Helicobacter pylori eradication therapy: experience from a large prospective series. Gut 2004; 53: [PMID: DOI: / gut ] 58 Bertoni F, Conconi A, Capella C, Motta T, Giardini R, Ponzoni M, Pedrinis E, Novero D, Rinaldi P, Cazzaniga G, Biondi A, Wotherspoon A, Hancock BW, Smith P, Souhami R, Cotter FE, Cavalli F, Zucca E. Molecular follow-up in gastric mucosa-associated lymphoid tissue lymphomas: early analysis of the LY03 cooperative trial. Blood 2002; 99: [PMID: DOI: /blood.V ] 59 Bayerdörffer E, Neubauer A, Rudolph B, Thiede C, Lehn N, Eidt S, Stolte M. Regression of primary gastric lymphoma of 2757 March 21, 2014 Volume 20 Issue 11

39 Park JB et al. H. pylori and MALT lymphoma mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. MALT Lymphoma Study Group. Lancet 1995; 345: [PMID: DOI: / S (95) ] 60 Roggero E, Zucca E, Pinotti G, Pascarella A, Capella C, Savio A, Pedrinis E, Paterlini A, Venco A, Cavalli F. Eradication of Helicobacter pylori infection in primary low-grade gastric lymphoma of mucosa-associated lymphoid tissue. Ann Intern Med 1995; 122: [PMID: DOI: / ] 61 Pinotti G, Zucca E, Roggero E, Pascarella A, Bertoni F, Savio A, Savio E, Capella C, Pedrinis E, Saletti P, Morandi E, Santandrea G, Cavalli F. Clinical features, treatment and outcome in a series of 93 patients with low-grade gastric MALT lymphoma. Leuk Lymphoma 1997; 26: [PMID: ] 62 Wotherspoon AC. Gastric lymphoma of mucosa-associated lymphoid tissue and Helicobacter pylori. Annu Rev Med 1998; 49: [PMID: DOI: /annurev. med ] 63 Choi YJ, Lee DH, Kim JY, Kwon JE, Kim JY, Jo HJ, Shin CM, Kim HY, Park YS, Kim N, Jung HC, Song IS. Low Grade Gastric Mucosa-associated Lymphoid Tissue Lymphoma: Clinicopathological Factors Associated with Helicobacter pylori Eradication and Tumor Regression. Clin Endosc 2011; 44: [PMID: DOI: /ce ] 64 Montalban C, Norman F. Treatment of gastric mucosaassociated lymphoid tissue lymphoma: Helicobacter pylori eradication and beyond. Expert Rev Anticancer Ther 2006; 6: [PMID: DOI: / ] 65 Fock KM, Katelaris P, Sugano K, Ang TL, Hunt R, Talley NJ, Lam SK, Xiao SD, Tan HJ, Wu CY, Jung HC, Hoang BH, Kachintorn U, Goh KL, Chiba T, Rani AA. Second Asia-Pacific Consensus Guidelines for Helicobacter pylori infection. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 66 Nakamura S, Yao T, Aoyagi K, Iida M, Fujishima M, Tsuneyoshi M. Helicobacter pylori and primary gastric lymphoma. A histopathologic and immunohistochemical analysis of 237 patients. Cancer 1997; 79: 3-11 [PMID: ] 67 Karat D, O Hanlon DM, Hayes N, Scott D, Raimes SA, Griffin SM. Prospective study of Helicobacter pylori infection in primary gastric lymphoma. Br J Surg 1995; 82: [PMID: DOI: /bjs ] 68 Morgner A, Lehn N, Andersen LP, Thiede C, Bennedsen M, Trebesius K, Neubauer B, Neubauer A, Stolte M, Bayerdörffer E. Helicobacter heilmannii-associated primary gastric low-grade MALT lymphoma: complete remission after curing the infection. Gastroenterology 2000; 118: [PMID: DOI: /S (00) ] 69 Chen LT, Lin JT, Shyu RY, Jan CM, Chen CL, Chiang IP, Liu SM, Su IJ, Cheng AL. Prospective study of Helicobacter pylori eradication therapy in stage I(E) high-grade mucosaassociated lymphoid tissue lymphoma of the stomach. J Clin Oncol 2001; 19: [PMID: ] 70 Raderer M, Streubel B, Wöhrer S, Häfner M, Chott A. Successful antibiotic treatment of Helicobacter pylori negative gastric mucosa associated lymphoid tissue lymphomas. Gut 2006; 55: [PMID: DOI: / gut ] 71 Schechter NR, Portlock CS, Yahalom J. Treatment of mucosa-associated lymphoid tissue lymphoma of the stomach with radiation alone. J Clin Oncol 1998; 16: [PMID: ] 72 Kuo SH, Chen LT, Wu MS, Lin CW, Yeh KH, Kuo KT, Yeh PY, Tzeng YS, Wang HP, Hsu PN, Lin JT, Cheng AL. Longterm follow-up of gastrectomized patients with mucosaassociated lymphoid tissue lymphoma: need for a revisit of surgical treatment. Ann Surg 2008; 247: [PMID: DOI: /SLA.0b013e ] 73 Yoon SS, Coit DG, Portlock CS, Karpeh MS. The diminishing role of surgery in the treatment of gastric lymphoma. Ann Surg 2004; 240: [PMID: DOI: /01. sla c] 74 Schechter NR, Yahalom J. Low-grade MALT lymphoma of the stomach: a review of treatment options. Int J Radiat Oncol Biol Phys 2000; 46: [PMID: DOI: / S (99) ] 75 Tsang RW, Gospodarowicz MK, Pintilie M, Wells W, Hodgson DC, Sun A, Crump M, Patterson BJ. Localized mucosaassociated lymphoid tissue lymphoma treated with radiation therapy has excellent clinical outcome. J Clin Oncol 2003; 21: [PMID: DOI: /JCO ] 76 Yahalom J. MALT lymphomas: a radiation oncology viewpoint. Ann Hematol 2001; 80 Suppl 3: B100-B105 [PMID: ] 77 Du MQ, Isaccson PG. Gastric MALT lymphoma: from aetiology to treatment. Lancet Oncol 2002; 3: [PMID: DOI: /S (02) ] 78 McLaughlin P, Grillo-López AJ, Link BK, Levy R, Czuczman MS, Williams ME, Heyman MR, Bence-Bruckler I, White CA, Cabanillas F, Jain V, Ho AD, Lister J, Wey K, Shen D, Dallaire BK. Rituximab chimeric anti-cd20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol 1998; 16: [PMID: ] 79 Foran JM, Rohatiner AZ, Cunningham D, Popescu RA, Solal-Celigny P, Ghielmini M, Coiffier B, Johnson PW, Gisselbrecht C, Reyes F, Radford JA, Bessell EM, Souleau B, Benzohra A, Lister TA. European phase II study of rituximab (chimeric anti-cd20 monoclonal antibody) for patients with newly diagnosed mantle-cell lymphoma and previously treated mantle-cell lymphoma, immunocytoma, and small B-cell lymphocytic lymphoma. J Clin Oncol 2000; 18: [PMID: ] 80 Dimopoulos MA, Zervas C, Zomas A, Kiamouris C, Viniou NA, Grigoraki V, Karkantaris C, Mitsouli C, Gika D, Christakis J, Anagnostopoulos N. Treatment of Waldenström s macroglobulinemia with rituximab. J Clin Oncol 2002; 20: [PMID: DOI: /JCO ] 81 Coiffier B, Haioun C, Ketterer N, Engert A, Tilly H, Ma D, Johnson P, Lister A, Feuring-Buske M, Radford JA, Capdeville R, Diehl V, Reyes F. Rituximab (anti-cd20 monoclonal antibody) for the treatment of patients with relapsing or refractory aggressive lymphoma: a multicenter phase II study. Blood 1998; 92: [PMID: ] 82 Czuczman MS, Grillo-López AJ, White CA, Saleh M, Gordon L, LoBuglio AF, Jonas C, Klippenstein D, Dallaire B, Varns C. Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-cd20 monoclonal antibody and CHOP chemotherapy. J Clin Oncol 1999; 17: [PMID: ] 83 Vose JM, Link BK, Grossbard ML, Czuczman M, Grillo- Lopez A, Gilman P, Lowe A, Kunkel LA, Fisher RI. Phase II study of rituximab in combination with chop chemotherapy in patients with previously untreated, aggressive non- Hodgkin s lymphoma. J Clin Oncol 2001; 19: [PMID: ] 84 Coiffier B, Lepage E, Briere J, Herbrecht R, Tilly H, Bouabdallah R, Morel P, Van Den Neste E, Salles G, Gaulard P, Reyes F, Lederlin P, Gisselbrecht C. CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-b-cell lymphoma. N Engl J Med 2002; 346: [PMID: DOI: /NEJMoa011795] 85 Conconi A, Martinelli G, Thiéblemont C, Ferreri AJ, Devizzi L, Peccatori F, Ponzoni M, Pedrinis E, Dell Oro S, Pruneri G, Filipazzi V, Dietrich PY, Gianni AM, Coiffier B, Cavalli F, Zucca E. Clinical activity of rituximab in extranodal marginal zone B-cell lymphoma of MALT type. Blood 2003; 102: [PMID: DOI: /blood ] 2758 March 21, 2014 Volume 20 Issue 11

40 Park JB et al. H. pylori and MALT lymphoma 86 Martinelli G, Laszlo D, Ferreri AJ, Pruneri G, Ponzoni M, Conconi A, Crosta C, Pedrinis E, Bertoni F, Calabrese L, Zucca E. Clinical activity of rituximab in gastric marginal zone non-hodgkin s lymphoma resistant to or not eligible for anti-helicobacter pylori therapy. J Clin Oncol 2005; 23: [PMID: DOI: /JCO ] 87 Urakami Y, Sano T, Begum S, Endo H, Kawamata H, Oki Y. Endoscopic characteristics of low-grade gastric mucosa-associated lymphoid tissue lymphoma after eradication of Helicobacter pylori. J Gastroenterol Hepatol 2000; 15: [PMID: DOI: /j x] 88 Ishihara R, Tatsuta M, Iishi H, Uedo N, Narahara H, Ishiguro S. Usefulness of endoscopic appearance for choosing a biopsy target site and determining complete remission of primary gastric lymphoma of mucosa-associated lymphoid tissue after eradication of Helicobacter pylori infection. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 89 Wündisch T, Thiede C, Morgner A, Dempfle A, Günther A, Liu H, Ye H, Du MQ, Kim TD, Bayerdörffer E, Stolte M, Neubauer A. Long-term follow-up of gastric MALT lymphoma after Helicobacter pylori eradication. J Clin Oncol 2005; 23: [PMID: DOI: /JCO ] 90 Thiede C, Wündisch T, Neubauer B, Alpen B, Morgner A, Ritter M, Ehninger G, Stolte M, Bayerdörffer E, Neubauer A. Eradication of Helicobacter pylori and stability of remissions in low-grade gastric B-cell lymphomas of the mucosa-associated lymphoid tissue: results of an ongoing multicenter trial. Recent Results Cancer Res 2000; 156: [PMID: DOI: / _16] 91 Montalban C, Manzanal A, Boixeda D, Redondo C, Alvarez I, Calleja JL, Bellas C. Helicobacter pylori eradication for the treatment of low-grade gastric MALT lymphoma: follow-up together with sequential molecular studies. Ann Oncol 1997; 8 Suppl 2: [PMID: DOI: /annonc/8. suppl_2.s37] P- Reviewers: Peter B, Sakata N S- Editor: Qi Y L- Editor: O Neill M E- Editor: Wang CH 2759 March 21, 2014 Volume 20 Issue 11

41 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor TOPIC HIGHLIGHT Efficacy of Helicobacter pylori eradication for the prevention of metachronous gastric cancer after endoscopic resection for early gastric cancer Jae Young Jang, Hoon Jai Chun Jae Young Jang, Division of Gastroenterology, Department of Internal Medicine, College of Medicine, Kyung Hee University, Seoul , South Korea Hoon Jai Chun, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, Seoul , South Korea Author contributions: Jang JY wrote the paper; Chun HJ designed and edited the paper. Correspondence to: Hoon Jai Chun, MD, PhD, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, 73 Inchon-ro, Seongbuk-gu, Seoul , South Korea. drchunhj@chol.com Telephone: Fax: Received: August 16, 2013 Revised: November 9, 2013 Accepted: November 28, 2013 Published online: March 21, 2014 Abstract Helicobacter pylori (H. pylori) plays an important role in gastric carcinogenesis, as the majority of gastric cancers develop from H. pylori-infected gastric mucosa. The rate of early gastric cancer diagnosis has increased in Japan and Korea, where H. pylori infection and gastric cancer are highly prevalent. Early intestinal-type gastric cancer without concomitant lymph node metastasis is usually treated by endoscopic resection. Secondary metachronous gastric cancers often develop because atrophic mucosa left untreated after endoscopic treatment confers a high risk of gastric cancer. The efficacy of H. pylori eradication for the prevention of metachronous gastric cancer remains controversial. However, in patients who undergo endoscopic resection of early gastric cancer, H. pylori eradication is recommended to suppress or delay metachronous gastric cancer. Careful and regularly scheduled endoscopy should be performed to detect minute metachronous gastric cancer after endoscopic resection Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Helicobacter pylori ; Gastric cancer; Endoscopic resection; Metachronous cancer Core tip: In Japan and Korea, mucosal gastric cancer without concomitant lymph node metastasis is usually treated with endoscopic resection. However, gastric cancer recurrence following endoscopic resection is a significant problem. Secondary metachronous gastric cancers often develop due to atrophic mucosa left untreated after endoscopic treatment. Currently, all available evidence suggests that Helicobacter pylori (H. pylori ) eradication represents a primary chemopreventive strategy. However, the efficacy of H. pylori eradication for the prevention of metachronous gastric cancer has been controversial. Therefore, endoscopists should inspect the entire stomach for minute or occult metachronous gastric cancer. In addition, regular surveillance endoscopy should be performed. Jang JY, Chun HJ. Efficacy of Helicobacter pylori eradication for the prevention of metachronous gastric cancer after endoscopic resection for early gastric cancer. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2760.htm DOI: org/ /wjg.v20.i INTRODUCTION Gastric cancer ranks as the fourth most common cancer and the second most frequent cause of death from can March 21, 2014 Volume 20 Issue 11

42 Jang JY et al. H. pylori eradication after ER for EGC cer, accounting for 10.4% of cancer deaths worldwide [1]. Although the incidence of gastric cancer has declined in recent years, it remains a major health concern. Gastric carcinogenesis is a multifactorial process influenced by an interaction of host factors, including Helicobacter pylori (H. pylori) infection and environmental factors, such as diets rich in salt and nitrates/nitrites [2]. H. pylori plays an important role in gastric carcinogenesis, as the majority of non-cardia gastric cancers develop from H. pyloriinfected mucosa [3]. H. pylori colonizes the gastric mucosa and triggers a series of inflammatory reactions, which are considered an important cause of chronic atrophic gastritis [4,5], an early step in a series of mucosal changes in the stomach leading to cancer. The current model for stomach carcinogenesis begins with gastritis and proceeds to chronic atrophic gastritis, followed by intestinal metaplasia, dysplasia, and, finally, carcinoma [6]. This model is supported by a considerable number of clinicopathological and epidemiological studies conducted in countries with a high incidence of gastric cancer; indeed, the World Health Organization has categorized H. pylori as a group 1 carcinogen for gastric cancer on the basis of these epidemiological studies [7,8]. Furthermore, animal models have clearly shown a causal link between H. pylori and gastric cancers [9,10], and H. pylori eradication has been shown to be a primary preventive measure for gastric cancer in these models [11]. However, the primary prevention of gastric cancer through H. pylori eradication in humans remains controversial. In Japan and Korea, mucosal gastric cancer without concomitant lymph node metastasis is usually treated with endoscopic resection (i.e., endoscopic mucosal resection and endoscopic submucosal dissection). Secondary metachronous gastric cancers often develop due to atrophic mucosa left untreated after endoscopic treatment, which confers a high risk of gastric cancer. The Japanese Society for Helicobacter Research has recommended that patients undergo H. pylori eradication therapy following endoscopic treatment of early gastric cancer for the prevention of metachronous cancers [12]. However, few studies have evaluated the efficacy of H. pylori eradication for metachronous gastric cancer prevention. The aim of this review is to evaluate existing evidence on the efficacy of H. pylori eradication for the prevention of metachronous gastric cancer after endoscopic resection of early gastric cancer. We reviewed large-scale epidemiological studies, meta-analyses, and animal model-based investigations linking gastric cancer to H. pylori infection. Literature searches using the Medline and PubMed databases were performed as part of the preparation for the implementation of this guideline. Our search was performed using index words related to H. pylori ( Helicobacter pylori OR Helicobacter OR pylori OR eradication ), gastric cancer ( gastric cancer OR stomach cancer OR metachronous ), and treatment ( endoscopic resection OR endoscopic submucosal dissection ). EFFECT OF H. PYLORI ERADICATION ON PRIMARY PREVENTION OF GASTRIC CANCER Intervention studies completed in Columbia [13], China [14], and Japan [15] have suggested that H. pylori eradication is the most effective approach to gastric cancer prevention, but that it is more effective in patients with no basal atrophic gastritis or intestinal metaplasia. A pooled analysis of six studies with a total of 6695, largely Asian, participants followed for 4-10 years showed that the relative risk of gastric cancer after H. pylori eradication was 0.65 (95%CI: ) [16]. However, a large-scale, double-blind randomized study in China showed that gastric cancer was still diagnosed after successful eradication of H. pylori and that eradication did not lead to a significant decrease in the incidence of gastric cancer [17]. A meta-analysis of four randomized intervention studies with gastric cancer incidence serving as a secondary outcome showed a nonsignificant OR of 0.67 (95%CI: ) [18]. Currently, all available evidence suggests that H. pylori eradication represents a primary chemopreventive strategy in a subset of subjects. However, H. pylori eradication in patients who have already developed advanced pre-neoplastic lesions does not prevent gastric cancer development. RISK OF METACHRONOUS CANCER IN PATIENTS WHO HAVE UNDERGONE ENDOSCOPIC RESECTION AND H. PYLORI ERADICATION FOR EARLY GASTRIC CANCER The rate of early gastric cancer diagnosis has increased due to improved diagnostic procedures and use of endoscopy as a screening tool, particularly in asymptomatic individuals in Japan and Korea. In Japan, 60% of gastric cancers are early-stage tumors [19]. Early intestinaltype gastric cancer without concomitant lymph node metastasis is usually treated with endoscopic resection. Guidelines for the treatment of gastric cancer state that intestinal-type mucosal cancer < 20 mm in diameter with no evidence of ulcer or ulcer scar is an indication for endoscopic resection [20]. However, gastric cancer recurrence following endoscopic resection of early gastric cancer is a significant problem, as gastric cancer patients may have a higher H. pylori infection rate (71%-95%) [21] and a more abnormal mucosa with atrophic gastritis or intestinal metaplasia than the general population. Therefore, field carcinogenesis can result in gastric cancer, as the gastric environment is likely to promote the occurrence of secondary cancer. Gastric cancer can recur in the stomach as a local recurrence or metachronous cancers. Metachronous gastric cancer is defined as new carcinoma that develops in areas other than the primary site at least 1 year after 2761 March 21, 2014 Volume 20 Issue 11

43 Jang JY et al. H. pylori eradication after ER for EGC endoscopic resection. As endoscopic resection spares a larger area of the gastric mucosa, multiple metachronous cancers may occur more frequently after endoscopic resection than after partial gastrectomy. The estimated recurrence rate of early gastric cancer in the gastric stump is 1.13%-1.90% [22,23]. Hosokawa et al [24] reported that the cumulative 5-year prevalence of residual gastric cancer post-partial gastrectomy for early gastric cancer was 2.4%. An increased risk of metachronous gastric cancers is expected in patients treated by endoscopic resection, in proportion to the larger area of gastric mucosa remaining in these patients. The length of follow-up has varied in previous studies, but the annual incidence rate of metachronous gastric cancer after endoscopic resection ranged from 3.3%-3.5% [19,25,26]. H. pylori eradication from the residual gastric mucosa after endoscopic treatment of early gastric cancer has an inhibitory effect on the occurrence of metachronous gastric cancer [27,28], and has been recommended in various guidelines [12,29]. Uemura et al [27] assigned patients who had undergone endoscopic therapy for early gastric cancer to an H. pylori eradication group or a non-eradication group and performed long-term follow-up. During a follow-up period of approximately 5 years, secondary gastric cancer was detected in 10 of 67 (15%) patients in the non-eradication group and 0 of 65 patients in the eradication group [27]. This study was not evaluated highly because the sample size was small and the patients were not strictly randomized. However, a multicenter retrospective study by Nakagawa et al [28] yielded a similar result. This study included 2835 patients with a median follow-up period of 2 years, during which H. pylori was eradicated in 356 (13%) patients. Metachronous gastric cancers developed in 8 (2%) patients successfully treated for H. pylori, compared with 129 (5%) patients with persistent H. pylori infection (OR = 0.42, 95%CI: , P = 0.021). A prospective randomized trial by Fukase et al [30] showed a significant decrease in the incidence of metachronous gastric cancer after endoscopic resection of early gastric cancer during a 3-year follow-up period. Secondary cancers were observed in significantly fewer (9 of 255) patients in the H. pylori eradication group compared with the control group (24 of 250 patients; HR = 0.339, 95%CI: , P = 0.003). In both groups, intestinal metaplasia was observed in 45%-65% of patients and gastric mucosal atrophy was moderate or severe in 80%-90% of patients. The authors concluded that H. pylori eradication might also be effective in patients who have early gastric cancer with mucosal atrophy and intestinal metaplasia. They suspected that eradication would inhibit the occurrence of new gastric cancer and reduce the growth rate of cancers that do occur. Because the 3-year follow-up period of this study was too brief to evaluate whether eradication prevents new occurrence of gastric cancer, this study likely evaluated clinical cancers that developed from occult cancer; i.e., cancer that existed but was not detectable at the time of endoscopic treatment. If the detection time of residual cancer in the eradication group was delayed compared with the control group, these findings may thus indicate that H. pylori eradication decreases the rate of gastric cancer growth. In contrast, a recently reported retrospective multicenter study showed that H. pylori eradication after endoscopic resection of early gastric cancer does not reduce the incidence of metachronous gastric cancer [31]. During overall follow-up periods of (median, 3.0) years, metachronous gastric cancer developed in 13 of 177 (14.3%) patients in the persistent group and 15 of 91 (8.5%) patients in the eradicated group (log-rank test, P = 0.262). This finding is in agreement with a report from China that H. pylori eradication did not significantly reduce the incidence of gastric cancer [17]. Based on a multivariate logistic regression analysis, severe mucosal atrophy at baseline and during > 5 years of follow-up were found to be independent risk factors for the development of metachronous gastric cancer. The authors concluded that H. pylori should be eradicated before the progression of gastric mucosal atrophy. Haruma et al [32] also reported that severe mucosal atrophy was more frequent in patients with metachronous gastric cancer after H. pylori eradication than in those without, and that severe corpus atrophy was the only independent risk factor for cancer after H. pylori eradication. According to one recent multicenter retrospective study [26], the mean annual incidence rate of metachronous cancers was 3.5% in 1258 patients with early gastric cancer who were followed after endoscopic resection. The incidence rate did not differ between patients with or without H. pylori eradication [26]. Until now, the efficacy of H. pylori eradication for the prevention of metachronous gastric cancer has been controversial. Despite incongruities, as suggested by the existence of several guidelines, H. pylori eradication has been recommended to suppress or delay metachronous gastric cancer in patients who have undergone endoscopic resection of early gastric cancer. At the very least, we suspect that such benefits will be greater in patients without atrophy or intestinal metaplasia. However, eradication does not completely eliminate the risk of developing gastric cancer. Therefore, endoscopists using newly developed imaging techniques, such as magnifying endoscopy and narrow band imaging, should inspect the entire stomach for minute or occult metachronous gastric cancer. In addition, regular surveillance endoscopy should be performed every 6-12 mo for 5 years after initial endoscopic resection. REFERENCES 1 Parkin DM. International variation. Oncogene 2004; 23: [PMID: DOI: /sj.onc ] 2 Houghton J, Wang TC. Helicobacter pylori and gastric cancer: a new paradigm for inflammation-associated epithelial cancers. Gastroenterology 2005; 128: [PMID: DOI: /j.gastro ] 3 Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 2001; 345: [PMID: DOI: /NEJMoa001999] 2762 March 21, 2014 Volume 20 Issue 11

44 Jang JY et al. H. pylori eradication after ER for EGC 4 Kuipers EJ, Uyterlinde AM, Peña AS, Roosendaal R, Pals G, Nelis GF, Festen HP, Meuwissen SG. Long-term sequelae of Helicobacter pylori gastritis. Lancet 1995; 345: [PMID: DOI: /S (95) ] 5 Correa P, Miller MJ. Helicobacter pylori and gastric atrophy- -cancer paradoxes. J Natl Cancer Inst 1995; 87: [PMID: DOI: /jnci/ ] 6 Correa P. The epidemiology of gastric cancer. World J Surg 1991; 15: [PMID: DOI: /BF ] 7 Forman D, Newell DG, Fullerton F, Yarnell JW, Stacey AR, Wald N, Sitas F. Association between infection with Helicobacter pylori and risk of gastric cancer: evidence from a prospective investigation. BMJ 1991; 302: [PMID: DOI: /bmj ] 8 Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 1991; 325: [PMID: DOI: / NEJM ] 9 Watanabe T, Tada M, Nagai H, Sasaki S, Nakao M. Helicobacter pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology 1998; 115: [PMID: DOI: /S (98)70143-X] 10 Honda S, Fujioka T, Tokieda M, Satoh R, Nishizono A, Nasu M. Development of Helicobacter pylori-induced gastric carcinoma in Mongolian gerbils. Cancer Res 1998; 58: [PMID: ] 11 Shimizu N, Ikehara Y, Inada K, Nakanishi H, Tsukamoto T, Nozaki K, Kaminishi M, Kuramoto S, Sugiyama A, Katsuyama T, Tatematsu M. Eradication diminishes enhancing effects of Helicobacter pylori infection on glandular stomach carcinogenesis in Mongolian gerbils. Cancer Res 2000; 60: [PMID: ] 12 Asaka M, Kato M, Takahashi S, Fukuda Y, Sugiyama T, Ota H, Uemura N, Murakami K, Satoh K, Sugano K. Guidelines for the management of Helicobacter pylori infection in Japan: 2009 revised edition. Helicobacter 2010; 15: 1-20 [PMID: DOI: /j x] 13 Mera R, Fontham ET, Bravo LE, Bravo JC, Piazuelo MB, Camargo MC, Correa P. Long term follow up of patients treated for Helicobacter pylori infection. Gut 2005; 54: [PMID: DOI: /gut ] 14 You WC, Brown LM, Zhang L, Li JY, Jin ML, Chang YS, Ma JL, Pan KF, Liu WD, Hu Y, Crystal-Mansour S, Pee D, Blot WJ, Fraumeni JF, Xu GW, Gail MH. Randomized doubleblind factorial trial of three treatments to reduce the prevalence of precancerous gastric lesions. J Natl Cancer Inst 2006; 98: [PMID: DOI: /jnci/djj264] 15 Take S, Mizuno M, Ishiki K, Nagahara Y, Yoshida T, Yokota K, Oguma K, Okada H, Shiratori Y. The effect of eradicating helicobacter pylori on the development of gastric cancer in patients with peptic ulcer disease. Am J Gastroenterol 2005; 100: [PMID: DOI: / j x] 16 Fuccio L, Zagari RM, Eusebi LH, Laterza L, Cennamo V, Ceroni L, Grilli D, Bazzoli F. Meta-analysis: can Helicobacter pylori eradication treatment reduce the risk for gastric cancer? Ann Intern Med 2009; 151: [PMID: DOI: / ] 17 Wong BC, Lam SK, Wong WM, Chen JS, Zheng TT, Feng RE, Lai KC, Hu WH, Yuen ST, Leung SY, Fong DY, Ho J, Ching CK, Chen JS. Helicobacter pylori eradication to prevent gastric cancer in a high-risk region of China: a randomized controlled trial. JAMA 2004; 291: [PMID: DOI: /jama ] 18 Fuccio L, Zagari RM, Minardi ME, Bazzoli F. Systematic review: Helicobacter pylori eradication for the prevention of gastric cancer. Aliment Pharmacol Ther 2007; 25: [PMID: DOI: /j x] 19 Kato M, Asaka M, Ono S, Nakagawa M, Nakagawa S, Shimizu Y, Chuma M, Kawakami H, Komatsu Y, Hige S, Takeda H. Eradication of Helicobacter pylori for primary gastric cancer and secondary gastric cancer after endoscopic mucosal resection. J Gastroenterol 2007; 42 Suppl 17: [PMID: DOI: /s ] 20 Nakajima T. Gastric cancer treatment guidelines in Japan. Gastric Cancer 2002; 5: 1-5 [PMID: DOI: / s ] 21 Ekström AM, Held M, Hansson LE, Engstrand L, Nyrén O. Helicobacter pylori in gastric cancer established by CagA immunoblot as a marker of past infection. Gastroenterology 2001; 121: [PMID: DOI: /gast ] 22 Sowa M, Kato Y, Onoda N, Kubo T, Maekawa H, Nishimura M, Nakanishi K, Maeda K, Chung YS, Umeyama K. Early cancer of the gastric remnant--with special emphasis on the importance of follow-up of gastrectomized patients. Hepatogastroenterology 1992; 39: [PMID: ] 23 Takeda J, Toyonaga A, Koufuji K, Kodama I, Aoyagi K, Yano S, Ohta J, Shirozu K. Early gastric cancer in the remnant stomach. Hepatogastroenterology 1998; 45: [PMID: ] 24 Hosokawa O, Kaizaki Y, Watanabe K, Hattori M, Douden K, Hayashi H, Maeda S. Endoscopic surveillance for gastric remnant cancer after early cancer surgery. Endoscopy 2002; 34: [PMID: DOI: /s ] 25 Han JS, Jang JS, Choi SR, Kwon HC, Kim MC, Jeong JS, Kim SJ, Sohn YJ, Lee EJ. A study of metachronous cancer after endoscopic resection of early gastric cancer. Scand J Gastroenterol 2011; 46: [PMID: DOI: / ] 26 Kato M, Nishida T, Yamamoto K, Hayashi S, Kitamura S, Yabuta T, Yoshio T, Nakamura T, Komori M, Kawai N, Nishihara A, Nakanishi F, Nakahara M, Ogiyama H, Kinoshita K, Yamada T, Iijima H, Tsujii M, Takehara T. Scheduled endoscopic surveillance controls secondary cancer after curative endoscopic resection for early gastric cancer: a multicentre retrospective cohort study by Osaka University ESD study group. Gut 2013; 62: [PMID: DOI: /gutjnl ] 27 Uemura N, Mukai T, Okamoto S, Yamaguchi S, Mashiba H, Taniyama K, Sasaki N, Haruma K, Sumii K, Kajiyama G. Effect of Helicobacter pylori eradication on subsequent development of cancer after endoscopic resection of early gastric cancer. Cancer Epidemiol Biomarkers Prev 1997; 6: [PMID: ] 28 Nakagawa S, Asaka M, Kato M, Nakamura T, Kato C, Fujioka T, Tatsuta M, Keida K, Terao S, Takahashi S, Uemura N, Kato T, Aoyama N, Saito D, Suzuki M, Imamura A, Sato K, Miwa H, Nomura H, Kaise M, Oohara S, Kawai T, Urabe K,. Sakaki N, Ito S, Noda Y, Yanaka A, Kusugami K, Goto H, Furuta T, Fujino M, Kinjyou F, Ookusa T. Helicobacter pylori eradication and metachronous gastric cancer after endoscopic mucosal resection of early gastric cancer. Aliment Pharmacol Ther 2006; 24: [DOI: /j x] 29 Malfertheiner P, Megraud F, O Morain CA, Atherton J, Axon AT, Bazzoli F, Gensini GF, Gisbert JP, Graham DY, Rokkas T, El-Omar EM, Kuipers EJ. Management of Helicobacter pylori infection--the Maastricht IV/ Florence Consensus Report. Gut 2012; 61: [PMID: DOI: /gutjnl ] 30 Fukase K, Kato M, Kikuchi S, Inoue K, Uemura N, Okamoto S, Terao S, Amagai K, Hayashi S, Asaka M. Effect of eradication of Helicobacter pylori on incidence of metachronous gastric carcinoma after endoscopic resection of early gastric cancer: an open-label, randomised controlled trial. Lancet 2008; 372: [PMID: DOI: / S (08) ] 31 Maehata Y, Nakamura S, Fujisawa K, Esaki M, Moriyama 2763 March 21, 2014 Volume 20 Issue 11

45 Jang JY et al. H. pylori eradication after ER for EGC T, Asano K, Fuyuno Y, Yamaguchi K, Egashira I, Kim H, Kanda M, Hirahashi M, Matsumoto T. Long-term effect of Helicobacter pylori eradication on the development of metachronous gastric cancer after endoscopic resection of early gastric cancer. Gastrointest Endosc 2012; 75: [PMID: DOI: /j.gie ] 32 Haruma K, Kusunoki H, Manabe N, Kamada T, Sato M, Ishii M, Shiotani A, Hata J. Real-time assessment of gastroduodenal motility by ultrasonography. Digestion 2008; 77 Suppl 1: [PMID: DOI: / ] P- Reviewers: Biscione FM, Guan YS, Xu JJ, Xiao Q, Zhang Q S- Editor: Qi Y L- Editor: A E- Editor: Wang CH 2764 March 21, 2014 Volume 20 Issue 11

46 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Hoon Jai Chun, MD, PhD, AGAF, Professor, Series Editor TOPIC HIGHLIGHT Helicobacter pylori infection following partial gastrectomy for gastric cancer Sanghoon Park, Hoon Jai Chun Sanghoon Park, Department of Internal Medicine, KEPCO Medical Center, Seoul , South Korea Hoon Jai Chun, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, Korea University Medical Center, Seoul , South Korea Author contributions: Park S and Chun HJ performed the literature search, and collected and analyzed the data; Park S wrote the manuscript; Chun HJ supervised the project. Correspondence to: Hoon Jai Chun, MD, PhD, Professor, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Institute of Digestive Disease and Nutrition, Korea University College of Medicine, Korea University Medical Center, Inchon-ro 73, Seongbuk-gu, Seoul , South Korea. drchunhj@chol.com Telephone: Fax: Received: August 16, 2013 Revised: October 21, 2013 Accepted: November 1, 2013 Published online: March 21, 2014 Abstract Gastric remnants are an inevitable consequence of partial gastrectomy following resection for gastric cancer. The presence of gastric stumps is itself a risk factor for redevelopment of gastric cancer. Helicobacter pylori (H. pylori ) infection is also a well-known characteristic of gastric carcinogenesis. H. pylori colonization in the remnant stomach therefore draws special interest from clinicians in terms of stomach cancer development and pathogenesis; however, the H. pylori -infected gastric remnant is quite different from the intact organ in several aspects and researchers have expressed conflicting opinions with respect to its role in pathogenesis. For instance, H. pylori infection of the gastric stump produced controversial results in several recent studies. The prevalence of H. pylori infection in the gastric stump has varied among recent reports. Gastritis developing in the remnant stomach presents with a unique pattern of inflammation that is different from the pattern seen in ordinary gastritis of the intact organ. Bile refluxate also has a significant influence on the colonization of the stomach stump, with several studies reporting mixed results as well. In contrast, the elimination of H. pylori from the gastric stump has shown a dramatic impact on eradication rate. H. pylori elimination is recognized to be important for cancer prevention and considerable agreement of opinion is seen among researchers. To overcome the current discrepancies in the literature regarding the role of H. pylori in the gastric stump, further research is required Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Helicobacter pylori ; Gastrectomy; Gastric cancer Core tip: Helicobacter pylori (H. pylori ) are colonizing the remnant stomach after partial gastrectomy for gastric cancer interacts with the remaining gastric stump in a unique way. Many theories have been proposed as to the exact role or etiological manifestation of H. pylori on the remnant stomach relating to prevalence rate, carcinogenesis, and extent of clearance. Yet, studies have provided inconsistent results and no unified opinion has been reached on each topic. This article summarizes findings from the collective investigational reports on the influence of H. pylori in the gastric remnant. Park S, Chun HJ. Helicobacter pylori infection following partial gastrectomy for gastric cancer. World J Gastroenterol 2014; 20(11): Available from: URL: com/ /full/v20/i11/2765.htm DOI: org/ /wjg.v20.i INTRODUCTION Curative attempts to resect gastric adenocarcinoma leave 2765 March 21, 2014 Volume 20 Issue 11

47 Park S et al. Helicobacter pylori infection post-gastrectomy Table 1 Differences in the characteristics and manifestations of different gastric resections recently presented Manifestations Distal gastrectomy a gastric stump, creating the possibility of metachronous tumors arising from the remnant organ. A number of post-surgical management strategies have been adopted to lessen the risk of gastric malignancy recurrence, such as adjuvant chemotherapy and regular endoscopic surveillance. Based on the strong and well-established association between Helicobacter pylori (H. pylori) and carcinogenesis in intact stomach, identifying and eradicating the presence of this bacterial carcinogen has been suggested as another approach for decreasing cancer recurrence in the gastric stump [1,2]. However, some researchers have refuted the evidentiary importance of this strategy, since the carcinogenic role of H. pylori has yet to be definitively established in remnant stomach [3]. Following surgical resection, remnant tissue provides a unique environment for the propagation of H. pylori as compared to the intact stomach. The natural course of H. pylori infection is typified by atrophic changes that result from microorganisms that migrate to the proximal stomach. The role of H. pylori infection in subjects who undergo distal gastrectomy for gastric cancer has been unclear due to mixed results from recent studies. In this article, we will review the research on the interaction between H. pylori and its anatomically altered habitat. We will further explore the role of bile refluxate on H. pylori infection, and the effect of H. pylori eradication on the progression of gastric carcinogenesis. OBSERVATIONS OF H. PYLORI Proximal gastrectomy Bile reflux Polymorphonuclear infiltration (60.5%) (12.9%) (i.e., rate of inflammation) H. pylori infection rate Chronic and active inflammation Intestinal metaplasia It is suggested that the presence of a gastric stump after proximal gastrectomy promotes the progression of intestinal metaplasia and hampers the colonization of Helicobacter pylori (H. pylori). However, this notion is contrary to results from previous studies showing a relatively low H. pylori prevalence in the gastric stump. INFECTION IN THE REMNANT STOMACH Prevalence of H. pylori infection after partial gastric resection Several clinical conditions confer a high risk for gastric cancer. These conditions include pan-gastritis, prior gastric neoplasia, and corpus-dominant gastritis. Among clinical considerations, previous gastric procedures are considered to be an indication for aggressive H. pylori eradication [3,4]. According to guidelines from the Maastricht Ⅳ/Florence Consensus Report, eradication of H. pylori is strongly recommended as an essential treatment for the prevention of gastric cancer in populations at high risk [1]. The reported rates of H. pylori infection in the remnant stomach after distal gastrectomy fall within a broad range (19%-70%) [5-9]. Data from one group of researchers concluded that H. pylori prevalence is relatively low in patients who have undergone distal gastrectomy [10,11]. Another study from Israel supports this data with demonstrated infection rates as low as 18% [12]. This low prevalence of H. pylori after distal gastrectomy is explained by the decreased survivability of the microorganism in patients with an absent antrum. The antrum serves as the main colonizing location for H. pylori, as well as the source of bile reflux that produces an increase in intragastric ph [13,14]. Some researchers have suggested that the elevation in ph in the stomach leads to a reduction or disappearance of H. pylori in the gastric stump; furthermore, the organism is detected more commonly in the gastric corpus than near the anastomotic rim [7,15]. Biliary reflux from the small intestine to the stomach after the removal of the pyloric sphincter is suspected to further inhibit H. pylori proliferation [16-18]. Some studies have suggested that bile inhibits H. pylori growth in vitro and may play a role in eradicating H. pylori in vivo [14,19]. The type of anastomosis utilized during surgical resection is also known to influence the rate of H. pylori infection (Table 1). Several investigations have suggested that bile reflux in conjunction with the type of anastomosis used for the procedure inhibits H. pylori colonization [20,21]. H. pylori mediated gastritis of the gastric stump H. pylori infection in the gastric remnant after gastrectomy is known to be associated with a pattern of gastritis that is characterized by active and chronic inflammatory cell infiltration into the lamina propria [11,22]. Data has suggested that the presence of H. pylori infection mediates the severity of inflammatory change seen in the remnant stomach [23,24]. In a study utilizing a fiberoptic detector of bilirubin, refluxate from gastrectomy subjects and endoscopic biopsy specimens were analyzed. The results suggest that mucosal erythema was induced by bile refluxate and the active chronic inflammatory cell infiltration was caused by H. pylori infection [11]. The presentation of inflammation is dependent on the surgical type of gastric excision. One recent singlesite investigation revealed that neutrophilic infiltration predominated in the gastric remnant of distal gastrectomy subjects but not in the remnants of proximal gastrectomy patients (Table 1, 60.5% vs 12.9%, P < 0.001) [25]. The authors explained this finding by suggesting that the gastric stump remaining after proximal gastrectomy was prone to intestinal metaplasia with continuing inflammation, creating a difficult environment for H. pylori colonization. There are several factors that may influence the infection rate of H. pylori in the gastric stump. Early research failed to yield sufficient data comparing different types of surgery, such as the Billroth versus Roux-en-Y procedures. More recent investigations, however, have revealed 2766 March 21, 2014 Volume 20 Issue 11

48 Park S et al. Helicobacter pylori infection post-gastrectomy Table 2 Some issues disputed among researchers regarding Helicobacter pylori infection in the gastric remnant after partial gastrectomy Issues Prospective Consequence H. pylori infection decreases after partial gastrectomy, depending upon surgery and anastomosis type Distal gastrectomy leads to bile reflux and resultant Subjects with proximal gastrectomy are prone to intestinal elevated intra-gastric ph, hampering H. pylori inhabitation; metaplasia, which is a difficult environment for H. pylori this was also shown in an in vitro study [19] survival [25] Billroth type Ⅱ anastomosis has higher bile reflux Duodenogastric reflux facilitates the survival of H. pylori [27] compared with Billroth type Ⅰ or vagotomy, with concordant lower H. pylori infection prevalence [6,8] Bile refluxate is toxic to H. pylori, leading to spontaneous eradication [23] H. pylori is a risk factor of Some academic gastroenterological societies recognize H. carcinogenesis in the gastric pylori as a risk factor equivalent to the intact organ [1,2] stump H. pylori eradication is required Bile reflux inhibits H. pylori inhabitation in the gastric stump H. pylori-positive subjects with a remnant stomach after gastrectomy for cancer showed a higher prevalence for premalignant lesions compared to H. pylori-negative subjects H. pylori eradication is strongly recommended [1] Spontaneous eradication by the reflux of bile contents is suggested [23] Showing a rather low H. pylori infection rate suggests a different pathogenesis of gastric cancer from the remnant stomach [3] Eradication therapy improved intestinal metaplasia, preventing premalignant changes [30] Some academic gastroenterological societies do not advocate H. pylori eradication in the gastric stump There was no apparent inverse relationship between the quantity of bile refluxate and H. pylori infection [11] Pylorus-preserving gastrectomy led to the spontaneous clearance of H. pylori [28] H. pylori: Helicobacter pylori. that the type of gastrectomy may influence the rate of infection; that is, the H. pylori infection rate differed according to the type of surgery conducted. A systematic review of 36 studies that assessed H. pylori infection after several types of surgery for peptic ulceration showed a mean infection rate of about 50% (ranging from 19% to 73%) in patients who underwent partial gastrectomy and a relatively higher infection rate (about 83%) in subjects who underwent vagotomy procedures [8]. Another study addressed the difference in H. pylori infection rates in different types of anastomoses after distal gastrectomy (Billroth Ⅰ or Ⅱ). The Billroth type Ⅰ anastomoses had an infection rate of 70.8%, significantly higher than that of the type Ⅱ anastomoses (45.9%) [6]. Similarly, Billroth type Ⅱ anastomoses showed significantly higher bile reflux compared with other surgical procedures such as pylorus-preserving gastrectomy or Roux-en-Y methods [10]. Infection rates also differed between proximal and distal gastrectomy procedures. It was postulated that the remnant stomach after proximal gastrectomy was prone to intestinal metaplasia, an irreversible change that made it difficult for H. pylori to thrive. In the case of distal gastrectomy, which is currently a more common procedure among gastric cancer patients, bile reflux is known to influence the biologic surroundings of H. pylori in the stomach (Table 2). Beyond the surgical approach employed, several additional factors have been studied with regard to the infection rate of H. pylori. One investigation found that the prevalence of H. pylori in the gastric stump was significantly decreased with the patients age, time postgastrectomy, and presence of severe reflux gastritis [23]. Bair et al [17] presented an analogous report showing that spontaneous H. pylori clearance was related to the type of surgery and time of post-operative resection. Influence of bile reflux: Friend or foe? There has been a debate regarding the exact role of bile reflux on H. pylori colonization in the remnant stomach after partial gastrectomy. One study demonstrated that bile reflux induces glandular atrophy and chronic inflammation but does not increase polymorphonuclear cell activity [10]. Investigations utilizing a precise bile reflux measurement described no apparent inverse relationship between the quantity of bile refluxate and H. pylori infection [11]. According to a study by Onoda et al [23], the prevalence of H. pylori infection was lower in Billroth-Ⅱ reconstruction patients with severe bile reflux and subsequent stomal gastritis, suggesting a spontaneous eradication of H. pylori by the reflux of bile contents. In contrast, some investigators have questioned the theory of biliary obliteration of H. pylori in the gastric stump. One study showed that Roux-en-Y reconstruction after distal gastrectomy produces smaller amounts of bile reflux and as a result had a lower rate of H. pylori infection [26]. This study also observed a lower fasting enterogastric reflux in the patients who received the Rouxen-Y method (5.3%) compared with those who received Billroth Ⅱ reconstruction (62.1%), as measured by biliary scintigraphy. Nakagawara et al [27] reported that bile refluxate facilitated the survival of H. pylori, speculating that H. pylori was perhaps inhibited by other bacteria in the gut. Pylorus-preserving gastrectomy for gastric cancer also resulted in significantly lower H. pylori prevalence after surgery [28]. To date, the rate of H. pylori infection in the gastric remnant seems to be smaller than the rates in the anatomically intact organ. These results, however, lack a 2767 March 21, 2014 Volume 20 Issue 11

49 Park S et al. Helicobacter pylori infection post-gastrectomy thorough explanation of the precise mechanism providing for low H. pylori prevalence in the stump, and thus further investigation is required. Requirement for H. pylori eradication therapy H. pylori infection in the remnant stomach after partial gastrectomy is a causative factor in gastric cancer in the residual organ [22]. Remnant stomachs that are infected with H. pylori after partial gastrectomy for gastric cancer are prone to develop premalignant lesions and subsequent gastric cancer [23,29]. Giuliani et al [29] studied the manifestations of gastric cancer precursor lesions, such as chronic atrophic gastritis, intestinal metaplasia and dysplasia, among H. pylori-positive subjects. These patients had gastric remnants after gastrectomy for peptic ulcer disease or gastric cancer. H. pylori-positive subjects with a remnant stomach after gastrectomy showed a higher prevalence of premalignant lesions compared with H. pylori-negative subjects (OR = 4.20, 95%CI: ). These results indicate a significant role of H. pylori infection in the pathogenesis of disease. The authors concluded that H. pylori eradication might prevent metachronous gastric cancer in subjects with higher risk after gastrectomy. There have been mixed results regarding the efficacy of H. pylori eradication on the prevention of premalignant changes in the gastric mucosa such as intestinal metaplasia. In one study, standard proton pump inhibitorbased eradication therapy resulted in significant atrophic glandular improvement [30]. However, some investigators have presented the opposite result, where atrophic glands and intestinal metaplasia were not improved even after successful H. pylori eradication [31]. After studying the prevalence of several histological characteristics and H. pylori infection in subjects with gastric stumps, some researchers have concluded that H. pylori eradication might prevent cancer development in the remnant organ. In particular, one investigation described the spontaneous eradication of the organism in 78.8% of partial gastrectomy subjects [11]. Methods for diagnosing the infection of remnant stomach by H. pylori have been another matter of discussion. In contrast to the case of an intact organ, the nature of the gastric stump after partial gastrectomy appears to affect the reliability of testing for H. pylori colonization. Several reports showed that urease breath test (UBT) provides lower diagnostic accuracy when using histology as a reference. From a study performed by Adamopoulos et al [32] a relatively poor agreement was shown by UBT (κ = 0.41) in contrast to rapid urease test (RUT) (κ = 0.97) [32]. When UBT was compared with RUT retrospectively in another recent study, however, UBT was comparable to RUT in terms of accuracy (UBT 87% vs RUT 72%). Attempts to eradicate H. pylori in the gastric stump show a strong success rate of around 90% across several studies [30,31]. Examining data from a study by Matsukura et al [31], H. pylori eradication in gastric remnants had a success rate of 70%, comparable to non-surgery patients. In another study from Korea, the eradication rate of H. pylori-infected gastric stumps was 82.7% [33]. In general, with appropriate treatment, the rate of H. pylori eradication in the gastric stump appears to be comparable to that of intact organs. The temporal timing of H. pylori eradication is an important issue to consider and has been studied by several investigators [31]. For example, surgery can be delayed for one or two weeks in order to complete H. pylori eradication. In addition to time considerations, bile reflux after surgery, change in gastric emptying time, type of surgery performed, perioperative antibiotic administration, and changes in intragastric ph are other factors for consideration. One randomized controlled trial concluded that pre- or post-operative H. pylori eradication treatment did not affect the clinical outcome in terms of eradication rate [34]. Additionally, that study found no difference among the methods for post partial gastrectomy in preventing the advance of gastric cancer. As the ordinary antibiotic selections for gastrectomy patients are generally insufficient for effective elimination, it is possible to assume that prophylactic antibiotics will not seriously affect intragastric colonization of H. pylori. Relationship between H. pylori and distal esophageal cancer With respect to cancers on the distal esophagus, H. pylori infection is generally known to have an inhibitory role against carcinogenesis [35]. In contrast, squamous cell carcinoma in the upper or middle esophagus and adenocarcinoma adjacent to the gastro-esophageal junction is inversely related to H. pylori infection of stomach. Presumably, H. pylori colonizing the gastric stump after partial gastrectomy will influence the development of distal esophageal adenocarcinoma in some way. There is a scarcity in the literature regarding the relationship between distal esophageal cancer and the gastric remnant infected with H. pylori. Further investigations are needed to clarify this concern. CONCLUSION H. pylori is a well-known etiologic factor for gastric cancer. Likewise, a remnant stomach after partial gastrectomy for gastric cancer is also an important etiological factor for gastric carcinogenesis. According to a number of studies, H. pylori infection in the remnant stomach seems to play a role in gastric cancer development, albeit with contrary views from various research groups. A number of questions remain, including the factors influencing the infection state, the specific eradication rate and its role in cancer development, and the exact effect of refluxed biliary contents on H. pylori. The prevalence of H. pylori in the gastric stump seems to be lower than in the intact organ, with a significant rate of elimination when therapeutically targeted for eradication. We suggest that H. pylori infection still needs to be eliminated from the gastric tissue to reduce the risk of stump cancer. Some researchers 2768 March 21, 2014 Volume 20 Issue 11

50 Park S et al. Helicobacter pylori infection post-gastrectomy propose that bile refluxate facilitates the proliferation of H. pylori, but most investigators advocate the inhibitory effect of bile. Overall, the presence of H. pylori infection in the gastric stump requires further investigation to clarify the function and role of the organism in cancer reappearance. REFERENCES 1 Malfertheiner P, Megraud F, O Morain CA, Atherton J, Axon AT, Bazzoli F, Gensini GF, Gisbert JP, Graham DY, Rokkas T, El-Omar EM, Kuipers EJ. Management of Helicobacter pylori infection--the Maastricht IV/ Florence Consensus Report. Gut 2012; 61: [PMID: DOI: /gutjnl ] 2 Lam SK, Talley NJ. Report of the 1997 Asia Pacific Consensus Conference on the management of Helicobacter pylori infection. J Gastroenterol Hepatol 1998; 13: 1-12 [PMID: ] 3 Sinning C, Schaefer N, Standop J, Hirner A, Wolff M. Gastric stump carcinoma - epidemiology and current concepts in pathogenesis and treatment. Eur J Surg Oncol 2007; 33: [PMID: DOI: /j.ejso ] 4 Stalnikowicz R, Benbassat J. Risk of gastric cancer after gastric surgery for benign disorders. Arch Intern Med 1990; 150: [PMID: ] 5 Leivonen M, Nordling S, Haglund C. The course of Helicobacter pylori infection after partial gastrectomy for peptic ulcer disease. Hepatogastroenterology 1998; 45: [PMID: ] 6 Tomtitchong P, Onda M, Matsukura N, Tokunaga A, Kato S, Matsuhisa T, Yamada N, Hayashi A. Helicobacter pylori infection in the remnant stomach after gastrectomy: with special reference to the difference between Billroth I and II anastomoses. J Clin Gastroenterol 1998; 27 Suppl 1: S154-S158 [PMID: DOI: / ] 7 Schilling D, Jakobs R, Peitz U, Sulliga M, Stolte M, Riemann J, Labenz J. Diagnostic accuracy of (13)C-urea breath test in the diagnosis of Helicobacter pylori infection in patients with partial gastric resection due to peptic ulcer disease: a prospective multicenter study. Digestion 2001; 63: 8-13 [PMID: ] 8 Danesh J, Appleby P, Peto R. How often does surgery for peptic ulceration eradicate Helicobacter pylori? Systematic review of 36 studies. BMJ 1998; 316: [PMID: ] 9 Kim ES, Park DK, Hong SH, Chung MG, Kwon OS, Kim SS, Koo YS, Kim YK, Kang DH, Choi DJ, Park HC, Lee WG, Kim JH. Helicobacter pylori infection in the remnant stomach after radical subtotal gastrectomy. Korean J Gastroenterol 2003; 42: [PMID: ] 10 Sobala GM, O Connor HJ, Dewar EP, King RF, Axon AT, Dixon MF. Bile reflux and intestinal metaplasia in gastric mucosa. J Clin Pathol 1993; 46: [PMID: ] 11 Lee Y, Tokunaga A, Tajiri T, Masuda G, Okuda T, Fujita I, Kiyama T, Yoshiyuki T, Kato S, Matsukura N, Yamada N. Inflammation of the gastric remnant after gastrectomy: mucosal erythema is associated with bile reflux and inflammatory cellular infiltration is associated with Helicobacter pylori infection. J Gastroenterol 2004; 39: [PMID: DOI: /s y] 12 Wardi J, Shalev T, Shevah O, Boaz M, Avni Y, Shirin H. A rapid continuous-real-time 13C-urea breath test for the detection of Helicobacter pylori in patients after partial gastrectomy. J Clin Gastroenterol 2012; 46: [PMID: DOI: /MCG.0b013e31823eff09] 13 Kuipers EJ, Thijs JC, Festen HP. The prevalence of Helicobacter pylori in peptic ulcer disease. Aliment Pharmacol Ther 1995; 9 Suppl 2: [PMID: ] 14 O Connor HJ, Dixon MF, Wyatt JI, Axon AT, Ward DC, Dewar EP, Johnston D. Effect of duodenal ulcer surgery and enterogastric reflux on Campylobacter pyloridis. Lancet 1986; 2: [PMID: ] 15 Loffeld RJ, Loffeld BC, Arends JW, Flendrig JA, van Spreeuwel JP. Retrospective study of Campylobacter-like organisms in patients undergoing partial gastrectomy. J Clin Pathol 1988; 41: [PMID: ] 16 Fukuhara K, Osugi H, Takada N, Takemura M, Lee S, Taguchi S, Kaneko M, Tanaka Y, Fujiwara Y, Nishizawa S, Kinoshita H. Duodenogastric reflux eradicates Helicobacter pylori after distal gastrectomy. Hepatogastroenterology 1998; 51: [PMID: ] 17 Bair MJ, Wu MS, Chang WH, Shih SC, Wang TE, Chen CJ, Lin CC, Liu CY, Chen MJ. Spontaneous clearance of Helicobacter pylori colonization in patients with partial gastrectomy: correlates with operative procedures and duration after operation. J Formos Med Assoc 2009; 108: [PMID: DOI: /S (09) ] 18 Abe H, Murakami K, Satoh S, Sato R, Kodama M, Arita T, Fujioka T. Influence of bile reflux and Helicobacter pylori infection on gastritis in the remnant gastric mucosa after distal gastrectomy. J Gastroenterol 2005; 40: [PMID: DOI: /s ] 19 O Connor HJ, Wyatt JI, Dixon MF, Axon AT. Campylobacter like organisms and reflux gastritis. J Clin Pathol 1986; 39: [PMID: ] 20 Robles-Campos R, Lujan-Mompean JA, Parrilla-Paricio P, Bermejo-Lopez J, Liron-Ruiz R, Torralba-Martinez JA, Morales-Cuenca G, Molina-Martinzez JA. Role of Helicobacter pylori infection and duodenogastric reflux in the pathogenesis of alkaline reflux gastritis after gastric operations. Surg Gynecol Obstet 1993; 176: [PMID: ] 21 Niemelä S, Karttunen T, Heikkilä J, Mäentausta O, Lehtola J. Relationship of Campylobacter pylori and duodenogastric reflux. Dig Dis Sci 1989; 34: [PMID: ] 22 Nagahata Y, Kawakita N, Azumi Y, Numata N, Yano M, Saitoh Y. Etiological involvement of Helicobacter pylori in reflux gastritis after gastrectomy. Am J Gastroenterol 1996; 91: [PMID: ] 23 Onoda N, Maeda K, Sawada T, Wakasa K, Arakawa T, Chung KH. Prevalence of Helicobacter pylori infection in gastric remnant after distal gastrectomy for primary gastric cancer. Gastric Cancer 2001; 4: [PMID: DOI: / s ] 24 Katsube T, Ogawa K, Hamaguchi K, Murayama M, Konnno S, Shimakawa T, Naritaka Y, Yagawa H, Kajiwara T, Aiba M. Prevalence of Helicobacter pylori in the residual stomach after gastrectomy for gastric cancer. Hepatogastroenterology 2002; 49: [PMID: ] 25 Nabeshima K, Ogoshi K. Relationship between Helicobacter pylori and histological changes in the gastric remnant after subtotal gastrectomy. Tokai J Exp Clin Med 2011; 36: [PMID: ] 26 Chan DC, Fan YM, Lin CK, Chen CJ, Chen CY, Chao YC. Roux-en-Y reconstruction after distal gastrectomy to reduce enterogastric reflux and Helicobacter pylori infection. J Gastrointest Surg 2007; 11: [PMID: DOI: /s ] 27 Nakagawara H, Miwa K, Nakamura S, Hattori T. Duodenogastric reflux sustains Helicobacter pylori infection in the gastric stump. Scand J Gastroenterol 2003; 38: [PMID: ] 28 Miyashita T, Miwa K, Inokuchi M, Nakagawara H, Tajima H, Takamura H, Ninomiya I, Kitagawa H, Fushida S, Fujimura T, Hattori T, Ohta T. Spontaneous clearance of Helicobacter pylori after pylorus-preserving gastrectomy for gastric cancer. Oncol Rep 2013; 30: [PMID: DOI: /or ] 29 Giuliani A, Caporale A, Demoro M, Benvenuto E, Scarpini 2769 March 21, 2014 Volume 20 Issue 11

51 Park S et al. Helicobacter pylori infection post-gastrectomy M, Spada S, Angelico F. Gastric cancer precursor lesions and Helicobacter pylori infection in patients with partial gastrectomy for peptic ulcer. World J Surg 2005; 29: [PMID: DOI: /s ] 30 Onoda N, Katsuragi K, Sawada T, Maeda K, Mino A, Ohira M, Ishikawa T, Wakasa K, Hirakawa K. Efficacy of Helicobacter pylori eradication on the chronic mucosal inflammation of the remnant stomach after distal gastrectomy for early gastric cancer. J Exp Clin Cancer Res 2005; 24: [PMID: ] 31 Matsukura N, Tajiri T, Kato S, Togashi A, Masuda G, Fujita I, Tokunaga A, Yamada N. Helicobacter pylori eradication therapy for the remnant stomach after gastrectomy. Gastric Cancer 2003; 6: [PMID: DOI: / s ] 32 Adamopoulos AB, Stergiou GS, Sakizlis GN, Tiniakos DG, Nasothimiou EG, Sioutis DK, Achimastos AD. Diagnostic value of rapid urease test and urea breath test for Helicobacter pylori detection in patients with Billroth II gastrectomy: a prospective controlled trial. Dig Liver Dis 2009; 41: 4-8 [PMID: DOI: /j.dld ] 33 Kim IK, Paik WH, Lee JK, Chung GE, Kim YJ, Lee CH, Hond KS, Lee SH, Park Y-S, Hwang J-H, Kim J-W, Jung SH, Kim N, Lee DH, Jung HC, Song IS, Kim HH, Lee HS. The Eradication Rate of Helicobacter pylori on the Remnant Stomach after Curative Resection for Gastric Cancer and the Influence of Eradication. Kor J Gastrointest Endosc 2007; 35: Kim CG, Song HJ, Kook MC, Hong EK, Park S, Lee JY, Lee JH, Ryu KW, Kim YW, Bae JM, Choi IJ. Preoperative versus postoperative Helicobacter pylori eradication therapy in gastric cancer patients: a randomized trial. Am J Gastroenterol 2008; 103: [PMID: ] 35 Whiteman DC, Parmar P, Fahey P, Moore SP, Stark M, Zhao ZZ, Montgomery GW, Green AC, Hayward NK, Webb PM. Association of Helicobacter pylori infection with reduced risk for esophageal cancer is independent of environmental and genetic modifiers. Gastroenterology 2010; 139: 73-83; quiz e11-e12 [PMID: ] P- Reviewers: Braden B, Bonavina L, Eshraghian A S- Editor: Qi Y L- Editor: A E- Editor: Wang CH 2770 March 21, 2014 Volume 20 Issue 11

52 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Challenges in managing hepatitis C virus infection in cancer patients Roy A Borchardt, Harrys A Torres Roy A Borchardt, Harrys A Torres, Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, United States Author contributions: Borchardt RA and Torres HA contributed equally to this work, and both wrote the article. Correspondence to: Harrys A Torres, MD, Assistant Professor, Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030, United States. htorres@mdanderson.org Telephone: Fax: Received: September 18, 2013 Revised: December 10, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract Cancer patients have unique problems associated with hepatitis C virus (HCV) infection and treatment not seen in the general population. HCV infection poses additional challenges and considerations for the management of cancer, and vice versa. HCV infection also can lead to the development of cancer, particularly hepatocellular carcinoma and non-hodgkin lymphoma. In severely immunocompromised cancer patients, diagnosis of HCV infection requires increased reliance on RNA detection techniques. HCV infection can affect chemotherapy, and delay of HCV infection treatment until completion of chemotherapy and achievement of cancer remission may be required to decrease the potential for drug-drug interactions between antineoplastic agents and HCV therapeutics and potentiation of side effects of these agents. In addition, hematopoietic stem cell transplant (HSCT) recipients have an increased risk of early development of cirrhosis and fibrosis. Whether this increased risk applies to all patients regardless of cancer treatment is unknown. Furthermore, patients with cancer may have poorer sustained virological responses to HCV infection treatment than do those without cancer. Unfortunately, not all cancer patients are candidates for HCV infection therapy. In this article, we review the challenges in managing HCV infection in cancer patients and HSCT recipients Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Cancer; Hematopoietic stem cell transplant; Chemotherapy; Treatment; Antiviral; Pegylated interferon; Ribavirin Core tip: Hepatitis C virus (HCV) infection adds complexity to treatment considerations of cancer patients. This is amplified by the absence of standard of care guidelines for the management of cancer patients with HCV infection. Not only can HCV infection result in the development hepatocellular cancer and non-hodgkin lymphoma, but the presence of HCV infection in cancer patients can affect the treatment of malignancies with antineoplastic chemotherapies. Side effects of HCV therapy can be exacerbated in cancer patients due to underlying cytopenias and comorbidities. In those patients treated for HCV infection, cancer patients have poorer response to treatment than the general noncancer population. Borchardt RA, Torres HA. Challenges in managing hepatitis C virus infection in cancer patients. World J Gastroenterol 2014; 20(11): Available from: URL: com/ /full/v20/i11/2771.htm DOI: org/ /wjg.v20.i INTRODUCTION Hepatitis C virus (HCV) is the most common bloodborne pathogen in the United States, infecting an estimated million people or roughly 1.0%-1.5% of 2771 March 21, 2014 Volume 20 Issue 11

53 Borchardt RA et al. HCV management in cancer patients the population [1]. Chronic HCV infection is the principal cause of liver disease-related deaths and the leading indication for liver transplantation in the United States [2]. HCV infection can also result in the development of hepatocellular carcinoma (HCC) and lymphoma, especially non-hodgkin lymphoma [3,4]. In 2010, the incidence of new HCV infections in the United States was estimated to be about per year [1]. Although effective treatments that clear HCV infection are available, most affected individuals do not know they are infected [1]. Cancer patients pose unique challenges to the management and treatment of chronic HCV. In this patient population, there is an increased risk of liver disease progression, occurrence of occult HCV infection, development of viral reactivation, and no standard of care to guide how and when to treat such patients. In this article, we review the challenges in managing HCV infection in cancer patients and hematopoietic stem cell transplant (HSCT) recipients. HCV INFECTION PREVALENCE IN CANCER PATIENTS Although chronic HCV infection is common in cancer patients, studies of HCV infection in this population are lacking. Hence, the natural history of HCV infection and infection treatment outcomes in cancer patients are poorly understood. The known facts about HCV infection in cancer patients are limited. Estimates of the prevalence of HCV infection in cancer patients range from 1.5% to 32% [5-8]. DOES HCV INFECTION MANAGEMENT DIFFER IN PATIENTS WITH AND WITHOUT CANCER? Management of HCV infection is more challenging in patients with cancer than in those without it given several diagnostic and therapeutic differences in these two patient groups (Table 1). Diagnostic challenges Cancer patients, especially those with hematologic malignancies, can have false-negative results of serological tests using antibodies against HCV. In some of these severely immunocompromised patients, conventional detection of anti-hcv antibodies is not sufficient for diagnosis, necessitating polymerase chain reaction analysis for HCV RNA quantitation in blood to identify patients with occult infections [9-12]. Additionally, following chemotherapy, HCV reactivation can occur [13] as described below. HSCT recipients with HCV infection have a greater risk of early cirrhosis and higher rate of fibrosis progression than do HCV-infected patients who do not undergo this transplantation. For example, researchers observed an expected median time to the development of cirrhosis of 18 years in HSCT recipients with chronic HCV infection, but 40 years in control patients with chronic HCV infection who did not receive HSCTs [14]. Cirrhosis may be a contraindication to high-dose conditioning regimens for HSCTs. Therefore, physicians should consider performing a liver biopsy before the start of conditioning therapy if they have a clinical suspicion of cirrhosis or extensive fibrosis resulting from chronic viral infection, including HCV infection, irrespective of the virus s genotype [10,14]. Therapeutic challenges No standard of treatment exists for patients with cancer and HCV infection. Treatment of this infection can mitigate specific risks in certain cancer patients. Unfortunately, evidence-based knowledge regarding the effects of treatment of HCV infection in cancer patients is lacking. This is likely reflective of exclusion of cancer patients from trials of HCV therapeutics owing in part to baseline hematological abnormalities frequently observed in cancer patients. In a retrospective study, we have observed poor efficacy of antiviral treatment in HCV-infected cancer patients as a concern, as well. A sustained virological responses (SVRs) was observed in 11 (41%) of 27 cancer patients with chronic HCV infection [15]. Of the 11 patients, 3 had genotype 1 infection, and none of these patients achieved SVR. HCV GENOTYPE DISTRIBUTION IN CANCER PATIENTS HCV is genetically heterogeneous, with seven unique identifiable genotypes [16,17]. These genotypes exhibit variable geographical distribution worldwide, with genotype 1 occurring most frequently in the United States, followed by genotypes 2 and 3 [18]. In a retrospective multicenter study, we examined the distribution of HCV genotypes in 636 patients with proven HCV infection (detectable HCV RNA). We found that genotype 1 was the predominant genotype in cancer patients, with a prevalence of about 66%; in comparison, the prevalence of this genotype was 84% in immunocompetent patients and 99% in patients co-infected with HCV and human immunodeficiency virus [19]. Also, genotypes 2 and 3 were more common in cancer patients than in the general population [19]. HCV genotype 2 was most prevalent in lymphoma patients and resulted in a threefold greater risk of lymphoma than did the other genotypes [19]. These findings provide evidence that the distribution of HCV genotypes 1, 2, and 3 differs by underlying disease status among patients in the same geographic region and suggest a carcinogenic association for some genotypes. TREATMENT OF HCV INFECTION IN CANCER PATIENTS Cancer patients benefit from treatment of their HCV infections in several ways [20]. As in the general population [21], the potential benefits of SVRs to this treatment include 2772 March 21, 2014 Volume 20 Issue 11

54 Borchardt RA et al. HCV management in cancer patients Table 1 Differences on hepatitis C virus infection in cancer patients compared to those without cancer Occurrence of occult infection Higher risk of developing early cirrhosis Higher rate of fibrosis progression Development of viral reactivation No standard of care treatment Worse virological outcome longevity of response and impact on clinical events such as prevention of liver disease progression, and improved survival. The durability of SVR seems to be unaffected by chemotherapy in cancer patients. In one study at our center of 30 HCV-infected cancer patients who had SVRs before cancer diagnosis and then received chemotherapy or immunosuppressive therapy, none of them had post-svr relapse of their infections following cancer treatment [22]. Compared with those who do not have responses to pegylated interferon (pegifn) alpha-2 and ribavirin therapy, non cancer patients who undergo successful treatment of HCV infections have fewer hepatic complications, lower liver disease-related mortality rates, and lower HCC incidence rates [21]. Similarly, among 140 cancer patients with chronic HCV infection seen in our institution, we observed progression of liver disease to cirrhosis and portal hypertension in 7% and 9% of the untreated patients, respectively [15]. None of the patients who received treatment of HCV infection had progression of liver disease. Furthermore, HCV infection treatment is associated with reduced risk of cancer recurrence and improved survival rates in patients with HCVrelated HCC [23,24]. HCV infection increases mortality risk in the posttransplantation period in HSCT recipients [25]. Therefore, HCV infection treatment should be considered for all eligible HSCT recipients [10], including cancer patients. In some instances, HCV infection can be eradicated prior to the start of immunosuppressive therapy for cancer. This is of particular interest to oncologists, because HCV reactivation can occur following chemotherapy [13] and lead to discontinuation of or dose reduction for potentially life-saving chemotherapy [26]. CHALLENGES IN MANAGING HCV INFECTION THERAPY IN CANCER PATIENTS Side effects of treatment of HCV infections are common in the general population [27-29]. Adverse events of HCV therapy that, in our experience, can be worse in patients than in those without it are listed in Table 2. For example, HCV infection treatment-related anemia and other blood abnormalities can be more profound in cancer patients. Not uncommonly, pretreatment baseline hemoglobin levels are decreased, especially in patients with hematological malignancies. As reported in patients Table 2 Side effects of drugs used to treat hepatitis C virusinfection that can be exacerbated in hepatitis C virusinfected cancer patients Drugs Interferon and ribavirin First generation protease inhibitors Boceprevir Telaprevir Side effects Fatigue Flu-like syndrome Nausea and vomiting Low-grade fever Weight loss Irritability Insomnia Depression Anemia Thrombocytopenia Neutropenia Pruritus Rashes Dyspnea Poor appetite Difficulty concentrating Severe infections (bacterial, fungal, or viral) Anemia Renal impairment Anemia Rash Gastrointestinal side effects (diarrhea and rectal burning) Renal impairment without cancer, initiation of HCV infection treatment can be associated with a rapid drop in hemoglobin level in recipients of first-generation protease inhibitors (e.g., telaprevir, boceprevir) along with pegifn alpha-2 plus ribavirin. This adverse effect seems to be more common in these patients than in recipients of dual therapy with pegifn and ribavirin alone [30]. Similarly, other types of cytopenia can be encountered in cancer patients at baseline before treatment of HCV infection, such as leukopenia, thrombocytopenia, and neutropenia. These effects also can be profound in these patients upon initiation of HCV infection therapy, necessitating dose reduction for anti-hcv medications. Use of hematopoietic growth factors may be required to restore baseline hemoglobin levels, white blood cell counts, and platelet counts and help maintain and complete full-dose antiviral therapy for chronic HCV infections in cancer patients. In a series of cancer patients receiving treatment of HCV infection at our institution from 2009 to 2012, 24 (86%) of 28 patients experienced antiviral-induced hepatotoxic effects [31]. We administered growth factors (e.g., erythropoietin, granulocyte-macrophage colony-stimulating factor, thrombopoietin) to 15 patients (54%); with 9 (60%) of these patients received more than one growth factor. Patients who completed antiviral therapy were numerically more likely to have received growth factors than were those who did not (83% vs 63%, P = 0.6). More patients undergoing dual therapy than those undergoing triple therapy with first-generation protease inhibitors were able to complete their antiviral regimens when growth factors were included (0% vs 50%, P = 0.1). Overall, maintenance of treatment with full March 21, 2014 Volume 20 Issue 11

55 Borchardt RA et al. HCV management in cancer patients Cancer patient with chronic HCV infection Evidence of metastatic disease Yes, then monitor HCV infection No Six months after cancer remission No, then monitor HCV infection Yes Candidate for HCV therapy 1 No, then monitor HCV infection Yes Initiate pegifn plus ribavirin +/- protease inhibitor or other direct-acting antiviral agents based on infecting genotype Monitor laboratory parameters and side effects Other side effects, treat accordingly Significant treatment-related hematological toxicity No, then monitor HCV therapy response Yes Consider pegifn and/or ribavirin dose reduction, administer hematopoietic growth factors, transfusions, treatment discontinuation Monitor HCV therapy response Figure 1 Algorithm for managing chronic hepatitis C virus infection in cancer patients. 1 At least 6 mo after cancer remission before initiating myelosuppressive hepatitis C virus (HCV) treatment with interferon-based therapy. Wait 2 years after hematopoietic stem cell transplant before initiation of interferon-based HCV therapy for patients with normal serum creatinine, normal blood counts, off immunosuppressive therapy > 6 mo, and without evidence of original disease recurrence or graft versus host disease [10]. PegIFN: Pegylated interferon. dose antivirals was more common in those who received growth factors than in those who did not (100% vs 33%, P = 0.01); this was especially true for pegifn alpha-2 (100% vs 17%, P = 0.04) and ribavirin (75% vs 36%, P = 0.3). We observed no major side effects with the use of other growth factors. The effect of dose reduction for anti-hcv medications and/or growth factors on the efficacy of treatment of this infection in cancer patients remains to be determined. Psychiatric disorders, such as severe depression, adjustment disorder, anxiety, and bipolar disorder, are not uncommon in cancer patients [32]. Furthermore, depression is a major comorbidity in HCV-infected cancer patients, even in untreated individuals [33]. Uncontrolled major depression is an exclusionary criterion for initiation of HCV infection treatment with interferon [2]. Cancer patients may experience depression at any time throughout the course of their disease, ranging from prior to and during cancer treatment to even the post treatment survivorship period [34,35]. HCV reactivation is a rare yet important problem in cancer patients, particularly those with hematological malignancies [13]. If a patient with chronic HCV infection and cancer experiences viral reactivation while receiving chemotherapy, the management options are to reduce doses in the current chemotherapy regimen, select an alternative chemotherapy regimen with no overlapping hepatotoxic effects, and discontinue chemotherapy. HOW AND WHEN CAN CANCER PATIENTS RECEIVE TREATMENT OF HCV INFECTION? In general, we recommend treatment of HCV infection in cancer survivors without evidence of metastatic disease, which compromises life expectancy. In our practice, we wait at least 6 mo after cancer remission before initiating myelosuppressive HCV infection treatment with pegifn and ribavirin to allow patients bone marrow stem cell counts to recover. However, the patient s cancer can relapse during this period. A discussion with the treating oncologist is recommended to determine the time after which the patient s cancer is unlikely to relapse. Given our limited clinical understanding of potential drug-drug interactions between HCV therapeutics and chemotherapeutics and chemotherapy tolerability in HCV-infected cancer patients, simultaneous treatment of cancer (e.g., 2774 March 21, 2014 Volume 20 Issue 11

56 Borchardt RA et al. HCV management in cancer patients chemotherapy, radiation therapy) and HCV infection should be avoided. Also, HCV infection treatment can be administered to HSCT recipients who meet the following criteria: complete remission of the original disease, a period of at least 2 years since the HSCT, no evidence of protracted acute or chronic graft-vs-host disease, no immunosuppressive therapy for at least 6 mo, and normal blood counts and serum creatinine levels [10]. An overview for managing cancer patients with chronic HCV infection is outlined in Figure 1. Clinical experience with use of direct-acting antivirals in cancer survivors is very limited and and thus requires further research. CONCLUSION HCV infection is a unique challenge in the management of cancer patients. These challenges include an increased risk for liver disease progression, occurrence of occult HCV infection and development of viral reactivation. The potential manifestation of underlying psychiatric disorders before or during HCV therapy requires close monitoring and intervention as warranted. All these challenges are confounded by the fact that there is no standard of care for HCV management and treatment of patients with malignancies. HCV-infected cancer patients suitable for antiviral therapy may benefit from it, because of the HCV-related complications or poor survival rates seen in cancer patients and HSCT recipients with HCV infection who do not receive this therapy. However, this treatment requires close monitoring for side effects. Use of hematopoietic growth factors enables continuation of antiviral treatment in some cases. However, antiviral dose reductions may be necessary because of underlying baseline hematological deficiencies or severe adverse treatment responses. Experience with direct-acting antivirals in this patient population is very limited. The costeffectiveness and benefit-adverse reactions ratio have yet to be clearly delineated. More research is required to establish these parameters. More effective and better tolerated antivirals are urgently needed to treat HCV-infected cancer patients. ACKNOWLEDGMENTS We thank Don Norwood for editorial assistance. REFERENCES 1 Smith BD, Morgan RL, Beckett GA, Falck-Ytter Y, Holtzman D, Teo CG, Jewett A, Baack B, Rein DB, Patel N, Alter M, Yartel A, Ward JW. Recommendations for the identification of chronic hepatitis C virus infection among persons born during MMWR Recomm Rep 2012; 61: 1-32 [PMID: ] 2 Ghany MG, Strader DB, Thomas DL, Seeff LB. Diagnosis, management, and treatment of hepatitis C: an update. Hepatology 2009; 49: [PMID: DOI: / hep.22759] 3 Davila JA, Morgan RO, Shaib Y, McGlynn KA, El-Serag HB. Hepatitis C infection and the increasing incidence of hepatocellular carcinoma: a population-based study. Gastroenterology 2004; 127: [PMID: DOI: /j.gastro ] 4 Gisbert JP, García-Buey L, Pajares JM, Moreno-Otero R. Prevalence of hepatitis C virus infection in B-cell non-hodgkin s lymphoma: systematic review and meta-analysis. Gastroenterology 2003; 125: [PMID: DOI: /j.gastro ] 5 Fujii Y, Kaku K, Tanaka M, Yosizaki M, Kaneko T, Matumoto N. Hepatitis C virus infection in patients with leukemia. Am J Hematol 1994; 46: [PMID: DOI: /ajh ] 6 Markovic S, Drozina G, Vovk M, Fidler-Jenko M. Reactivation of hepatitis B but not hepatitis C in patients with malignant lymphoma and immunosuppressive therapy. A prospective study in 305 patients. Hepatogastroenterology 1999; 46: [PMID: ] 7 Faggioli P, De Paschale M, Tocci A, Luoni M, Fava S, De Paoli A, Tosi A, Cassi E. Acute hepatic toxicity during cyclic chemotherapy in non Hodgkin s lymphoma. Haematologica 1997; 82: [PMID: ] 8 Vento S, Cainelli F, Longhi MS. Reactivation of replication of hepatitis B and C viruses after immunosuppressive therapy: an unresolved issue. Lancet Oncol 2002; 3: [PMID: DOI: /S (02) ] 9 Torres HA, Boeckh M, Chemaly RF. Viral infections. In: Yeung SJ, Escalante C, Gagel RF, editors. Internal medicine care of cancer patient. 1st ed. Shelton, CT: BC Decker Inc., 2009: Tomblyn M, Chiller T, Einsele H, Gress R, Sepkowitz K, Storek J, Wingard JR, Young JA, Boeckh MJ. Guidelines for preventing infectious complications among hematopoietic cell transplantation recipients: a global perspective. Biol Blood Marrow Transplant 2009; 15: [PMID: DOI: /j.bbmt ] 11 Rai RR, Mathur A, Mathur D, Udawat HP, Nepalia S, Nijhawan S, Mathur A. Prevalence of occult hepatitis B & C in HIV patients infected through sexual transmission. Trop Gastroenterol 2007; 28: [PMID: ] 12 Locasciulli A, Cavalletto D, Pontisso P, Cavalletto L, Scovena E, Uderzo C, Masera G, Alberti A. Hepatitis C virus serum markers and liver disease in children with leukemia during and after chemotherapy. Blood 1993; 82: [PMID: ] 13 Torres HA, Davila M. Reactivation of hepatitis B virus and hepatitis C virus in patients with cancer. Nat Rev Clin Oncol 2012; 9: [PMID: DOI: /nrclinonc ] 14 Peffault de Latour R, Lévy V, Asselah T, Marcellin P, Scieux C, Adès L, Traineau R, Devergie A, Ribaud P, Espérou H, Gluckman E, Valla D, Socié G. Long-term outcome of hepatitis C infection after bone marrow transplantation. Blood 2004; 103: [PMID: DOI: / blood ] 15 Torres HA, Mahale P, Davila M, Mulanovich V, Granwehr B, Kontoyiannis DP, Raad II. Hepatitis C virus infection in cancer patients: the story of a forgotten population. In: Abstracts of the 48th Annual Meeting of the Infectious Diseases Society of America: 2010 Oct 21-24; Canada: Vancouver, Simmonds P, Bukh J, Combet C, Deléage G, Enomoto N, Feinstone S, Halfon P, Inchauspé G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 2005; 42: [PMID: DOI: / hep.20819] 17 Smith DB, Bukh J, Kuiken C, Muerhoff AS, Rice CM, Stapleton JT, Simmonds P. Expanded classification of hepatitis C virus into 7 genotypes and 67 subtypes: updated criteria 2775 March 21, 2014 Volume 20 Issue 11

57 Borchardt RA et al. HCV management in cancer patients and genotype assignment Web resource. Hepatology 2014; 59: [PMID: DOI: /hep.26744] 18 Nainan OV, Alter MJ, Kruszon-Moran D, Gao FX, Xia G, McQuillan G, Margolis HS. Hepatitis C virus genotypes and viral concentrations in participants of a general population survey in the United States. Gastroenterology 2006; 131: [PMID: DOI: /j.gastro ] 19 Torres HA, Nevah MI, Barnett BJ, Mahale P, Kontoyiannis DP, Hassan MM, Raad II. Hepatitis C virus genotype distribution varies by underlying disease status among patients in the same geographic region: a retrospective multicenter study. J Clin Virol 2012; 54: [PMID: DOI: /j.jcv ] 20 Torres HA, Adachi JA, Roach LR, Smith KM, Mahale PS, Davila M, Raad II. Hepatitis C clinic operated by infectious disease specialists at a comprehensive cancer center: help is on the way. Clin Infect Dis 2012; 54: [PMID: DOI: /cid/cir930] 21 Pearlman BL, Traub N. Sustained virologic response to antiviral therapy for chronic hepatitis C virus infection: a cure and so much more. Clin Infect Dis 2011; 52: [PMID: DOI: /cid/cir076] 22 Mahale P, Okhuysen PC, Torres HA. Does Chemotherapy Cause Viral Relapse in Cancer Patients With Hepatitis C Infection Successfully Treated With Antivirals? Clin Gastroenterol Hepatol 2013; Epub ahead of print [PMID: ] 23 Arcaini L, Merli M, Passamonti F, Bruno R, Brusamolino E, Sacchi P, Rattotti S, Orlandi E, Rumi E, Ferretti V, Rizzi S, Meli E, Pascutto C, Paulli M, Lazzarino M. Impact of treatment-related liver toxicity on the outcome of HCV-positive non-hodgkin s lymphomas. Am J Hematol 2010; 85: [PMID: ] 24 Morgan RL, Baack B, Smith BD, Yartel A, Pitasi M, Falck- Ytter Y. Eradication of hepatitis C virus infection and the development of hepatocellular carcinoma: a meta-analysis of observational studies. Ann Intern Med 2013; 158: [PMID: DOI: / ] 25 Ramos CA, Saliba RM, de Pádua L, Khorshid O, Shpall EJ, Giralt S, Patah PA, Hosing CM, Popat UR, Rondon G, Khouri IF, Nieto YL, Champlin RE, de Lima M. Impact of hepatitis C virus seropositivity on survival after allogeneic hematopoietic stem cell transplantation for hematologic malignancies. Haematologica 2009; 94: [PMID: DOI: /haematol.13756] 26 Mahale P, Kontoyiannis DP, Chemaly RF, Jiang Y, Hwang JP, Davila M, Torres HA. Acute exacerbation and reactivation of chronic hepatitis C virus infection in cancer patients. J Hepatol 2012; 57: [PMID: DOI: / j.jhep ] 27 Jou JH, Muir AJ. In the clinic. Hepatitis C. Ann Intern Med 2012; 157: ITC6-1 - ITC6-16 [PMID: DOI: / ] 28 Hoofnagle JH, Seeff LB. Peginterferon and ribavirin for chronic hepatitis C. N Engl J Med 2006; 355: [PMID: DOI: /NEJMct061675] 29 Mauss S, Hueppe D, Alshuth U. Renal impairment is frequent in chronic hepatitis C patients under triple therapy with telaprevir or boceprevir. Hepatology 2014; 59: [PMID: ] 30 Perry CM. Telaprevir: a review of its use in the management of genotype 1 chronic hepatitis C. Drugs 2012; 72: [PMID: DOI: / ] 31 Torres HA, Mahale P, Saxena A, Afshar-Kharghan V, Kroll MH, Oo TH. Use of growth factors in treatment of hepatitis C viral infection in cancer patients. Annual Meeting of the American Society of Hematology in Atlanta. Blood: Georgia suppl, 2012: abstract Reilly CM, Bruner DW, Mitchell SA, Minasian LM, Basch E, Dueck AC, Cella D, Reeve BB. A literature synthesis of symptom prevalence and severity in persons receiving active cancer treatment. Support Care Cancer 2013; 21: [PMID: DOI: /s ] 33 Sockalingam S, Links PS, Abbey SE. Suicide risk in hepatitis C and during interferon-alpha therapy: a review and clinical update. J Viral Hepat 2011; 18: [PMID: DOI: /j x] 34 Laoutidis ZG, Mathiak K. Antidepressants in the treatment of depression/depressive symptoms in cancer patients: a systematic review and meta-analysis. BMC Psychiatry 2013; 13: 140 [PMID: DOI: / X ] 35 Mitchell AJ, Ferguson DW, Gill J, Paul J, Symonds P. Depression and anxiety in long-term cancer survivors compared with spouses and healthy controls: a systematic review and meta-analysis. Lancet Oncol 2013; 14: [PMID: DOI: /S (13) ] P- Reviewers: Quer J, Shi Z S- Editor: Zhai HH L- Editor: A E- Editor: Ma S 2776 March 21, 2014 Volume 20 Issue 11

58 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Role of macrophages and monocytes in hepatitis C virus infections Dennis Revie, Syed Zaki Salahuddin Dennis Revie, Department of Biology, California Lutheran University, Thousand Oaks, CA 91360, United States Syed Zaki Salahuddin, California Institute of Molecular Medicine, Ventura, CA 93003, United States Author contributions: All the authors contributed equally to this manuscript. Correspondence to: Dr. Dennis Revie, Professor, Department of Biology, California Lutheran University, 60 W Olsen Rd, MC 3700, Thousand Oaks, CA 91360, United States. revie@clunet.edu Telephone: Fax: Received: September 28, 2013 Revised: November 27, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract A number of studies conducted over many years have shown that hepatitis C virus (HCV) can infect a variety of cell types. In vivo infection of monocytes, macrophages, and dendritic cells by HCV has been frequently shown by a number of researchers. These studies have demonstrated replication of HCV by detecting the presence of both negative genomic strands and a variety of non-structural HCV proteins in infected cells. In addition, analyses of genome sequences have also shown that different cell types can harbor different HCV variants. Investigators have also done preliminary studies of which cellular genes are affected by HCV infection, but there have not yet been a sufficient number of these studies to understand the effects of infection on these cells. Analyses of in vitro HCV replication have shown that monocytes, macrophages and dendritic cells can be infected by HCV from patient sera or plasma. These studies suggest that entry and cellular locations may vary between different cell types. Some studies suggest that macrophages may preferentially allow HCV genotype 1 to replicate, but macrophages do not appear to select particular hypervariable regions. Overall, these studies agree with a model where monocytes and macrophages act as an amplification system, in which these cells are infected and show few cytopathic effects, but continuously produce HCV. This allows them to produce virus over an extended time and allows its spread to other cell types Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Macrophages; Monocytes; Dendritic cells; Hepatitis C virus replication Core tip: We review the evidence of infection of monocytes and macrophages by hepatitis C virus (HCV), both in vivo and in vitro. There are two innovative ideas: (1) the hypervariable region of HCV may vary due to host range of variants in addition to immune pressure; and (2) a novel model of the role of macrophages and monocytes in HCV infections is proposed that is consistent with current evidence. Revie D, Salahuddin SZ. Role of macrophages and monocytes in hepatitis C virus infections. World J Gastroenterol 2014; 20(11): Available from: URL: com/ /full/v20/i11/2777.htm DOI: org/ /wjg.v20.i INTRODUCTION Hepatitis C virus (HCV) is a cause of liver diseases as well as other extrahepatic pathologies. A combination of the drugs ribavirin and pegylated interferon is usually used as therapy. More recently other drugs have been approved that may increase the chances of successful treatment. These other drugs are designed to interfere with specific viral proteins. It is important to understand how HCV replicates so that rational therapies can be designed March 21, 2014 Volume 20 Issue 11

59 Revie D et al. Macrophages and monocytes in HCV infections This review concentrates on the infection of monocytes, macrophages, and dendritic cells by HCV so that we can better understand the life cycle of HCV. Macrophages are phagocytic cells that are found in all tissues. They are produced from the differentiation of monocytes. Macrophages are part of the innate immune system, but they also have a role in adaptive immunity by stimulating immune cells to respond to pathogens. Liver macrophages are called Kupffer cells, which comprise as much as 25% of the cells in the liver [1,2], while brain macrophages are called microglial cells, which comprise about 10% of the cells in the brain [3]. There is evidence that Kupffer cells are involved in lipid homeostasis in the liver [4], and that impaired activation of Kupffer cells can result in hepatic steatosis and insulin resistance [5]. Similarly, microglial cell disfunction in the central nervous system (CNS) can result in neurodegenerative diseases [3]. HCV has not only been implicated in liver diseases, but also in a number of extrahepatic pathologies, including mixed cryoglobulinemia, B-cell non-hodgkin lymphoma, and porphyria cutanea tarda [6]. Most of these diseases are thought to be due to indirect effects of HCV infection, such as chronic inflammation, autoantibody production, and the deposition of antibody-antigen complexes. A number of HCV-related nervous system disorders have also been found, including neurological problems such as confusion or seizures, cognitive problems such as fatigue and depression, and neuropathies such as pain and sensory problems [7]. There is some evidence of direct involvement of HCV in some of these disorders, but others are also probably due to secondary effects of the infection. Since there are a large number of extrahepatic problems in HCV-infected individuals, studies have been done to determine the types of cells that can be infected by HCV. Many different cell types and tissues have been reported to be infected by HCV [8], but proof that they are the cause of particular problems in patients is mostly lacking. In this review, we will be concentrating on the evidence of infection of monocytes and macrophages, and the possible consequences of infection of these cells. HCV is a positive-strand virus about 9.6 kb in size. Replication is through a negative-strand intermediate. Evidence of negative strands of HCV in cells is often used as indicating that the HCV present in particular cells is replicating. When HCV replicates, it produces a number of well characterized non-structural proteins not found in the virus: NS2, NS3, NS4A, NS4B, NS5A, and NS5B. The presence of these proteins in cells is interpreted as resulting from HCV replication. The proteins in the virion are core, the envelope proteins E1 and E2, and the ion channel protein p7. There is also one protein produced from a ribosomal frameshift during translation, called F or AFRP. All of these proteins are made from cleavage of a polyprotein of approximately 3000 amino acids. The HCV genome contains a 341 untranslated nucleotide segment at the 5 end of the genome called the 5 UTR or 5 NTR that is important for replication [9] and translation [10,11]. The region of the genome located at the amino end of the E2 protein is called the hypervariable region 1 (HVR1). The 5 UTR is the most conserved region of the genome and the HVR1 is the most variable. IN VIVO EXPERIMENTS SHOWING INFECTION OF MONOCYTES Soon after assays were developed for HCV, reports that the replicative form, the negative strand of the HCV genome, could be detected in peripheral blood mononuclear cells (PBMC) [12-15]. However, it was later shown that false positives of HCV RNA could be a problem. Therefore, modifications to the PCR protocols were instituted, including the use of rtth polymerase. Since then, over 20 additional studies have shown the presence of negative strands of HCV RNA in PBMC using modified PCR methods [8]. In addition, many studies have shown that B-cells, T-cells and other cell types in vivo also can have detectable negative strands of HCV RNA. After PBMC were shown to be infected by HCV, studies were performed to determine which cell types were infected. Flow cytometry was used to separate monocytes from other cell types of PBMC from HCVinfected patients. These cells appeared to contain the Core protein of HCV [14], suggesting that HCV was inside the cells. In situ hybridization to locate negative strand HCV RNA has also been used to show that HCV infects monocytes/macrophages, B cells, and possibly T-cells [16]. Immunofluorescence experiments also have shown a variety of HCV non-structural proteins in the cells, confirming they were infected [16]. RT-PCR has also been used to test for negative strands of HCV. PBMC separated into different cell types by immunomagnetic selection of cell types show both HCV positive and negative strands of HCV RNA in granulocytes, monocytes, and B-cells, but not in T-cells or thrombocytes [17]. Other studies using immunomagnetic selection of cell types have shown negative HCV strands in monocytes/macrophages, T-cells, and B-cells [18] and in B-cells, monocytes, and polymorphonuclear leukocytes, but not in T-cells [19]. These studies all agree that, in some patients, negative strands can be found in monocytes or macrophages. HCV has also been found to bind to natural killer, monocytes, and B-cells found in PBMC, suggesting a role for these cells as carriers of HCV to various tissues [20]. Fluorescence microscopy and immunohistochemistry have also been used to show that HCV in monocytes is present and replicating. For example, studies have shown the presence of NS4/NS4B [16,21-23] and NS5/NS5A [24,25] in monocytes or macrophages. As studies have shown that different cell types in PBMC harbor replicating HCV, other work investigated differences in quasispecies in these tissues. The predominant hypervariable region 1 (HVR-1) sequence of HCV has been shown to be different in liver, PBMC, and plasma [26] or liver, PBMC, and serum in patients [27,28]. However, these studies did not look at particular cell types in these 2778 March 21, 2014 Volume 20 Issue 11

60 Revie D et al. Macrophages and monocytes in HCV infections samples. Significantly different sequences have been found in different cell types found in PBMC, including monocytes and B-cells [29]. Different types of monocytic cell lineages have been investigated, with CD14 +, CD16 ++ and CD14 ++, CD16 ++ but not CD14 +, CD16 - cells being found infected [30]. These studies suggest that different cell types allow replication of slightly different versions of HCV. Studies have also investigated liver tissue for infection by HCV. One early study used in situ hybridization to locate HCV and found a few positive cells, which were most likely lymphocytes or macrophages [31], but they did not positively identify the cell types. A more recent study stained cells for both HCV Core and NS4 as well as cell type specific markers CD68, CD3, and CD20 [21]. They found that macrophages were the major target of HCV in liver, heart, kidney, and bone marrow cells. Other in situ hybridization and immunohistochemical studies of liver cells have not stained for both HCV and the cell type; more studies are therefore needed. Since cognitive impairment is a manifestation of HCV infection, a number of studies of HCV infection of neuronal cells have been performed. HCV negative strands were found in brain tissues from three patients that were obtained from autopsies [32]. They also showed that in two patients the serum and brain derived HCV had different HCV genotypes. As CD14 was detected in the brain tissue samples but not CD2 (T-cells) or CD19 (B-cells), they suggest that macrophages/monocytes were infected. HCV sequences from brain, liver, lymph node, and serum samples were also found to have differences in the HVR1 and IRES regions, providing evidence of tissue compartmentalization [33]. They also investigated translation efficiency of the IRES, and found the quasispecies in the brain have lower translation efficiency than that of liver or serum. RT-PCR has been used to show that HCV is found in postmortem brain tissue [34]. Immunostaining was also performed to determine that microglial/macrophage cells (CD68 + and CD45 + ) were infected by HCV, while neurons and oligodendroglial cells did not stain. Brain macrophages/microglial cells have also analyzed for cytokine and chemokine expression [35]. Higher levels of expression of the cytokines interleukin 1α and tumor necrosis factor α, interleukin 1β, interleukin 12, and interleukin 18 and the chemokines interleukin 8, interleukin 16, and interferon-inducible protein 10 were found in HCV infected CD68 + brain cells. They suggested that infected leukocytes could pass HCV to cells in the CNS. Two groups have investigated expression of toll-like receptors (TLR) in monocytes of infected individuals. One study found that TLRs 2, 5, 6, 7, 8, 9, and 10 mrna levels were all upregulated compared to uninfected individuals [36]. In addition, MD-2, CD14, and MyD88 were also upregulated in monocytes. However, they did not check the monocytes to see if they were infected with HCV. A second study looked primarily at expression levels in PBMC [37]. They found TLRs 4, 7, and 8 upregulated in CD14 + monocytes, as well as TNFα, IL-6, and IL- 12p35 in PBMC. Therefore, TLR7 and TLR8, which are activated by single-strand RNA, were found upregulated by both groups, and TLR3 did not significantly change in either study, but they disagreed on the other TLR. This could be due to a number of factors, including patient differences and how the monocytes were collected. One other group found no significant differences in the levels of CD14 + CD16 - and CD16 + CD14 - monocytes after HCV infection [38], although there were differences in response to TLR8-ligation or LPS stimulation. Therefore, they suggest that CD16 + CD14 - monocytes do not appear to have a role in HCV pathogenesis, although they may differentiate into Kupffer or Dendritic cells. However, there is no reason to expect that levels of monocytes would be related to the pathogenesis of HCV, so their conclusions don t seem reasonable. Dendritic cells (DC), like macrophages, are derived from monocytes. RT-PCR has been used to show that monocyte-derived DCs contain HCV RNA [39]. Circulating DCs have also been shown to be positive for HCV RNA [40,41]. Analysis of the HVR-1 quasispecies suggests that HCV in dendritic cells were different than serum. Myeloid dendritic cells (mdc) separated from plasmacytoid dendritic cells (pdc), and then sequenced, had HVR-1 that was often significantly different between the DC and sera. HCV was detected in monocytes, but not in mature DC produced from the monocytes after stimulation with granulocyte macrophage colony-stimulating factor (GM-CSF) and IL-4 [42]. They found the metabolism of the DCs to be altered compared to monocytes from uninfected patients. It may be that their conversion of monocytes to DC only works well on HCV-negative cells, e.g., HCV-infection may inhibit the conversion. However, a recent review of the effects of chronic HCV infection on dendritic cells found some agreement that there are lowered numbers of mdc and pdc in infected individuals, but there have not been any convincing functional defects found in the cells [43]. These in vivo studies show that monocytes, macrophages, and dendritic cells can be infected by HCV. The HCV sequence results suggest that different cell types can select slightly different HCV variants, producing separate pools or compartments. This suggests that at least part of the reason that the major HCV variants change in patients over extended times is due to changes in cell tropism. A recent study of one HCV patient over an extended time suggests that the proportions of particular variants changes over time [44]. It is hard to reconcile their observations with the hypothesis that immune pressure is the driving force for genetic variation of HCV. Instead, a combination of changes in cell tropism and the immune system adaptive system trying to eliminate the virus better accounts for HCV variation over extended times. Studies that have investigated monocyte/macrophage cell responses to HCV have not been extensive enough to reach firm conclusions about changes in gene expression by HCV infected cells March 21, 2014 Volume 20 Issue 11

61 Revie D et al. Macrophages and monocytes in HCV infections IN VITRO EXPERIMENTS INVESTIGATING REPLICATION OF HCV IN MONOCYTES As there is significant evidence for infection of monocytes, macrophages, and dendritic cells in vivo, a number of groups have studied infection of these cell types in vitro. The first study of monocytes/macrophages in vitro isolated the cells from healthy donors [45]. They then incubated them with HCV positive sera. There was a low level of infection, and the HVR-1 sequences of the serum and cultured samples were very similar. A second study testing the infection of Kupffer cells found no significant infection of them [46]. Monocytes/macrophages isolated from PBMC of healthy donors were shown to be infectable by sera from HCV-infected patients [47]. They found negative strands of HCV present in the cells, and the quasispecies of the 5 UTR and NS5B regions were investigated by singlestrand conformation polymorphism (SSCP) and sequencing. They found some sequence changes in either the NS5B or 5 UTR for samples from some patients. Monocytes/macrophages already infected with HIV have been found to be more infectable by HCV, and they had higher levels of HCV RNA than cells that were not pre-infected with HIV [48]. PBMC from uninfected individuals that was incubated with HCV genotype 4, and then separated into cell types by flow cytometry, has detectable negative strands by RT-PCR and immunofluorescence staining against core and E1 24 h post infection [49]. The staining was most frequently in monocytes, as determined by flow cytometry. A monocytoid cell line, THP-1, has been tested for susceptibility to infection by HCV [50]. The presence of HCV envelope protein E2 was found inside cells using immunofluorescence, and HCV RNA was detectable in cell culture supernatants seven days after infection. However, recently, another group found HCV to enter THP-1 cells in a manner that was insensitive to anti-cd81 blocking antibodies, but the HCV did not replicate [51]. These cells, therefore, may not be useful as an in vitro model for studying HCV replication. However, they showed that Kupffer cells in the liver produce low but detectable levels of interferon-β in HCV-infected individuals and THP-1 cells also produce interferon-β in response to HCV infection, suggesting that THP-1 cells were responding similarly to Kupffer cells. Livers of HCVinfected individuals were also analyzed for the source of IL-1β production. Staining of liver sections using antibodies against both IL-1β and CD68 showed that IL- 1β was produced in intrahepatic macrophages [52]. In vitro cultured THP-1 cells also produced IL-1β in response to cell culture-derived HCV (HCVcc). The THP-1 cells had peak IL-1β production 3 h after virus exposure. The virus was found to enter THP-1 cells in a method independent of the CD81 co-receptor. UV-inactivated virus also caused the IL-1β response, suggesting that viral replication was not necessary for the response. Dendritic cells have been tested in vitro for susceptibil- ity to HCV infection [53]. Negative strands were detected in both immature and mature DC within 2 d after infection. Quasispecies analysis of the HVR-1 and SSCP of the 5 UTR showed minor differences between HCV in the patient sera and the DC HCV. One study of the infection of isolated dendritic cells, both myeloid DC and plasmacytoid DC, using HCVcc provided evidence that HCV uses different methods of entry into each of the cell types [54]. They also provide evidence that the HCV localizes in different places in the two cell types: endosomes in plasmacytoid DC and in lysosomes in myeloid DC. The virus thus likely uses different sets of receptors to enter each cell. A culture system that has been extensively studied uses primary macrophages generated from umbilical cord blood [55]. In this system, HCV from serum or plasma of an HCV-infected individual was used to infect the primary macrophages (Figure 1). After about 7 d, the HCV in the cell culture supernatant was used to infect other cell types, including B-cells, T-cells, and macrophage-like neuronal cells (Table 1). Analysis of the 5 UTR of HCV genotype 1 showed that there were only minor differences between the serum/plasma and the HCV produced by the other cell types [56]. However, variants in serum that contained a large deletion did not replicate in the macrophages [57]. This suggests that the macrophages are replicating most but not all HCV variants. Additional support for this was seen when HCV genotype 3 was analyzed [58]. The 5 UTR for the HCV genotype 3 cultured in vitro had changed significantly, and was now similar to HCV genotype 1. This suggested that the macrophages are selecting sequences similar to HCV genotype 1. Culturing in other cell types did cause selection of particular HVR-1. It was also found that culturing in macrophages produced the same variants as seen in one patient s serum almost 18 mo later, suggesting macrophages tend to produce the same variants in vitro as seen in vivo. Overall, these results suggest that macrophages in HCV genotype 1 individuals are producing HCV that is a little more infectious than that found in the serum. These results suggest that studying the infection of monocytes and macrophages in vitro and in vivo may yield insights into the life cycle of the virus. What is the role of monocytes and macrophages? Are they important for sustaining the infection or just innocent bystanders and only transiently infected? MODEL OF THE ROLE OF MACROPHAGES Most HCV investigators have likely regarded the productive infection of macrophages by HCV as either something that does not happen or of little importance. Researchers who have studied the in vivo infection of macrophages and monocytes, however, have provided a substantial amount of evidence that they are infected, as detailed above. There has been little agreement of whether infection of monocytes or macrophages is im March 21, 2014 Volume 20 Issue 11

62 Revie D et al. Macrophages and monocytes in HCV infections Mononuclear cells from fetal cord blood Induce with PMA Specimen from HCV infected patients Induce with PWM Generate macrophages Serum PBMC Transform with EBV Culture for 3 wk Cell free transmission 0.45 m Freshly transformed B cells Macrophages HCV producing stock culture Cell free transmission Co-Culture Macrophages Figure 1 Isolation method for studying in vitro replication of hepatitis C virus. Macrophages are generated from mononuclear cells in fetal cord blood and infected by hepatitis C virus (HCV). Adapted from reference [55]. EBV: Epstein-Barr virus; PWM: Pokeweed mitogen; PMA: Phorbol-12-myristate-13-acetate; PBMC: Peripheral blood mononuclear cells. Table 1 Transmission of hepatitis C virus into various hematopoetic and liver cells Short term replication Long term replication T-cells B-cells Monocytes/ + - macrophages 3 Neuronal precursors Liver cells 5 Kupffer cells + - Hepatocyte + +/- Adapted from reference [55]. 1 T-cells isolated from human fetal cord blood; 2 B-cells immortalized by infection with transforming Epstein-Barr virus; 3 Monocyte/macrophages: adherent cells stimulated with phorbol-12- myristate-13-acetate; 4 Recently isolated neuronal cells from fetal human brain; 5 Freshly isolated liver cells from liver biopsies. Kupffer cells are liver macrophages and hepatocytes are liver endothelial cells. portant for the long term consequences of HCV infection. Some work has been performed on the infection of neuronal cells in vivo, and it has been suggested that infection of microglial/macrophage cells may allow HCV to pass through the blood-brain barrier to infect brain cells such as astroglial cells [34,35,48]. This has been described as a Trojan horse mechanism. Evidence that HCV RNA purified from various tissues (compartments) has small differences in their HVR and/or 5 UTR sequences suggests that different versions of HCV replicate in different tissues. In addition, in vitro evidence suggests that different cell types also preferentially replicate slightly different versions of HCV. Of the cell types investigated in vitro, monocytes/macrophages appear to have sequences that are closest to those found in the sera of patients. This suggests that monocytes/ macrophages have an important role in HCV replication in vivo. The Trojan horse mechanism that has been proposed for infection of cells in the brain may also be valid for other tissues. Therefore, monocytes/macrophages in HCV infection may act as a carrier of the infection to other cells. The monocytes/macrophages get infected, but do not themselves have significant cytotoxic effects or metabolic problems when infected. This allows them to be infected for longer periods of time. Instead, they replicate HCV in a relatively non-specific manner for as long as they survive. Macrophages select against defective HCV, probably, in other regions of the HCV genome. Macrophages in HIV-1 infections have been shown to be holding compartments for HIV-1, where membranous labyrinths form and contain the virus [59]. Macrophages may also act in a similar manner with HCV and therefore produce and/or hold a lot of virus. Overall, we propose a model where HCV infects macrophages. The macrophages replicate the HCV and then pass it on to other cell types. Other cell types, on the other hand, often show effects of HCV infection, including cytopathic effects such as cell death. It may be that these cell types, when infected, produce the diseases we associate with long term infection by HCV, such as liver damage due to the cytopathic effects of HCV on hepatocytes. It should be noted that there are many types of macrophages, so each particular type may act slightly differently with regards to HCV, but our model extrapolates from the ones that have been studied to date. What are the clinical implications of the proposed role of macrophages/monocytes? First, macrophages 2781 March 21, 2014 Volume 20 Issue 11

63 Revie D et al. Macrophages and monocytes in HCV infections are fairly long-lived cells, and generally survive for weeks. It has been proposed that the presence of CD14 on the cells supports survival of the cells [60]. This long life, even after HCV infection, suggests that not only is HCV produced for extended periods, but the cells can also produce cytokines that affect other immune cells such as B-cells and T-cells [60,61]. The cytokines can cause cytopathic effects on other nearby cells. Therefore, the infection of long-lived cells may partially explain the long treatment times needed to eradicate HCV. Second, results of in vitro studies may explain differences in therapy for different HCV genotypes. As described above, HCV genotype 1 readily infects macrophages in vitro, but HCV genotype 3 does not. Since therapy for HCV genotype 1 needs to be done for longer periods than HCV genotype 3 [60], this may be due in part to the different cell tropisms for the two genotypes. Evidence in support of this has been shown in one report that showed that in patients that did not have a sustained virologic response to combination therapy with ribavirin and pegylated interferon-α, 88% were infected with genotypes 1 or 4, while 24% were infected with genotypes 2 or 3 [62]. Some patients were infected with two genotypes. Third, studies of extrahepatic diseases resulting from HCV infection suggest the presence of replicating virus in peripheral blood or bone marrow-derived lymphocytes in patients with mixed cryoglobulinemia [63], in carotid plaques [64], and in peripheral blood leukocytes of patients with lichen planus [65]. The researchers did not determine which specific cell types contained replicating HCV in any of these reports, but it is likely that monocytes are infected. Unfortunately, we can find no studies that have investigated which specific cell types produce replicating HCV in any studies of extrahepatic diseases caused by HCV infection. Last, one group has shown CD68-positive macrophages in liver, heart, kidney, and bone marrow in autopsy specimens from patients that had hepatocellular carcinoma and cardiomyopathies [21]. This study therefore suggests that many different tissues can contain infected macrophages that may cause disease, either by passing HCV or indirectly by releasing signaling molecules. The study of HCV replication to date has mostly concentrated on the JFH1/HuH 7.5 model system, to the neglect of studying HCV isolated from patients. This system is not relevant for the studies of the infection of a variety of cell types by the natural virus, which will be needed to let us understand how HCV causes disease. Although the work performed to date has advanced our understanding of HCV, the field needs to compare the results obtained from the model systems with studies using the natural virus to obtain a better understanding of how HCV is able to replicate in infected individuals. REFERENCES 1 Kita H, Mackay IR, Van De Water J, Gershwin ME. The lymphoid liver: considerations on pathways to autoimmune injury. Gastroenterology 2001; 120: [PMID: DOI: /gast ] 2 Dong Z, Wei H, Sun R, Tian Z. The roles of innate immune cells in liver injury and regeneration. Cell Mol Immunol 2007; 4: [PMID: ] 3 Aguzzi A, Barres BA, Bennett ML. Microglia: scapegoat, saboteur, or something else? Science 2013; 339: [PMID: DOI: /science ] 4 Baffy G. Kupffer cells in non-alcoholic fatty liver disease: the emerging view. J Hepatol 2009; 51: [PMID: DOI: /j.jhep ] 5 Stienstra R, Saudale F, Duval C, Keshtkar S, Groener JE, van Rooijen N, Staels B, Kersten S, Müller M. Kupffer cells promote hepatic steatosis via interleukin-1beta-dependent suppression of peroxisome proliferator-activated receptor alpha activity. Hepatology 2010; 51: [PMID: DOI: /hep.23337] 6 Ko HM, Hernandez-Prera JC, Zhu H, Dikman SH, Sidhu HK, Ward SC, Thung SN. Morphologic features of extrahepatic manifestations of hepatitis C virus infection. Clin Dev Immunol 2012; 2012: [PMID: DOI: /2012/740138] 7 Monaco S, Ferrari S, Gajofatto A, Zanusso G, Mariotto S. HCVrelated nervous system disorders. Clin Dev Immunol 2012; 2012: [PMID: DOI: /2012/236148] 8 Revie D, Salahuddin SZ. Human cell types important for hepatitis C virus replication in vivo and in vitro: old assertions and current evidence. Virol J 2011; 8: 346 [PMID: DOI: / x-8-346] 9 Friebe P, Lohmann V, Krieger N, Bartenschlager R. Sequences in the 5 nontranslated region of hepatitis C virus required for RNA replication. J Virol 2001; 75: [PMID: DOI: /JVI ] 10 Rijnbrand RC, Lemon SM. Internal ribosome entry sitemediated translation in hepatitis C virus replication. Curr Top Microbiol Immunol 2000; 242: [PMID: DOI: / _5] 11 Wang C, Sarnow P, Siddiqui A. Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding mechanism. J Virol 1993; 67: [PMID: ] 12 Wang JT, Sheu JC, Lin JT, Wang TH, Chen DS. Detection of replicative form of hepatitis C virus RNA in peripheral blood mononuclear cells. J Infect Dis 1992; 166: [PMID: DOI: /infdis/ ] 13 Qian C, Camps J, Maluenda MD, Civeira MP, Prieto J. Replication of hepatitis C virus in peripheral blood mononuclear cells. Effect of alpha-interferon therapy. J Hepatol 1992; 16: [PMID: DOI: /S (05) ] 14 Bouffard P, Hayashi PH, Acevedo R, Levy N, Zeldis JB. Hepatitis C virus is detected in a monocyte/macrophage subpopulation of peripheral blood mononuclear cells of infected patients. J Infect Dis 1992; 166: [PMID: DOI: /infdis/ ] 15 Zignego AL, Macchia D, Monti M, Thiers V, Mazzetti M, Foschi M, Maggi E, Romagnani S, Gentilini P, Bréchot C. Infection of peripheral mononuclear blood cells by hepatitis C virus. J Hepatol 1992; 15: [PMID: DOI: / (92)90073-X] 16 Sansonno D, Iacobelli AR, Cornacchiulo V, Iodice G, Dammacco F. Detection of hepatitis C virus (HCV) proteins by immunofluorescence and HCV RNA genomic sequences by non-isotopic in situ hybridization in bone marrow and peripheral blood mononuclear cells of chronically HCVinfected patients. Clin Exp Immunol 1996; 103: [PMID: DOI: /j tb08296.x] 17 Lerat H, Rumin S, Habersetzer F, Berby F, Trabaud MA, Trépo C, Inchauspé G. In vivo tropism of hepatitis C virus genomic sequences in hematopoietic cells: influence of viral load, viral genotype, and cell phenotype. Blood 1998; 91: [PMID: ] 18 Laskus T, Radkowski M, Piasek A, Nowicki M, Horban A, 2782 March 21, 2014 Volume 20 Issue 11

64 Revie D et al. Macrophages and monocytes in HCV infections Cianciara J, Rakela J. Hepatitis C virus in lymphoid cells of patients coinfected with human immunodeficiency virus type 1: evidence of active replication in monocytes/macrophages and lymphocytes. J Infect Dis 2000; 181: [PMID: DOI: /315283] 19 Crovatto M, Pozzato G, Zorat F, Pussini E, Nascimben F, Baracetti S, Grando MG, Mazzaro C, Reitano M, Modolo ML, Martelli P, Spada A, Santini G. Peripheral blood neutrophils from hepatitis C virus-infected patients are replication sites of the virus. Haematologica 2000; 85: [PMID: ] 20 Natarajan V, Kottilil S, Hazen A, Adelsberger J, Murphy AA, Polis MA, Kovacs JA. HCV in peripheral blood mononuclear cells are predominantly carried on the surface of cells in HIV/HCV co-infected individuals. J Med Virol 2010; 82: [PMID: DOI: /jmv.21906] 21 Matsumori A, Shimada M, Obata T. Leukocytes are the major target of hepatitis C virus infection: Possible mechanism of multiorgan involvement including the heart. CVD Prev Control 2010; 5: [DOI: /j.cvdpc ] 22 Sansonno D, Cornacchiulo V, Racanelli V, Dammacco F. In situ simultaneous detection of hepatitis C virus RNA and hepatitis C virus-related antigens in hepatocellular carcinoma. Cancer 1997; 80: [PMID: ] 23 Benkoël L, Biagini P, Dodero F, De Lamballerie X, De Micco P, Chamlian A. Immunohistochemical detection of C-100 hepatitis C virus antigen in formaldehyde-fixed paraffinembedded liver tissue. Correlation with serum, tissue and in situ RT-PCR results. Eur J Histochem 2004; 48: [PMID: ] 24 Pham TN, King D, Macparland SA, McGrath JS, Reddy SB, Bursey FR, Michalak TI. Hepatitis C virus replicates in the same immune cell subsets in chronic hepatitis C and occult infection. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 25 Sansonno D, Gesualdo L, Manno C, Schena FP, Dammacco F. Hepatitis C virus-related proteins in kidney tissue from hepatitis C virus-infected patients with cryoglobulinemic membranoproliferative glomerulonephritis. Hepatology 1997; 25: [PMID: DOI: /hep ] 26 Maggi F, Fornai C, Morrica A, Vatteroni ML, Giorgi M, Marchi S, Ciccorossi P, Bendinelli M, Pistello M. Divergent evolution of hepatitis C virus in liver and peripheral blood mononuclear cells of infected patients. J Med Virol 1999; 57: [PMID: ] 27 Okuda M, Hino K, Korenaga M, Yamaguchi Y, Katoh Y, Okita K. Differences in hypervariable region 1 quasispecies of hepatitis C virus in human serum, peripheral blood mononuclear cells, and liver. Hepatology 1999; 29: [PMID: DOI: /hep ] 28 Navas S, Martín J, Quiroga JA, Castillo I, Carreño V. Genetic diversity and tissue compartmentalization of the hepatitis C virus genome in blood mononuclear cells, liver, and serum from chronic hepatitis C patients. J Virol 1998; 72: [PMID: ] 29 Ducoulombier D, Roque-Afonso AM, Di Liberto G, Penin F, Kara R, Richard Y, Dussaix E, Féray C. Frequent compartmentalization of hepatitis C virus variants in circulating B cells and monocytes. Hepatology 2004; 39: [PMID: DOI: /hep.20087] 30 Coquillard G, Patterson BK. Determination of hepatitis C virus-infected, monocyte lineage reservoirs in individuals with or without HIV coinfection. J Infect Dis 2009; 200: [PMID: DOI: /605476] 31 Blight K, Trowbridge R, Rowland R, Gowans E. Detection of hepatitis C virus RNA by in situ hybridization. Liver 1992; 12: [PMID: ] 32 Radkowski M, Wilkinson J, Nowicki M, Adair D, Vargas H, Ingui C, Rakela J, Laskus T. Search for hepatitis C virus negative-strand RNA sequences and analysis of viral sequences in the central nervous system: evidence of replication. J Virol 2002; 76: [PMID: DOI: / JVI ] 33 Forton DM, Karayiannis P, Mahmud N, Taylor-Robinson SD, Thomas HC. Identification of unique hepatitis C virus quasispecies in the central nervous system and comparative analysis of internal translational efficiency of brain, liver, and serum variants. J Virol 2004; 78: [PMID: DOI: /JVI ] 34 Letendre S, Paulino AD, Rockenstein E, Adame A, Crews L, Cherner M, Heaton R, Ellis R, Everall IP, Grant I, Masliah E. Pathogenesis of hepatitis C virus coinfection in the brains of patients infected with HIV. J Infect Dis 2007; 196: [PMID: DOI: /519285] 35 Wilkinson J, Radkowski M, Eschbacher JM, Laskus T. Activation of brain macrophages/microglia cells in hepatitis C infection. Gut 2010; 59: [PMID: DOI: /gut ] 36 Dolganiuc A, Garcia C, Kodys K, Szabo G. Distinct Tolllike receptor expression in monocytes and T cells in chronic HCV infection. World J Gastroenterol 2006; 12: [PMID: ] 37 Sato K, Ishikawa T, Okumura A, Yamauchi T, Sato S, Ayada M, Matsumoto E, Hotta N, Oohashi T, Fukuzawa Y, Kakumu S. Expression of Toll-like receptors in chronic hepatitis C virus infection. J Gastroenterol Hepatol 2007; 22: [PMID: DOI: /j x] 38 Peng C, Liu BS, de Knegt RJ, Janssen HL, Boonstra A. The response to TLR ligation of human CD16 + CD14 - monocytes is weakly modulated as a consequence of persistent infection with the hepatitis C virus. Mol Immunol 2011; 48: [PMID: DOI: /j.molimm ] 39 Bain C, Fatmi A, Zoulim F, Zarski JP, Trépo C, Inchauspé G. Impaired allostimulatory function of dendritic cells in chronic hepatitis C infection. Gastroenterology 2001; 120: [PMID: ] 40 Goutagny N, Fatmi A, De Ledinghen V, Penin F, Couzigou P, Inchauspé G, Bain C. Evidence of viral replication in circulating dendritic cells during hepatitis C virus infection. J Infect Dis 2003; 187: [PMID: ] 41 Goutagny N, Vieux C, Decullier E, Ligeoix B, Epstein A, Trepo C, Couzigou P, Inchauspe G, Bain C. Quantification and functional analysis of plasmacytoid dendritic cells in patients with chronic hepatitis C virus infection. J Infect Dis 2004; 189: [PMID: DOI: /383248] 42 Gelderblom HC, Nijhuis LE, de Jong EC, te Velde AA, Pajkrt D, Reesink HW, Beld MG, van Deventer SJ, Jansen PL. Monocyte-derived dendritic cells from chronic HCV patients are not infected but show an immature phenotype and aberrant cytokine profile. Liver Int 2007; 27: [PMID: DOI: /j x] 43 Ryan EJ, O Farrelly C. The affect of chronic hepatitis C infection on dendritic cell function: a summary of the experimental evidence. J Viral Hepat 2011; 18: [PMID: DOI: /j x] 44 Palmer BA, Moreau I, Levis J, Harty C, Crosbie O, Kenny- Walsh E, Fanning LJ. Insertion and recombination events at hypervariable region 1 over 9.6 years of hepatitis C virus chronic infection. J Gen Virol 2012; 93: [PMID: DOI: /vir ] 45 Caussin-Schwemling C, Schmitt C, Stoll-Keller F. Study of the infection of human blood derived monocyte/macrophages with hepatitis C virus in vitro. J Med Virol 2001; 65: [PMID: ] 46 Royer C, Steffan AM, Navas MC, Fuchs A, Jaeck D, Stoll- Keller F. A study of susceptibility of primary human Kupffer cells to hepatitis C virus. J Hepatol 2003; 38: [PMID: ] 47 Radkowski M, Bednarska A, Horban A, Stanczak J, Wilkinson J, Adair DM, Nowicki M, Rakela J, Laskus T. Infection 2783 March 21, 2014 Volume 20 Issue 11

65 Revie D et al. Macrophages and monocytes in HCV infections of primary human macrophages with hepatitis C virus in vitro: induction of tumour necrosis factor-alpha and interleukin 8. J Gen Virol 2004; 85: [PMID: ] 48 Laskus T, Radkowski M, Jablonska J, Kibler K, Wilkinson J, Adair D, Rakela J. Human immunodeficiency virus facilitates infection/replication of hepatitis C virus in native human macrophages. Blood 2004; 103: [PMID: ] 49 el-awady MK, Tabll AA, Redwan el-rm, Youssef S, Omran MH, Thakeb F, el-demellawy M. Flow cytometric detection of hepatitis C virus antigens in infected peripheral blood leukocytes: binding and entry. World J Gastroenterol 2005; 11: [PMID: ] 50 Ponzetto A, Gennero L, Cutufia M, Beltramo T, Enrietto M, Pescarmona P, Pugliese A. Effect of HCV infection on THP-1 monocytoid cells. Cell Biochem Funct 2005; 23: [PMID: DOI: /cbf.1158] 51 Lau DT, Negash A, Chen J, Crochet N, Sinha M, Zhang Y, Guedj J, Holder S, Saito T, Lemon SM, Luxon BA, Perelson AS, Gale M. Innate immune tolerance and the role of kupffer cells in differential responses to interferon therapy among patients with HCV genotype 1 infection. Gastroenterology 2013; 144: e12 [PMID: DOI: / j.gastro ] 52 Negash AA, Ramos HJ, Crochet N, Lau DT, Doehle B, Papic N, Delker DA, Jo J, Bertoletti A, Hagedorn CH, Gale M. IL- 1β production through the NLRP3 inflammasome by hepatic macrophages links hepatitis C virus infection with liver inflammation and disease. PLoS Pathog 2013; 9: e [PMID: DOI: /journal.ppat ] 53 Navas MC, Fuchs A, Schvoerer E, Bohbot A, Aubertin AM, Stoll-Keller F. Dendritic cell susceptibility to hepatitis C virus genotype 1 infection. J Med Virol 2002; 67: [PMID: DOI: /jmv.2204] 54 Lambotin M, Baumert TF, Barth H. Distinct intracellular trafficking of hepatitis C virus in myeloid and plasmacytoid dendritic cells. J Virol 2010; 84: [PMID: DOI: /JVI ] 55 Revie D, Braich RS, Bayles D, Chelyapov N, Khan R, Geer C, Reisman R, Kelley AS, Prichard JG, Salahuddin SZ. Transmission of human hepatitis C virus from patients in secondary cells for long term culture. Virol J 2005; 2: 37 [PMID: DOI: / X-2-37] 56 Revie D, Alberti MO, Braich RS, Chelyapov N, Bayles D, Prichard JG, Salahuddin SZ. Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies. Virol J 2006; 3: 81 [PMID: DOI: / X-3-81] 57 Revie D, Alberti MO, Braich RS, Bayles D, Prichard JG, Salahuddin SZ. Discovery of significant variants containing large deletions in the 5 UTR of human hepatitis C virus (HCV). Virol J 2006; 3: 82 [PMID: DOI: / X-3-82] 58 Revie D, Alberti MO, Prichard JG, Kelley AS, Salahuddin SZ. Analysis of the 5 UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages. Virol J 2010; 7: 155 [PMID: DOI: / X-7-155] 59 Welsch S, Groot F, Kräusslich HG, Keppler OT, Sattentau QJ. Architecture and regulation of the HIV-1 assembly and holding compartment in macrophages. J Virol 2011; 85: [PMID: DOI: /jvi ] 60 Farnik H, Mihm U, Zeuzem S. Optimal therapy in genotype 1 patients. Liver Int 2009; 29 Suppl 1: [PMID: DOI: /j x] 61 NIH Consensus Statement on Management of Hepatitis C: NIH Consens State Sci Statements 2002; 19: 1-46 [PMID: ] 62 Di Liberto G, Roque-Afonso AM, Kara R, Ducoulombier D, Fallot G, Samuel D, Feray C. Clinical and therapeutic implications of hepatitis C virus compartmentalization. Gastroenterology 2006; 131: [PMID: ] 63 Sansonno D, Tucci FA, Lauletta G, De Re V, Montrone M, Troiani L, Sansonno L, Dammacco F. Hepatitis C virus productive infection in mononuclear cells from patients with cryoglobulinaemia. Clin Exp Immunol 2007; 147: [PMID: ] 64 Boddi M, Abbate R, Chellini B, Giusti B, Giannini C, Pratesi G, Rossi L, Pratesi C, Gensini GF, Paperetti L, Zignego AL. Hepatitis C virus RNA localization in human carotid plaques. J Clin Virol 2010; 47: [PMID: ] 65 Kurokawa M, Hidaka T, Sasaki H, Nishikata I, Morishita K, Setoyama M. Analysis of hepatitis C virus (HCV) RNA in the lesions of lichen planus in patients with chronic hepatitis C: detection of anti-genomic- as well as genomic-strand HCV RNAs in lichen planus lesions. J Dermatol Sci 2003; 32: [PMID: ] P- Reviewers: Imazeki F, Iwasaki Y, Irshad M S- Editor: Gou SX L- Editor: A E- Editor: Ma S 2784 March 21, 2014 Volume 20 Issue 11

66 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Establishment of chronic hepatitis C virus infection: Translational evasion of oxidative defence TOPIC HIGHLIGHT Shiu-Wan Chan Shiu-Wan Chan, Faculty of Life Sciences, The University of Manchester, Manchester M13 9PT, United Kingdom Author contributions: Chan SW designed and wrote the review article. Supported by The work quoted from my laboratory was supported by a Medical Research Council (United Kingdom) grant Correspondence to: Shiu-Wan Chan, PhD, Faculty of Life Sciences, The University of Manchester, Michael Smith Building, Oxford Road, Manchester M13 9PT, United Kingdom. shiu-wan.chan@manchester.ac.uk Telephone: Received: September 28, 2013 Revised: December 3, 2013 Accepted: January 14, 2014 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) causes a clinically important disease affecting 3% of the world population. HCV is a single-stranded, positive-sense RNA virus belonging to the genus Hepacivirus within the Flaviviridae family. The virus establishes a chronic infection in the face of an active host oxidative defence, thus adaptation to oxidative stress is key to virus survival. Being a small RNA virus with a limited genomic capacity, we speculate that HCV deploys a different strategy to evade host oxidative defence. Instead of counteracting oxidative stress, it utilizes oxidative stress to facilitate its own survival. Translation is the first step in the replication of a plus strand RNA virus so it would make sense if the virus can exploit the host oxidative defence in facilitating this very first step. This is particularly true when HCV utilizes an internal ribosome entry site element in translation, which is distinctive from that of cap-dependent translation of the vast majority of cellular genes, thus allowing selective translation of genes under conditions when global protein synthesis is compromised. Indeed, we were the first to show that HCV translation was stimulated by an important prooxidant-hydrogen peroxide in hepatocytes, suggesting that HCV is able to adapt to and utilize the host antiviral response to facilitate its own translation thus allowing the virus to thrive under oxidative stress condition to establish chronicity. Understanding how HCV translation is regulated under oxidative stress condition will advance our knowledge on how HCV establishes chronicity. As chronicity is the initiator step in disease progression this will eventually lead to a better understanding of pathogenicity, which is particularly relevant to the development of anti-virals and improved treatments of HCV patients using anti-oxidants Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Oxidative stress; Hydrogen peroxide; Translation; Internal ribosome entry site; Chronicity; Persistence Core tip: Oxidative stress inhibits canonical translation, however, emerging evidence suggests that oxidative stress can actually stimulate alternative translation from select internal ribosome entry site (IRES) elements including that involved in redox regulation and in persistent virus infection e.g., human immunodeficiency virus and hepatitis C virus (HCV). We postulate a novel role of oxidative stress-activated IRES-mediated translation in redox homeostasis and virus persistence. In the case of HCV, we explore the idea that HCV exploits oxidative stress to activate its own translation as a novel means of evading the host oxidative defence to establish chronicity. Chan SW. Establishment of chronic hepatitis C virus infection: Translational evasion of oxidative defence. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2785.htm DOI: org/ /wjg.v20.i March 21, 2014 Volume 20 Issue 11

67 Chan SW. Oxidative stress-activated IRES translation INTRODUCTION Hepatitis C virus (HCV) causes a clinically important disease affecting 3% of the world population [1]. About 75% of the infection will develop into chronic hepatitis, which can then progress into fibrosis, cirrhosis and hepatocellular carcinoma. A vaccine is not available. Current interferon (IFN) treatments are expensive, with numerous side effects and are particularly ineffective against the predominant genotype 1 in America and European countries [2]. The newly approved protease inhibitors likely promote the emergence of drug resistant mutants, owing to the high mutation rate of the HCV genome [2]. Thus there is a pressing need for alternative HCV therapies. HCV establishes a chronic infection in the face of an active immune response and the host oxidative defence. A number of mechanisms have been proposed to account for evasion of the antibody and cellular immunity and the natural killer, IFN and Toll-like receptor innate immunity [3-5]. However, little is known about how the virus can survive in a highly oxidative environment given that oxidative stress is such a prominent clinical feature associated with hepatitis C infection [6-12]. Adaptation to oxidative stress is key to virus survival. We postulate that adaptation can be at the level of translation as HCV uses an internal ribosome entry site (IRES) element for translation, distinctive from that of cellular translation [13]. Indeed, we were the first to show that translation from the HCV IRES was stimulated by an important pro-oxidant-hydrogen peroxide (H2O2) in hepatocytes, suggesting that HCV is able to adapt to and utilize host anti-viral response to facilitate its own translation thus allowing the virus to thrive under oxidative stress condition to establish chronicity [14]. Anti-oxidants are now in clinical trials in the treatment of HCV patients [15-17]. Understanding the mechanisms of how HCV evades host oxidative defence at the translational level may help shape the formulation of improved and new anti-oxidant treatments for HCV. HCV HCV is a Hepacivirus belonging to the family Flaviviridae [18]. As a single-stranded, positive-sense RNA virus, translation is the first step in the life cycle of HCV upon infection of a susceptible cell. Its 5 untranslated region (UTR) contains an IRES element used to translate the 9.6 kb RNA genome into a single polypeptide which is then cleaved by the host and viral proteases into structural proteins core, envelopes E1 and E2, and non-structural (NS) proteins p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B (Figure 1) [19]. The RNA polymerase, NS5B, then catalyzes replication of the viral genome. The genome of HCV undergoes a high mutation rate giving rise to genetic variants, thus HCV is divided into genotypes and sub-types and is populated as quasispecies [20,21]. A quasispecies is a cloud of diverse, genetically linked mutants that function cooperatively and behave as a unit for natural selection [22]. Thus, a population of mutants with similar fitness values will out-compete those with a broad range of fitness values even though the latter includes mutants of high fitness values. This constitutes the basis of the survival of the flattest in quasispecies theory in contrast to Darwinian the survival of the fittest [23]. However, there is much debate on whether HCV or any RNA virus ever exists as a quasispecies in evolutionary term as the mutation rate of HCV is never high enough to lead to quasispecies dynamics [23]. Nevertheless, this quasispecies /intra-host variants phenomenon has great impact on virus persistence, pathogenesis, anti-viral treatment and vaccine design. However, different regions of the genome exhibit different degrees of sequence variability, with the envelope E2 region being the most variable harbouring hypervariable regions and the 5 UTR the most conserved [21,24,25]. Thus, targeting 5 UTR may be a solution to solve the problem of sequence variability in anti-viral therapies [26,27]. TRANSLATION The vast majority of proteins is synthesized by a process known as cap-dependent translation, so named because it requires a 7-methyl guanosine (m 7 G) cap-structure at the 5 end of the mrna [28]. Translation is initiated when the cap is bound by the cap-binding complex eukaryotic initiation factor (eif) 4F, which consists of eif4e, eif4a and eif4g (Figure 2A). eif4e is the cap-binding protein. eif4a is a helicase, its unwinding activity is promoted by another initiation factor, eif4b. eif4g is the scaffold protein, which functions to recruit the 40S ribosomal subunit-eif3-eif2 pre-initiation complex to the 5 end of the mrna via protein-protein interaction between eif4g and eif3. The ribosomal complex, primed by eif1/1a, then scans a short distance ( nucleotides) to (usually) the nearest AUG triplet within a favorable (Kozak) sequence context to initiate translation [29]. IRES mediates an alternative form of translation distinctive from that of cap-dependent translation of the vast majority of cellular genes, thus allowing selective translation of genes under conditions when global protein synthesis is compromised e.g., virus infection, stress [30-32]. IRES translation is an important strategy employed by a subset of virus, mainly that of RNA viruses belonging to the Picornaviridae family, to continue viral protein synthesis during host translational shut off. IR- ESs found in cellular mrnas mainly serve the function of regulating cellular processes such as apoptosis, differentiation, angiogenesis, thus their activity is usually tightly regulated and many are only responsive to stress. Studies on viral IRESs suggest that the IRES element forms a direct landing pad for the ribosome, therefore, the secondary and tertiary structures of the IRES are important for its activity (Figure 2B) [33-36]. As a result, the viral IRES element normally spans a considerably longer 5 UTR that folds into a higher order structure and is interspersed with multiple AUG triplets [37]. However, short sequence motif rather than secondary structure is important in 2786 March 21, 2014 Volume 20 Issue 11

68 5 UTR p7 NS2 NS4A 3 UTR NS C E1 E2 NS3 NS5A NS5B 4B AUG IRES C NS3 Co-factor NS5B Core Serine protease Helicase RNA-dependent RNA polymerase E1 E2 Envelope Glycoproteins NS5A Replication Cell signalling Signal peptide peptidase Autoprotease Signal peptidase NS2 protease NS3 protease Viroporin Membranous web Replicase Figure 1 Hepatitis C virus genome. The 9.6 kb hepatitis C virus genome is flanked by highly structured 5 untranslated region (UTR) and 3 UTR which contain regulatory elements. The genomic sequence is translated into a polyprotein via internal ribosome entry site (IRES)-mediated translation. The polyprotein is then cleaved into individual structural and non-structural (NS) proteins by cellular signal peptidase and signal peptide peptidase and viral auto protease (NS2) and serine protease (NS3). most cellular IRES activity [38,39]. As short as a 9-nucleotide sequence from the 5 UTR of the cellular gene Gtx exhibited IRES activity [40,41]. In yeast and Drosophila, strong IRES activity was associated with weak secondary structure [42]. Because IRES-mediated translation is independent of a cap many canonical eifs are dispensable, however, the requirement for canonical eifs varies greatly amongst IRESs, ranging from the dependence of the entire set of eifs in the hepatitis A virus (a picornavirus unrelated to HCV) IRES to none of them in the cricket paralysis virus IRES [31,35,37]. Another characteristic of IRES translation is that it is regulated by a diverse group of proteins known as IRES trans-acting factors (ITAFs) [43]. ITAF Each IRES has a unique set of ITAFs, even within the same group of IRES that shares primary sequence and secondary structure [44]. On the other hand, IRES of diverse origins can share common ITAFs [45]. Many of these ITAFs are RNA chaperone proteins. Most of them facilitate IRES-mediated translation although some are negatively regulating. Common ITAFs include the La autoantigen, polypyrimidine tract binding protein (PTB), heterogeneous nuclear ribonucleoproteins (hnrnps), poly r(c) binding protein (PCBP), Upstream of N-ras (unr), death-associated protein 5 (DAP5) and the embryonic lethal abnormal vision/protein (ELAV/HuR) [30,46-52]. ITAF modification by stress signals is an important aspect in the regulation of IRES activity under stress conditions, using mechanisms such as nuclear-cytoplasmic shuttling, protein cleavage, phosphorylation and increased protein expression [53-58]. Many of the ITAFs are abundant nuclear proteins, thus nuclear-cytoplasmic shuttling presents an effective means of a fast response [59]. hnrnp A1 shuttled to the cytoplasm during osmotic shock to downregulate translation from the X-linked inhibitor of apoptosis protein (XIAP) IRES but upregulate translation from the fibroblast growth factor-2 IRES [53]. hnrnp A1 also shuttled to the cytoplasm in rhinovirus- 2-infected and UVC-irradiated cells to enhance translation from the rhinovirus IRES but limit translation from the apoptotic peptidase activating factor 1 IRES [60]. Proteolysis also plays an important part in regulating IRES activity, either by directly conferring novel function to the truncated protein or by causing protein shuttling after the removal of the nuclear localization signal (NLS), or both. Caspase cleavage of DAP5 during endoplasmic reticulum (ER) stress released an active fragment with a novel ITAF function to activate the cellular inhibitor of apoptosis protein (HIAP2) IRES [54]. Cleavage of the La protein and PTB by the poliovirus serine protease released truncated fragments devoid of NLS to shuttle to the cytoplasm to either activate or repress the poliovirus IRES [55,56]. Phos March 21, 2014 Volume 20 Issue 11

69 Chan SW. Oxidative stress-activated IRES translation A Cap-dependent translation eif1-4 4E 7-mG 4G 4A 4B A Ribosome scans to AUG AUG 40S ribosome B HCV IRES-mediated translation 3 Ribosome lands on AUG 2 AUG 40S ribosome Figure 2 Two different modes of translational initiation. A: Cap-dependent translation. Initiation of translation of most cellular genes requires a 7-methyl guanosine cap-structure at its 5 end and a full set of canonical eukaryotic translation factors (eifs) for ribosome binding and scanning to the AUG start codon [29]. The cap-binding complex eif4f consists of the cap-binding eif4e, the scaffold eif4g and the helicase eif4a. eif4b promotes the RNA unwinding activity of eif4a. Recruitment of the 40S ribosomal subunit-eif3-eif2 pre-initiation complex to the 5 end of the mrna is via protein-protein interaction between eif4g and eif3. The ribosomal complex, primed by eif1/1a, then scans a short distance ( nucleotides) to (usually) the nearest AUG triplet to initiate translation; B: Internal ribosome entry site (IRES)- mediated translation. The viral IRES element spans a considerably longer 5 untranslated region (UTR) ( nucleotides) that folds into a higher order structure and is interspersed with multiple AUG triplets [37]. The requirement for canonical eifs varies greatly amongst IRESs, ranging from the dependence of the entire set of eifs in the picornavirus hepatitis A virus IRES to none of them in the cricket paralysis virus IRES. The hepatitis C virus (HCV) IRES has the second simplest requirement, only needing eif2 and eif3. In reminiscent of the prokaryotic ribosomal binding of the Shine-Dalgarno sequence, the HCV IRES can directly recruit the 40S ribosome which lands on the authentic AUG initiator codon [35,63,65]. In some other IRESs, the ribosome lands on an upstream AUG and then scans or shunts to the initiator AUG [37]. An important feature about IRES-mediated translation is that its activity is regulated by IRES trans-acting factors [43]. and eif3 to form the 43S pre-initiation complex [35,63,65]. Structural and biochemical studies have indicated an unusually vast binding site for the ribosome encompassing domains Ⅱ, Ⅲ and Ⅳ and conformational changes in both the 40S ribosomal subunit and the IRES have been observed upon their interaction [66]. Binding between the IRES and the ribosome is thought to be mediated via ribosomal proteins although the role of RNA-RNA interaction cannot be excluded [67-69]. eif3 can bind both the ribosome and junction domain Ⅲabc and domain Ⅲb of the IRES, thus playing a significant role in stabilizing the ribosome-eif2 binary complex [70]. The ternary complex eif2α-gtp-the trna for the first methionine ( Met trnai) does not directly bind the IRES, rather it forms a ternary complex with eif3 and the 40S ribosomal subunit to position Met trnai directly onto the AUG codon in the P-site of the ribosome [70]. A number of putative ITAFs for the HCV IRES have been identified, including La, PTB, hnrnp D, hnrnp L, HuR, the NS1-associated protein 1 and mir-122 (Figphorylation of ITAFs is also commonly used to modify ITAF function. Phosphorylation of the hnrnp C protein during differentiation stimulated translation from the IRES of c-sis [57]. In some cases, over-expression of ITAF is sufficient to promote IRES translation. Elevated expression of unr stimulated translation from the IRES of PITSLRE cyclin-dependent protein kinase during G2/M phase of the cell cycle [58]. HCV IRES The HCV 5 UTR is divided into four stem-loop domains (Figure 3) [61]. The IRES element is made up of approximately 340 nucleotides and spans domain Ⅱ and extends into the core-coding region encompassing a double pseudoknot fold [13,62-64]. The HCV IRES has the second simplest requirement of eifs, only needing eif2 and eif3. In reminiscent of the prokaryotic ribosomal binding of the Shine-Dalgarno sequence, the HCV IRES can directly recruit the 40S ribosome before association with eif March 21, 2014 Volume 20 Issue 11

70 Chan SW. Oxidative stress-activated IRES translation Ⅱ Py-1 Pseudoknot Py-3 Ⅲa Py-2 Ⅲb AUG ure 3) [71-82]. There is evidence for a critical role of the La autoantigen in IRES translation, by binding to and altering the conformation of the IRES to orchestrate assembly of the ribosomal complex [82,83]. La is one of the best known ITAFs and is pivotal in mediating translation from a number of IRESs [72,82,84-89]. It normally functions in RNA metabolism e.g., nascent polⅢ transcript processing and RNP assembly but is co-opted as an ITAF in IRES translation [90]. Pathologically, La is an autoantigen in a number of autoimmune diseases such as lupus and Sjögren s syndrome [91]. The binding site for the La autoantigen has been mapped to the initiator AUG and the adjacent GCAC motif although additional binding sites may exist [88,92]. The binding sites for some other ITAFs have also been mapped [61,92]. Together with that of the ribosomal subunit and eif3, these binding sites offer attractive targets for antiviral intervention because of (1) Ⅲc Ⅲe Ⅳ Ⅲd Ⅲf GCAC Binding sites 40S eif3 La PTB (Py-1-3) hnrnp L NSAP1 mir122 Figure 3 The hepatitis C virus internal ribosome entry site. The hepatitis C virus (HCV) 5 untranslated region (UTR) is divided into four stem-loop domains and sub-domains [61]. The internal ribosome entry site (IRES) element is made up of approximately 340 nucleotides and spans domain Ⅱ and extends into the core-coding region encompassing a double pseudoknot fold [13,62-64]. The stem, loop and unpaired regions are all important in interaction with host factors. The HCV IRES can directly recruit the 40S ribosomal subunit before association with eukaryotic translation factor (eif)2 and eif3 to form the 43S pre-initiation complex [35,65]. Structural and biochemical studies have indicated an unusually vast binding site for the ribosome encompassing domains Ⅱ, Ⅲ and Ⅳ and conformational changes in both the 40S ribosomal subunit and the IRES have been observed upon their interaction [66]. Binding between the IRES and the ribosome is thought to be mediated via ribosomal proteins although the role of RNA-RNA interaction cannot be excluded [67-69]. eif3 can bind both the ribosome and junction domain Ⅲabc and domain Ⅲb. The ternary complex eif2αguanosine triphosphate (GTP)-the trna for the first methionine ( Met trnai) does not directly bind the IRES, rather it forms a ternary complex with eif3 and the 40S ribosomal subunit to position Met trnai directly onto the AUG codon in the P-site of the ribosome [70]. A number of non-canonical host factors are able to bind the HCV IRES and likely play a facilitating role in IRES translation. However, there is evidence for a critical role of the La autoantigen in IRES translation, by binding to and altering the conformation of the IRES to orchestrate assembly of the ribosomal complex [82,83]. NS: Non-structural. the highly conserved nature of the IRES [93] ; (2) the distinctive mode of translation making it likely to produce an anti-viral with a high therapeutic index [94] ; and (3) the use of cellular targets making it less ready to select for resistant mutants. HCV IRES activity can also be modulated by the viral proteins core, NS2/3, NS3 and NS5A and the 3 UTR [95-100]. A long range interaction between the IRES and the 3 UTR is thought to be essential for IRES activity [101]. However, it is still unclear what constitutes the bona fide ITAFs and how they regulate HCV IRES activity, in particular under stress. OXIDATIVE STRESS IN HEPATITIS C Accumulation of reactive oxygen species (ROS) and the generation of oxidative stress are implicated in the development of a number of inflammatory diseases, including viral hepatitis [102]. Chronic hepatitis C patients present elevated blood and hepatic levels of pro-oxidants, reduced anti-oxidants levels, iron overload with increased lipid peroxidation, decreased hepatic glutathione and increased oxidative DNA damage [ ]. Proteomic and microarray analysis of liver biopsies revealed increased oxidative stress in hepatitis C samples [109,110]. Important ROS include superoxide anion O2.-, H2O2 and hydroxyl radical. OH. ROS exist in every cell as part of the by-products of active respiration in the mitochondria (Figure 4) [111]. ROS are harmful to cells as they will cause oxidative damage to intracellular macromolecules and are eliminated by anti-oxidant enzymes such as superoxide dismutase, catalase and the glutathione system to maintain redox balance (Figure 4). A low level of ROS, in particular H2O2, is however, important mediator of cellular signal transduction pathways [111,112]. A high level of ROS is important in fighting infections [113]. Immune recognition of infected cells triggers the release of ROS from sequestered phagocytes and activated macrophages. Endogenous ROS are also produced as a direct result of hepatitis C viral replication and interactions of a number of hepatitis C viral proteins with the host cell, as evidenced by studying infected cultured cells and ectopically expressed viral proteins (core, NS3 or NS5A) in cultured hepatocytes, monocytes and isolated mitochondria [6-12,114,115]. This is supported by data from in vivo studies. Transgenic mice carrying the structural proteins exhibited elevated levels of ROS and were more susceptible to oxidant injury [10]. Infection of a SCID/Alb/ upa chimeric mouse (mouse with chimeric human and mouse liver) also revealed increased oxidative stress in infected hepatocytes [116]. It has recently been shown that the NAD(P)H oxidases, Nox1 and Nox4, are two of the endogenous ROS sources in HCV-infected cultured cells and liver samples [117,118]. EVASION OF OXIDATIVE DEFENCE-HCV AND OTHERS ROS are lethal to pathogens. How do pathogens coun March 21, 2014 Volume 20 Issue 11

71 Chan SW. Oxidative stress-activated IRES translation Mitochondria Xanthine oxidase NADPH oxidase Superoxide dismutase Fenton reaction Fe 2+ Fe 3+ e- e- O2 O2.- H2O2 e- e-. OH H2O e- e- e- e- Catalase glutathione peroxidases Peroxiredoxins H2O Figure 4 Oxidant and anti-oxidant systems. During active respiration in the mitochondria, electron leaked from the respiratory chain reacts with oxygen (O2) to form reactive oxygen species (ROS) superoxide anion O2.- and pro-oxidant-hydrogen peroxide (H2O2). O2.- is quickly dismuted to H2O2 in a reaction catalyzed by superoxide dismutase. Non-mitochondrial sources of O2.- and H2O2 include cytosolic xanthine oxidase and plasma membrane nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. H2O2 is decomposed by iron in the Fenton reaction to yield the highly oxidizing hydroxyl radical. OH, causing macromolecule damage, DNA damage and lipid peroxidation. H2O2 can be reduced to water (H2O) by catalase, glutathione peroxidases and peroxiredoxins. teract the damaging effects of ROS? Bacteria do it at the transcriptional level as they normally do. Some bacteria such as Escherichia coli and Salmonella typhimurium can sense and counteract oxidative stress by inducing transcription of response genes from the OxyR regulon [119,120]. Viruses, being obligatory intracellular parasites with limited genomic capacity, exploit different strategies to suit their life style. The poxvirus molluscum contagiosum virus has a large DNA genome thus is capable of encoding their own anti-oxidant protein to become resistant to the cytotoxic effect of H2O2 [121,122]. HCV is a small RNA virus with a limited genomic capacity. There is no evidence that HCV encodes an anti-oxidant protein. This has led us to speculate that HCV deploys a different strategy to evade the host oxidative defence. Instead of counteracting oxidative stress, it utilizes oxidative stress to facilitate its own survival. This would be advantageous to the virus because it persists as a chronic infection. Precedence can be found in human immunodeficiency virus (HIV), which also establishes a chronic infection and has been associated with increased oxidative stress in HIV patients [123]. HIV replication was facilitated by ROS via activation of the transcription factors nuclear factorkappa B and hypoxia inducible factor 1 alpha to stimulate gene expression from the HIV long terminal repeat [ ]. The effect of ROS on HCV replication is inconclusive, as opposing results were obtained from laboratory studies (most likely due to the use of different pro-oxidants and HCV expression systems) although some clinical studies and anti-oxidants trials do support a stimulatory role of ROS on HCV replication [17, ]. Translation is the first step in the replication of a plus strand RNA virus so it would make sense if the virus can exploit the host oxidative defence in facilitating this very first step. Indeed, we have previously shown that H2O2 stimulates translation from the HCV IRES [14]. Amongst viruses, HCV and HIV infections are commonly associated with elevated oxidative stress in patients, meaning that the viruses are continuously exposed to oxidative stress [123]. Coincidentally, they both cause chronic infections and translation from their IRESs is both upregulated by H2O2, suggesting that the viruses can adapt to and utilize oxidative stress to their own advantage [14,138]. Amongst cellular IRESs, translation from the IRESs of nuclear factor erythroid-2 related factor 2 (Nrf2) and ferritin is stimulated by pro-oxidants [ ]. Coincidentally, these proteins are both involved in restoring redox balance, suggesting that upregulation of IRES translation could be a homeostatic response to oxidative stress. Nrf2 is the coordinator of the anti-oxidant response to oxidative stress and translation from its IRES was stimulated by H2O2 [139,141]. Ferritin sequesters excess iron from catalyzing the Fenton reaction that leads to the production of free radicals and translation from the ferritin IRES was activated by iron (Figure 4) [140]. A protective response to oxidative stress was also mediated by IRES translation in a pathological setting of ischaemic insults [142]. A rapid rise in the level of H2O2 damaged the neuron but at the same time, conferred neuroprotection to ischaemic insults by stimulating translation from the Sp1 IRES. Altogether these results suggest that one of the adaptive responses to oxidative stress could be at the level of translation and that an IRES is being deployed to achieve this. It is interesting to see whether viruses co-opted a homeostatic cellular IRES in their counter-defence against oxidative stress or vice versa March 21, 2014 Volume 20 Issue 11

72 Chan SW. Oxidative stress-activated IRES translation persistent infection. + eif2a GTP eif2a Met trnai GTP + 40s ribosome eif2a GTP eif2a GDP GDP 40S ribosome GTP eif2b mrna Figure 5 Delivery of Met trnai to the ribosome. Eukaryotic translation factor (eif)2α forms a ternary complex with guanosine triphosphate (GTP) and the trna for the first methionine ( Met trnai) to deliver Met trnai to the 40S ribosomal subunit. Following hydrolysis of GTP to guanosine diphosphate (GDP), the eif2α-gdp complex leaves the ribosome. GDP is converted to GTP in an exchange reaction catalyzed by the exchanger eif2b. eif2α-gtp can then be recycled for more ternary complex formation with Met trnai to continue translation initiation. When eif2α is phosphorylated at Serine-51 (red), it inhibits eif2b. Thus GDP cannot be exchanged for GTP and protein synthesis is arrested at this step. Will all viruses possessing an IRES element be capable of taking advantage of oxidative stress to increase their replication rate? IRES is present in all members of the Picornaviridae family including poliovirus, rhinovirus (common cold), encephalomyocarditis virus, foot-andmouth disease virus and hepatitis A virus [143]. Picornavirus IRESs are divided into Type I-V based on structural and functional similarity [144]. Type Ⅳ IRES is grouped with IRESs from the two genera Hepacivirus and Pestivirus of the Flaviviridae family (here known as HCV-like IRES), leading to the speculation that HCV acquired an IRES element from picornavirus in the distant past by recombination [143,145]. This may explain why IRES is not a common feature of the Flaviviridae family and is absent from the genus Flavivirus. IRESs have also been found in some retroviruses and DNA viruses establishing chronic/latent infections such as HIV and Kaposi s sarcoma-associated herpesvirus [138,146]. It is interesting to see whether responsiveness to oxidative stress is a function preserved in all HCV-like IRESs regardless of whether they establish an acute or chronic infection or it is a function evolved with MECHANISMS OF IRES TRANSLATION UNDER OXIDATIVE STRESS CONDITION How then could an IRES facilitate an adaptive oxidative response? All protein synthesis relies on eif2α to deliver Met trnai to the 40S ribosomal subunit by forming a ternary complex eif2α-gtp- Met trnai (Figure 5) [147]. Following hydrolysis of GTP to GDP, the eif2α- GDP complex leaves the ribosome. GDP is converted to GTP in an exchange reaction catalyzed by the exchanger eif2b, allowing eif2α-gtp to be recycled for more complex formation with Met trnai to continue translation initiation. Phosphorylation of eif2α at Serine-51 (Ser-51) inhibits eif2b, thus arresting protein synthesis at the step of GDP-GTP exchange. To date four mammalian eif2α kinases have been known. They are the RNA-activated protein kinase (PKR), PKR-like ER eif2α kinase (PERK), heme-regulated inhibitor of translation (HRI) and the mammalian homologue of yeast eif2α kinase general control nonderepressible 2 (GCN2) [ ]. These kinases share similarity in their kinase domains but differ in their regulatory domains allowing them to respond to distinct stress stimuli whilst phosphorylating eif2α at the identical residue Ser-51. PKR is specifically activated by ds-rna during virus infections; PERK is specifically activated by ER stress; HRI is specifically activated by heme deficiency in erythroid cells primarily involved in the regulation of haemoglobin synthesis whereas GCN2 is specifically activated by amino acid starvation. We have shown that H2O2 is also a stress signal to induce phosphorylation of eif2α although currently we do not have evidence to suggest which of the four mammalian kinases is operating in our system [14]. All of the four kinases have been shown to be the eif2α kinase under different oxidative stress conditions and in different cell types: HRI in arsenite-induced oxidative stress; GCN2 in UV-irradiation-induced oxidative stress and PKR and PERK in H2O2-stimulated osteoblastoma and HEK293 cells [ ]. It is equally possible that oxidative stress-induced eif2α phosphorylation is a result of inhibition of a phosphatase rather than activation of a kinase [157]. Little is known of how Met trnai is delivered to maintain IRES translation under oxidative stress condition, when eif2α is phosphorylated. So the question will be under this condition what is used to deliver Met trnai? Although many eifs are dispensable for IRES-mediated translation, almost all still rely on eif2α to deliver Met trnai, thus are sensitive to the inhibitory effect of phospho-eif2α. The HCV IRES is no exception. Under non-stressed condition, translation from the HCV IRES is still dependent on eif2α to deliver Met trnai [ ]. However, some IRESs can evade this critical step of translational control and allow them to maintain translation under conditions that would otherwise inhibit protein synthesis. First, instead of downregulation by phospho-eif2α, translation from select viral and cellular 2791 March 21, 2014 Volume 20 Issue 11

73 Chan SW. Oxidative stress-activated IRES translation IRESs is actually upregulated by phospho-eif2α [ ]. The exact mechanism of how phospho-eif2α upregulates select IRES translation is unclear. Regarding HCV, there is no evidence that translation from the HCV IRES is upregulated by phospho-eif2α, either under stress conditions that induce phosphorylation of eif2α or by ectopic expression of a phospho-mimetic eif2α-sd (substitution of Ser-51 with Aspartate-51 which mimics the structure of phospho-eif2α) [14,164,165]. Secondly, a minority of IRESs does not require any eifs for translation. The cricket paralysis virus intergenic IRES simply folds to mimic the function of Met trnai [166]. The HCV IRES can also operate without eif. However, this factor-less translation was performed under in vitro condition, using a non-physiological high concentration of Mg 2+[167]. It is not known whether the HCV IRES can operate in an eif-less mode of translation in vivo. Thirdly, IRES translation can switch from eif2-dependent to eif2- independent mode of translation under stress conditions or during virus infections that induce phosphorylation of eif2α. Translation from the poliovirus IRES during early phase of infection was dependent on eif2α but was independent of eif2α during late phase of infection and this eif2-independence was assisted by the viral 2A protease [168]. HCV infection also induces phosphorylation of eif2α [169]. Translation from the HCV, classical swine fever virus (CSFV) and the cellular XIAP IRESs was resistant to the inhibitory effect of eif2α phosphorylation by switching from eif2-dependent to eif2-independent mode of translation, using alternative eif such as eif5b, eif2a or eif2d/ligatin to deliver Met trnai [ , ]. It remains to be seen which mechanisms operate to deliver Met trnai in IRES translation under oxidative stress condition. However, the use of an eif2-independent mode of translation simply allows translation to operate at a lower efficiency when the more efficient canonical eif2αdependent pathway is inhibited [158,160]. The HCV IRES behaves in a very different way under oxidative stress condition in that translation is not only maintained, but is actually upregulated, suggesting a different or additional way of regulation under oxidative stress condition [14,174]. This is similar to the HIV and Nrf2 IRESs, in which translation is stimulated by oxidative stress [ ,141]. Thus far two mechanisms have been proposed by which oxidative stress stimulates IRES translation, both of which involve ITAF, stressing the importance of ITAF in translational regulation during oxidative stress. A positive regulatory mechanism A positive regulatory mechanism in which oxidative stress stimulates IRES translation by increasing cytoplasmic level of ITAF, either by promoting its cytoplasmic shuttling or by one of the mechanisms mentioned above. An example can be seen in the Nrf2 IRES. H2O2 stimulated Nrf2 IRES translation by increasing shuttling of its ITAF, La, to the cytoplasm [141]. In this case, the H2O2-responsive element has been mapped to a region responsible for both basal and H2O2-induced IRES activity [139]. A derepression mechanism This is similar to the positive regulatory mechanism in which oxidative stress stimulates IRES translation by increasing cytoplasmic level of ITAF. However, in this case, the IRES activity is normally repressed by being locked into a weakly active conformation by a repressor protein. Oxidative stress induces eif2α phosphorylation to shut down global protein synthesis including that of the repressor. As the repressor level drops, oxidative stress increases the cytoplasmic level of an activator ITAF, either by promoting its cytoplasmic shuttling or by one of the mechanisms mentioned above. The release of the repressor allows binding of the activator ITAF to induce a conformational change in the IRES to activate translation. In this case, the H2O2-responsive element has been mapped to a negatively regulating domain that inhibits basal IRES translation. An example can be found in the HIV IRES, although in this case the repressor and activator ITAFs have yet to be identified to support this derepression hypothesis [138]. As for HCV, we currently do not have evidence to suggest how H2O2 activates IRES translation. However, others have found that iron stimulates translation from the HCV IRES, via upregulation of eif3 and La mrnas [175,176]. Iron catalyzes the Fenton reaction in the conversion of H2O2 into the highly oxidizing and damaging. OH (Figure 4) [111]. Thus iron promotes oxidative stress and iron overload is frequent in HCV patients [105]. Although these studies did not show a direct correlation between oxidative stress and IRES translation, they provide an indication of how this might work and the similarity with the two proposed mechanisms in that they all involve an ITAF. Further work will be required to dissect the mechanisms of how H2O2 activates translation from the HCV IRES. Still exactly how oxidative stress stimulates IRES translation is far from clear. Despite collectively known as IRES, each IRES is unique in terms of sequence, structure, use of eif and ITAF, mechanism of translation and response to stress. Cellular IRESs are distinctly different from viral IRESs in that they are naturally capped, flatter and for most, depend on short motif rather than overall structure to function [38,39]. HIV-a retrovirus-has a capped mrna which is translated by a cap-dependent mechanism under normal circumstances [177]. For HIV and some cellular genes, IRES-mediated translation serves as an alternative mechanism of translation under stress conditions [138]. In contrast, when IRES-mediated translation represents the main (sole) mechanism of translation in RNA viruses such as picornavirus and HCV the mrnas are uncapped [38]. Thus it is anticipated that the mechanisms used to respond to oxidative stress would be as diverse as the IRES itself. QUASISPECIES /INTRA-HOST IRES VARIANTS IMPACT ON OXIDATIVE RESPONSIVENESS AND PERSISTENCE HCV genome exhibits a high degree of sequence varia March 21, 2014 Volume 20 Issue 11

74 Chan SW. Oxidative stress-activated IRES translation tion, with > 30% difference between genotypes and 20%-25% between sub-types [178]. Due to structural constraint, the 5 UTR (which contains the IRES element) is the most conserved region, but substitutions along the IRES region are common amongst genotypes, sub-types and even quasispecies /intra-host variants [93,179]. Substitutions have been mapped to the stem, loop and unpaired regions [36,180,181]. Most of the substitutions in the stem regions are co-variants thus preserving the structural integrity of the IRES element. A minority of substitutions in the stem regions results in loss of base-pairing and alteration in IRES structure and hence function. Substitutions mapped to the loop or unpaired regions are important as well, as they may contain binding sites for the ribosomal subunit, eif3 and ITAFs [36,182,183]. Therefore, despite being a highly conserved region, slight alteration in the IRES sequence can have a profound effect on basal IRES translation and responsiveness to stresses. The efficiency of genotypic IRESs has been compared in various studies. IRESs from some genotypes or sub-types were more efficient in mediating basal translation (i.e., under nonstressed condition), however, the results are not consistent across studies, most probably due to the use of different IRES regions in their studies and the existence of intra-genotypic variation in the IRES sequences used in different studies [ ]. Indeed, substitutions are commonly found in closely related IRES sequences isolated from a single patient and some of these substitutions impacted a substantial change in the translational efficiency, highlighting the fact that HCV exists as a swarm of variants each with slightly different IRES sequence and structure hence efficiency in basal translation and responsiveness to stresses/ifn [187]. It is well known that genotype is a determining factor in patients response to IFN treatment. Comparison of IRESs from six genotypes did not reveal any differences in their translational responsiveness to IFN, however, IRESs isolated from sustained responders of genotype 3a patients had lower translation efficiencies than that from non-responders and were more prone to IFN inhibition [188,189]. Other studies also identified marked differences in the distribution of substitutions between sustained responder and non-responder IRESs and between pre-treatment and post-treatment IRESs in non-responders, regardless of genotypes [ ]. These results further emphasize the significance of intra-host IRES variants in determining stress/ifn responsiveness. Variation in IRES sequence can also have an effect on virus replication via two mechanisms. First, as many of the translated proteins are required for virus replication, a change in the translation efficiency can alter the availability of proteins involved in virus replication. Second, the antisense IRES contains the promoter for the plus strand synthesis in virus replication, thus variation in IRES sequence can affect the rate of replication [194,195]. It is therefore interesting to see whether intra-host variation in IRES sequence will also result in a swarm of variants with different degrees of replication efficiencies under oxidative stress condition. This may also explain why opposing results were obtained regarding the effects of ROS on HCV replication [17, ]. Therefore, studies with viruses with high sequence variability such as HIV and HCV have been complicated by the existence of a population of intra-host variants in each patient. The collective response of this population of intra-host variants will ultimately determine the response to oxidative stress and outcome of infection (persistence). CONCLUSION HCV establishes a chronic infection [1]. To survive in a harsh environment the virus needs to deploy a number of machinery to evade the host anti-viral responses, one of which is oxidative stress [113]. H2O2 induces phosphorylation of eif2α resulting in inhibition of global (including that of viral) protein synthesis and constitutes an important defence against virus infection [14]. Possession of an IRES element enables some viral and cellular genes to continue protein synthesis when the majority of protein synthesis is inhibited by phosphorylation of eif2α, by means of (1) a phospho-eif2α-dependent mechanism [ ] ; (2) an eif-less mechanism [166,167] ; and (3) an eif2α- independent mechanism [ ,168, ]. At present, there is no evidence to suggest which mechanism is operating to enable translation from the HCV IRES to proceed when eif2α is phosphorylated by H2O2 [14]. Thus far studies on other IRESs have led to the proposal of a positive regulatory and a derepression mechanism, both involving H2O2-responsive ITAF, such as the La autoantigen, implicating a pivotal role of ITAF in H2O2-regulated IRES translation [ ,141]. HCV IRES appears to belong to a class of IRESs that is translationally upregulated by H2O2 [14, ]. This category of IRESs includes a number of cellular IRESs that orchestrate the anti-oxidants response and IRESs from viruses that establish chronic infections in a highly oxidative environment. It is interesting to see whether viruses co-opted a cellular homeostatic IRES or it is an inherent property of the viral IRES in the facilitation of a persistent infection. HCV exhibits a high degree of sequence variability [178]. One must therefore take into consideration the collective response of a swarm of intra-host variants, each with different IRES structure and function and hence different translation and replication efficiencies under oxidative stress condition and, as a functional unit, will ultimately determine how well the virus can survive a highly oxidative environment in the process leading to persistence. ACKNOWLEDGMENTS Thanks must go to Paul MacCallum, Samantha Jack, Philip Egan and Benjamin McDermott, without their work, it will not be possible to write this review article. I would also like to thank the anonymous reviewers for their critical comments March 21, 2014 Volume 20 Issue 11

75 Chan SW. Oxidative stress-activated IRES translation REFERENCES 1 Hajarizadeh B, Grebely J, Dore GJ. Epidemiology and natural history of HCV infection. Nat Rev Gastroenterol Hepatol 2013; 10: [PMID: DOI: /nrgastro ] 2 Scheel TK, Rice CM. Understanding the hepatitis C virus life cycle paves the way for highly effective therapies. Nat Med 2013; 19: [PMID: DOI: /nm.3248] 3 Bowen DG, Walker CM. Adaptive immune responses in acute and chronic hepatitis C virus infection. Nature 2005; 436: [PMID: DOI: /nature04079] 4 Gale M, Foy EM. Evasion of intracellular host defence by hepatitis C virus. Nature 2005; 436: [PMID: DOI: /nature04078] 5 Horner SM, Gale M. Regulation of hepatic innate immunity by hepatitis C virus. Nat Med 2013; 19: [PMID: DOI: /nm.3253] 6 Toro F, Conesa A, Garcia A, Bianco NE, De Sanctis JB. Increased peroxide production by polymorphonuclear cells of chronic hepatitis C virus-infected patients. Clin Immunol Immunopathol 1998; 88: [PMID: DOI: / clin ] 7 Bureau C, Bernad J, Chaouche N, Orfila C, Béraud M, Gonindard C, Alric L, Vinel JP, Pipy B. Nonstructural 3 protein of hepatitis C virus triggers an oxidative burst in human monocytes via activation of NADPH oxidase. J Biol Chem 2001; 276: [PMID: DOI: /jbc. M ] 8 Gong G, Waris G, Tanveer R, Siddiqui A. Human hepatitis C virus NS5A protein alters intracellular calcium levels, induces oxidative stress, and activates STAT-3 and NF-kappa B. Proc Natl Acad Sci USA 2001; 98: [PMID: DOI: /pnas ] 9 Korenaga M, Wang T, Li Y, Showalter LA, Chan T, Sun J, Weinman SA. Hepatitis C virus core protein inhibits mitochondrial electron transport and increases reactive oxygen species (ROS) production. J Biol Chem 2005; 280: [PMID: DOI: /jbc.M ] 10 Moriya K, Nakagawa K, Santa T, Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Miyazawa T, Ishibashi K, Horie T, Imai K, Todoroki T, Kimura S, Koike K. Oxidative stress in the absence of inflammation in a mouse model for hepatitis C virus-associated hepatocarcinogenesis. Cancer Res 2001; 61: [PMID: ] 11 Okuda M, Li K, Beard MR, Showalter LA, Scholle F, Lemon SM, Weinman SA. Mitochondrial injury, oxidative stress, and antioxidant gene expression are induced by hepatitis C virus core protein. Gastroenterology 2002; 122: [PMID: DOI: /gast ] 12 Qadri I, Iwahashi M, Capasso JM, Hopken MW, Flores S, Schaack J, Simon FR. Induced oxidative stress and activated expression of manganese superoxide dismutase during hepatitis C virus replication: role of JNK, p38 MAPK and AP-1. Biochem J 2004; 378: [PMID: DOI: / BJ ] 13 Tsukiyama-Kohara K, Iizuka N, Kohara M, Nomoto A. Internal ribosome entry site within hepatitis C virus RNA. J Virol 1992; 66: [PMID: ] 14 MacCallum PR, Jack SC, Egan PA, McDermott BT, Elliott RM, Chan SW. Cap-dependent and hepatitis C virus internal ribosome entry site-mediated translation are modulated by phosphorylation of eif2alpha under oxidative stress. J Gen Virol 2006; 87: [PMID: DOI: / vir ] 15 Farias MS, Budni P, Ribeiro CM, Parisotto EB, Santos CE, Dias JF, Dalmarco EM, Fröde TS, Pedrosa RC, Wilhelm Filho D. Antioxidant supplementation attenuates oxidative stress in chronic hepatitis C patients. Gastroenterol Hepatol 2012; 35: [PMID: DOI: / j.gastrohep ] 16 Gane EJ, Weilert F, Orr DW, Keogh GF, Gibson M, Lockhart MM, Frampton CM, Taylor KM, Smith RA, Murphy MP. The mitochondria-targeted anti-oxidant mitoquinone decreases liver damage in a phase II study of hepatitis C patients. Liver Int 2010; 30: [PMID: DOI: / j x] 17 Melhem A, Stern M, Shibolet O, Israeli E, Ackerman Z, Pappo O, Hemed N, Rowe M, Ohana H, Zabrecky G, Cohen R, Ilan Y. Treatment of chronic hepatitis C virus infection via antioxidants: results of a phase I clinical trial. J Clin Gastroenterol 2005; 39: [PMID: DOI: /01. mcg ] 18 Simmonds P. The origin of hepatitis C virus. Curr Top Microbiol Immunol 2013; 369: 1-15 [PMID: DOI: / _1] 19 Lindenbach BD, Rice CM. Unravelling hepatitis C virus replication from genome to function. Nature 2005; 436: [PMID: DOI: /nature04077] 20 Simmonds P, Alberti A, Alter HJ, Bonino F, Bradley DW, Brechot C, Brouwer JT, Chan SW, Chayama K, Chen DS. A proposed system for the nomenclature of hepatitis C viral genotypes. Hepatology 1994; 19: [PMID: DOI: /hep ] 21 Simmonds P, Bukh J, Combet C, Deléage G, Enomoto N, Feinstone S, Halfon P, Inchauspé G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 2005; 42: [PMID: DOI: / hep.20819] 22 Lauring AS, Andino R. Quasispecies theory and the behavior of RNA viruses. PLoS Pathog 2010; 6: e [PMID: DOI: /journal.ppat ] 23 Holmes EC. Does hepatitis C virus really form quasispecies? Infect Genet Evol 2010; 10: [PMID: DOI: /j.meegid ] 24 Chan SW, McOmish F, Holmes EC, Dow B, Peutherer JF, Follett E, Yap PL, Simmonds P. Analysis of a new hepatitis C virus type and its phylogenetic relationship to existing variants. J Gen Virol 1992; 73 (Pt 5): [PMID: DOI: / ] 25 Simmonds P, McOmish F, Yap PL, Chan SW, Lin CK, Dusheiko G, Saeed AA, Holmes EC. Sequence variability in the 5 non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. J Gen Virol 1993; 74 ( Pt 4): [PMID: DOI: / ] 26 Parsons J, Castaldi MP, Dutta S, Dibrov SM, Wyles DL, Hermann T. Conformational inhibition of the hepatitis C virus internal ribosome entry site RNA. Nat Chem Biol 2009; 5: [PMID: DOI: /nchembio.217] 27 Prabhu R, Garry RF, Dash S. Small interfering RNA targeted to stem-loop II of the 5 untranslated region effectively inhibits expression of six HCV genotypes. Virol J 2006; 3: 100 [PMID: ] 28 Dever TE. Translation initiation: adept at adapting. Trends Biochem Sci 1999; 24: [PMID: DOI: / S (99) ] 29 Pestova TV, Kolupaeva VG, Lomakin IB, Pilipenko EV, Shatsky IN, Agol VI, Hellen CU. Molecular mechanisms of translation initiation in eukaryotes. Proc Natl Acad Sci USA 2001; 98: [PMID: DOI: / pnas ] 30 Holcik M, Sonenberg N, Korneluk RG. Internal ribosome initiation of translation and the control of cell death. Trends Genet 2000; 16: [PMID: DOI: / S (00) ] 31 Jang SK. Internal initiation: IRES elements of picornavi March 21, 2014 Volume 20 Issue 11

76 Chan SW. Oxidative stress-activated IRES translation ruses and hepatitis c virus. Virus Res 2006; 119: 2-15 [PMID: DOI: /j.virusres ] 32 Vagner S, Galy B, Pyronnet S. Irresistible IRES. Attracting the translation machinery to internal ribosome entry sites. EMBO Rep 2001; 2: [PMID: DOI: / embo-reports/kve208] 33 Kieft JS, Zhou K, Jubin R, Murray MG, Lau JY, Doudna JA. The hepatitis C virus internal ribosome entry site adopts an ion-dependent tertiary fold. J Mol Biol 1999; 292: [PMID: DOI: /jmbi ] 34 Lyons AJ, Lytle JR, Gomez J, Robertson HD. Hepatitis C virus internal ribosome entry site RNA contains a tertiary structural element in a functional domain of stem-loop II. Nucleic Acids Res 2001; 29: [PMID: DOI: /nar/ ] 35 Otto GA, Puglisi JD. The pathway of HCV IRES-mediated translation initiation. Cell 2004; 119: [PMID: DOI: /j.cell ] 36 Tang S, Collier AJ, Elliott RM. Alterations to both the primary and predicted secondary structure of stem-loop IIIc of the hepatitis C virus 1b 5 untranslated region (5 UTR) lead to mutants severely defective in translation which cannot be complemented in trans by the wild-type 5 UTR sequence. J Virol 1999; 73: [PMID: ] 37 Jackson RJ. Alternative mechanisms of initiating translation of mammalian mrnas. Biochem Soc Trans 2005; 33: [PMID: DOI: /BST ] 38 Plank TD, Kieft JS. The structures of nonprotein-coding RNAs that drive internal ribosome entry site function. Wiley Interdiscip Rev RNA 2012; 3: [PMID: DOI: /wrna.1105] 39 Baird SD, Lewis SM, Turcotte M, Holcik M. A search for structurally similar cellular internal ribosome entry sites. Nucleic Acids Res 2007; 35: [PMID: DOI: /nar/gkm483] 40 Chappell SA, Edelman GM, Mauro VP. A 9-nt segment of a cellular mrna can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc Natl Acad Sci USA 2000; 97: [PMID: DOI: /pnas ] 41 Chappell SA, Edelman GM, Mauro VP. Biochemical and functional analysis of a 9-nt RNA sequence that affects translation efficiency in eukaryotic cells. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: / pnas ] 42 Xia X, Holcik M. Strong eukaryotic IRESs have weak secondary structure. PLoS One 2009; 4: e4136 [PMID: DOI: /journal.pone ] 43 Spriggs KA, Bushell M, Mitchell SA, Willis AE. Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ 2005; 12: [PMID: DOI: /sj.cdd ] 44 Pilipenko EV, Pestova TV, Kolupaeva VG, Khitrina EV, Poperechnaya AN, Agol VI, Hellen CU. A cell cycle-dependent protein serves as a template-specific translation initiation factor. Genes Dev 2000; 14: [PMID: ] 45 Bonnal S, Boutonnet C, Prado-Lourenço L, Vagner S. IRESdb: the Internal Ribosome Entry Site database. Nucleic Acids Res 2003; 31: [PMID: DOI: /nar/ gkg003] 46 Henis-Korenblit S, Shani G, Sines T, Marash L, Shohat G, Kimchi A. The caspase-cleaved DAP5 protein supports internal ribosome entry site-mediated translation of death proteins. Proc Natl Acad Sci USA 2002; 99: [PMID: DOI: /pnas ] 47 Anderson EC, Hunt SL, Jackson RJ. Internal initiation of translation from the human rhinovirus-2 internal ribosome entry site requires the binding of Unr to two distinct sites on the 5 untranslated region. J Gen Virol 2007; 88: [PMID: DOI: /vir ] 48 Damiano F, Rochira A, Tocci R, Alemanno S, Gnoni A, Siculella L. hnrnp A1 mediates the activation of the IRESdependent SREBP-1a mrna translation in response to endoplasmic reticulum stress. Biochem J 2013; 449: [PMID: DOI: /BJ ] 49 Durie D, Lewis SM, Liwak U, Kisilewicz M, Gorospe M, Holcik M. RNA-binding protein HuR mediates cytoprotection through stimulation of XIAP translation. Oncogene 2011; 30: [PMID: DOI: /onc ] 50 Evans JR, Mitchell SA, Spriggs KA, Ostrowski J, Bomsztyk K, Ostarek D, Willis AE. Members of the poly (rc) binding protein family stimulate the activity of the c-myc internal ribosome entry segment in vitro and in vivo. Oncogene 2003; 22: [PMID: DOI: /sj.onc ] 51 Holcík M, Gordon BW, Korneluk RG. The internal ribosome entry site-mediated translation of antiapoptotic protein XIAP is modulated by the heterogeneous nuclear ribonucleoproteins C1 and C2. Mol Cell Biol 2003; 23: [PMID: DOI: /MCB ] 52 Verma B, Bhattacharyya S, Das S. Polypyrimidine tractbinding protein interacts with coxsackievirus B3 RNA and influences its translation. J Gen Virol 2010; 91: [PMID: DOI: /vir ] 53 Lewis SM, Veyrier A, Hosszu Ungureanu N, Bonnal S, Vagner S, Holcik M. Subcellular relocalization of a trans-acting factor regulates XIAP IRES-dependent translation. Mol Biol Cell 2007; 18: [PMID: DOI: /mbc. E ] 54 Warnakulasuriyarachchi D, Cerquozzi S, Cheung HH, Holcík M. Translational induction of the inhibitor of apoptosis protein HIAP2 during endoplasmic reticulum stress attenuates cell death and is mediated via an inducible internal ribosome entry site element. J Biol Chem 2004; 279: [PMID: DOI: /jbc.M ] 55 Back SH, Kim YK, Kim WJ, Cho S, Oh HR, Kim JE, Jang SK. Translation of polioviral mrna is inhibited by cleavage of polypyrimidine tract-binding proteins executed by polioviral 3C(pro). J Virol 2002; 76: [PMID: DOI: /jvi ] 56 Shiroki K, Isoyama T, Kuge S, Ishii T, Ohmi S, Hata S, Suzuki K, Takasaki Y, Nomoto A. Intracellular redistribution of truncated La protein produced by poliovirus 3Cpro-mediated cleavage. J Virol 1999; 73: [PMID: ] 57 Sella O, Gerlitz G, Le SY, Elroy-Stein O. Differentiationinduced internal translation of c-sis mrna: analysis of the cis elements and their differentiation-linked binding to the hnrnp C protein. Mol Cell Biol 1999; 19: [PMID: ] 58 Tinton SA, Schepens B, Bruynooghe Y, Beyaert R, Cornelis S. Regulation of the cell-cycle-dependent internal ribosome entry site of the PITSLRE protein kinase: roles of Unr (upstream of N-ras) protein and phosphorylated translation initiation factor eif-2alpha. Biochem J 2005; 385: [PMID: DOI: /BJ ] 59 Lewis SM, Holcik M. For IRES trans-acting factors, it is all about location. Oncogene 2008; 27: [PMID: DOI: /sj.onc ] 60 Cammas A, Pileur F, Bonnal S, Lewis SM, Lévêque N, Holcik M, Vagner S. Cytoplasmic relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation initiation of specific mrnas. Mol Biol Cell 2007; 18: [PMID: DOI: /mbc.E ] 61 Fraser CS, Doudna JA. Structural and mechanistic insights into hepatitis C viral translation initiation. Nat Rev Microbiol 2007; 5: [PMID: DOI: /nrmicro1558] 62 Berry KE, Waghray S, Mortimer SA, Bai Y, Doudna JA. Crystal structure of the HCV IRES central domain reveals strategy for start-codon positioning. Structure 2011; 19: [PMID: DOI: /j.str ] 63 Reynolds JE, Kaminski A, Carroll AR, Clarke BE, Rowlands 2795 March 21, 2014 Volume 20 Issue 11

77 Chan SW. Oxidative stress-activated IRES translation DJ, Jackson RJ. Internal initiation of translation of hepatitis C virus RNA: the ribosome entry site is at the authentic initiation codon. RNA 1996; 2: [PMID: ] 64 Wang C, Le SY, Ali N, Siddiqui A. An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5 noncoding region. RNA 1995; 1: [PMID: ] 65 Pestova TV, Shatsky IN, Fletcher SP, Jackson RJ, Hellen CU. A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs. Genes Dev 1998; 12: [PMID: DOI: /gad ] 66 Spahn CM, Kieft JS, Grassucci RA, Penczek PA, Zhou K, Doudna JA, Frank J. Hepatitis C virus IRES RNA-induced changes in the conformation of the 40s ribosomal subunit. Science 2001; 291: [PMID: DOI: / science ] 67 Fukushi S, Okada M, Stahl J, Kageyama T, Hoshino FB, Katayama K. Ribosomal protein S5 interacts with the internal ribosomal entry site of hepatitis C virus. J Biol Chem 2001; 276: [PMID: DOI: /jbc. C ] 68 Hertz MI, Landry DM, Willis AE, Luo G, Thompson SR. Ribosomal protein S25 dependency reveals a common mechanism for diverse internal ribosome entry sites and ribosome shunting. Mol Cell Biol 2013; 33: [PMID: DOI: /MCB ] 69 Malygin AA, Shatsky IN, Karpova GG. Proteins of the human 40S ribosomal subunit involved in hepatitis C IRES binding as revealed from fluorescent labeling. Biochemistry (Mosc) 2013; 78: [PMID: DOI: /S ] 70 Ji H, Fraser CS, Yu Y, Leary J, Doudna JA. Coordinated assembly of human translation initiation complexes by the hepatitis C virus internal ribosome entry site RNA. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: /pnas ] 71 Ali N, Siddiqui A. Interaction of polypyrimidine tract-binding protein with the 5 noncoding region of the hepatitis C virus RNA genome and its functional requirement in internal initiation of translation. J Virol 1995; 69: [PMID: ] 72 Ali N, Siddiqui A. The La antigen binds 5 noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation. Proc Natl Acad Sci USA 1997; 94: [PMID: DOI: /pnas ] 73 Anwar A, Ali N, Tanveer R, Siddiqui A. Demonstration of functional requirement of polypyrimidine tract-binding protein by SELEX RNA during hepatitis C virus internal ribosome entry site-mediated translation initiation. J Biol Chem 2000; 275: [PMID: DOI: /jbc.M ] 74 Gosert R, Chang KH, Rijnbrand R, Yi M, Sangar DV, Lemon SM. Transient expression of cellular polypyrimidine-tract binding protein stimulates cap-independent translation directed by both picornaviral and flaviviral internal ribosome entry sites In vivo. Mol Cell Biol 2000; 20: [PMID: DOI: /MCB ] 75 Hahm B, Kim YK, Kim JH, Kim TY, Jang SK. Heterogeneous nuclear ribonucleoprotein L interacts with the 3 border of the internal ribosomal entry site of hepatitis C virus. J Virol 1998; 72: [PMID: ] 76 Kim JH, Paek KY, Ha SH, Cho S, Choi K, Kim CS, Ryu SH, Jang SK. A cellular RNA-binding protein enhances internal ribosomal entry site-dependent translation through an interaction downstream of the hepatitis C virus polyprotein initiation codon. Mol Cell Biol 2004; 24: [PMID: DOI: /MCB ] 77 Hwang B, Lim JH, Hahm B, Jang SK, Lee SW. hnrnp L is required for the translation mediated by HCV IRES. Biochem Biophys Res Commun 2009; 378: [PMID: DOI: /j.bbrc ] 78 Paek KY, Kim CS, Park SM, Kim JH, Jang SK. RNA-binding protein hnrnp D modulates internal ribosome entry sitedependent translation of hepatitis C virus RNA. J Virol 2008; 82: [PMID: DOI: /JVI ] 79 Park SM, Paek KY, Hong KY, Jang CJ, Cho S, Park JH, Kim JH, Jan E, Jang SK. Translation-competent 48S complex formation on HCV IRES requires the RNA-binding protein NSAP1. Nucleic Acids Res 2011; 39: [PMID: DOI: /nar/gkr509] 80 Rivas-Aravena A, Ramdohr P, Vallejos M, Valiente-Echeverría F, Dormoy-Raclet V, Rodríguez F, Pino K, Holzmann C, Huidobro-Toro JP, Gallouzi IE, López-Lastra M. The Elavlike protein HuR exerts translational control of viral internal ribosome entry sites. Virology 2009; 392: [PMID: DOI: /j.virol ] 81 Roberts AP, Lewis AP, Jopling CL. mir-122 activates hepatitis C virus translation by a specialized mechanism requiring particular RNA components. Nucleic Acids Res 2011; 39: [PMID: ] 82 Costa-Mattioli M, Svitkin Y, Sonenberg N. La autoantigen is necessary for optimal function of the poliovirus and hepatitis C virus internal ribosome entry site in vivo and in vitro. Mol Cell Biol 2004; 24: [PMID: ] 83 Pudi R, Srinivasan P, Das S. La protein binding at the GCAC site near the initiator AUG facilitates the ribosomal assembly on the hepatitis C virus RNA to influence internal ribosome entry site-mediated translation. J Biol Chem 2004; 279: [PMID: DOI: /jbc.M ] 84 Petz M, Them N, Huber H, Beug H, Mikulits W. La enhances IRES-mediated translation of laminin B1 during malignant epithelial to mesenchymal transition. Nucleic Acids Res 2012; 40: [PMID: DOI: /nar/gkr717] 85 Ray PS, Das S. La autoantigen is required for the internal ribosome entry site-mediated translation of Coxsackievirus B3 RNA. Nucleic Acids Res 2002; 30: [PMID: DOI: /nar/gkf583] 86 Kim YK, Back SH, Rho J, Lee SH, Jang SK. La autoantigen enhances translation of BiP mrna. Nucleic Acids Res 2001; 29: [PMID: DOI: /nar/ ] 87 Kim YK, Jang SK. La protein is required for efficient translation driven by encephalomyocarditis virus internal ribosomal entry site. J Gen Virol 1999; 80 ( Pt 12): [PMID: ] 88 Ali N, Pruijn GJ, Kenan DJ, Keene JD, Siddiqui A. Human La antigen is required for the hepatitis C virus internal ribosome entry site-mediated translation. J Biol Chem 2000; 275: [PMID: ] 89 Holcik M, Korneluk RG. Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation. Mol Cell Biol 2000; 20: [PMID: DOI: /MCB ] 90 Bayfield MA, Yang R, Maraia RJ. Conserved and divergent features of the structure and function of La and La-related proteins (LARPs). Biochim Biophys Acta 2010; 1799: [PMID: DOI: /j.bbagrm ] 91 Lindop R, Arentz G, Thurgood LA, Reed JH, Jackson MW, Gordon TP. Pathogenicity and proteomic signatures of autoantibodies to Ro and La. Immunol Cell Biol 2012; 90: [PMID: DOI: /icb ] 92 Pudi R, Abhiman S, Srinivasan N, Das S. Hepatitis C virus internal ribosome entry site-mediated translation is stimulated by specific interaction of independent regions of human La autoantigen. J Biol Chem 2003; 278: [PMID: DOI: /jbc.M ] 93 Simmonds P. Genetic diversity and evolution of hepatitis C virus--15 years on. J Gen Virol 2004; 85: [PMID: DOI: /vir ] 2796 March 21, 2014 Volume 20 Issue 11

78 Chan SW. Oxidative stress-activated IRES translation 94 Dasgupta A, Das S, Izumi R, Venkatesan A, Barat B. Targeting internal ribosome entry site (IRES)-mediated translation to block hepatitis C and other RNA viruses. FEMS Microbiol Lett 2004; 234: [PMID: ] 95 Boni S, Lavergne JP, Boulant S, Cahour A. Hepatitis C virus core protein acts as a trans-modulating factor on internal translation initiation of the viral RNA. J Biol Chem 2005; 280: [PMID: DOI: /jbc.M ] 96 Kalliampakou KI, Kalamvoki M, Mavromara P. Hepatitis C virus (HCV) NS5A protein downregulates HCV IRESdependent translation. J Gen Virol 2005; 86: [PMID: DOI: /vir ] 97 She Y, Han T, Ye L, Wu Z. Hepatitis C virus NS2/3 protease regulates HCV IRES-dependent translation and NS5B RdRp activity. Arch Virol 2009; 154: [PMID: DOI: /s ] 98 She Y, Liao Q, Chen X, Ye L, Wu Z. Hepatitis C virus (HCV) NS2 protein up-regulates HCV IRES-dependent translation and down-regulates NS5B RdRp activity. Arch Virol 2008; 153: [PMID: DOI: / s ] 99 Bung C, Bochkaeva Z, Terenin I, Zinovkin R, Shatsky IN, Niepmann M. Influence of the hepatitis C virus 3 -untranslated region on IRES-dependent and cap-dependent translation initiation. FEBS Lett 2010; 584: [PMID: DOI: /j.febslet ] 100 Song Y, Friebe P, Tzima E, Jünemann C, Bartenschlager R, Niepmann M. The hepatitis C virus RNA 3 -untranslated region strongly enhances translation directed by the internal ribosome entry site. J Virol 2006; 80: [PMID: DOI: /JVI ] 101 Romero-López C, Berzal-Herranz A. A long-range RNA- RNA interaction between the 5 and 3 ends of the HCV genome. RNA 2009; 15: [PMID: DOI: /rna ] 102 Schwarz KB. Oxidative stress during viral infection: a review. Free Radic Biol Med 1996; 21: [PMID: DOI: / (96) ] 103 Fujita N, Sugimoto R, Ma N, Tanaka H, Iwasa M, Kobayashi Y, Kawanishi S, Watanabe S, Kaito M, Takei Y. Comparison of hepatic oxidative DNA damage in patients with chronic hepatitis B and C. J Viral Hepat 2008; 15: [PMID: DOI: /j x] 104 Konishi M, Iwasa M, Araki J, Kobayashi Y, Katsuki A, Sumida Y, Nakagawa N, Kojima Y, Watanabe S, Adachi Y, Kaito M. Increased lipid peroxidation in patients with nonalcoholic fatty liver disease and chronic hepatitis C as measured by the plasma level of 8-isoprostane. J Gastroenterol Hepatol 2006; 21: [PMID: ] Venturini D, Simão AN, Barbosa DS, Lavado EL, Narciso VE, Dichi I, Dichi JB. Increased oxidative stress, decreased total antioxidant capacity, and iron overload in untreated patients with chronic hepatitis C. Dig Dis Sci 2010; 55: [PMID: DOI: /s ] 106 Yoshida Y, Imai Y, Sawai Y, Saito Y, Cao J, Fukuda K, Niki E. Hydroxyoctadecadienoic acid as a potential biomarker for oxidative stress in patients with chronic hepatitis C. J Gastroenterol Hepatol 2010; 25: [PMID: DOI: /j x] 107 De Maria N, Colantoni A, Fagiuoli S, Liu GJ, Rogers BK, Farinati F, Van Thiel DH, Floyd RA. Association between reactive oxygen species and disease activity in chronic hepatitis C. Free Radic Biol Med 1996; 21: [PMID: DOI: / (96) ] 108 Paradis V, Kollinger M, Fabre M, Holstege A, Poynard T, Bedossa P. In situ detection of lipid peroxidation by-products in chronic liver diseases. Hepatology 1997; 26: [PMID: DOI: /hep ] 109 Yamashita T, Kaneko S, Hashimoto S, Sato T, Nagai S, Toyoda N, Suzuki T, Kobayashi K, Matsushima K. Serial analysis of gene expression in chronic hepatitis C and hepatocellular carcinoma. Biochem Biophys Res Commun 2001; 282: [PMID: DOI: /bbrc ] 110 Diamond DL, Jacobs JM, Paeper B, Proll SC, Gritsenko MA, Carithers RL, Larson AM, Yeh MM, Camp DG, Smith RD, Katze MG. Proteomic profiling of human liver biopsies: hepatitis C virus-induced fibrosis and mitochondrial dysfunction. Hepatology 2007; 46: [PMID: DOI: /hep.21751] 111 Bindoli A, Rigobello MP. Principles in redox signaling: from chemistry to functional significance. Antioxid Redox Signal 2013; 18: [PMID: DOI: / ars ] 112 Veal EA, Day AM, Morgan BA. Hydrogen peroxide sensing and signaling. Mol Cell 2007; 26: 1-14 [PMID: DOI: /j.molcel ] 113 Nathan C, Cunningham-Bussel A. Beyond oxidative stress: an immunologist s guide to reactive oxygen species. Nat Rev Immunol 2013; 13: [PMID: DOI: / nri3423] 114 Pal S, Polyak SJ, Bano N, Qiu WC, Carithers RL, Shuhart M, Gretch DR, Das A. Hepatitis C virus induces oxidative stress, DNA damage and modulates the DNA repair enzyme NEIL1. J Gastroenterol Hepatol 2010; 25: [PMID: DOI: /j x] 115 Blackham S, Baillie A, Al-Hababi F, Remlinger K, You S, Hamatake R, McGarvey MJ. Gene expression profiling indicates the roles of host oxidative stress, apoptosis, lipid metabolism, and intracellular transport genes in the replication of hepatitis C virus. J Virol 2010; 84: [PMID: DOI: /JVI ] 116 Joyce MA, Walters KA, Lamb SE, Yeh MM, Zhu LF, Kneteman N, Doyle JS, Katze MG, Tyrrell DL. HCV induces oxidative and ER stress, and sensitizes infected cells to apoptosis in SCID/Alb-uPA mice. PLoS Pathog 2009; 5: e [PMID: DOI: /journal.ppat ] 117 Boudreau HE, Emerson SU, Korzeniowska A, Jendrysik MA, Leto TL. Hepatitis C virus (HCV) proteins induce NADPH oxidase 4 expression in a transforming growth factor betadependent manner: a new contributor to HCV-induced oxidative stress. J Virol 2009; 83: [PMID: DOI: /JVI ] 118 de Mochel NS, Seronello S, Wang SH, Ito C, Zheng JX, Liang TJ, Lambeth JD, Choi J. Hepatocyte NAD(P)H oxidases as an endogenous source of reactive oxygen species during hepatitis C virus infection. Hepatology 2010; 52: [PMID: DOI: /hep.23671] 119 Imlay JA. The molecular mechanisms and physiological consequences of oxidative stress: lessons from a model bacterium. Nat Rev Microbiol 2013; 11: [PMID: DOI: /nrmicro3032] 120 Storz G, Tartaglia LA, Ames BN. Transcriptional regulator of oxidative stress-inducible genes: direct activation by oxidation. Science 1990; 248: [PMID: DOI: /science ] 121 McFadden G. Even viruses can learn to cope with stress. Science 1998; 279: [PMID: DOI: /science ] 122 Shisler JL, Senkevich TG, Berry MJ, Moss B. Ultravioletinduced cell death blocked by a selenoprotein from a human dermatotropic poxvirus. Science 1998; 279: [PMID: DOI: /science ] 123 Stehbens WE. Oxidative stress in viral hepatitis and AIDS. Exp Mol Pathol 2004; 77: [PMID: DOI: /j.yexmp ] 124 Deshmane SL, Amini S, Sen S, Khalili K, Sawaya BE. Regulation of the HIV-1 promoter by HIF-1α and Vpr proteins. Virol J 2011; 8: 477 [PMID: ] 125 Pyo CW, Yang YL, Yoo NK, Choi SY. Reactive oxygen species activate HIV long terminal repeat via post-translational 2797 March 21, 2014 Volume 20 Issue 11

79 Chan SW. Oxidative stress-activated IRES translation control of NF-kappaB. Biochem Biophys Res Commun 2008; 376: [PMID: DOI: /j.bbrc ] 126 Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J 1991; 10: [PMID: ] 127 Choi J, Lee KJ, Zheng Y, Yamaga AK, Lai MM, Ou JH. Reactive oxygen species suppress hepatitis C virus RNA replication in human hepatoma cells. Hepatology 2004; 39: [PMID: DOI: /hep.20001] 128 Grønbaek K, Sonne J, Ring-Larsen H, Poulsen HE, Friis H, Bygum Krarup H. Viral load is a negative predictor of antioxidant levels in hepatitis C patients. Scand J Infect Dis 2005; 37: [PMID: DOI: / ] 129 Waris G, Turkson J, Hassanein T, Siddiqui A. Hepatitis C virus (HCV) constitutively activates STAT-3 via oxidative stress: role of STAT-3 in HCV replication. J Virol 2005; 79: [PMID: DOI: /JVI ] 130 Fillebeen C, Pantopoulos K. Iron inhibits replication of infectious hepatitis C virus in permissive Huh7.5.1 cells. J Hepatol 2010; 53: [PMID: DOI: / j.jhep ] 131 Kuroki M, Ariumi Y, Ikeda M, Dansako H, Wakita T, Kato N. Arsenic trioxide inhibits hepatitis C virus RNA replication through modulation of the glutathione redox system and oxidative stress. J Virol 2009; 83: [PMID: DOI: /JVI ] 132 Lehmann E, El-Tantawy WH, Ocker M, Bartenschlager R, Lohmann V, Hashemolhosseini S, Tiegs G, Sass G. The heme oxygenase 1 product biliverdin interferes with hepatitis C virus replication by increasing antiviral interferon response. Hepatology 2010; 51: [PMID: ] 133 Rivas-Estilla AM, Bryan-Marrugo OL, Trujillo-Murillo K, Pérez-Ibave D, Charles-Niño C, Pedroza-Roldan C, Ríos- Ibarra C, Ramírez-Valles E, Ortiz-López R, Islas-Carbajal MC, Nieto N, Rincón-Sánchez AR. Cu/Zn superoxide dismutase (SOD1) induction is implicated in the antioxidative and antiviral activity of acetylsalicylic acid in HCV-expressing cells. Am J Physiol Gastrointest Liver Physiol 2012; 302: G1264-G1273 [PMID: DOI: /ajpgi ] 134 McCartney EM, Semendric L, Helbig KJ, Hinze S, Jones B, Weinman SA, Beard MR. Alcohol metabolism increases the replication of hepatitis C virus and attenuates the antiviral action of interferon. J Infect Dis 2008; 198: [PMID: DOI: /593216] 135 Seronello S, Ito C, Wakita T, Choi J. Ethanol enhances hepatitis C virus replication through lipid metabolism and elevated NADH/NAD+. J Biol Chem 2010; 285: [PMID: DOI: /jbc.M ] 136 Yano M, Ikeda M, Abe K, Kawai Y, Kuroki M, Mori K, Dansako H, Ariumi Y, Ohkoshi S, Aoyagi Y, Kato N. Oxidative stress induces anti-hepatitis C virus status via the activation of extracellular signal-regulated kinase. Hepatology 2009; 50: [PMID: DOI: /hep.23026] 137 McCartney EM, Helbig KJ, Narayana SK, Eyre NS, Aloia AL, Beard MR. Signal transducer and activator of transcription 3 is a proviral host factor for hepatitis C virus. Hepatology 2013; 58: [PMID: DOI: /hep.26496] 138 Gendron K, Ferbeyre G, Heveker N, Brakier-Gingras L. The activity of the HIV-1 IRES is stimulated by oxidative stress and controlled by a negative regulatory element. Nucleic Acids Res 2011; 39: [PMID: DOI: /nar/ gkq885] 139 Li W, Thakor N, Xu EY, Huang Y, Chen C, Yu R, Holcik M, Kong AN. An internal ribosomal entry site mediates redoxsensitive translation of Nrf2. Nucleic Acids Res 2010; 38: [PMID: DOI: /nar/gkp1048] 140 Daba A, Koromilas AE, Pantopoulos K. Alternative ferritin mrna translation via internal initiation. RNA 2012; 18: [PMID: DOI: /rna ] 141 Zhang J, Dinh TN, Kappeler K, Tsaprailis G, Chen QM. La autoantigen mediates oxidant induced de novo Nrf2 protein translation. Mol Cell Proteomics 2012; 11: M [PMID: DOI: /mcp.M ] 142 Yeh SH, Yang WB, Gean PW, Hsu CY, Tseng JT, Su TP, Chang WC, Hung JJ. Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxideactivated internal ribosomal entry site pathway. Nucleic Acids Res 2011; 39: [PMID: DOI: / nar/gkr161] 143 Belsham GJ. Divergent picornavirus IRES elements. Virus Res 2009; 139: [PMID: DOI: / j.virusres ] 144 Sweeney TR, Dhote V, Yu Y, Hellen CU. A distinct class of internal ribosomal entry site in members of the Kobuvirus and proposed Salivirus and Paraturdivirus genera of the Picornaviridae. J Virol 2012; 86: [PMID: DOI: /JVI ] 145 Hellen CU, de Breyne S. A distinct group of hepacivirus/ pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination. J Virol 2007; 81: [PMID: DOI: / JVI ] 146 Bieleski L, Hindley C, Talbot SJ. A polypyrimidine tract facilitates the expression of Kaposi s sarcoma-associated herpesvirus vflip through an internal ribosome entry site. J Gen Virol 2004; 85: [PMID: DOI: / vir ] 147 Proud CG. eif2 and the control of cell physiology. Semin Cell Dev Biol 2005; 16: 3-12 [PMID: DOI: / j.semcdb ] 148 Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 1999; 397: [PMID: DOI: /16729] 149 Sood R, Porter AC, Olsen DA, Cavener DR, Wek RC. A mammalian homologue of GCN2 protein kinase important for translational control by phosphorylation of eukaryotic initiation factor-2alpha. Genetics 2000; 154: [PMID: ] 150 Williams BR. PKR; a sentinel kinase for cellular stress. Oncogene 1999; 18: [PMID: DOI: / sj.onc ] 151 Chen JJ, London IM. Regulation of protein synthesis by hemeregulated eif-2 alpha kinase. Trends Biochem Sci 1995; 20: [PMID: DOI: /S (00) ] 152 Jiang HY, Wek RC. GCN2 phosphorylation of eif2alpha activates NF-kappaB in response to UV irradiation. Biochem J 2005; 385: [PMID: DOI: / BJ ] 153 Mouton-Liger F, Paquet C, Dumurgier J, Bouras C, Pradier L, Gray F, Hugon J. Oxidative stress increases BACE1 protein levels through activation of the PKR-eIF2α pathway. Biochim Biophys Acta 2012; 1822: [PMID: DOI: /j.bbadis ] 154 Pyo CW, Choi JH, Oh SM, Choi SY. Oxidative stress-induced cyclin D1 depletion and its role in cell cycle processing. Biochim Biophys Acta 2013; 1830: [PMID: ] 155 Lu L, Han AP, Chen JJ. Translation initiation control by heme-regulated eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses. Mol Cell Biol 2001; 21: [PMID: ] 156 McEwen E, Kedersha N, Song B, Scheuner D, Gilks N, Han A, Chen JJ, Anderson P, Kaufman RJ. Heme-regulated inhibitor kinase-mediated phosphorylation of eukaryotic translation initiation factor 2 inhibits translation, induces stress granule formation, and mediates survival upon arsenite exposure. J Biol Chem 2005; 280: [PMID: ] 2798 March 21, 2014 Volume 20 Issue 11

80 Chan SW. Oxidative stress-activated IRES translation 157 O Loghlen A, Pérez-Morgado MI, Salinas M, Martín ME. Reversible inhibition of the protein phosphatase 1 by hydrogen peroxide. Potential regulation of eif2 alpha phosphorylation in differentiated PC12 cells. Arch Biochem Biophys 2003; 417: [PMID: DOI: /S (03) ] 158 Kim JH, Park SM, Park JH, Keum SJ, Jang SK. eif2a mediates translation of hepatitis C viral mrna under stress conditions. EMBO J 2011; 30: [PMID: DOI: /emboj ] 159 Pestova TV, de Breyne S, Pisarev AV, Abaeva IS, Hellen CU. eif2-dependent and eif2-independent modes of initiation on the CSFV IRES: a common role of domain II. EMBO J 2008; 27: [PMID: DOI: /emboj ] 160 Terenin IM, Dmitriev SE, Andreev DE, Shatsky IN. Eukaryotic translation initiation machinery can operate in a bacterial-like mode without eif2. Nat Struct Mol Biol 2008; 15: [PMID: DOI: /nsmb.1445] 161 Fernandez J, Bode B, Koromilas A, Diehl JA, Krukovets I, Snider MD, Hatzoglou M. Translation mediated by the internal ribosome entry site of the cat-1 mrna is regulated by glucose availability in a PERK kinase-dependent manner. J Biol Chem 2002; 277: [PMID: DOI: /jbc.M ] 162 Fernandez J, Yaman I, Sarnow P, Snider MD, Hatzoglou M. Regulation of internal ribosomal entry site-mediated translation by phosphorylation of the translation initiation factor ei- F2alpha. J Biol Chem 2002; 277: [PMID: DOI: /jbc.M ] 163 Gerlitz G, Jagus R, Elroy-Stein O. Phosphorylation of initiation factor-2 alpha is required for activation of internal translation initiation during cell differentiation. Eur J Biochem 2002; 269: [PMID: DOI: / j x] 164 Choi SY, Scherer BJ, Schnier J, Davies MV, Kaufman RJ, Hershey JW. Stimulation of protein synthesis in COS cells transfected with variants of the alpha-subunit of initiation factor eif-2. J Biol Chem 1992; 267: [PMID: ] 165 Chan SW, Egan PA. Effects of hepatitis C virus envelope glycoprotein unfolded protein response activation on translation and transcription. Arch Virol 2009; 154: [PMID: DOI: /s ] 166 Jan E, Kinzy TG, Sarnow P. Divergent trna-like element supports initiation, elongation, and termination of protein biosynthesis. Proc Natl Acad Sci USA 2003; 100: [PMID: DOI: /pnas ] 167 Lancaster AM, Jan E, Sarnow P. Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site. RNA 2006; 12: [PMID: DOI: /rna ] 168 Redondo N, Sanz MA, Welnowska E, Carrasco L. Translation without eif2 promoted by poliovirus 2A protease. PLoS One 2011; 6: e25699 [PMID: DOI: /journal. pone ] 169 Garaigorta U, Chisari FV. Hepatitis C virus blocks interferon effector function by inducing protein kinase R phosphorylation. Cell Host Microbe 2009; 6: [PMID: DOI: /j.chom ] 170 Dmitriev SE, Terenin IM, Andreev DE, Ivanov PA, Dunaevsky JE, Merrick WC, Shatsky IN. GTP-independent trna delivery to the ribosomal P-site by a novel eukaryotic translation factor. J Biol Chem 2010; 285: [PMID: DOI: /jbc.M ] 171 Robert F, Kapp LD, Khan SN, Acker MG, Kolitz S, Kazemi S, Kaufman RJ, Merrick WC, Koromilas AE, Lorsch JR, Pelletier J. Initiation of protein synthesis by hepatitis C virus is refractory to reduced eif2.gtp.met-trna(i)(met) ternary complex availability. Mol Biol Cell 2006; 17: [PMID: DOI: /mbc.E ] 172 Skabkin MA, Skabkina OV, Dhote V, Komar AA, Hellen CU, Pestova TV. Activities of Ligatin and MCT-1/DENR in eukaryotic translation initiation and ribosomal recycling. Genes Dev 2010; 24: [PMID: DOI: /gad ] 173 Thakor N, Holcik M. IRES-mediated translation of cellular messenger RNA operates in eif2α- independent manner during stress. Nucleic Acids Res 2012; 40: [PMID: DOI: /nar/gkr701] 174 Jack SC, Chan SW. The role of PERK and GCN2 in basal and hydrogen peroxide-regulated translation from the hepatitis C virus internal ribosome entry site. Virus Genes 2011; 43: [PMID: DOI: /s ] 175 Cho H, Lee HC, Jang SK, Kim YK. Iron increases translation initiation directed by internal ribosome entry site of hepatitis C virus. Virus Genes 2008; 37: [PMID: DOI: /s ] 176 Wang Q, Liu Y, An D, Diao H, Xu W, He X, Sun R, Wei L, Li L. Regulation of hepatitis C virus translation initiation by iron: role of eif3 and La protein. Virus Res 2012; 167: [PMID: DOI: /j.virusres ] 177 de Breyne S, Soto-Rifo R, López-Lastra M, Ohlmann T. Translation initiation is driven by different mechanisms on the HIV-1 and HIV-2 genomic RNAs. Virus Res 2013; 171: [PMID: DOI: /j.virusres ] 178 Kuiken C, Simmonds P. Nomenclature and numbering of the hepatitis C virus. Methods Mol Biol 2009; 510: [PMID: ] 179 Soler M, Pellerin M, Malnou CE, Dhumeaux D, Kean KM, Pawlotsky JM. Quasispecies heterogeneity and constraints on the evolution of the 5 noncoding region of hepatitis C virus (HCV): relationship with HCV resistance to interferonalpha therapy. Virology 2002; 298: [PMID: DOI: /viro ] 180 Honda M, Beard MR, Ping LH, Lemon SM. A phylogenetically conserved stem-loop structure at the 5 border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation. J Virol 1999; 73: [PMID: ] 181 Odreman-Macchioli FE, Tisminetzky SG, Zotti M, Baralle FE, Buratti E. Influence of correct secondary and tertiary RNA folding on the binding of cellular factors to the HCV IRES. Nucleic Acids Res 2000; 28: [PMID: DOI: /nar/ ] 182 Barría MI, González A, Vera-Otarola J, León U, Vollrath V, Marsac D, Monasterio O, Pérez-Acle T, Soza A, López-Lastra M. Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation. Nucleic Acids Res 2009; 37: [PMID: DOI: /nar/ gkn1022] 183 Zhang J, Yamada O, Ito T, Akiyama M, Hashimoto Y, Yoshida H, Makino R, Masago A, Uemura H, Araki H. A single nucleotide insertion in the 5 -untranslated region of hepatitis C virus leads to enhanced cap-independent translation. Virology 1999; 261: [PMID: DOI: / viro ] 184 Buratti E, Gerotto M, Pontisso P, Alberti A, Tisminetzky SG, Baralle FE. In vivo translational efficiency of different hepatitis C virus 5 -UTRs. FEBS Lett 1997; 411: [PMID: DOI: /S (97) ] 185 Honda M, Rijnbrand R, Abell G, Kim D, Lemon SM. Natural variation in translational activities of the 5 nontranslated RNAs of hepatitis C virus genotypes 1a and 1b: evidence for a long-range RNA-RNA interaction outside of the internal ribosomal entry site. J Virol 1999; 73: [PMID: ] 186 Collier AJ, Tang S, Elliott RM. Translation efficiencies of the 5 untranslated region from representatives of the six major genotypes of hepatitis C virus using a novel bicistronic reporter assay system. J Gen Virol 1998; 79 (Pt 10): [PMID: ] 187 Laporte J, Malet I, Andrieu T, Thibault V, Toulme JJ, Wy March 21, 2014 Volume 20 Issue 11

81 Chan SW. Oxidative stress-activated IRES translation chowski C, Pawlotsky JM, Huraux JM, Agut H, Cahour A. Comparative analysis of translation efficiencies of hepatitis C virus 5 untranslated regions among intraindividual quasispecies present in chronic infection: opposite behaviors depending on cell type. J Virol 2000; 74: [PMID: DOI: /JVI ] 188 Hazari S, Patil A, Joshi V, Sullivan DE, Fermin CD, Garry RF, Elliott RM, Dash S. Alpha interferon inhibits translation mediated by the internal ribosome entry site of six different hepatitis C virus genotypes. J Gen Virol 2005; 86: [PMID: DOI: /vir ] 189 Yasmeen A, Hamid S, Granath FN, Lindström H, Elliott RM, Siddiqui AA, Persson MA. Correlation between translation efficiency and outcome of combination therapy in chronic hepatitis C genotype 3. J Viral Hepat 2006; 13: [PMID: DOI: /j x] 190 El Awady MK, Azzazy HM, Fahmy AM, Shawky SM, Badreldin NG, Yossef SS, Omran MH, Zekri AR, Goueli SA. Positional effect of mutations in 5 UTR of hepatitis C virus 4a on patients response to therapy. World J Gastroenterol 2009; 15: [PMID: DOI: / wjg ] 191 Ogata K, Kashiwagi T, Iwahashi J, Hara K, Honda H, Ide T, Kumashiro R, Kohara M, Sata M, Watanabe H, Hamada N. A mutational shift from domain III to II in the internal ribosome entry site of hepatitis C virus after interferon-ribavirin therapy. Arch Virol 2008; 153: [PMID: DOI: /s ] 192 Thelu MA, Drouet E, Hilleret MN, Zarski JP. Lack of clinical significance of variability in the internal ribosome entry site of hepatitis C virus. J Med Virol 2004; 72: [PMID: DOI: /jmv.20021] 193 Thélu MA, Leroy V, Ramzan M, Dufeu-Duchesne T, Marche P, Zarski JP. IRES complexity before IFN-alpha treatment and evolution of the viral load at the early stage of treatment in peripheral blood mononuclear cells from chronic hepatitis C patients. J Med Virol 2007; 79: [PMID: DOI: /jmv.20792] 194 Friebe P, Lohmann V, Krieger N, Bartenschlager R. Sequences in the 5 nontranslated region of hepatitis C virus required for RNA replication. J Virol 2001; 75: [PMID: DOI: /JVI ] 195 Masante C, Mahias K, Lourenço S, Dumas E, Cahour A, Trimoulet P, Fleury H, Astier-Gin T, Ventura M. Seven nucleotide changes characteristic of the hepatitis C virus genotype 3 5 untranslated region: correlation with reduced in vitro replication. J Gen Virol 2008; 89: [PMID: DOI: /vir ] P- Reviewers: Enjoji M, Faintuch J, Vaughan G S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2800 March 21, 2014 Volume 20 Issue 11

82 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Kidney transplantation from donors with hepatitis C infection TOPIC HIGHLIGHT Massimiliano Veroux, Daniela Corona, Nunziata Sinagra, Alessia Giaquinta, Domenico Zerbo, Burcin Ekser, Giuseppe Giuffrida, Pietro Caglià, Riccardo Gula, Vincenzo Ardita, Pierfrancesco Veroux Massimiliano Veroux, Daniela Corona, Nunziata Sinagra, Alessia Giaquinta, Domenico Zerbo, Burcin Ekser, Giuseppe Giuffrida, Pietro Caglià, Riccardo Gula, Vincenzo Ardita, Pierfrancesco Veroux, Vascular Surgery and Organ Transplant Unit, Department of Surgery, Transplantation and Advanced Technologies, University Hospital of Catania, Catania, Italy Author contributions: Veroux M and Ardita V wrote the paper; Veroux M, Corona D, Sinagra N, Gula R, Giaquinta A and Zerbo D collected the data; Ekser B, Giuffrida G and Caglià P analyzed the data; Veroux P gave the final approval to the article. Correspondence to: Massimiliano Veroux, MD, PhD, Vascular Surgery and Organ Transplant Unit, Department of Surgery, Transplantation and Advanced Technologies, University Hospital of Catania, Via Santa Sofia, 86, Catania, Italy. veroux@unict.it Telephone: Fax: Received: September 29, 2013 Revised: December 3, 2013 Accepted: January 2, 2014 Published online: March 21, 2014 long-term results, which may be affected by the progression of liver disease in the recipients. An accurate selection of both donor and recipient is mandatory to achieve a satisfactory long-term outcome Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Kidney transplantation; Deceased donor; Hepatitis C virus; De novo glomerulonephritis; Liver failure; Graft survival; End-stage renal disease; Hemodialysis Veroux M, Corona D, Sinagra N, Giaquinta A, Zerbo D, Ekser B, Giuffrida G, Caglià P, Gula R, Ardita V, Veroux P. Kidney transplantation from donors with hepatitis C infection. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: Abstract The increasing demand for organ donors to supply the increasing number of patients on kidney waiting lists has led to most transplant centers developing protocols that allow safe utilization from donors with special clinical situations which previously were regarded as contraindications. Deceased donors with previous hepatitis C infection may represent a safe resource to expand the donor pool. When allocated to serology-matched recipients, kidney transplantation from donors with hepatitis C may result in an excellent short-term outcome and a significant reduction of time on the waiting list. Special care must be dedicated to the pre-transplant evaluation of potential candidates, particularly with regard to liver functionality and evidence of liver histological damage, such as cirrhosis, that could be a contraindication to transplantation. Pre-transplant antiviral therapy could be useful to reduce the viral load and to improve the INTRODUCTION The increasing demand for available organ donors for kidney transplantation has led many transplant centers to expand their acceptance criteria by including deceased donors with special clinical situations, such as potentially transmittable infections. Kidney transplantation is nowadays considered the best replacement therapy for patients with end-stage renal disease (ESRD); therefore, there is a clear need to expand the current donor pool. One strategy focuses on the use of donor kidneys with viral hepatitis, and several organ procurement associations have adopted the policy of accepting kidneys from deceased donors with hepatitis C infection. Defining the natural history of hepatitis C infection in ESRD patients remains difficult for several reasons: 2801 March 21, 2014 Volume 20 Issue 11

83 Veroux M et al. Donors with hepatitis C the disease extends for many years, and the onset of the disease is frequently unknown [1]. Moreover, the infection is likely to be asymptomatic with an apparently indolent course. HCV infection has been estimated to occur in 7.8%-9.2% of the ESRD population, and fortunately its incidence is slowly declining all over the world [2-5]. ESRD patients have a relative risk of death between 1.41 and 1.78 [5-8], and a recent meta-analysis quantified the relative risk of death in ESRD patients with HCV infection as 1.57 [9]. The natural history of HCV infection in renal transplant recipients is not well known [10] : most transplant centers do not perform a liver biopsy before transplant and in addition, compared to those with normal renal function, ESRD patients with HCV have lower serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and albumin levels, lower viral loads (usually < 1 million copies/ml), and less hepatic steatosis [11-26]. Moreover, HCV-positive renal transplant recipients may have higher morbidity and mortality, making long-term consequences difficult to assess [1,26]. The presence of anti-hcv antibodies is an independent and significant risk factor for death and graft failure in renal transplant recipients [11], and many transplant centers have recently reported a lower graft and patient survival in HCV-positive recipients [2-5,8,12-25]. Multicenter surveys [17-19] have confirmed that HCV-seropositivity confers an additional risk for death in renal transplant recipients. There are several factors that may influence patient survival in HCV-seropositive patients: the progression of liver disease [25-27] (although all studies have not incorporated a liver biopsy in the pre-transplant work-up), the immunosuppressive therapy, the development of new-onset diabetes mellitus after transplantation, and the higher risk of cardiovascular disease [1]. However, the benefit in terms of survival advantage of renal transplantation in patients with HCV infection vs long-term dialysis has been demonstrated in many retrospective studies [23-25,28], and no studies have demonstrated a diminished survival after kidney transplantation, so that kidney transplantation should now be considered the treatment of choice for ESRD patients with HCV infection. HCV infection has a negative impact on the survival of ESRD patients due to the increased risk of cardiovascular events [8,9]. Although some studies have reported a high relative risk of death from liver disease of up to 5.79 [8], only a small proportion of deaths were attributable to liver disease (2%-14%) [8,9], probably because most patients die of other clinical conditions before the liver disease can progress to a clinically relevant disease. While survival is improved in this group of patients compared to HCV-infected patients with ESRD who do not undergo renal transplantation, debate in the literature continues as to the short- and long-term outcomes of patients with chronic HCV infection undergoing renal transplantation compared with ESRD patients without HCV infection who are transplanted. It is known that viral loads increase following renal transplantation (1.8- to 30.3-fold): in a recent retrospective study, Gentil Govantes et al [29] found that patients with active viral replication at the time of kidney transplantation had a significantly increased incidence of liver disease and reduced renal function. Moreover, active viral replication was an independent risk factor for post-transplant mortality and graft failure among HCV-positive recipients. The prevalence of diabetes mellitus is higher in HCVinfected patients post-transplant, and chronic HCV infection is associated with decreased patient and graft survival when compared with patients who are not infected with HCV [26,27]. Additionally, liver failure has been implicated as the cause of death in 8%-28% of renal transplant recipients in the long term [30], and death from hepatocellular carcinoma and cirrhosis was notably higher among hemodialysed patients who were HCV antibody-positive [9]. While short-term results are similar to those of patients who are not infected with HCV, data about the long-term outcome of HCV-infected kidney transplants showed a lower graft and patient survival among HCV recipients, with liver failure being the primary cause of death in these patients (10%-22%) [31,32]. KIDNEY TRANSPLANTATION FROM DECEASED HCV-POSITIVE DONORS The widely accepted opinion that HCV infection may be transmitted from donors with HCV infection with a frequency of 100% [33] has yielded the opinion that HCVpositive kidneys should not be transplanted. However, this policy could determine a discard of about 5% of organ donors, aggravating the organ shortage. A recent survey [7] demonstrated that in deceased donors in the United States between 1995 and 2009, HCV-positive kidneys were 2.60-times more likely to be discarded. Interestingly, only 29% of HCV-positive recipients received HCV-positive kidneys, and more than 50% of HCVpositive kidneys were discarded. Nowadays, many transplant centers have adopted the policy of accepting kidneys from HCV-positive organ donors for HCV-positive recipients, even if the safety of the use of kidneys from HCV-infected donors has not been fully elucidated [34-36]. Evidence suggests that outcomes of HCV-positive recipients who receive kidneys from HCV-positive donors are slightly worse than outcomes of HCV-positive recipients who receive a kidney from similar HCV-negative donors [7]. However, HCV-positive recipients who received HCV-positive kidneys have a significantly lower waiting time than their HCV-negative counterparts [7], with no adverse effects on short-term patient and graft survival [37-40]. Although some authors have advocated avoiding the use of HCV-positive kidneys in recipients older than 65 years due to the higher risk of infectious complications [3], there is no clear evidence that older age may have an impact on graft survival in patients receiving kidney transplantations from HCV-positive donors [40]. However, up to 20% of patients may have reactivation of the disease after transplantation [40], and the time to reactivation may be shorter in renal transplant recipi March 21, 2014 Volume 20 Issue 11

84 Veroux M et al. Donors with hepatitis C ents of HCV-positive kidneys. The clinical importance of HCV reactivation following kidney transplantation from HCV-positive donors is controversial and, although some studies demonstrated a higher rate of liver disease in recipients of HCV-positive kidneys compared to recipients of HCV-negative recipients, graft survival was not different between the two groups [41-43]. While kidney transplantation confers a significant advantage in terms of patient survival in ESRD patients with HCV infection when compared to maintenance hemodialysis, donor HCV serologic status is independently associated with an increased risk of mortality [44]. Abbott et al [45] evaluated United States Renal Data System (USRDS) Medicare beneficiaries awaiting kidney transplantation and demonstrated that transplantation from HCV-positive donors is associated with improved survival when compared with patients on the waiting list, although this advantage was not as substantial as transplantation from all deceased donors. However, a recent survey by Kucirka et al [7] showed that kidney transplantation from HCV-positive donors was associated with 1.29-times increase in the risk of death; this was reflected in a difference of only 1% in 1-year survival and 2% in 3-year survival. In a recent study, Morales et al [43] compared 162 kidney transplant recipients receiving a graft from an HCVpositive donor with 306 receiving a kidney graft from an HCV-negative donor: five- and ten-year patient survival was 84.8% and 72.7%, respectively, in the group of patients receiving a graft from an HCV-positive donor vs 86.6% and 76.5% in recipients of an HCV-negative graft (P = 0.250). Five- and ten-year graft survival was not statistically different between the two groups. Decompensated liver disease rate was also not significantly different between the two groups (10.3% vs 6.2%). A historical cohort study of deceased United States adult donor renal transplant recipients over a 5-year period from 1996 to 2001 demonstrated that receiving an HCV(+) donor kidney was independently associated with increased mortality, primarily as a result of non- HCV infection, presumably due to the theory that acute HCV infection places transplant patients at risk for overimmunosuppression as a direct inhibitory effect of HCV on T-cell function [46]. Recent evidence has suggested that kidney transplantations from HCV-positive donors may have a worse graft outcome when compared with HCV-negative recipients [8,47-49], and eradication of HCV infection before transplantation seems to reduce the risk for HCV-associated renal dysfunction after transplantation and may reduce the risk for HCV disease progression, thereby providing the rationale for treatment of HCV before transplantation. The issue of transplanting kidneys from HCV-positive organ donors into anti-hcv positive/hcv RNA negative recipients has not been fully addressed: in a retrospective study, Morales et al [50] demonstrated a higher rate of viral reactivation among anti-hcv positive/hcv RNA negative recipients who received a kidney from an anti-hcv positive donor. Based on these findings, many transplant centers adopted the policy of transplanting kidneys from anti-hcv positive donors into HCV RNA positive recipients, restricting the use of HCV-positive donors to recipients with active viremia [1,40]. The use of organs from viremic HCV-positive donors into HCV- RNA negative recipients would have the effect of reintroducing HCV infection, whereas using HCV-positive kidneys in HCV RNA positive recipients can determine a superinfection with a different genotype [1], with many severe clinical consequences. Ideally, donors and recipients should be matched for HCV genotype to minimize the risk of superinfection, even if this procedure is rarely performed during a deceased donor evaluation. Organs from HCV-RNA positive donors should be offered only to viremic recipients or even discarded, due to the high rate of viral reactivation after transplantation [40]. However, a large multicenter trial demonstrated that the type of genotype might not have a significant impact on survival among patients with ESRD, since the survival in patients with mixed infection was similar to that of patients with a single HCV infection [51]. PRE-TRANSPLANT EVALUATION AND TREATMENT All kidney transplant candidates undergo a full evaluation of serologic markers, including anti-hcv serology. In dialysis patients with chronic HCV infection, serum aminotransferase levels are not reliable in determining disease activity and fibrosis severity, and uremic patients may be more likely than non-uremic patients to have persistently normal serum aminotransferase levels. Therefore, the presence of persistently normal serum aminotransferase levels does not exclude the presence of significant liver disease [52]. While recent observations suggest that liver biopsy is not useful in anti-hcv positive/hcv-rna negative patients [53], all anti-hcv positive ESRD patients should undergo an HCV-RNA evaluation, and all HCV-RNA positive patients should undergo a liver biopsy (Figure 1). The information obtained from liver biopsy is mandatory in the decision making for acceptance of an anti- HCV positive ESRD patient to the waiting list for a kidney transplantation. In fact, biochemical tests are not useful for reflecting the histological severity of liver damage, and liver disease may progress rapidly after transplantation. Although recent studies suggest that kidney transplantation alone could be feasible even in patients with biopsy-proven cirrhosis with a hepatic portal venous gradient less than 10 mmhg [54], the finding of pre-transplant cirrhosis has been clearly associated with a strong reduction of survival in renal transplant recipients [52,55], and now it is considered a contraindication to kidney transplantation alone. Information about the progression of liver disease after transplantation is lacking: most of the studies have demonstrated the progression of liver disease in kidney 2803 March 21, 2014 Volume 20 Issue 11

85 Veroux M et al. Donors with hepatitis C Anti-HCV positive ESRD renal transplant candidates HCV-RNA positive HCV-RNA positive Liver biopsy Minimal to mild activity Minimal to mild fibrosis No cirrhosis Consider for antiviral treatment (PEG interferon monotherapy) Severe fibrosis Cirrhosis Not responsive or not suitable for antiviral treatment Sustained viral response for 6 mo Consider for combined liver-kidney transplantation Waiting list for kidney transplantation from either anti-hcv positive or negative organ donors Consider for Kidney transplantation from anti-hcv negative donor Figure 1 Proposed algorithm for the evaluation and allocation of renal transplant candidates with hepatitis C virus infection. ESRD: End-stage renal disease; HCV: Hepatitis C virus; PEG: Polyethylene glycol. transplant recipients, but data on pre-transplant biopsies are not reported. Cross-sectional studies suggest that about 25% of HCV(+) patients with ESRD have significant fibrosis pre-transplant [1]. Zylberberg et al [56] retrospectively compared the liver histopathology of 28 HCV(+) kidney recipients to that of 28 controls. Over a period of 7 years, hepatic fibrosis worsened in 50% of patients, and 21% developed cirrhosis. In a prospective cohort study by Alric et al [57], serial liver biopsies in 30 renal transplant recipients, performed at 4 and 7 years following renal transplant, demonstrated a progression of liver fibrosis in 30% of the patients. In contrast, Kamar et al [58] demonstrated no progression of liver fibrosis in 50% of patients. The rate of progression among kidney transplant recipients was lower than in HCV-infected patients without ESRD, probably due to immunosuppressant effects that result in less inflammation and subsequent fibrosis in response to HCV infection [56-58]. Recently, in a study evaluating the progression of liver disease in a HCV-positive cohort of kidney transplant recipients, de Oliveira Uehara et al [59] demonstrated a progression of liver fibrosis in 50% of patients and a worsening of necro-inflammatory activity in 32%: progression of liver disease was noted even in patients without significant histological alteration before transplant. In contrast, Roth et al [60] evaluated the progression of liver disease in 44 HCV-positive kidney transplant recipients, where pre-transplant biopsy was available. Unexpectedly, despite many years of immunosuppression, liver histology remained stable (or even improved) in the majority of re-biopsied kidney transplant recipients: 16% of the liver biopsies obtained after transplant showed histologic improvement when compared with the baseline pretransplant sample, whereas only 23% showed progression of liver injury. Kucirka et al [12] analyzed more than 6000 kidney transplantations from the UNOS database and demonstrated that only 29% of HCV-positive deceased donor kidney recipients received a graft from an HCV-positive donor. It was of interest that kidney transplantation from HCVpositive donors could reduce by more than one year the waiting time for HCV patients, but those who received a kidney from an HCV-positive donor had a 2.6-fold higher risk of joining the liver transplantation list. Since most studies [61-66] demonstrated a rate of 20%-100% of acute rejection in HCV-positive kidney transplant recipients treated with interferon alfa, post-transplant treatment is now contraindicated, and the only therapeutic management of HCV infection in ESRD patients listed for kidney transplantation remains pre-transplant treatment, whenever possible. Optimal management of HCV infection should occur prior to the development of ESRD, when both interferon and ribavirin can be used to maximize viral response. However, for those patients who are not diagnosed until after they have reached ESRD or who contract HCV after ESRD develops, treatment options are more limited given the relative contraindication to ribavirin in the setting of renal failure and the need for close monitoring for hemolysis and anemia in the event 2804 March 21, 2014 Volume 20 Issue 11

86 Veroux M et al. Donors with hepatitis C of ribavirin use [67]. In addition, ESRD patients have a lower tolerability to interferon, and two meta-analyses showed a 17%-30% dropout rate in this patient population vs a standard non-esrd dropout rate of about 3%-10% [68]. Many small studies have demonstrated the efficacy of interferon monotherapy in the treatment of HCV infection in ESRD patients. Two recent meta-analyses assessing the efficacy of interferon monotherapy have shown sustained viral response (SVR, defined by an undetectable HCV RNA < 50 IU/mL in serum at least 6 mo after stopping treatment) rates of 33%-37% [68] and this SVR appears to continue post-transplant, minimizing the effect of post-transplant HCV glomerulonephritis. The combination of ribavirin and interferon is problematic in ESRD patients, due to the low clearance of ribavirin by dialysis, exacerbating the risk of hemolysis in patients already at higher risk of anemia. Some small studies demonstrated a SVR of 66% in ESRD patients [64], but the risk/benefit ratio related to adding ribavirin was not established. Given the difficulty with hemolysis when using ribavirin in ESRD, extreme caution with close monitoring of ribavirin levels is recommended [3]. At this time, there are data, albeit limited, supporting the safety of pegylated interferon as monotherapy for the treatment of hepatitis C in patients with ESRD. Gupta et al [69] showed that less than 50% of pegylated interferon alfa-2b is renally cleared and that hemodialysis did not appear to affect its clearance. Unfortunately, there are little data on tolerability, with a wide range of withdrawal rates in the three studies performed above: from 0% to 73% [3]. However, Werner et al [70] recently reported a 45% SVR among 22 HCV-positive ESRD patients treated with PEG-IFN monotherapy. In patients with normal renal function, similar enhancements in SVR rates are seen when pegylated interferon is combined with ribavirin. Based on this finding, the most promising recent development in the treatment of chronic HCV-infected patients with ESRD is the use of pegylated interferon combined with low-dose ribavirin, despite the known risks with ribavirin use in patients with chronic renal failure. Rendina et al [71] completed a randomized, controlled trial involving 35 patients treated with 135 μg/wk of pegylated interferon alpha-2a and low-dose ribavirin 200 mg daily every other day for 48 wk. The study showed a 97% SVR rate despite an early withdrawal rate of 15%, with only 6% withdrawal due to lack of tolerability and no adverse events reported. Summarizing, recent evidence suggests that the standard of care for treatment of HCV-positive ESRD patients is interferon monotherapy. Whether pegylated IFN offers advantages over non-pegylated IFN is unknown [71,72]. The treatment duration with IFN monotherapy is typically 48 wk [71,72], but non-responders may be identified even after 3-6 mo of treatment. Genotypes 1, 4, 5 and 6 are more resistant to IFN therapy and need a longer course of treatment [73]. Patients who fail to achieve HCV RNA of < 50 IU/mL after 6 mo of treatment should be considered as non-responsive and generally should have treatment discontinued. POST-TRANSPLANT TREATMENT AND HCV GLOMERULONEPHRITIS Treatment of HCV in kidney transplant recipients is not routinely recommended [74,75] because of concerns about IFN precipitating acute rejection. However, there are clinical circumstances in which a risk/benefit assessment may favor treatment. In the study by Aljumah et al [55], 19 HCV-positive kidney transplant recipients received treatment with a combination of pegylated interferon and ribavirin for 48 wk, with an SVR in 42.1% of patients. Only one patient developed a borderline acute rejection. HCV-associated glomerulonephritis can recur after kidney transplantation and cause progressive renal dysfunction, and antiviral therapy may be needed to prevent graft loss; moreover, patients with advanced fibrosis or severe cholestatic hepatitis warrant consideration of treatment to prevent death as a result of liver-related complications. Some data suggest that these transplant recipients will benefit from treatment with IFN monotherapy or IFN plus ribavirin combination therapy [73-77]. Kidney injury in HCV-positive patients may be mediated through immunological and non-immunological mechanisms. HCV-RNA and related proteins have been found in mesangial cells, tubular epithelial cells and endothelial cells of glomerular and tubular capillaries, and this has been associated with higher proteinuria, possibly reflecting direct mesangial injury by HCV infection [77,78]. Kidney injury may be mediated by a systemic immune response to HCV infection, which is mediated by cryoglobulins, HCV-antibody immune complexes or amyloid deposition [79]. Persistence of HCV leads to chronic overstimulation of B-lymphocytes and production of mixed cryoglobulins that are deposited in the mesangium and glomerular capillaries [79]. This is usually associated with histologic signs of vasculitis and downstream fibrinoid necrosis of the glomeruli. Non-immunologically mediated kidney injury may be related to high levels of fasting serum insulin and insulin resistance, which promote proliferation of renal cells [80]. This histological kidney injury represents HCV-related glomerulonephritis, which may develop many years after initial infection with HCV [72]. The most common HCVrelated nephropathy is membranoproliferative glomerulonephritis (MPGN), usually in the context of cryoglobulinemia. Most patients have no clear symptoms, but the triad of purpura, asthenia and arthralgia is evident in 30% of cases [81]. Renal involvement is reported in one third of patients with cryoglobulinemia [82]. Glomerular disease may manifest acutely in 5% of cases and the majority of patients develop hypertension: renal biopsy shows a pattern of MPGN [82], and the diagnosis of HCV-related MPGN is made by a positive test for serum HCV antibodies and HCV RNA March 21, 2014 Volume 20 Issue 11

87 Veroux M et al. Donors with hepatitis C The long-term outcome of HCV-related nephropathies is still not clearly defined; however, HCV-positive patients were found to have a 40% higher likelihood for developing renal insufficiency compared with seronegative patients [83]. Hypertension, proteinuria and progressive renal failure are the main clinical manifestations of HCV-associated chronic kidney disease. Thus, renoprotection with either angiotensin-converting enzyme inhibitors or angiotensin Ⅱ receptor blockers must be applied [73]. Antiviral therapy should be attempted in hemodialysed patients [73]. In kidney transplant recipients with de novo glomerulonephritis with low proteinuria and stable renal function, initiation of antiviral therapy should be based on the degree of liver damage. For patients with severe de novo glomerulonephritis and high risk of chronic graft failure, antiviral therapy (IFN alone or in combination with ribavirin) should be initiated as soon as possible [73]. Immunosuppressive treatment should be adapted to prevent rejection while minimizing viral replication. Experimental studies [84] have shown that cyclosporine may inhibit the intracellular replication of HCV, independently of its immunosuppressive activity. However, in the clinical setting this antiviral effect of cyclosporine remains controversial [50,85]. Findings of the USRDS registry reported a better graft survival in recipients treated with mycophenolate mofetil (MMF) than in those on other immunosuppressive therapy [50]. However, a prospective study reported an increase in viral replication in patients on MMF therapy [86], suggesting that the immunosuppressive therapy should be adapted to patients clinical conditions. FUTURE CHALLENGES Kidney transplantation is the best replacement therapy for HCV-positive ESRD patients, as it confers a survival advantage when compared to dialysis. Kidney transplantation from HCV-positive donors into HCV-positive recipients may be useful to expand the donor pool, by increasing the rate of utilization of these kidneys. While short-term results are conflicting, kidney transplantations from HCV-positive donors permit a reduction in waiting time for kidney transplantation with long-term graft and patient survival similar to HCV-positive recipients receiving a kidney from an HCV-negative donor. However, de novo HCV-related glomerulonephritis and the higher risk of chronic humoral rejection may hamper the graft survival in these patients. Future studies should address the optimal immunosuppressive therapy aiming to reduce the risk of liver disease progression and the risk of cardiovascular complications, such as new-onset diabetes mellitus after transplantation, which may be increased in HCV-positive kidney transplant recipients. REFERENCES 1 Fabrizi F, Messa P, Martin P. Current status of renal transplantation from HCV-positive donors. Int J Artif Organs 2009; 32: [PMID: ] 2 Finelli L, Miller JT, Tokars JI, Alter MJ, Arduino MJ. National surveillance of dialysis-associated diseases in the United States, Semin Dial 2005; 18: [PMID: DOI: /j X x] 3 Okoh EJ, Bucci JR, Simon JF, Harrison SA. HCV in patients with end-stage renal disease. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 4 Domínguez-Gil B, Esforzado N, Andrés A, Campistol JM, Morales JM. Renal transplantation from donors with a positive serology for hepatitis C. Contrib Nephrol 2012; 176: [PMID: DOI: / ] 5 Kalantar-Zadeh K, Kilpatrick RD, McAllister CJ, Miller LG, Daar ES, Gjertson DW, Kopple JD, Greenland S. Hepatitis C virus and death risk in hemodialysis patients. J Am Soc Nephrol 2007; 18: [PMID: DOI: / ASN ] 6 Berenguer M. Treatment of chronic hepatitis C in hemodialysis patients. Hepatology 2008; 48: [PMID: DOI: /hep.22545] 7 Kucirka LM, Singer AL, Ros RL, Montgomery RA, Dagher NN, Segev DL. Underutilization of hepatitis C-positive kidneys for hepatitis C-positive recipients. Am J Transplant 2010; 10: [PMID: DOI: / j x] 8 Scott DR, Wong JK, Spicer TS, Dent H, Mensah FK, Mc- Donald S, Levy MT. Adverse impact of hepatitis C virus infection on renal replacement therapy and renal transplant patients in Australia and New Zealand. Transplantation 2010; 90: [PMID: DOI: / TP.0b013e3181f92548] 9 Fabrizi F, Takkouche B, Lunghi G, Dixit V, Messa P, Martin P. The impact of hepatitis C virus infection on survival in dialysis patients: meta-analysis of observational studies. J Viral Hepat 2007; 14: [PMID: DOI: / j x] 10 Kidney Disease: Improving Global Outcomes. KDIGO clinical practice guidelines for the prevention, diagnosis, evaluation, and treatment of Hepatitis C in chronic kidney disease. Kidney Int 2008; 73 (Suppl 109): S1-S99 11 Fabrizi F, Martin P, Dixit V, Bunnapradist S, Dulai G. Hepatitis C virus antibody status and survival after renal transplantation: meta-analysis of observational studies. Am J Transplant 2005; 5: [PMID: DOI: / j x] 12 Kucirka LM, Peters TG, Segev DL. Impact of donor hepatitis C virus infection status on death and need for liver transplant in hepatitis C virus-positive kidney transplant recipients. Am J Kidney Dis 2012; 60: [PMID: DOI: /j.ajkd ] 13 Pedroso S, Martins L, Fonseca I, Dias L, Henriques AC, Sarmento AM, Cabrita A. Impact of hepatitis C virus on renal transplantation: association with poor survival. Transplant Proc 2006; 38: [PMID: DOI: /j.tra nsproceed ] 14 Gheith OA, Saad MA, Hassan AA, A-Eldeeb S, Agroudy AE, Sheashaa H, Ghoneim MA. Hepatic dysfunction in kidney transplant recipients: prevalence and impact on graft and patient survival. Clin Exp Nephrol 2007; 11: [PMID: DOI: /s ] 15 Arango J, Arbelaez M, Henao J, Mejia G, Arroyave I, Carvajal J, Garcia A, Gutierrez J, Velásquez A, Garcia L, Aguirre C. Kidney graft survival in patients with hepatitis C: a single center experience. Clin Transplant 2008; 22: [PMID: DOI: /j x] 16 Kliem V, Burg M, Haller H, Suwelack B, Abendroth D, Fritsche L, Fornara P, Pietruck F, Frei U, Donauer J, Lison AE, Michel U. Relationship of hepatitis B or C virus prevalences, risk factors, and outcomes in renal transplant recipients: analysis of German data. Transplant Proc 2008; 40: March 21, 2014 Volume 20 Issue 11

88 Veroux M et al. Donors with hepatitis C [PMID: DOI: /j.transproceed ] 17 Meier-Kriesche HU, Ojo AO, Hanson JA, Kaplan B. Hepatitis C antibody status and outcomes in renal transplant recipients. Transplantation 2001; 72: [PMID: ] 18 Batty DS, Swanson SJ, Kirk AD, Ko CW, Agodoa LY, Abbott KC. Hepatitis C virus seropositivity at the time of renal transplantation in the United States: associated factors and patient survival. Am J Transplant 2001; 1: [PMID: ] 19 Luan FL, Schaubel DE, Zhang H, Jia X, Pelletier SJ, Port FK, Magee JC, Sung RS. Impact of immunosuppressive regimen on survival of kidney transplant recipients with hepatitis C. Transplantation 2008; 85: [PMID: DOI: /TP.0b013e f3a] 20 Hu KQ, Lee SM, Hu SX, Xia VW, Hillebrand DJ, Kyulo NL. Clinical presentation of chronic hepatitis C in patients with end-stage renal disease and on hemodialysis versus those with normal renal function. Am J Gastroenterol 2005; 100: [PMID: ] 21 Sterling RK, Sanyal AJ, Luketic VA, Stravitz RT, King AL, Post AB, Mills AS, Contos MJ, Shiffman ML. Chronic hepatitis C infection in patients with end stage renal disease: characterization of liver histology and viral load in patients awaiting renal transplantation. Am J Gastroenterol 1999; 94: [PMID: DOI: /j x] 22 Luzar B, Ferlan-Marolt V, Brinovec V, Lesnicar G, Klopcic U, Poljak M. Does end-stage kidney failure influence hepatitis C progression in hemodialysis patients? Hepatogastroenterology 2003; 50: [PMID: ] 23 Maluf DG, Fisher RA, King AL, Gibney EM, Mas VR, Cotterell AH, Shiffman ML, Sterling RK, Behnke M, Posner MP. Hepatitis C virus infection and kidney transplantation: predictors of patient and graft survival. Transplantation 2007; 83: [PMID: DOI: /01. tp a] 24 Sezer S, Ozdemir FN, Akcay A, Arat Z, Boyacioglu S, Haberal M. Renal transplantation offers a better survival in HCVinfected ESRD patients. Clin Transplant 2004; 18: [PMID: DOI: /j x] 25 Bloom RD, Sayer G, Fa K, Constantinescu S, Abt P, Reddy KR. Outcome of hepatitis C virus-infected kidney transplant candidates who remain on the waiting list. Am J Transplant 2005; 5: [PMID: DOI: / j x] 26 Veroux M, Corona D, Veroux P. Kidney transplantation from donors with viral Heaptitis. In: Veroux M, Veroux P, editors. Kidney Transplantation: challenging the future. UAE: Bentham Publisher, 2012: Fabrizi F, Martin P, Dixit V, Bunnapradist S, Kanwal F, Dulai G. Post-transplant diabetes mellitus and HCV seropositive status after renal transplantation: meta-analysis of clinical studies. Am J Transplant 2005; 5: [PMID: DOI: /j x] 28 Ingsathit A, Kamanamool N, Thakkinstian A, Sumethkul V. Survival advantage of kidney transplantation over dialysis in patients with hepatitis C: a systematic review and metaanalysis. Transplantation 2013; 95: [PMID: DOI: /TP.0b013e de2] 29 Gentil Govantes MA, Esforzado N, Cruzado JM, González- Roncero FM, Balaña M, Saval N, Morales JM. Harmful effects of viral replication in seropositive hepatitis C virus renal transplant recipients. Transplantation 2012; 94: [PMID: DOI: /TP.0b013e31826fc98f] 30 Einollahi B, Hajarizadeh B, Bakhtiari S, Lesanpezeshki M, Khatami MR, Nourbala MH, Pourfarziani V, Alavian SM. Pretransplant hepatitis C virus infection and its effect on the post-transplant course of living renal allograft recipients. J Gastroenterol Hepatol 2003; 18: [PMID: ] 31 Aroldi A, Lampertico P, Montagnino G, Passerini P, Villa M, Campise MR, Lunghi G, Tarantino A, Cesana BM, Messa P, Ponticelli C. Natural history of hepatitis B and C in renal allograft recipients. Transplantation 2005; 79: [PMID: ] 32 Rostami Z, Nourbala MH, Alavian SM, Bieraghdar F, Jahani Y, Einollahi B. The impact of Hepatitis C virus infection on kidney transplantation outcomes: A systematic review of 18 observational studies: The impact of HCV on renal transplantation. Hepat Mon 2011; 11: [PMID: ] 33 Pereira BJ, Wright TL, Schmid CH, Bryan CF, Cheung RC, Cooper ES, Hsu H, Heyn-Lamb R, Light JA, Norman DJ. Screening and confirmatory testing of cadaver organ donors for hepatitis C virus infection: a U.S. National Collaborative Study. Kidney Int 1994; 46: [PMID: ] 34 Botero RC. Should patients with chronic hepatitis C infection be transplanted? Transplant Proc 2004; 36: [PMID: ] 35 Avery R, Preiksaitis J, Green M. Use of anti-hcv-positive donor organs. Am J Transplant 2005; 5: 1579 [PMID: ] 36 Veroux P, Veroux M, Puliatti C, Cappello D, Macarone M, Gagliano M, Fiamingo P, Di Mare M, Spataro M, Ginevra N. Kidney transplantation from hepatitis C virus-positive donors into hepatitis C virus-positive recipients: a safe way to expand the donor pool? Transplant Proc 2005; 37: [PMID: ] 37 Mandal AK, Kraus ES, Samaniego M, Rai R, Humphreys SL, Ratner LE, Maley WR, Burdick JF. Shorter waiting times for hepatitis C virus seropositive recipients of cadaveric renal allografts from hepatitis C virus seropositive donors. Clin Transplant 2000; 14: [PMID: ] 38 Morales JM, Aguado JM. Hepatitis C and renal transplantation. Curr Opin Organ Transplant 2012; 17: [PMID: DOI: /MOT.0b013e32835a2bac] 39 Woodside KJ, Ishihara K, Theisen JE, Early MG, Covert LG, Hunter GC, Gugliuzza KK, Daller JA. Use of kidneys from hepatitis C seropositive donors shortens waitlist time but does not alter one-yr outcome. Clin Transplant 2003; 17: [PMID: ] 40 Veroux P, Veroux M, Sparacino V, Giuffrida G, Puliatti C, Macarone M, Fiamingo P, Cappello D, Gagliano M, Spataro M, Di Mare M, Cannizzaro MA, Severino V. Kidney transplantation from donors with viral B and C hepatitis. Transplant Proc 2006; 38: [PMID: DOI: / j.transproceed ] 41 Pereira BJ, Wright TL, Schmid CH, Levey AS. A controlled study of hepatitis C transmission by organ transplantation. The New England Organ Bank Hepatitis C Study Group. Lancet 1995; 345: [PMID: ] 42 Bouthot BA, Murthy BV, Schmid CH, Levey AS, Pereira BJ. Long-term follow-up of hepatitis C virus infection among organ transplant recipients: implications for policies on organ procurement. Transplantation 1997; 63: [PMID: ] 43 Morales JM, Campistol JM, Domínguez-Gil B, Andrés A, Esforzado N, Oppenheimer F, Castellano G, Fuertes A, Bruguera M, Praga M. Long-term experience with kidney transplantation from hepatitis C-positive donors into hepatitis C-positive recipients. Am J Transplant 2010; 10: [PMID: DOI: /j x] 44 Abbott KC, Bucci JR, Matsumoto CS, Swanson SJ, Agodoa LY, Holtzmuller KC, Cruess DF, Peters TG. Hepatitis C and renal transplantation in the era of modern immunosuppression. J Am Soc Nephrol 2003; 14: [PMID: ] 45 Abbott KC, Lentine KL, Bucci JR, Agodoa LY, Peters TG, Schnitzler MA. The impact of transplantation with deceased donor hepatitis c-positive kidneys on survival in wait-listed long-term dialysis patients. Am J Transplant 2004; 4: [PMID: DOI: /j x] 46 Chan TM, Wu PC, Lok AS, Lai CL, Cheng IK. Clinicopathological features of hepatitis C virus antibody negative fatal chronic hepatitis C after renal transplantation. Nephron 1995; 2807 March 21, 2014 Volume 20 Issue 11

89 Veroux M et al. Donors with hepatitis C 71: [PMID: ] 47 Ridruejo E, Díaz C, Michel MD, Soler Pujol G, Martínez A, Marciano S, Mandó OG, Vilches A. Short and long term outcome of kidney transplanted patients with chronic viral hepatitis B and C. Ann Hepatol 2010; 9: [PMID: ] 48 Morales JM, Marcén R, Andres A, Domínguez-Gil B, Campistol JM, Gallego R, Gutierrez A, Gentil MA, Oppenheimer F, Samaniego ML, Muñoz-Robles J, Serón D. Renal transplantation in patients with hepatitis C virus antibody. A long national experience. NDT Plus 2010; 3: ii41-ii46 [PMID: DOI: /ndtplus/sfq070] 49 Singh N, Neidlinger N, Djamali A, Leverson G, Voss B, Sollinger HW, Pirsch JD. The impact of hepatitis C virus donor and recipient status on long-term kidney transplant outcomes: University of Wisconsin experience. Clin Transplant 2012; 26: [PMID: DOI: /j x] 50 Morales JM, Campistol JM, Castellano G, Andres A, Colina F, Fuertes A, Ercilla G, Bruguera M, Andreu J, Carretero P. Transplantation of kidneys from donors with hepatitis C antibody into recipients with pre-transplantation anti-hcv. Kidney Int 1995; 47: [PMID: ] 51 Natov SN, Lau JY, Ruthazer R, Schmid CH, Levey AS, Pereira BJ. Hepatitis C virus genotype does not affect patient survival among renal transplant candidates. The New England Organ Bank Hepatitis C Study Group. Kidney Int 1999; 56: [PMID: ] 52 Mathurin P, Moussalli J, Cadranel JF, Thibault V, Charlotte F, Dumouchel P, Cazier A, Huraux JM, Devergie B, Vidaud M, Opolon P, Poynard T. Slow progression rate of fibrosis in hepatitis C virus patients with persistently normal alanine transaminase activity. Hepatology 1998; 27: [PMID: ] 53 Kim SM, Kim HW, Lee EK, Park SK, Han DJ, Kim SB. Usefulness of liver biopsy in anti-hepatitis C virus antibodypositive and hepatitis C virus RNA-negative kidney transplant recipients. Transplantation 2013; 96: [PMID: DOI: /TP.0b013e318294cad1] 54 Paramesh AS, Davis JY, Mallikarjun C, Zhang R, Cannon R, Shores N, Killackey MT, McGee J, Saggi BH, Slakey DP, Balart L, Buell JF. Kidney transplantation alone in ESRD patients with hepatitis C cirrhosis. Transplantation 2012; 94: [PMID: DOI: /TP.0b013e318255f890] 55 Aljumah AA, Saeed MA, Al Flaiw AI, Al Traif IH, Al Alwan AM, Al Qurashi SH, Al Ghamdi GA, Al Hejaili FF, Al Balwi MA, Al Sayyari AA. Efficacy and safety of treatment of hepatitis C virus infection in renal transplant recipients. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i1.55] 56 Zylberberg H, Nalpas B, Carnot F, Skhiri H, Fontaine H, Legendre C, Kreis H, Bréchot C, Pol S. Severe evolution of chronic hepatitis C in renal transplantation: a case control study. Nephrol Dial Transplant 2002; 17: [PMID: ] 57 Alric L, Kamar N, Bonnet D, Danjoux M, Abravanel F, Lauwers-Cances V, Rostaing L. Comparison of liver stiffness, fibrotest and liver biopsy for assessment of liver fibrosis in kidney-transplant patients with chronic viral hepatitis. Transpl Int 2009; 22: [PMID: DOI: / j x] 58 Kamar N, Rostaing L, Selves J, Sandres-Saune K, Alric L, Durand D, Izopet J. Natural history of hepatitis C virusrelated liver fibrosis after renal transplantation. Am J Transplant 2005; 5: [PMID: DOI: / j x] 59 de Oliveira Uehara SN, Emori CT, da Silva Fucuta Pereira P, Perez RM, Pestana JO, Lanzoni VP, e Silva IS, Silva AE, Ferraz ML. Histological evolution of hepatitis C virus infection after renal transplantation. Clin Transplant 2012; 26: [PMID: DOI: /j x] 60 Roth D, Gaynor JJ, Reddy KR, Ciancio G, Sageshima J, Kupin W, Guerra G, Chen L, Burke GW. Effect of kidney transplantation on outcomes among patients with hepatitis C. J Am Soc Nephrol 2011; 22: [PMID: DOI: /ASN ] 61 Wéclawiack H, Kamar N, Mehrenberger M, Guilbeau-Frugier C, Modesto A, Izopet J, Ribes D, Sallusto F, Rostaing L. Alpha-interferon therapy for chronic hepatitis C may induce acute allograft rejection in kidney transplant patients with failed allografts. Nephrol Dial Transplant 2008; 23: [PMID: DOI: /ndt/gfm678] 62 Roth D, Bloom R. Selection and management of hepatitis C virus-infected patients for the kidney transplant waiting list. Contrib Nephrol 2012; 176: [PMID: DOI: / ] 63 Magnone M, Holley JL, Shapiro R, Scantlebury V, McCauley J, Jordan M, Vivas C, Starzl T, Johnson JP. Interferonalpha-induced acute renal allograft rejection. Transplantation 1995; 59: [PMID: ] 64 Ozgür O, Boyacioğlu S, Telatar H, Haberal M. Recombinant alpha-interferon in renal allograft recipients with chronic hepatitis C. Nephrol Dial Transplant 1995; 10: [PMID: ] 65 Rostaing L, Modesto A, Baron E, Cisterne JM, Chabannier MH, Durand D. Acute renal failure in kidney transplant patients treated with interferon alpha 2b for chronic hepatitis C. Nephron 1996; 74: [PMID: ] 66 Morales JM, Bloom R, Roth D. Kidney transplantation in the patient with hepatitis C virus infection. Contrib Nephrol 2012; 176: [PMID: DOI: / ] 67 Bruchfeld A, Lindahl K, Ståhle L, Söderberg M, Schvarcz R. Interferon and ribavirin treatment in patients with hepatitis C-associated renal disease and renal insufficiency. Nephrol Dial Transplant 2003; 18: [PMID: ] 68 Russo MW, Goldsweig CD, Jacobson IM, Brown RS. Interferon monotherapy for dialysis patients with chronic hepatitis C: an analysis of the literature on efficacy and safety. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 69 Gupta SK, Glue P, Jacobs S, Belle D, Affrime M. Single-dose pharmacokinetics and tolerability of pegylated interferonalpha2b in young and elderly healthy subjects. Br J Clin Pharmacol 2003; 56: [PMID: ] 70 Werner T, Aqel B, Balan V, Byrne T, Carey E, Douglas D, Heilman RL, Rakela J, Mekeel K, Reddy K, Vargas HE. Treatment of hepatitis C in renal transplantation candidates: a single-center experience. Transplantation 2010; 90: [PMID: DOI: /TP.0b013e3181e72837] 71 Rendina M, Schena A, Castellaneta NM, Losito F, Amoruso AC, Stallone G, Schena FP, Di Leo A, Francavilla A. The treatment of chronic hepatitis C with peginterferon alfa-2a (40 kda) plus ribavirin in haemodialysed patients awaiting renal transplant. J Hepatol 2007; 46: [PMID: ] 72 Terrault NA, Adey DB. The kidney transplant recipient with hepatitis C infection: pre- and posttransplantation treatment. Clin J Am Soc Nephrol 2007; 2: [PMID: ] 73 Rostaing L, Weclawiak H, Izopet J, Kamar N. Treatment of hepatitis C virus infection after kidney transplantation. Contrib Nephrol 2012; 176: [PMID: DOI: / ] 74 Perico N, Cattaneo D, Bikbov B, Remuzzi G. Hepatitis C infection and chronic renal diseases. Clin J Am Soc Nephrol 2009; 4: [PMID: DOI: /CJN ] 75 Shu KH, Lan JL, Wu MJ, Cheng CH, Chen CH, Lee WC, Chang HR, Lian JD. Ultralow-dose alpha-interferon plus ribavirin for the treatment of active hepatitis C in renal transplant recipients. Transplantation 2004; 77: [PMID: ] 2808 March 21, 2014 Volume 20 Issue 11

90 Veroux M et al. Donors with hepatitis C 76 Tang S, Cheng IK, Leung VK, Kuok UI, Tang AW, Wing Ho Y, Neng Lai K, Mao Chan T. Successful treatment of hepatitis C after kidney transplantation with combined interferon alpha- 2b and ribavirin. J Hepatol 2003; 39: [PMID: ] 77 Poynard T, Yuen MF, Ratziu V, Lai CL. Viral hepatitis C. Lancet 2003; 362: [PMID: ] 78 Sansonno D, Gesualdo L, Manno C, Schena FP, Dammacco F. Hepatitis C virus-related proteins in kidney tissue from hepatitis C virus-infected patients with cryoglobulinemic membranoproliferative glomerulonephritis. Hepatology 1997; 25: [PMID: ] 79 Barsoum RS. Hepatitis C virus: from entry to renal injury- -facts and potentials. Nephrol Dial Transplant 2007; 22: [PMID: DOI: /ndt/gfm205] 80 Sarafidis PA, Ruilope LM. Insulin resistance, hyperinsulinemia, and renal injury: mechanisms and implications. Am J Nephrol 2006; 26: [PMID: DOI: / ] 81 Monti G, Galli M, Invernizzi F, Pioltelli P, Saccardo F, Monteverde A, Pietrogrande M, Renoldi P, Bombardieri S, Bordin G. Cryoglobulinaemias: a multi-centre study of the early clinical and laboratory manifestations of primary and secondary disease. GISC. Italian Group for the Study of Cryoglobulinaemias. QJM 1995; 88: [PMID: ] 82 Meyers CM, Seeff LB, Stehman-Breen CO, Hoofnagle JH. Hepatitis C and renal disease: an update. Am J Kidney Dis 2003; 42: [PMID: ] 83 Dalrymple LS, Koepsell T, Sampson J, Louie T, Dominitz JA, Young B, Kestenbaum B. Hepatitis C virus infection and the prevalence of renal insufficiency. Clin J Am Soc Nephrol 2007; 2: [PMID: DOI: /CJN ] 84 Fabrizi F, Bromberg J, Elli A, Dixit V, Martin P. Review article: hepatitis C virus and calcineurin inhibition after renal transplantation. Aliment Pharmacol Ther 2005; 22: [PMID: ] 85 Fagiuoli S, Bruni F, Bravi M, Candusso M, Gaffuri G, Colledan M, Torre G. Cyclosporin in steroid-resistant autoimmune hepatitis and HCV-related liver diseases. Dig Liver Dis 2007; 39 Suppl 3: S379-S385 [PMID: DOI: / S (07) ] 86 Rostaing L, Izopet J, Sandres K, Cisterne JM, Puel J, Durand D. Changes in hepatitis C virus RNA viremia concentrations in long-term renal transplant patients after introduction of mycophenolate mofetil. Transplantation 2000; 69: [PMID: ] P- Reviewer: Bahri O S- Editor: Wen LL L- Editor: Logan S E- Editor: Ma S 2809 March 21, 2014 Volume 20 Issue 11

91 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Histopathological evaluation of recurrent hepatitis C after liver transplantation: A review Francesco Vasuri, Deborah Malvi, Elisa Gruppioni, Walter F Grigioni, Antonia D Errico-Grigioni Francesco Vasuri, Deborah Malvi, Elisa Gruppioni, Walter F Grigioni, Antonia D Errico-Grigioni, F. Addarii Institute of Oncology and Transplantation Pathology, S. Orsola-Malpighi Hospital, Bologna University, Bologna, Italy Author contributions: Vasuri F and Malvi D reviewed the literature, wrote the paper and contributed to the images; Gruppioni E reviewed the literature concerning reverse transcription-polymerase chain reaction methods in hepatitis C virus recipients and wrote the relevant paragraph; Grigioni WF and D Errico-Grigioni A designed the review and revised it critically; all authors approved the final version of the manuscript and its contents. Correspondence to: Walter F Grigioni, MD, F. Addarii Institute of Oncology and Transplant Pathology, S. Orsola-Malpighi Hospital, Bologna University, V.le Ercolani 4/2, Bologna, Italy. franco.grigioni@aosp.bo.it Telephone: Fax: Received: September 23, 2013 Revised: November 8, 2013 Accepted: December 12, 2013 Published online: March 21, 2014 Abstract Although the morphological features of hepatitis C virus (HCV) recurrence after orthotopic liver transplantation (OLT) have been well established in the last decades, the differential diagnosis still represents a challenge for the pathologist, especially early recurrent hepatitis C vs mild acute cellular rejection. The present review focuses on the role of the pathologist and the pathology laboratory in the management of recipients with recurrent hepatitis C, the usefulness of early and late post-olt liver biopsies, and the potential role of ancillary techniques (immunohistochemistry and reverse transcription-polymerase chain reaction, RT-PCR). The English literature on the topic is reviewed, focusing on the histopathology, the immunohistochemistry and the use of RT-PCR on HCV-positive post-olt biopsies. The different histopathological illustrations of early and chronic recurrent hepatitis C are presented, with special focus on the main differential diagnoses and those fea- tures with prognostic relevance (cholestasis above all). The usefulness of ancillary techniques are discussed, especially HCV RNA quantitation by RT-PCR. Finally, the usefulness of long-term protocol biopsies is addressed: their usefulness for the study of allograft disease progression is clear, but their meaning in the long term is still debated. The significance of plasma cell infiltrate in HCV-positive allografts, the prognostic weight of graft steatosis, and the impact of donor age in recurrent hepatitis C also represent additional open issues Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Histopathology; Immunohistochemistry; Orthotopic liver transplantation; Recurrent hepatitis C; Polymerase chain reaction Core tip: Recently, tissue hepatitis C virus (HCV) RNA quantitation by means of reverse transcription-polymerase chain reaction has been largely used in the early post-orthotopic liver transplantation (OLT) phases, especially in the differential diagnosis of recurrent hepatitis C vs mild acute rejection, replacing immunohistochemistry in some laboratories. Nevertheless, the importance of tissue HCV RNA quantitation in the long post-olt term has not been clarified yet. The suitability and usefulness of protocol biopsies are still debated: protocol biopsies may be necessary in order to answer other open questions, such as the significance of plasma cell infiltrate in HCV-positive allografts, the prognostic weight of HCV-induced steatosis, and the impact of donor age in recurrent hepatitis C. Vasuri F, Malvi D, Gruppioni E, Grigioni WF, D Errico-Grigioni A. Histopathological evaluation of recurrent hepatitis C after liver transplantation: A review. World J Gastroenterol 2014; 20(11): Available from: URL: com/ /full/v20/i11/2810.htm DOI: March 21, 2014 Volume 20 Issue 11

92 Vasuri F et al. Histopathological analysis of recurrent hepatitis C org/ /wjg.v20.i INTRODUCTION End-stage liver disease due to chronic hepatitis C virus (HCV) infection is the leading indication for orthotopic liver transplantation (OLT) in Western countries [1]. HCV reinfection is virtually universal after OLT, and up to 70% of patients are expected to experience histological recurrent hepatitis C [2-13], with a higher risk of graft loss and mortality compared to recipients undergoing transplantion for other etiologies [5,14-16]. It is noteworthy that the incidence of HCV disease in allografts has increased since the nineties according to the literature, probably due to the application of more effective immunosuppression regimens. Indeed immunosuppression, especially the steroid boluses given in the case of acute cellular rejection (ACR), inevitably accelerate the virus-mediated graft damage, with a more aggressive course compared with HCV disease in native livers [17-20]. Although some authors have recently underlined a good outcome of HCV-positive recipients at 5 years after OLT [13], recurrent hepatitis C still represents the major cause of graft failure. In this setting, it is now recognized that the histopathological analysis of post-olt liver biopsies can produce valuable data for the diagnosis and prognosis of recurrent hepatitis C, and therefore for the management of HCV-positive recipients, though in this case, no universal approach is recognized. Moreover, the histopathological diagnosis of recurrent hepatitis C implies many pitfalls and a wide range of differential diagnoses, and it can be very challenging especially in the early post-olt phases. The present review focuses on the role of pathologist and pathology laboratory in the diagnosis of recurrent hepatitis C, the objective usefulness of early and late post-olt liver biopsies, and the potential role of ancillary techniques in the diagnosis and prediction of the disease progression. LIVER BIOPSY IN EARLY ACUTE RECURRENT HEPATITIS C The timing and the indications of post-olt liver biopsies represent a key step in the management of HCVpositive recipients. Although the decision is normally made by the surgical team, and therefore does not directly involve the pathologist, the practice of protocol biopsies after OLT might influence the whole transplant team. As early recurrent hepatitis C, as well as the early allograft damage that can simulate it, are clinically and serologically evident, early liver biopsies are usually performed for established clinical indications. Moreover, complications after liver biopsy are rare but potentially serious, and the histopathological report of a biopsy performed with normal tests does not usually influence the therapeutic approach [21]. For these reasons, there has been a progressive cessation of early protocol biopsies in many centers. In our center, protocol biopsies are not performed, and we introduced the concept of first-event biopsy. The first-event biopsy is defined as the biopsy taken at the very first increase in transaminase level and/ or clinical worsening after OLT [22]. Although we realize that this approach cannot be free from selection bias, the histopathological and reverse transcription-polymerase chain reaction (RT-PCR) studies of the tissue obtained from the first-event biopsies can provide valuable diagnostic and prognostic data on HCV recurrent disease (see also the RT-PCR section) [22,23]. The onset of typical acute recurrent hepatitis C is generally recorded within 4-12 wk after OLT, but according to Demetris, it can be detected as early as 10 to 14 d [12]. Saraf et al [24] reported a case of a woman who experienced recurrent hepatitis C at day 9, attributing the early onset to the advanced donor and recipient ages. In our most recent experience, 75% of HCV-positive recipients had a histopathological diagnosis of recurrent hepatitis C after a mean of 86 d, but with a high variability, including a case of recurrent hepatitis C after 3 d [22]. This finding is in agreement with Pacholczyk et al [13], who reported the minimum recurrence time in their series at 5 d. These extreme cases of early recurrent hepatitis C are very rare, but they are not to be excluded a priori, also taking into account HCV virulence and immunosuppression suitability. In any case, experience has taught us that the diagnosis of recurrent hepatitis C after such a short period requires tissue HCV RNA quantitation, as well as the clinical and histopathological exclusion of other possible causes of graft damage, e.g., ACR, early surgical complications, ischemia/reperfusion injuries, and other early complications, which have a much higher incidence in the first days after OLT. HISTOPATHOLOGY OF EARLY RECURRENT HEPATITIS C Typical acute recurrent hepatitis C On the basis of nearly 20 years of publications, Demetris classified the histopathological presentation of recurrent hepatitis C into three groups: the typical presentation (acute and chronic), fibrosing cholestatic HCV hepatitis (FCH), and a plasma cell-rich variant [12]. Each of these histopathological variants can be intertwined with other post-olt complications (ACR above all). Lobular hepatitis observed in typical acute recurrent hepatitis C is similar to the acute viral damage observed in the very first phases of hepatitis C in nontransplanted livers, but has very low (or absent) portal tract involvement. In particular, early recurrent hepatitis C is characterized by lobular architectural disarray with Councilman bodies and spotty necrosis, Kupffer cells activation, and mild lymphocytic sinusoidal infiltrate [1,12,25,26] (Figure 1). The Councilman bodies (or acidophilic bodies) are the expression of the apoptotic death of hepatocytes during lobular damage. The formation of apoptotic 2811 March 21, 2014 Volume 20 Issue 11

93 Vasuri F et al. Histopathological analysis of recurrent hepatitis C A B Figure 1 Typical histopathological appearance of acute recurrent hepatitis C. A: Lobular architectural disarray, lobular necrosis with lymphocytic sinusoidal infiltrate and visible Councilman bodies (black arrow) are evident, as well as a mild portal tract inflammation (arrowhead); hematoxylin-eosin stain, 20 magnification; B: Detail of the same case at 40 magnification: note the high number of Councilman bodies in a single field (black arrows), and a minimal amount of macrovesicular steatosis. bodies was described during hepatitis C, both in native livers and OLT allografts, as a consequence of several mechanisms including direct cytotoxicity by HCV, activation of the extrinsic apoptotic pathway by the recipient immune system, and sensitization to the FasL/CD95 intrinsic pathway by HCV core proteins [27-29]. In the OLT setting, the morphological features are further complicated by immunosuppression. The first quantitation of Councilman bodies in the allograft differential diagnosis was performed in 2002 by Saxena et al [30], who found a two-fold higher mean number of apoptotic bodies per cm 2 in recurrent hepatitis C than in ACR. The authors also suggested that the finding of > 50 acidophilic bodies in the whole biopsy was strongly indicative of recurrent hepatitis C [30]. Some years later, in order to obtain more reproducible results, our group evaluated the socalled Councilman bodies/portal tract ratio ( C/P ratio ), which simply represents the mean number of Councilman bodies for each portal tract counted in the biopsy [22,23]. The C/P ratio was the only histopathological variable able to discriminate recurrent hepatitis C from other conditions, as well as the only variable directly correlated with the intrahepatic HCV RNA load. Moreover, high-risk recipients showed more Councilman bodies than others, with a mean C/P ratio of 1.5 (see below) [22]. Histopathological variants: Fibrosing cholestatic HCV hepatitis FCH is a quite peculiar presentation of recurrent hepatitis C, although it was first described in a HBV-positive OLT recipient [31]. FCH is characterized by an early onset (within 1 year) and an overall poor prognosis, due to the rapid fibrosis progression and the poor response to conventional antiviral therapies [6,32]. At histology, FCH shows hepatocyte swelling and ballooning, spotty necrosis with Councilman bodies, cholestasis with ductular reaction and a ductular-type interface activity, with a mild mixed portal infiltrate (Figure 2A-C). Late alterations include periportal fibrosis and cirrhosis (Figure 2D) [6,12,32-35]. In a previous study on 10 FCH cases (on 135 HCV-positive recipients), the median hepatitis activity grade and the Banff score were significantly higher than in usual acute recurrent hepatitis C [34]. The occurrence of a peculiar sinusoidal pattern of fibrosis was also described as important for the diagnosis of FCH [34]. According to a recent paper, the diagnosis of cholestatic HCV requires at least three out of four histological features (ductular reaction, cholestasis, hepatocyte ballooning and periportal sinusoidal fibrosis), 1 mo after OLT, after exclusion of other causes of cholestasis. These histological features seem to have a prognostic meaning as well [35]. FCH is likely to affect over-immunosuppressed recipients [36], with a massive viral replication, as reflected by the occurrence of very high viral loads in both serum and liver tissue, as reported in different papers from the end of the nineties [22,33,37]. Notably, in one paper, the tissue HCV RNA levels in the native explanted liver correlated with a higher risk of FCH [38]. Histopathological variants: Plasma cell-rich recurrent hepatitis, a still open issue In 2007, Khettry et al [11] described nine cases (10% of their series) of recurrent hepatitis C with periportal and centrolobular necrosis and inflammation, characterized by a prominent plasma cell component. The authors named this entity post-liver transplantation autoimmune-like hepatitis and postulated that the interplay among the recipient s immune system, HCV replication and antigenicity, and immunosuppression therapy might occur in the development of this hyperimmune inflammatory reaction. Furthermore, although on the basis of non-scheduled biopsies, this autoimmune-like hepatitis seemed to be related to fibrosis progression [11]. In the same period, Fiel et al [39] highlighted that more than 80% of plasma cell hepatitis in their series occurred after a reduction in immunosuppression (calcineurin inhibitors), and that 55% had at least one previous episode of rejection. These findings led the authors to the conclusion that the plasma cell hepatitis was a form of rejection. An editorial by Demetris et al [45] in the same year underlined 2812 March 21, 2014 Volume 20 Issue 11

94 Vasuri F et al. Histopathological analysis of recurrent hepatitis C A B C D Figure 2 Histopathological appearance of fibrosing cholestatic recurrent hepatitis C. Hematoxylin-eosin stain 10 (A) and 40 (B) magnification: note the lobular architectural disarray, the portal tract fibrosis and distortion, the lobular necrosis with Councilman bodies and the cholestasis with hepatocellular feathery degeneration and ballooning. The immunohistochemistry for keratin 19 (C) highlights the prominent ductular reaction, while the reticulin stain (D) indicates advanced fibrosis. that HCV can stimulate some types of autoimmune alterations both in allografts and native livers [12]. Moreover, antiviral therapy can unleash autoimmune-mediated liver damage, as described for pegylated-interferon with or without ribavirin [40-43]. Finally, a case-control study described the worse prognosis of plasma cell-rich hepatitis, which interestingly was also correlated with the presence of plasma cells in the explanted liver in one study, suggesting the existence of an immunological disposition in some patients [44]. In 2009, Demetris classified the plasma cell-rich autoimmune hepatitis as a histopathological variant of recurrent hepatitis C, albeit stating that determining whether this represents an autoimmune variant of HCV, acute rejection, actual autoimmune hepatitis, or a combination of these possibilities requires a more thorough patient evaluation than what is currently done at most centers and further study [12,45]. Histopathological variants: recurrent hepatitis C with granulomas Not included in the Demetris classification of 2009 [12], was the possibility of a liver granulomatous reaction as presentation of HCV recurrent disease, first postulated in a case reported by Bárcena et al [46], although HCV was already listed as a possible cause of post-olt granulomas in a series of 42 recipients in 1995 [47]. Ten years later, non-necrotizing lobular (more rarely portal) granulomas were observed in unscheduled biopsies of four (8%) out of 53 HCV-positive recipients [48]. After the exclusion of other etiologies, the authors ascribed the granulomatous disease to hepatitis C. In another retrospective study in the same period, granulomas were found in 14 (1.7%) out of 820 HCV-positive recipients [49]. In this series, 10 cases were found on protocol biopsies, and four on biopsies performed for clinical indications: the prevalent lobular localization of the granulomas was confirmed, and since most patients received pegylated interferon, the authors hypothesized that granuloma formation may be indicative of antiviral stimulation against intrahepatic HCV [49]. The question whether this very rare biopsy finding represents a form of antiviral immune reaction, ultimately drug-modulated, still remains open, as is the role of the granulomatous reaction in fibrosis progression and graft survival. CHOLESTATIC RECURRENT HEPATITIS C: PROGNOSTIC ROLE OF POST-OLT LIVER BIOPSY Apart from the assessment of fibrosis progression, which will be discussed below, histopathological evaluation can play a prognostic role in the identification of those morphological features predictive of a worse outcome. In addition to some still debated histopathological characteristics, e.g., steatosis [50,51], apoptosis, or bile duct proliferation [52], another feature with a well-known impact on recipient outcome is cholestasis (Figure 3). The 2813 March 21, 2014 Volume 20 Issue 11

95 Vasuri F et al. Histopathological analysis of recurrent hepatitis C A B C D Figure 3 Histopathological features with a prognostic significance in recurrent hepatitis C. Steatosis (A) and cholestasis (B) are well shown. Cholestasis can be associated with bile duct proliferation (C) and/or hepatocellular ballooning (D). Hematoxylin-eosin stain, 10 (A) and 40 (B-D) magnification. relationship between cholestasis and a more severe form of recurrent hepatitis C is well established [6,53]. Recently, Moreira et al [54] proposed the so-called Histological Aggressiveness Score, based on the presence or absence of a prominent ductular reaction, hepatocellular ballooning, cholestasis, and periportal/sinusoidal fibrosis, all features typical of the most severe form of recurrent hepatitis C, i.e., FCH. In this study, 170 recipients were stratified into three risk groups using these four histopathological features, which are not included in the conventional grading systems of chronic hepatitis [54]. In our recent experience, the occurrence of a cholestatic recurrent hepatitis C was associated with a significantly higher tissue HCV RNA, and also with a poorer outcome [22]. Although we agree that FCH is by far one of the most aggressive forms of recurrent hepatitis C, we also believe that severe HCV recurrence is not always an indication of FCH. In our routine experience, more traditional features such as the amount of lobular necrosis (i.e., Councilman bodies), as well as the quantitation of intrahepatic HCV RNA (as mentioned below), are strong predictors of a poor outcome as well. Nonetheless, our results are in agreement with Moreira s, since 35% of our high-risk group (or group 3, with both tissue and serum high viral loads) experienced a cholestatic recurrent hepatitis C [22]. It should be borne in mind that Moreira et al [54] excluded recipients with post-olt biliary complications from their study; conversely, we included these recipients in our series, since a connection between recurrent hepatitis C and post-olt biliary complications has been previously proposed [55]. We found that most recipients with previous biliary complications belonged to the high risk group [22]. Future studies are required to investigate the intriguing cross-connection among biliary complications, HCV replication and recurrent hepatitis C. CHRONIC RECURRENT HEPATITIS C: THE PROTOCOL LIVER BIOPSY QUESTION Protocol biopsies and fibrosis progression Chronic (late) recurrent hepatitis C generally presents 6-12 mo after OLT. The main morphological features are portal tract inflammatory infiltrate, mostly composed of lymphocytes, with interface hepatitis and ductular reaction; the lobular necrosis with hepatocellular polymorphism persists depending also on the response to antiviral therapy [4,12,20,56]. The overall picture becomes similar to the histopathological presentation of C hepatitis in native livers. The differential diagnosis of chronic recurrent hepatitis C is usually not difficult for the pathologist, because of the typical histological picture, and because the diagnosis of hepatitis C in liver allograft has already been made on clinical grounds, if not with a previous biopsy. Therefore, there is no full agreement on the usefulness and indications of liver biopsy in this phase, since fibrosis progression in allografts represents the only valuable parameter in the long term for prediction of OLT outcome [10,57-60]. The severity of fibrosis progression in the allograft is determined early: some authors demonstrated that hepatitis grade and fibrosis stage within the first year 2814 March 21, 2014 Volume 20 Issue 11

96 Vasuri F et al. Histopathological analysis of recurrent hepatitis C after OLT might identify those patients with a possible rapid fibrotic evolution [18,52,61]. In order to evaluate and follow fibrosis progression, some centers adopt annual protocol liver biopsies, while others favor the clinical follow-up, with the execution of biopsies only in the case of an increase in transaminase levels or worsening of the clinical picture. In a first key study conducted on recipients followed by protocol biopsies, Gane et al [5] concluded that recipients with moderate chronic hepatitis at 1 year bore a significantly higher risk of cirrhosis development at 5 years, than recipients with mild hepatitis activity. Years later, large analyses on the usefulness of long-term protocol biopsies showed that the proportion of healthy allografts tended to decrease with time after OLT [62,63]. Moreover, in a series of 245 patients with at least 1 year of followup the presence of normal transaminase levels virtually excluded liver damage in non-hcv recipients, while in HCV-positive recipients, the serum tests seemed to be less sensitive, and the authors concluded that the longterm protocol biopsies were useful to assess the progression of recurrent hepatitis C [62]. This is confirmed by the fact that most centers worldwide do not perform longterm protocol biopsies for indications other than HCV [21], while in HCV-positive recipients protocol biopsies are still applied in most centers. The assessment of the hepatitis grade is important as well, as it correlates with staging and fibrosis progression [57,64,65]. Firpi et al [66] found that a fibrosis stage > 2 according to Ishak and/or an hepatitis activity index > 4 at 1 year correlated with a faster fibrosis progression. In a highly selected series of patients, Baiocchi et al [67] found a strong relationship between grade (especially portal inflammation) and fibrosis progression after 1 year. Furthermore, in a series of 159 patients, Ghabril et al [68] found that the HCV activity grade (Ishak > 4) even in the explanted liver was predictive of a more rapid graft fibrosis progression after OLT. In a series, the fibrosis progression in HCV-positive recipients was calculated as 0.8 units (according to Ishak) per year; interestingly, this mean value increased with donor age > 55 years, and decreased with donor age < 35 years [66]. Donor age was confirmed to be an important predictor of faster fibrosis progression in HCV-positive recipients also in further studies [69-74], although not in others [65,75]. Other risk factors include viral quasi-species, number of episodes of ACR, and changes in immunosuppression, as well as the sustained virological response to antiviral therapy [52,58,76]. Graft steatosis in recurrent hepatitis C Steatosis is another long-term histopathological alteration that was firstly considered specific of HCV recurrent disease after OLT in the past [77], especially in association with the HCV genotype 3 [78,79], and it was described also in C hepatitis in non-transplanted livers [80]. Recently, Brandman et al [50] have confirmed the presence of some degree of steatosis in nearly 30% (45 out of 152) HCVpositive recipients 1 year after OLT, especially with genotype 3 infection. HCV can directly induce steatosis by alteration of mitochondrial functions or by interference with the lipid metabolism pathway [79]. However, many factors other than HCV infection are likely to play a role in graft steatosis, including donor-specific characteristics such as donor age, or the occurrence of pre-transplant hypertension [50]. This issue surely deserves further studies, since post-olt steatosis and metabolic syndrome seem to be related, with a higher risk of fibrosis progression 1 year after OLT [50,70,81,82], although not all investigators agree [83,84]. HISTOPATHOLOGICAL DIFFERENTIAL DIAGNOSES OF RECURRENT HEPATITIS C Recurrent hepatitis C vs acute cellular rejection The most important differential diagnosis in the early post-transplant phases lies between recurrent viral hepatitis and ACR, especially of mild grade, and is primarily based on liver biopsy [12,26]. Actually, fully reliable guidelines clearly distinguishing recurrent hepatitis C from mild ACR at histology are not available yet, and the diagnosis is still characterized by low inter- and intraobserver agreement [85] : pathologist experience and the interplay between clinician and pathologist play a pivotal role in diagnosis and recipient management. The more characteristic histopathological features of early recurrent hepatitis C are lobular necrosis, steatosis, and Kupffer cell hyperplasia [26,30,32]. Conversely, the commonest findings in ACR include mixed portal tract inflammatory infiltrate with interface hepatitis, bile duct damage and venulitis, with or without lobular damage [30,86,87] (Figure 4), although in mild ACR these morphological features can be lacking in small biopsies. Since ACR and recurrent hepatitis C often co-exist in the same allograft [12], and since early HCV recurrent disease can sometimes mimic some ACR features (e.g., venulitis or biliary damage) [88,89] (Figure 4C and G), it was also suggested that the Banff criteria should be downgraded in HCV-positive recipients. For example, ACR should be diagnosed only in cases with > 50% of portal tract inflammation with biliary damage and/or > 50% of venulitis [26]. The relevance of this topic is that an ACR over-diagnosis might lead to over-immunosuppression, with serious consequences on HCV replication and graft survival. In fact, in order not to lose any graft to rejection, it is the protocol of many institutions to give the recipient a steroid bolus even only on the basis of a clinical suspicious of ACR, sometimes without liver biopsy. Although the typical features of ACR and HCV recurrence are easily recognizable when singularly present, the overlap of the two conditions still represents a challenge for the pathologist; in our institution RT- PCR for HCV RNA quantitation is mostly used for this differential diagnosis, as also suggested by others [23,28,90,91]. Other important, albeit less frequent conditions that are included in the differential diagnosis with early recurrent 2815 March 21, 2014 Volume 20 Issue 11

97 Vasuri F et al. Histopathological analysis of recurrent hepatitis C Recurrent hepatitis C Acute cellular rejection A E Lobular damage Endothelialitis Bile duct aggression Portal inflammation B C D F G H Figure 4 Histopathological appearance of recurrent hepatitis C (left) and acute cellular rejection (right). Portal inflammation is commonly mild in recurrent hepatitis C (A), with a predominant lympho-monocytic infiltrate and mild bile duct invasion (B), while in acute cellular rejection there is a mixed and more pronounced inflammatory infiltrate (E), with evident bile duct invasion (F). Endothelialitis can be found in both conditions (C, G). Lobular necrosis is more typical of recurrent hepatitis C (D); in acute cellular rejection hemorrhage and sinusoid dilatation are more evident (H). hepatitis C are ischemia/reperfusion injury, post-olt surgical complications, and drug reactions. Of note, the occurrence of preservation injuries in HCV-positive recipients was correlated with a poorer outcome [92] March 21, 2014 Volume 20 Issue 11

98 Vasuri F et al. Histopathological analysis of recurrent hepatitis C Other differential diagnoses The FCH histopathological picture is quite peculiar, and the main differential diagnoses include: ischemic injury due to hepatic artery thrombosis, extrahepatic biliary obstruction, adverse drug reactions, and chronic rejection (after 6 mo). All these conditions are characterized by hepatocyte ballooning, perivenular centro-lobular necrosis, cholestasis and Kupffer cell activation, as seen in FCH [32,35,93]. However, some features are distinctive of particular conditions, such as pilocytic neutrophil infiltrate in ascending cholangitis, portal edema, ductular reaction with neutrophils, and periductular fibrosis in large bile duct obstruction, and a scarcity of biliary ducts with mild portal inflammation in chronic rejection. In this latter case, the timing is important too. Finally, the distinction between FCH and typical recurrent hepatitis C, with or without fibrosis or cholestasis, is mainly based on the rapidity of graft failure and the lack of response to antiviral therapy. However, histology alone cannot be enough for a certain diagnosis of FCH, and the clinical picture, together with HCV RNA quantitation are required [94]. As discussed above, the differential diagnosis of plasma cell-rich hepatitis is very difficult, also because the distinction between autoimmune damage, hyperimmune damage (HCV- or drug-induced), and alloimmune damage (i.e., a plasma cell-rich rejection) is not always sharp. The clinical setting is crucial for the correct diagnosis of the recipient: the occurrence of de novo autoimmune antibodies (antinuclear antibodies, smooth muscle antibodies, LKM1 > 1:320 and anti-gstt1), a concurrent autoimmune disease and/or the serum markers can lead to the diagnosis of de novo autoimmune hepatitis [12,39]. According to a recent proposal by Fiel et al [39], a diagnosis of de novo autoimmune hepatitis is recommended when plasma cells represent at least 30% of the total inflammation, and interface hepatitis and lobular necrosis are mainly represented by plasma cells. Cytomegalovirus (CMV) infection is a common complication of OLT (up to 17%) [95], and is not likely to influence the course of HCV disease or ACR [96]. Since the distinctive features of CMV infection (e.g., nuclear inclusions) are frequently absent in the post-olt biopsy, lobular necrosis and disarray together with variable portal inflammation can add to the differential diagnosis in early recurrent hepatitis C [95]. Other non-specific, albeit helpful morphological findings in CMV infection, apart from the typical inclusions, are represented by mild bile duct damage, lobular microabscesses and lobular microgranulomas. In cases where CMV infection is suspected, specific immunohistochemistry (IHC) is recommended. Chronic recurrent hepatitis C is characterized by a portal mononuclear infiltrate with variable degrees of interface hepatitis. The biliary damage can be present, but it is not as severe and/or widespread as in chronic rejection, where bile duct regression can be the prevalent feature, also in the absence of inflammatory infiltrate [12]. ANCILLARY TECHNIQUES: IMMUNOHISTOCHEMISTRY HCV detection in liver tissue Since the nineties, many studies have tried to investigate the possible use of IHC to establish the presence of HCV antigens (mainly nonstructural antigen 4 or NS4, and c-100) in liver tissue. Notably, almost all these studies identified some grade of IHC positivity in HCV-positive patients, but without correlations with the histological findings and the clinical data [97-101]. However, it must be borne in mind that these IHC techniques often lacked reproducibility between laboratories, and cross-reactions were found in some cases [37,102]. Ballardini et al [103] first applied IHC for different HCV antigens (c100, c33, c22, NS5) in HCV-positive OLT recipients, and showed that IHC positivity appeared in hepatocyte cytoplasm in almost all livers at day 20 post- OLT [104]. Among the cases with acute lobular hepatitis, a median of 80% of positive hepatocytes was found, while in all other cases the percentage positivity was never greater than 30% [103]. The authors concluded that IHC might be used to support the diagnosis of recurrent hepatitis C when histology alone was not conclusive [104]. Studies from our group confirmed a strong correlation between IHC positivity in hepatocyte cytoplasm and intrahepatic viral load with RT-PCR [23,105]. IHC detection of HCV was associated with the typical histopathological features of hepatitis C (hepatocyte single-cell necrosis, bile duct damage, cholestasis, lymphoid aggregate) in a single study [106], while in another paper post-olt IHC positivity for anti-hcv core proteins correlated with IHC positivity in explanted livers and with the development of a cholestatic recurrent hepatitis C [107]. Finally, a recent work with a monoclonal antibodies against HCVenvelope 2 found a stronger positivity in definite or probable recurrent hepatitis C than in other conditions (including ACR) [108] ; this IHC positivity did not correlate with HCV RNA serum levels. Hepatic stellate cell activation IHC has been used in the investigation of some features which can indirectly be related to recurrent hepatitis C diagnosis and progression. Some papers of the same period applied IHC for α smooth muscle actin (α-sma) in order to detect activated mesenchymal hepatic stellate cells (HSC) in the portal tracts and fibrous septa in OLT specimens from HCV-positive recipients [ ]. The amount of α-sma-positive cells were predictive of recurrent hepatitis C with high histological activity, leading to an HSC-mediated rapid fibrosis [110], regardless of the amount of collagen deposition measured by the trichrome stain [111]. For the study of HSC activation in recurrent hepatitis C, glial fibrillary acid protein has also been proposed and compared with α-sma [112]. Meriden et al [52] have studied keratin 19 (K19) in bile 2817 March 21, 2014 Volume 20 Issue 11

99 Vasuri F et al. Histopathological analysis of recurrent hepatitis C duct proliferation and the expression of vimentin in HSC, portal mesenchymal cells and some biliary epithelial cells, with an increased expression of both markers in those patients with faster fibrosis progression, independently of the amount of collagen deposition as measured by Sirius Red. Early activation of HSC preceding collagen deposition was also described and, together with bile duct proliferation, was determined to play a role in fibrosis progression. Other applications of immunohistochemistry Claudin-1 protein is a tight junction protein expressed mainly on the apical-canalicular site of hepatocytes, and represents one of the most important HCV receptors. A recent study by Zadori et al [113] on 12 HCV-positive allografts found that cases with low apical Claudin-1 IHC expression at 1 year after OLT had a better response to antiviral therapy. Moreover, a correlation between Claudin-1 and the degree of fibrosis was found. As far as the differential diagnosis between recurrent hepatitis C and ACR is concerned, some markers have been proposed. The utility of IHC for C4d is still debated: some preliminary analyses reported that C4d tissue positivity, detected by means of IHC or immunofluorescence, was markedly higher in rejection cases than in recurrent hepatitis C [ ]. However, a more recent study found C4d positivity in 17.6% of ACR biopsies vs 25.9% of recurrent hepatitis C [117]. These results illustrate the controversial use of C4d for routine diagnosis. MacQuillan et al [118] studied the expression of MxA protein, a GTPase involved in interferon pathway activation, on 14 HCV-positive OLT patients, and found higher MxA expression in hepatocytes and monocytes of recurrent hepatitis C cases. These results are in contrast with Borgogna et al [119], who found a positive correlation between MxA expression and ACR, although they also observed a lower rate of fibrosis progression in patients with recurrent hepatitis C and concomitant strong MxA expression. These studies included cases with HCV-ACR overlap and cases treated with steroid boluses, which were likely to further confuse the scenario, and according to the same authors, validations on wider series are required. The IHC evaluation of the cell-cycle marker minichromosome maintenance protein-2 (Mcm-2) was also proposed in the literature: a single study found up to 24% of Mcm-2 positive hepatocytes in recipients who later developed fibrosis, vs 5% of patients without fibrosis [120]. Moreover, the portal tracts in ACR biopsies were reported to show more Mcm-2-positive lymphocytes, than in recurrent hepatitis C biopsies [121]. ANCILLARY TECHNIQUES: RT-PCR HCV RNA quantitation in liver tissue The first study of tissue HCV RNA quantitation was carried by Di Martino et al [122] on 84 biopsies from 33 HCVpositive recipients and HCV RNA was markedly higher in biopsies of HCV recurrence with lobular hepatitis, regardless of the occurrence of genotype 1b. Moreover, tissue HCV RNA seemed to decrease in the transition from lobular (acute) hepatitis to chronic hepatitis C, probably due to the host s response against HCV in the long term. Finally, an interesting positive correlation between the levels of HCV RNA at the first pre-transplant biopsy and the risk of chronization was found [122]. In the same year, Cirocco et al [90] confirmed on a series of 23 biopsies that tissue HCV RNA was significantly higher in recurrent hepatitis C cases than in other allograft conditions: moreover, the same authors confirmed these data using in situ RT-PCR on 25 recipients [123]. According to Aardema et al [124], who studied four sequential protocol biopsies in 26 recipients, intrahepatic HCV RNA was directly related to the degree of lobular hepatitis, but not to serum HCV. A semi-quantitative analysis of the HCV intermediate RNA filament, a marker of viral replication, showed that HCV started replicating very early after OLT: interestingly, this replication correlated with the other viral antigens, but neither with histological hepatic damage nor with serum HCV [125]. A further semi-quantitative PCR analysis on non-protocol biopsies showed that intrahepatic HCV RNA correlated with Fas mrna and DNA fragmentation, which represent important indexes of liver cells apoptosis [28]. Gottschlich et al [91] confirmed in 2001 the usefulness of tissue HCV RNA quantitation in the differential diagnosis between recurrent hepatitis C and ACR, on 72 biopsies from a series of 36 OLT recipients. After stratifying the recipients into different histopathological groups, i.e., recurrent hepatitis C (probable and definite), indeterminate, and ACR (probable and definite), they noticed significantly higher HCV RNA levels in the HCV groups, even if the probable rejection group had high levels as well. The authors hypothesized that ACR episodes might be able to increase viral replication or, more likely, that recurrent hepatitis C and ACR can coexist, with hepatitis C as the predominant process. The conclusions were that recipients with low intrahepatic HCV RNA were not likely to have recurrent hepatitis C, although high HCV RNA did not exclude ACR [91]. Starting from these assumptions, in 2008 our group carried out RT-PCR quantitation of non-scheduled biopsies from 65 consecutive HCV recipients: in this work we confirmed that intrahepatic HCV RNA correlated with IHC positivity for viral antigens and Councilman bodies (C/P ratio, see above), and we described a 73% sensitivity and 85% specificity for RT-PCR in discriminating recurrent hepatitis C from other conditions, assuming a cut-off value of 1.1 IU/ng [23]. One year later, in a methodological study on 215 biopsies, we described the correlation between intrahepatic HCV RNA and IHC, serum HCV RNA, and the main liver serum markers [105]. Finally, we recently proposed that the quantitation of HCV RNA on the first biopsy, together with the serum HCV RNA, might have a prognostic impact. Indeed, on the basis of tissue and serum HCV RNA loads, we stratified 83 HCV 2818 March 21, 2014 Volume 20 Issue 11

100 Vasuri F et al. Histopathological analysis of recurrent hepatitis C recipients into three categories: (1) tissue HCV RNA 1.5 IU/ng with any serum HCV RNA (68% recurrence rate and 0% HCV-related mortality); (2) tissue HCV RNA > 1.5 IU/ng and serum HCV RNA < copies/ml (91% recurrence rate and 14% mortality); and (3) tissue HCV RNA > 1.5 IU/ng and serum HCV RNA copies/ml (100% recurrence rate and 45% HCVrelated mortality). Moreover, we lowered the diagnostic cut-off value to 0.85 IU/ng, with 89% sensitivity and 71% specificity [22]. Prospective studies on larger series are required in order to confirm the true prognostic value of HCV RNA quantitation, and it is our opinion (together with Gottschlich) [91] that RT-PCR alone can be misleading, and it must always be interpreted in the context of the overall clinical and morphological background. Interleukin-28B polymorphism Apart from the quantitation of serum and intrahepatic viral load, RT-PCR technology has recently also been applied in the study of recipient genetic variability, such as the case of interleukin 28B (IL-28B), or type-Ⅲ interferon, whose polymorphism has been correlated with the response to antiviral therapy, or even spontaneous viral clearance, in hepatitis C [126]. As for the OLT setting, in an intriguing case report of a recipient engrafted with two liver lobes from two different living donors, different stages of fibrosis and different tissue HCV RNA were found in the two grafts after 2 years; the authors attributed this diversity to the IL-28B genetic variants in the two grafts [127]. In recent studies, different rates of sustained virological response to therapy were reported according to the presence or absence of favorable IL-28B genotypes (C/C and/or T/T genotype, according to the different studies) both in donor and recipient livers [ ]. Moreover, recipient IL-28B non-c/c genotype was an independent risk factor for cholestatic recurrent hepatitis C [133]. As underlined by Fabris et al [134] in non-transplanted HCV patients, and also in OLT recipients, the decision about antiviral therapy is driven by clinical indications, such as transaminases level and HCV genotype, and nowadays donor/recipient genotyping still does not help the clinician in the decision. However, we guess that the application of these technical procedures on donor and recipient tissue will represent a valid aid for the pathologist (and the clinician) for the routine management of HCV-positive recipients in the future. Other cytokines analyzed by RT-PCR in the post- OLT HCV setting are IL-2 and IL-4: in a series of 52 OLT recipients and 22 non-transplanted patients, Dharancy et al [135] found that IL-4 expression was high in severe hepatitis recurrence C cases, and lower in mild HCV infection and HCV-negative cases; IL-4 expression was confirmed in tissue by means of IHC. Nowadays, molecular techniques such as microarrays have been validated for use in the differential diagnosis between recurrent hepatitis C and ACR [136] ; this issue is not discussed in the present review. CONCLUSION Although the morphological features of recurrent hepatitis C have been well described in the last few decades, differential diagnosis can still represent a challenge for pathologists, especially in the setting of early recurrent hepatitis C and mild ACR. In addition to the clinical data, essential for the exclusion of other pathological conditions, many ancillary techniques have been proposed, and are mainly based on IHC. Very few of these techniques have been used routinely, and nowadays HCV RNA quantitation by means of RT-PCR has largely replaced IHC for HCV in most laboratories. Indeed, albeit more expensive, RT-PCR is by far more sensitive and specific than IHC, and can be of great help in the early post-olt management of recipients, even if RT-PCR itself is likely to be replaced in the future by some new technologies (not included in the present review). An open question is whether RT-PCR might be useful in the long post-olt term, i.e., if HCV RNA intrahepatic viral load after 1 year or more might have a prognostic meaning, for example in predicting fibrosis progression, or if other factors prevail, such as the host immune system, HSC activation, etc. Future prospective studies with an adequate follow-up are surely required. Protocol biopsies represent another important issue: without doubt they are very useful in the study of allograft disease progression, but they are not free from complications and might not be accepted by patients. It is likely that each transplant team will formulate its policy for post-transplant biopsies in the future, since arguments exist both in support of and against protocol biopsies. There is no doubt that protocol biopsies will be indispensable in answering other open questions, such as the significance of plasma cell infiltrate in HCV-positive allografts, the real prognostic weight of HCV-induced graft steatosis, and the impact of donor age and graft characteristics in recurrent hepatitis C. REFERENCES 1 Terrault N. Liver transplantation in the setting of chronic HCV. Best Pract Res Clin Gastroenterol 2012; 26: [PMID: DOI: /lt.23559] 2 Belli LS, Alberti A, Rondinara GF, de Carlis L, Romani F, Ideo G, Belli L. Recurrent HCV hepatitis after liver transplantation. Lancet 1993; 341: 378 [PMID: ] 3 Shiffman ML, Contos MJ, Luketic VA, Sanyal AJ, Purdum PP, Mills AS, Fisher RA, Posner MP. Biochemical and histologic evaluation of recurrent hepatitis C following orthotopic liver transplantation. Transplantation 1994; 57: [PMID: ] 4 Greenson JK, Svoboda-Newman SM, Merion RM, Frank TS. Histologic progression of recurrent hepatitis C in liver transplant allografts. Am J Surg Pathol 1996; 20: [PMID: ] 5 Gane EJ, Portmann BC, Naoumov NV, Smith HM, Underhill JA, Donaldson PT, Maertens G, Williams R. Long-term outcome of hepatitis C infection after liver transplantation. N Engl J Med 1996; 334: [PMID: ] 2819 March 21, 2014 Volume 20 Issue 11

101 Vasuri F et al. Histopathological analysis of recurrent hepatitis C 6 Schluger LK, Sheiner PA, Thung SN, Lau JY, Min A, Wolf DC, Fiel I, Zhang D, Gerber MA, Miller CM, Bodenheimer HC. Severe recurrent cholestatic hepatitis C following orthotopic liver transplantation. Hepatology 1996; 23: [PMID: ] 7 Guerrero RB, Batts KP, Burgart LJ, Barrett SL, Germer JJ, Poterucha JJ, Wiesner RH, Charlton MR, Persing DH. Early detection of hepatitis C allograft reinfection after orthotopic liver transplantation: a molecular and histologic study. Mod Pathol 2000; 13: [PMID: ] 8 McCaughan GW, Zekry A. Pathogenesis of hepatitis C virus recurrence in the liver allograft. Liver Transpl 2002; 8: S7-S13 [PMID: ] 9 Garcia-Retortillo M, Forns X, Feliu A, Moitinho E, Costa J, Navasa M, Rimola A, Rodes J. Hepatitis C virus kinetics during and immediately after liver transplantation. Hepatology 2002; 35: [PMID: ] 10 Guo L, Orrego M, Rodriguez-Luna H, Balan V, Byrne T, Chopra K, Douglas DD, Harrison E, Moss A, Reddy KS, Williams JW, Rakela J, Mulligan D, Vargas HE. Living donor liver transplantation for hepatitis C-related cirrhosis: no difference in histological recurrence when compared to deceased donor liver transplantation recipients. Liver Transpl 2006; 12: [PMID: ] 11 Khettry U, Huang WY, Simpson MA, Pomfret EA, Pomposelli JJ, Lewis WD, Jenkins RL, Gordon FD. Patterns of recurrent hepatitis C after liver transplantation in a recent cohort of patients. Hum Pathol 2007; 38: [PMID: ] 12 Demetris AJ. Evolution of hepatitis C virus in liver allografts. Liver Transpl 2009; 15 Suppl 2: S35-S41 [PMID: DOI: /lt.21890] 13 Pacholczyk M, Łągiewska B, Lisik W, Tronina O, Wasiak D, Cieciura T, Chmura A. Liver transplantation for HCV cirrhosis; cautious optimism after 10 years of experience. Ann Transplant 2012; 17: 5-10 [PMID: ] 14 Wright TL, Donegan E, Hsu HH, Ferrell L, Lake JR, Kim M, Combs C, Fennessy S, Roberts JP, Ascher NL. Recurrent and acquired hepatitis C viral infection in liver transplant recipients. Gastroenterology 1992; 103: [PMID: ] 15 Randhawa PS, Demetris AJ. Hepatitis C virus infection in liver allografts. Pathol Annu 1995; 30 Pt 2: [PMID: ] 16 Gallegos-Orozco JF, Yosephy A, Noble B, Aqel BA, Byrne TJ, Carey EJ, Douglas DD, Mulligan D, Moss A, de Petris G, Williams JW, Rakela J, Vargas HE. Natural history of postliver transplantation hepatitis C: A review of factors that may influence its course. Liver Transpl 2009; 15: [PMID: DOI: /lt.21954] 17 Shuhart MC, Bronner MP, Gretch DR, Thomassen LV, Wartelle CF, Tateyama H, Emerson SS, Perkins JD, Carithers RL. Histological and clinical outcome after liver transplantation for hepatitis C. Hepatology 1997; 26: [PMID: ] 18 Prieto M, Berenguer M, Rayón JM, Córdoba J, Argüello L, Carrasco D, García-Herola A, Olaso V, De Juan M, Gobernado M, Mir J, Berenguer J. High incidence of allograft cirrhosis in hepatitis C virus genotype 1b infection following transplantation: relationship with rejection episodes. Hepatology 1999; 29: [PMID: ] 19 Sugo H, Balderson GA, Crawford DH, Fawcett J, Lynch SV, Strong RW, Futagawa S. The influence of viral genotypes and rejection episodes on the recurrence of hepatitis C after liver transplantation. Surg Today 2003; 33: [PMID: ] 20 Germani G, Tsochatzis E, Papastergiou V, Burroughs AK. HCV in liver transplantation. Semin Immunopathol 2013; 35: [PMID: DOI: /s ] 21 Mells G, Neuberger J. Protocol liver allograft biopsies. Transplantation 2008; 85: [PMID: DOI: / TP.0b013e318176b1fd] 22 Vasuri F, Morelli MC, Gruppioni E, Fiorentino M, Ercolani G, Cescon M, Pinna AD, Grigioni WF, D Errico-Grigioni A. The meaning of tissue and serum HCV RNA quantitation in hepatitis C recurrence after liver transplantation: a retrospective study. Dig Liver Dis 2013; 45: [PMID: DOI: /j.dld ] 23 D Errico-Grigioni A, Fiorentino M, Vasuri F, Gruppioni E, Fabbrizio B, Zucchini N, Ballardini G, Morelli C, Pinna AD, Grigioni WF. Tissue hepatitis C virus RNA quantification and protein expression help identify early hepatitis C virus recurrence after liver transplantation. Liver Transpl 2008; 14: [PMID: DOI: /lt.21375] 24 Saraf N, Fiel MI, Deboccardo G, Emre S, Schiano TD. Rapidly progressive recurrent hepatitis C virus infection starting 9 days after liver transplantation. Liver Transpl 2007; 13: [PMID: ] 25 Park YN, Boros P, Zhang DY, Sheiner P, Kim-Schluger L, Thung SN. Serum hepatitis C virus RNA levels and histologic findings in liver allografts with early recurrent hepatitis C. Arch Pathol Lab Med 2000; 124: [PMID: ] 26 Demetris AJ, Eghtesad B, Marcos A, Ruppert K, Nalesnik MA, Randhawa P, Wu T, Krasinskas A, Fontes P, Cacciarelli T, Shakil AO, Murase N, Fung JJ, Starzl TE. Recurrent hepatitis C in liver allografts: prospective assessment of diagnostic accuracy, identification of pitfalls, and observations about pathogenesis. Am J Surg Pathol 2004; 28: [PMID: ] 27 Crespo J, Rivero M, Mayorga M, Fabrega E, Casafont F, Gomez-Fleitas M, Pons-Romero F. Involvement of the fas system in hepatitis C virus recurrence after liver transplantation. Liver Transpl 2000; 6: [PMID: ] 28 Di Martino V, Brenot C, Samuel D, Saurini F, Paradis V, Reynés M, Bismuth H, Féray C. Influence of liver hepatitis C virus RNA and hepatitis C virus genotype on FAS-mediated apoptosis after liver transplantation for hepatitis C. Transplantation 2000; 70: [PMID: ] 29 Lim EJ, Chin R, Angus PW, Torresi J. Enhanced apoptosis in post-liver transplant hepatitis C: effects of virus and immunosuppressants. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 30 Saxena R, Crawford JM, Navarro VJ, Friedman AL, Robert ME. Utilization of acidophil bodies in the diagnosis of recurrent hepatitis C infection after orthotopic liver transplantation. Mod Pathol 2002; 15: [PMID: ] 31 Davies SE, Portmann BC, O Grady JG, Aldis PM, Chaggar K, Alexander GJ, Williams R. Hepatic histological findings after transplantation for chronic hepatitis B virus infection, including a unique pattern of fibrosing cholestatic hepatitis. Hepatology 1991; 13: [PMID: ] 32 Narang TK, Ahrens W, Russo MW. Post-liver transplant cholestatic hepatitis C: a systematic review of clinical and pathological findings and application of consensus criteria. Liver Transpl 2010; 16: [PMID: DOI: /lt.22175] 33 Taga SA, Washington MK, Terrault N, Wright TL, Somberg KA, Ferrell LD. Cholestatic hepatitis C in liver allografts. Liver Transpl Surg 1998; 4: [PMID: ] 34 Dixon LR, Crawford JM. Early histologic changes in fibrosing cholestatic hepatitis C. Liver Transpl 2007; 13: [PMID: ] 35 Verna EC, Abdelmessih R, Salomao MA, Lefkowitch J, Moreira RK, Brown RS. Cholestatic hepatitis C following liver transplantation: an outcome-based histological definition, clinical predictors, and prognosis. Liver Transpl 2013; 19: [PMID: ] 36 McCaughan GW, Zekry A. Mechanisms of HCV reinfection and allograft damage after liver transplantation. J Hepatol 2004; 40: [PMID: ] 37 Doughty AL, Painter DM, McCaughan GW. Nonspecificity of monoclonal antibody Tordji-22 for the detection of hepa March 21, 2014 Volume 20 Issue 11

102 Vasuri F et al. Histopathological analysis of recurrent hepatitis C titis C virus in liver transplant recipients with cholestatic hepatitis. Liver Transpl Surg 1999; 5: [PMID: ] 38 Deshpande V, Burd E, Aardema KL, Ma CK, Moonka DK, Brown KA, Abouljoud MS, Nakhleh RE. High levels of hepatitis C virus RNA in native livers correlate with the development of cholestatic hepatitis in liver allografts and a poor outcome. Liver Transpl 2001; 7: [PMID: ] 39 Fiel MI, Agarwal K, Stanca C, Elhajj N, Kontorinis N, Thung SN, Schiano TD. Posttransplant plasma cell hepatitis (de novo autoimmune hepatitis) is a variant of rejection and may lead to a negative outcome in patients with hepatitis C virus. Liver Transpl 2008; 14: [PMID: DOI: /lt.21447] 40 Kontorinis N, Agarwal K, Elhajj N, Fiel MI, Schiano TD. Pegylated interferon-induced immune-mediated hepatitis post-liver transplantation. Liver Transpl 2006; 12: [PMID: ] 41 Berardi S, Lodato F, Gramenzi A, D Errico A, Lenzi M, Bontadini A, Morelli MC, Tamè MR, Piscaglia F, Biselli M, Sama C, Mazzella G, Pinna AD, Grazi G, Bernardi M, Andreone P. High incidence of allograft dysfunction in liver transplanted patients treated with pegylated-interferon alpha-2b and ribavirin for hepatitis C recurrence: possible de novo autoimmune hepatitis? Gut 2007; 56: [PMID: ] 42 Selzner N, Guindi M, Renner EL, Berenguer M. Immunemediated complications of the graft in interferon-treated hepatitis C positive liver transplant recipients. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 43 Levitsky J, Fiel MI, Norvell JP, Wang E, Watt KD, Curry MP, Tewani S, McCashland TM, Hoteit MA, Shaked A, Saab S, Chi AC, Tien A, Schiano TD. Risk for immune-mediated graft dysfunction in liver transplant recipients with recurrent HCV infection treated with pegylated interferon. Gastroenterology 2012; 142: e1 [PMID: DOI: /j.gastro ] 44 Ward SC, Schiano TD, Thung SN, Fiel MI. Plasma cell hepatitis in hepatitis C virus patients post-liver transplantation: case-control study showing poor outcome and predictive features in the liver explant. Liver Transpl 2009; 15: [PMID: DOI: /lt.21949] 45 Demetris AJ, Sebagh M. Plasma cell hepatitis in liver allografts: Variant of rejection or autoimmune hepatitis? Liver Transpl 2008; 14: [PMID: DOI: / lt.21518] 46 Bárcena R, Sanromán AL, Del Campo S, García M, Moreno A, De Vicente E, Candela A. Posttransplant liver granulomatosis associated with hepatitis C? Transplantation 1998; 65: [PMID: ] 47 Ferrell LD, Lee R, Brixko C, Bass NM, Lake JR, Roberts JP, Ascher N, Rabkin J. Hepatic granulomas following liver transplantation. Clinicopathologic features in 42 patients. Transplantation 1995; 60: [PMID: ] 48 Vakiani E, Hunt KK, Mazziotta RM, Emond JC, Brown RS, Lefkowitch JH, Bhagat G. Hepatitis C-associated granulomas after liver transplantation: morphologic spectrum and clinical implications. Am J Clin Pathol 2007; 127: [PMID: ] 49 Fiel MI, Shukla D, Saraf N, Xu R, Schiano TD. Development of hepatic granulomas in patients receiving pegylated interferon therapy for recurrent hepatitis C virus post liver transplantation. Transpl Infect Dis 2008; 10: [PMID: ] 50 Brandman D, Pingitore A, Lai JC, Roberts JP, Ferrell L, Bass NM, Terrault NA. Hepatic steatosis at 1 year is an additional predictor of subsequent fibrosis severity in liver transplant recipients with recurrent hepatitis C virus. Liver Transpl 2011; 17: [PMID: DOI: / lt.22389] 51 Subramanian V, Seetharam AB, Vachharajani N, Tiriveedhi V, Angaswamy N, Ramachandran S, Crippin JS, Shenoy S, Chapman WC, Mohanakumar T, Anderson CD. Donor graft steatosis influences immunity to hepatitis C virus and allograft outcome after liver transplantation. Transplantation 2011; 92: [PMID: DOI: / TP.0b013e318235a1ab] 52 Meriden Z, Forde KA, Pasha TL, Hui JJ, Reddy KR, Furth EE, Wells RG. Histologic predictors of fibrosis progression in liver allografts in patients with hepatitis C virus infection. Clin Gastroenterol Hepatol 2010; 8: , 296.e1-8 [PMID: DOI: /j.cgh ] 53 Rosen HR, Gretch DR, Oehlke M, Flora KD, Benner KG, Rabkin JM, Corless CL. Timing and severity of initial hepatitis C recurrence as predictors of long-term liver allograft injury. Transplantation 1998; 65: [PMID: ] 54 Moreira RK, Salomao M, Verna EC, Brown RS, Lefkowitch JH. The Hepatitis Aggressiveness Score (HAS): a novel classification system for post-liver transplantation recurrent hepatitis C. Am J Surg Pathol 2013; 37: [PMID: DOI: /PAS.0b013e31826a92ac] 55 Fujita S, Fujikawa T, Mizuno S, Reed AI, Kim RD, Howard RJ, Firpi RJ, Nelson DR, Hemming AW. Is early recurrence of hepatitis C associated with biliary anastomotic stricture after liver transplantation? Transplantation 2007; 84: [PMID: DOI: /01.tp ] 56 Guzman G, Chennuri R, Voros A, Boumendjel R, Locante A, Patel R, Valyi-Nagy T. Nucleometric study of anisonucleosis, diabetes and oxidative damage in liver biopsies of orthotopic liver transplant recipients with chronic hepatitis C virus infection. Pathol Oncol Res 2011; 17: [PMID: DOI: /s ] 57 Guido M, Fagiuoli S, Tessari G, Burra P, Leandro G, Boccagni P, Cillo U, Naccarato R, Rugge M. Histology predicts cirrhotic evolution of post transplant hepatitis C. Gut 2002; 50: [PMID: ] 58 Roche B, Sebagh M, Canfora ML, Antonini T, Roque-Afonso AM, Delvart V, Saliba F, Duclos-Vallee JC, Castaing D, Samuel D. Hepatitis C virus therapy in liver transplant recipients: response predictors, effect on fibrosis progression, and importance of the initial stage of fibrosis. Liver Transpl 2008; 14: [PMID: DOI: /lt.21635] 59 McKenna GJ, Trotter JF, Klintmalm E, Onaca N, Ruiz R, Jennings LW, Neri M, O Leary JG, Davis GL, Levy MF, Goldstein RM, Klintmalm GB. Limiting hepatitis C virus progression in liver transplant recipients using sirolimus-based immunosuppression. Am J Transplant 2011; 11: [PMID: DOI: /j x] 60 Calvaruso V, Dhillon AP, Tsochatzis E, Manousou P, Grillo F, Germani G, Patch D, O Beirne J, Burroughs AK. Liver collagen proportionate area predicts decompensation in patients with recurrent hepatitis C virus cirrhosis after liver transplantation. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: /j x] 61 Berenguer M, Aguilera V, Prieto M, Carrasco D, Rayón M, San Juan F, Landaverde C, Mir J, Berenguer J. Delayed onset of severe hepatitis C-related liver damage following liver transplantation: a matter of concern? Liver Transpl 2003; 9: [PMID: ] 62 Berenguer M, Rayón JM, Prieto M, Aguilera V, Nicolás D, Ortiz V, Carrasco D, López-Andujar R, Mir J, Berenguer J. Are posttransplantation protocol liver biopsies useful in the long term? Liver Transpl 2001; 7: [PMID: ] 63 Sebagh M, Rifai K, Féray C, Yilmaz F, Falissard B, Roche B, Bismuth H, Samuel D, Reynès M. All liver recipients benefit from the protocol 10-year liver biopsies. Hepatology 2003; 37: [PMID: ] 64 Sreekumar R, Gonzalez-Koch A, Maor-Kendler Y, Batts K, Moreno-Luna L, Poterucha J, Burgart L, Wiesner R, Kremers W, Rosen C, Charlton MR. Early identification of recipients with progressive histologic recurrence of hepatitis C after liver transplantation. Hepatology 2000; 32: [PMID: 2821 March 21, 2014 Volume 20 Issue 11

103 Vasuri F et al. Histopathological analysis of recurrent hepatitis C ] 65 Samonakis DN, Triantos CK, Thalheimer U, Quaglia A, Leandro G, Teixeira R, Papatheodoridis GV, Sabin CA, Rolando N, Davies S, Dhillon AP, Griffiths P, Emery V, Patch DW, Davidson BR, Rolles K, Burroughs AK. Immunosuppression and donor age with respect to severity of HCV recurrence after liver transplantation. Liver Transpl 2005; 11: [PMID: ] 66 Firpi RJ, Abdelmalek MF, Soldevila-Pico C, Cabrera R, Shuster JJ, Theriaque D, Reed AI, Hemming AW, Liu C, Crawford JM, Nelson DR. One-year protocol liver biopsy can stratify fibrosis progression in liver transplant recipients with recurrent hepatitis C infection. Liver Transpl 2004; 10: [PMID: ] 67 Baiocchi L, Angelico M, Petrolati A, Perrone L, Palmieri G, Battista S, Carbone M, Tariciotti L, Longhi C, Orlando G, Tisone G. Correlation between liver fibrosis and inflammation in patients transplanted for HCV liver disease. Am J Transplant 2008; 8: [PMID: DOI: / j x] 68 Ghabril M, Dickson RC, Krishna M, Machicao V, Aranda- Michel J, Bonatti H, Nguyen JH. Explanted liver inflammatory grade predicts fibrosis progression in hepatitis C recurrence. Liver Transpl 2011; 17: [PMID: DOI: /lt.22250] 69 Neumann UP, Berg T, Bahra M, Seehofer D, Langrehr JM, Neuhaus R, Radke C, Neuhaus P. Fibrosis progression after liver transplantation in patients with recurrent hepatitis C. J Hepatol 2004; 41: [PMID: ] 70 Foxton MR, Quaglia A, Muiesan P, Heneghan MA, Portmann B, Norris S, Heaton ND, O Grady JG. The impact of diabetes mellitus on fibrosis progression in patients transplanted for hepatitis C. Am J Transplant 2006; 6: [PMID: ] 71 Belli LS, Burroughs AK, Burra P, Alberti AB, Samonakis D, Cammà C, De Carlis L, Minola E, Quaglia A, Zavaglia C, Vangeli M, Patch D, Dhillon A, Cillo U, Guido M, Fagiuoli S, Giacomoni A, Slim OA, Airoldi A, Boninsegna S, Davidson BR, Rolles K, Pinzello G. Liver transplantation for HCV cirrhosis: improved survival in recent years and increased severity of recurrent disease in female recipients: results of a long term retrospective study. Liver Transpl 2007; 13: [PMID: ] 72 Rayhill SC, Wu YM, Katz DA, Voigt MD, Labrecque DR, Kirby PA, Mitros FA, Kalil RS, Miller RA, Stolpen AH, Schmidt WN. Older donor livers show early severe histological activity, fibrosis, and graft failure after liver transplantation for hepatitis C. Transplantation 2007; 84: [PMID: ] 73 Tallón Aguilar L, Molina García D, Barrera Pulido L, Pareja Ciuró F, Suárez Artacho G, Alamo Martínez JM, Bernal Bellido C, García González I, Serrano Díaz-Canedo J, Gómez Bravo MA, Bernardos Rodríguez A. Influence of donor age on survival in liver transplantation due to hepatitis C virus. Transplant Proc 2008; 40: [PMID: DOI: /j.transproceed ] 74 Jain A, Singhal A, Kashyap R, Safadjou S, Ryan CK, Orloff MS. Comparative analysis of hepatitis C recurrence and fibrosis progression between deceased-donor and livingdonor liver transplantation: 8-year longitudinal followup. Transplantation 2011; 92: [PMID: DOI: /TP.0b013e ] 75 Yilmaz N, Shiffman ML, Stravitz RT, Sterling RK, Luketic VA, Sanyal AJ, Mills AS, Contos MJ, Coterell A, Maluf D, Posner MP, Fisher RA. A prospective evaluation of fibrosis progression in patients with recurrent hepatitis C virus following liver transplantation. Liver Transpl 2007; 13: [PMID: ] 76 Lionetti R, Tisone G, Palmieri G, Almerighi C, Anselmo A, Tariciotti L, Lenci I, De Luca L, Monaco A, Angelico M. Maintenance ribavirin monotherapy delays fibrosis progression in liver transplant recipients with recurrent hepatitis C at high risk of progression. Dig Liver Dis 2010; 42: [PMID: DOI: /j.dld ] 77 Baiocchi L, Tisone G, Palmieri G, Rapicetta M, Pisani F, Orlando G, Casciani CU, Angelico M. Hepatic steatosis: a specific sign of hepatitis C reinfection after liver transplantation. Liver Transpl Surg 1998; 4: [PMID: ] 78 Gordon FD, Pomfret EA, Pomposelli JJ, Lewis WD, Jenkins RL, Khettry U. Severe steatosis as the initial histologic manifestation of recurrent hepatitis C genotype 3. Hum Pathol 2004; 35: [PMID: ] 79 Testino G, Sumberaz A, Leone S, Borro P. Recurrent hepatitis C and non-alcoholic fatty liver disease in transplanted patients: a review. Minerva Med 2013; 104: [PMID: ] 80 Rubbia-Brandt L, Quadri R, Abid K, Giostra E, Malé PJ, Mentha G, Spahr L, Zarski JP, Borisch B, Hadengue A, Negro F. Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. J Hepatol 2000; 33: [PMID: ] 81 Pelletier SJ, Iezzoni JC, Crabtree TD, Hahn YS, Sawyer RG, Pruett TL. Prediction of liver allograft fibrosis after transplantation for hepatitis C virus: persistent elevation of serum transaminase levels versus necroinflammatory activity. Liver Transpl 2000; 6: [PMID: ] 82 Hanouneh IA, Feldstein AE, McCullough AJ, Miller C, Aucejo F, Yerian L, Lopez R, Zein NN. The significance of metabolic syndrome in the setting of recurrent hepatitis C after liver transplantation. Liver Transpl 2008; 14: [PMID: DOI: /lt.21524] 83 Toniutto P, Fabris C, Avellini C, Minisini R, Bitetto D, Rossi E, Smirne C, Pirisi M. Excess body weight, liver steatosis, and early fibrosis progression due to hepatitis C recurrence after liver transplantation. World J Gastroenterol 2005; 11: [PMID: ] 84 Mindikoglu AL, Regev A, Casanova-Romero PY, Bejarano PA, Martinez EJ, Tzakis AG, Schiff ER. The impact of nonalcoholic fatty liver disease and the metabolic syndrome on progression of fibrosis in patients with recurrent HCV after liver transplantation. Transplant Proc 2006; 38: [PMID: ] 85 Regev A, Molina E, Moura R, Bejarano PA, Khaled A, Ruiz P, Arheart K, Berho M, Drachenberg CB, Mendez P, O Brien C, Jeffers L, Tzakis A, Schiff ER. Reliability of histopathologic assessment for the differentiation of recurrent hepatitis C from acute rejection after liver transplantation. Liver Transpl 2004; 10: [PMID: ] 86 Petrovic LM, Villamil FG, Vierling JM, Makowka L, Geller SA. Comparison of histopathology in acute allograft rejection and recurrent hepatitis C infection after liver transplantation. Liver Transpl Surg 1997; 3: [PMID: ] 87 Petrovic LM. Early recurrence of hepatitis C virus infection after liver transplantation. Liver Transpl 2006; 12: S32-S37 [PMID: ] 88 Yeh MM, Larson AM, Tung BY, Swanson PE, Upton MP. Endotheliitis in chronic viral hepatitis: a comparison with acute cellular rejection and non-alcoholic steatohepatitis. Am J Surg Pathol 2006; 30: [PMID: ] 89 Leung JY, Abraczinskas DR, Bhan AK, Terella AM, Pascual M, Cosimi AB, Chung RT. Recurrent allograft HCV presenting as acute cellular rejection: successful management with interferon and ribavirin alone. Clin Transplant 2003; 17: [PMID: ] 90 Cirocco R, Fragulidis GP, Weppler D, Zucker K, Markou M, Zervos XA, Viciana A, Esquinazi V, Nery JR, Reddy KR, Schiff E, Miller J, Tzakis AG. Recurrent hepatitis C infection following orthotopic liver transplantation is predicted by posttransplant serum and hepatic allograft viral titers. Transplant Proc 1997; 29: [PMID: ] 91 Gottschlich MJ, Aardema KL, Burd EM, Nakhleh RE, Brown 2822 March 21, 2014 Volume 20 Issue 11

104 Vasuri F et al. Histopathological analysis of recurrent hepatitis C KA, Abouljoud MS, Hirst K, Moonka DK. The use of hepatitis C viral RNA levels in liver tissue to distinguish rejection from recurrent hepatitis C. Liver Transpl 2001; 7: [PMID: ] 92 Watt KD, Lyden ER, Gulizia JM, McCashland TM. Recurrent hepatitis C posttransplant: early preservation injury may predict poor outcome. Liver Transpl 2006; 12: [PMID: ] 93 Xiao SY, Lu L, Wang HL. Fibrosing cholestatic hepatitis: clinicopathologic spectrum, diagnosis and pathogenesis. Int J Clin Exp Pathol 2008; 1: [PMID: ] 94 Satapathy SK, Sclair S, Fiel MI, Del Rio Martin J, Schiano T. Clinical characterization of patients developing histologically-proven fibrosing cholestatic hepatitis C post-liver transplantation. Hepatol Res 2011; 41: [PMID: DOI: /j X x] 95 Adeyi O, Fischer SE, Guindi M. Liver allograft pathology: approach to interpretation of needle biopsies with clinicopathological correlation. J Clin Pathol 2010; 63: [PMID: DOI: /jcp ] 96 Teixeira R, Pastacaldi S, Davies S, Dhillon AP, Emery VC, Rolles K, Davidson B, Patch D, Burroughs AK. The influence of cytomegalovirus viraemia on the outcome of recurrent hepatitis C after liver transplantation. Transplantation 2000; 70: [PMID: ] 97 Blight K, Rowland R, Hall PD, Lesniewski RR, Trowbridge R, LaBrooy JT, Gowans EJ. Immunohistochemical detection of the NS4 antigen of hepatitis C virus and its relation to histopathology. Am J Pathol 1993; 143: [PMID: ] 98 González-Peralta RP, Fang JW, Davis GL, Gish RG, Kohara M, Mondelli MU, Urdea MS, Mizokami M, Lau JY. Significance of hepatic expression of hepatitis C viral antigens in chronic hepatitis C. Dig Dis Sci 1995; 40: [PMID: ] 99 Vargas V, Krawczynski K, Castells L, Martinez N, Esteban J, Allende H, Esteban R, Guardia J. Recurrent hepatitis C virus infection after liver transplantation: immunohistochemical assessment of the viral antigen. Liver Transpl Surg 1998; 4: [PMID: ] 100 Brody RI, Eng S, Melamed J, Mizrachi H, Schneider RJ, Tobias H, Teperman LW, Theise ND. Immunohistochemical detection of hepatitis C antigen by monoclonal antibody TORDJI-22 compared with PCR viral detection. Am J Clin Pathol 1998; 110: [PMID: ] 101 Nayak NC, Sathar SA. Immunohistochemical detection of hepatitis C virus antigen in paraffin embedded liver biopsies from patients with chronic liver disease. Acta Histochem 1999; 101: [PMID: ] 102 Fenwick F, Bassendine MF, Agarwal K, Bevitt D, Pumeechockchai W, Burt AD, Toms GL. Immunohistochemical assessment of hepatitis C virus antigen in cholestatic hepatitis after liver transplantation. J Clin Pathol 2006; 59: [PMID: ] 103 Ballardini G, De Raffele E, Groff P, Bioulac-Sage P, Grassi A, Ghetti S, Susca M, Strazzabosco M, Bellusci R, Iemmolo RM, Grazi G, Zauli D, Cavallari A, Bianchi FB. Timing of reinfection and mechanisms of hepatocellular damage in transplanted hepatitis C virus-reinfected liver. Liver Transpl 2002; 8: [PMID: ] 104 Grassi A, Quarneti C, Ravaioli M, Bianchini F, Susca M, D Errico A, Piscaglia F, Tamè MR, Andreone P, Grazi G, Galli S, Zauli D, Pinna AD, Bianchi FB, Ballardini G. Detection of HCV antigens in liver graft: relevance to the management of recurrent post-liver transplant hepatitis C. Liver Transpl 2006; 12: [PMID: ] 105 Gruppioni E, Vasuri F, Fiorentino M, Capizzi E, Altimari A, Pirini MG, Grazi GL, Malvi D, Grigioni WF, D Errico- Grigioni A. Real-time quantitative assay for routine testing of HCV RNA in formalin-fixed, paraffin-embedded liver samples. Diagn Mol Pathol 2009; 18: [PMID: DOI: /PDM.0b013e e31] 106 Nuovo GJ, Holly A, Wakely P, Frankel W. Correlation of histology, viral load, and in situ viral detection in hepatic biopsies from patients with liver transplants secondary to hepatitis C infection. Hum Pathol 2002; 33: [PMID: ] 107 Pessôa MG, Alves VA, Wakamatsu A, Gomes JG, Maertens G, van der Borght B, Kim M, Ferrell L, Wright TL. Posttransplant recurrent hepatitis C: immunohistochemical detection of hepatitis C virus core antigen and possible pathogenic implications. Liver Int 2008; 28: [PMID: DOI: /j x] 108 Sadamori H, Yagi T, Iwagaki H, Matsuda H, Shinoura S, Umeda Y, Ohara N, Yanai H, Ogino T, Tanaka N. Immunohistochemical staining of liver grafts with a monoclonal antibody against HCV-Envelope 2 for recurrent hepatitis C after living donor liver transplantation. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: / j x] 109 Carpino G, Morini S, Ginanni Corradini S, Franchitto A, Merli M, Siciliano M, Gentili F, Onetti Muda A, Berloco P, Rossi M, Attili AF, Gaudio E. Alpha-SMA expression in hepatic stellate cells and quantitative analysis of hepatic fibrosis in cirrhosis and in recurrent chronic hepatitis after liver transplantation. Dig Liver Dis 2005; 37: [PMID: ] 110 Gawrieh S, Papouchado BG, Burgart LJ, Kobayashi S, Charlton MR, Gores GJ. Early hepatic stellate cell activation predicts severe hepatitis C recurrence after liver transplantation. Liver Transpl 2005; 11: [PMID: ] 111 Russo MW, Firpi RJ, Nelson DR, Schoonhoven R, Shrestha R, Fried MW. Early hepatic stellate cell activation is associated with advanced fibrosis after liver transplantation in recipients with hepatitis C. Liver Transpl 2005; 11: [PMID: ] 112 Carotti S, Morini S, Corradini SG, Burza MA, Molinaro A, Carpino G, Merli M, De Santis A, Muda AO, Rossi M, Attili AF, Gaudio E. Glial fibrillary acidic protein as an early marker of hepatic stellate cell activation in chronic and posttransplant recurrent hepatitis C. Liver Transpl 2008; 14: [PMID: DOI: /lt.21436] 113 Zadori G, Gelley F, Torzsok P, Sárváry E, Doros A, Deak AP, Nagy P, Schaff Z, Kiss A, Nemes B. Examination of claudin-1 expression in patients undergoing liver transplantation owing to hepatitis C virus cirrhosis. Transplant Proc 2011; 43: [PMID: DOI: /j.transpr oceed ] 114 Schmeding M, Dankof A, Krenn V, Krukemeyer MG, Koch M, Spinelli A, Langrehr JM, Neumann UP, Neuhaus P. C4d in acute rejection after liver transplantation--a valuable tool in differential diagnosis to hepatitis C recurrence. Am J Transplant 2006; 6: [PMID: ] 115 Lorho R, Turlin B, Aqodad N, Triki N, de Lajarte-Thirouard AS, Camus C, Lakehal M, Compagnon P, Dupont-Bierre E, Meunier B, Boudjema K, Messner M. C4d: a marker for hepatic transplant rejection. Transplant Proc 2006; 38: [PMID: ] 116 Jain A, Ryan C, Mohanka R, Orloff M, Abt P, Romano J, Bryan L, Batzold P, Mantry P, Bozorgzadeh A. Characterization of CD4, CD8, CD56 positive lymphocytes and C4d deposits to distinguish acute cellular rejection from recurrent hepatitis C in post-liver transplant biopsies. Clin Transplant 2006; 20: [PMID: ] 117 Fayek SA. The value of C4d deposit in post liver transplant liver biopsies. Transpl Immunol 2012; 27: [PMID: DOI: /j.trim ] 118 MacQuillan GC, de Boer WB, Allan JE, Platten MA, Reed WD, Jeffrey GP. Hepatocellular MxA protein expression supports the differentiation of recurrent hepatitis C disease from acute cellular rejection after liver transplantation. Clin 2823 March 21, 2014 Volume 20 Issue 11

105 Vasuri F et al. Histopathological analysis of recurrent hepatitis C Transplant 2010; 24: [PMID: DOI: / j x] 119 Borgogna C, Toniutto P, Smirne C, Azzimonti B, Rittà M, Avellini C, Fabris C, Landolfo S, Gariglio M, Pirisi M. Expression of the interferon-inducible proteins MxA and IFI16 in liver allografts. Histopathology 2009; 54: [PMID: DOI: /j x] 120 Marshall A, Rushbrook S, Morris LS, Scott IS, Vowler SL, Davies SE, Coleman N, Alexander G. Hepatocyte expression of minichromosome maintenance protein-2 predicts fibrosis progression after transplantation for chronic hepatitis C virus: a pilot study. Liver Transpl 2005; 11: [PMID: ] 121 Unitt E, Gelson W, Davies SE, Coleman N, Alexander GJ. Minichromosome maintenance protein-2-positive portal tract lymphocytes distinguish acute cellular rejection from hepatitis C virus recurrence after liver transplantation. Liver Transpl 2009; 15: [PMID: DOI: / lt.21680] 122 Di Martino V, Saurini F, Samuel D, Gigou M, Dussaix E, Reynès M, Bismuth H, Féray C. Long-term longitudinal study of intrahepatic hepatitis C virus replication after liver transplantation. Hepatology 1997; 26: [PMID: ] 123 Fragulidis GP, Cirocco RE, Weppler D, Berho M, Gillian G, Markou M, Viciana A, Esquenazi V, Nery JR, Miller J, Reddy KR, Tzakis AG. In situ enzymatic oligonucleotide amplification of hepatitis C virus-rna in liver biopsy specimens (reverse transcriptase in situ polymerase chain reaction) after orthotopic liver transplantation for hepatitis C-related liver disease. Transplantation 1998; 66: [PMID: ] 124 Aardema KL, Nakhleh RE, Terry LK, Burd EM, Ma CK, Moonka DK, Brown KA, Abouljoud MS. Quantitation of hepatitis C virus RNA in liver tissue of allografts: correlation with histologic features and liver function tests. Transplant Proc 1999; 31: [PMID: ] 125 Negro F, Giostra E, Krawczynski K, Quadri R, Rubbia-Brandt L, Mentha G, Colucci G, Perrin L, Hadengue A. Detection of intrahepatic hepatitis C virus replication by strand-specific semi-quantitative RT-PCR: preliminary application to the liver transplantation model. J Hepatol 1998; 29: 1-11 [PMID: ] 126 Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ, Sulkowski M, McHutchison JG, Goldstein DB. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 461: [PMID: DOI: /nature08309] 127 Motomura T, Taketomi A, Fukuhara T, Mano Y, Takeishi K, Toshima T, Harada N, Uchiyama H, Yoshizumi T, Soejima Y, Shirabe K, Matsuura Y, Maehara Y. The impact of IL28B genetic variants on recurrent hepatitis C in liver transplantation: significant lessons from a dual graft case. Am J Transplant 2011; 11: [PMID: DOI: / j x] 128 Coto-Llerena M, Pérez-Del-Pulgar S, Crespo G, Carrión JA, Martínez SM, Sánchez-Tapias JM, Martorell J, Navasa M, Forns X. Donor and recipient IL28B polymorphisms in HCVinfected patients undergoing antiviral therapy before and after liver transplantation. Am J Transplant 2011; 11: [PMID: DOI: /j x] 129 Eurich D, Boas-Knoop S, Ruehl M, Schulz M, Carrillo ED, Berg T, Neuhaus R, Neuhaus P, Neumann UP, Bahra M. Relationship between the interleukin-28b gene polymorphism and the histological severity of hepatitis C virus-induced graft inflammation and the response to antiviral therapy after liver transplantation. Liver Transpl 2011; 17: [PMID: DOI: /lt.22235] 130 Charlton MR, Thompson A, Veldt BJ, Watt K, Tillmann H, Poterucha JJ, Heimbach JK, Goldstein D, McHutchison J. Interleukin-28B polymorphisms are associated with histological recurrence and treatment response following liver transplantation in patients with hepatitis C virus infection. Hepatology 2011; 53: [PMID: DOI: / hep.24074] 131 Duarte-Rojo A, Deneke MG, Charlton MR. Interleukin-28B polymorphism in hepatitis C and liver transplantation. Liver Transpl 2013; 19: [PMID: DOI: / lt.23554] 132 Kawaoka T, Takahashi S, Takaki S, Hiramatsu A, Waki K, Hiraga N, Miki D, Tsuge M, Imamura M, Kawakami Y, Aikata H, Ochi H, Onoe T, Tashiro H, Ohdan H, Chayama K. Interleukin-28B single nucleotide polymorphism of donors and recipients can predict viral response to pegylated interferon/ribavirin therapy in patients with recurrent hepatitis C after living donor liver transplantation. J Gastroenterol Hepatol 2012; 27: [PMID: DOI: / j x] 133 Graziadei IW, Zoller HM, Schloegl A, Nachbaur K, Pfeiffer KP, Mark W, Mikuz G, Pratschke J, Margreiter R, Vogel W. Early viral load and recipient interleukin-28b rs genotype are predictors of the progression of hepatitis C after liver transplantation. Liver Transpl 2012; 18: [PMID: DOI: /lt.23402] 134 Fabris C, Falleti E, Cussigh A, Bitetto D, Fontanini E, Colletta C, Vandelli C, Cmet S, Ceriani E, Smirne C, Toniutto P, Pirisi M. The interleukin 28B rs C/T polymorphism and serum cholesterol as predictors of fibrosis progression in patients with chronic hepatitis C and persistently normal transaminases. J Med Virol 2012; 84: [PMID: DOI: /jmv.23259] 135 Dharancy S, Podevin P, Aoudjehane L, Batteux F, Rosenberg AR, Soubrane O, Calmus Y, Conti F. Elevated interleukin-4 expression in severe recurrent hepatitis C virus after liver transplantation. Transplantation 2007; 83: [PMID: ] 136 Gehrau R, Maluf D, Archer K, Stravitz R, Suh J, Le N, Mas V. Molecular pathways differentiate hepatitis C virus (HCV) recurrence from acute cellular rejection in HCV liver recipients. Mol Med 2011; 17: [PMID: DOI: /molmed ] P- Reviewers: Gruttadauria S, Hanazaki K, Pan JJ S- Editor: Gou SX L- Editor: Cant MR E- Editor: Ma S 2824 March 21, 2014 Volume 20 Issue 11

106 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Hepatitis C virus and metabolic disorder interactions towards liver damage and atherosclerosis TOPIC HIGHLIGHT Umberto Vespasiani-Gentilucci, Paolo Gallo, Antonio De Vincentis, Giovanni Galati, Antonio Picardi Umberto Vespasiani-Gentilucci, Paolo Gallo, Antonio De Vincentis, Giovanni Galati, Antonio Picardi, Internal Medicine and Hepatology Unit, University Campus Bio-Medico of Rome, Rome, Italy Author contributions: Vespasiani-Gentilucci U, Gallo P, De Vincentis A, Galati G and Picardi A contributed to this manuscript. Correspondence to: Antonio Picardi, MD, PhD, Internal Medicine and Hepatology Unit, University Campus Bio-Medico of Rome, Via Alvaro del Portillo 200, Rome, Italy. a.picardi@unicampus.it Telephone: Fax: Received: October 29, 2013 Revised: December 25, 2013 Accepted: January 3, 2014 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) is one of the main causes of liver disease worldwide, and alterations of glucose metabolism have reached pandemic proportions in western countries. However, the frequent coexistence between these two conditions is more than simply coincidental, since HCV can induce insulin resistance through several mechanisms. Indeed, the virus interferes with insulin signaling both directly and indirectly, inducing the production of pro-inflammatory cytokines. Furthermore, the entire viral life cycle has strict interconnections with lipid metabolism, and HCV is responsible for a viral steatosis which is frequently superimposed to a metabolic one. Several evidences suggest that HCV-induced metabolic disorders contribute both to the evolution of liver fibrosis and, likely, to the progression of the other disorders which are typically associated with altered metabolism, in particular atherosclerosis. In the present review, we will examine in depth the links between HCV infection and insulin resistance, liver steatosis and diabetes, and analyze the impact of these interactions on the progression of liver fibrosis and atherosclerosis. Special attention will be focused on the highly debated topic of the relationship between HCV infection and cardiovascular disease. The available clinical literature on this item will be broadly reviewed and all the mechanisms possibly implied will be discussed Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Metabolism; Insulin resistance; Diabetes mellitus; Steatosis; Fibrosis; Atherosclerosis; Cardiovascular risk Core tip: In this review we will analyze the mechanisms possibly contributing to the relationship between hepatitis C virus (HCV) infection and altered metabolism, as well as the clinical data suggesting that HCV-induced metabolic disorders favour both the progression of liver damage in terms of steatosis/fibrosis and the development of atherosclerosis. Particular attention will be devoted to the highly debated topic concerning the link between HCV infection and cardiovascular disease, a time-related interpretation on the factors impacting cardiovascular risk in the course of HCV infection will be provided, and, finally, the complex virus/host interplay will be graphically synthesized to provide an intuitive picture of the item. Vespasiani-Gentilucci U, Gallo P, De Vincentis A, Galati G, Picardi A. Hepatitis C virus and metabolic disorder interactions towards liver damage and atherosclerosis. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2825.htm DOI: org/ /wjg.v20.i METABOLIC EFFECTS OF HEPATITIS C VIRUS INFECTION Hepatitis C virus (HCV) is one of the main causes of 2825 March 21, 2014 Volume 20 Issue 11

107 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism liver disease worldwide [1], with more than 150 million of persons chronically infected, at risk of developing liver cirrhosis and cancer. Moreover, HCV infection is associated with glucose and lipid metabolism disturbances. Alterations of glucose metabolism, i.e., impaired fasting glucose, impaired glucose tolerance and diabetes mellitus (DM), have reached pandemic proportions in western countries [2]. Their keystone is insulin resistance (IR), they are closely linked to obesity and increase the risk of cardiovascular events. Given the prevalence of HCV infection and of these glucose metabolism disturbances, their frequent relationship is not unexpected: however, physiopathologically, it is not only coincidental. In fact, the virus causes IR and predisposes to DM. Several studies analyzed the frequency of DM in HCV-infected patients and confirmed this association. IR and DM are more prevalent in the course of HCV infection than in other liver diseases, independently from the stage of fibrosis [3,4], and HCV infection increases the incidence of DM after liver transplantation [5] ; on the other side, the prevalence of HCV infection among diabetic patients is higher than in the age-matched general population [6]. The coexistence of these metabolic derangements affects the progression and prognosis of liver disease and, at the same time, contributes to the systemic burden of HCV infection. Indeed the virus, through interactions with glucose and lipid homeostasis, via IR and steatosis, adds other mechanisms of liver damage and participates in the pathogenesis of non-liver-related disorders, such as cardiovascular disease [7]. HCV and insulin resistance Several epidemiological, experimental and clinical studies showed that chronic hepatitis C (CHC), from the early stages of infection, is associated with alterations of glucose metabolism. Indeed, both in retrospective and in longitudinal studies, the risk of developing IR or DM of HCV-infected patients, even when corrected for confounding factors, is approximately two-fold [8]. The most commonly used surrogate measure of insulin-resistance, i.e., the homeostatic model assessment (HOMA) index, is elevated also in early stages of disease [9], and it is higher than in patients with chronic HBV-infection matched for age, body mass index (BMI) and fibrosis [8]. Indeed, although an association between HBV infection and glucose metabolism disorders has been suggested, possibly secondary to HBV-induced pancreatic islet injury, epidemiological data are still highly controversial [10]. In addition, people with HCV infection are predisposed to develop DM approximately one decade earlier that those without the infection [3]. Many studies demonstrated that eradication of HCV infection with antiviral therapy is associated with a decrease of HOMA-index and of the incidence of glucose metabolism alterations [11-13], although these data have not been universally confirmed [14]. Moreover, the relationship between HCV and IR seems to be dependent on viral load [8] and more pronounced in genotypes (G) 1, 2 and 4 [15]. The target tissues of HCV-related metabolic disturbances are the liver, the primary site of infection, and the skeletal muscle. It is very interesting to note that the glucidic function of adipose tissue is not affected, unlike what is commonly described in the course of pure IR conditions [16]. Indeed, during euglycemic hyperinsulinemic clamp, patients with CHC without fibrosis and metabolic syndrome show an endogenous glucose output more than three times the normal and an abnormal muscle uptake of glucose, with a normal suppression of lipolysis from adipose tissue [17]. The presence of hepatic IR results in increased fasting glucose, while peripheral IR determines a reduced uptake of glucose [17,18], with the impairment of glucose oxidation. In a mouse model transgenic for HCV core protein, Shintani et al [19] showed that during a clamp with tracers infusion, the main site of resistance was the liver, as demonstrated by the capability to stimulate the muscle uptake of glucose but the failure to inhibit the endogenous glucose output. On the contrary, in humans, Milner et al [18] demonstrated that IR is principally peripheral, as evidenced by the decreased glucose disposal in the absence of endogenous glucose production (high dose clamp), without differences compared with healthy patients in glucose output at low dose insulin. In addition, Vanni et al [17] confirmed the predominant role of muscle in the development of IR, with an approximate 80% of peripheral contribution, demonstrating the higher glucose disposal during the clamp in controls compared to HCV patients. Finally, after liver transplantation, HCV-diabetic patients show an improvement in glucose tolerance but a persistent insulin resistance in peripheral tissues, particularly in the skeletal muscle [20,21]. All together, regardless of the prevalent site of IR, whose analysis is likely influenced by the technique used (duration of clamp and dose of insulin) and the population selected, it is evident that during CHC it develops an exclusive insulin resistant state which is different, but often superimposed, to the host metabolic derangements and that the two conditions influence and enhance each other. Molecular pathways of insulin resistance in HCV infection Many different mechanisms are associated with the development of IR during chronic liver disease and, in particular, in HCV-infection [10]. The virus directly interacts at different points of the insulin signalling cascade. In liver tissue from HCV-infected patients, Aytug et al [22] firstly reported an inhibition of the ability of insulin receptor substrate (IRS)-1 to associate with insulin receptor, a critical point in the regulation of hepatic gluconeogenesis, mediated by a reduced tyrosine phosphorylation of IRS-1 and a consequent defective downstream phosphorylation of phosphatidylinositol 3-kinase (PI3K) and protein kinase Akt. In addition, the virus may interfere with this pattern also through the up-regulation of the protein phosphatase 2A (PP2A), which dephosphorylates and inhibits Akt [23], although other studies failed to 2826 March 21, 2014 Volume 20 Issue 11

108 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism demonstrate a correlation between intrahepatic levels of PP2A and HOMA-IR. It is also interesting to note that, in vitro, HCV leads to over-expression of PP2A by inducing endoplasmic reticulum stress [24]. In experimental models based on the expression of HCV core protein, Kawaguchi et al [25] described the involvement of suppressor of cytokine signalling-3 (SOCS-3), which promotes the ubiquitin-mediated IRS-1 degradation; similarly, HCV may activate the proteasome activator 28 gamma (PA28γ) and, in the transgenic mouse, targeted delection of PA28γ gene restores insulin sensitivity [26]. The HCV core protein inhibits also the peroxisome proliferator activated receptors (PPARs). In particular, an inhibition of PPAR-α expressed in hepatocytes has been shown [27], while the effect of the virus on PPAR-γ has been observed only in G3 infection, inducing an alteration of adiponectin levels [28,29]. On the other side, HCV may also indirectly trigger IR inducing the production of pro-inflammatory cytokines, which contribute to the metabolic derangements not only in infected tissues but also in uninfected ones, such as the striated muscle. IL-18 and tumor necrosis factor (TNF) are some of the main molecules involved [17,18]. The capability of these proinflammatory cytokines to disturb insulin signalling is well recognized in the context of DM and metabolic syndrome but it is also described during chronic viral disease, irrespective of aetiology [30]. CHC is in fact associated with the up-regulation of T helper 1 lymphocyte cytokines [19,31] and, in HCV-infected patients, a relationship between the increased serum levels of soluble TNF receptors and HOMA-IR has been described [32]. In a transgenic mice model expressing the HCV core protein, IR was reverted by anti TNF-α antibodies [19]. In contrast, in a controlled study comparing non diabetic patients with HCV infection to matched uninfected controls, although serum levels of TNF-α were significantly higher in the HCV cohort, correlating with the extent of histological injury, they were not associated with IR in the multivariate model [33]. The association between IL-18 and hepatic IR seems more specific [17]. Indeed, IL-18 suppresses adiponectin expression in adipocytes and stimulates SOCS3 expression in the adipose tissue of obese mice, providing an indirect mechanism of IR. A key role in the development of liver injury and metabolic disturbances is played by both hepatic and systemic oxidative stress. In addition to chronic inflammation itself, the virus specifically induces reactive oxygen species (ROS) via multiple mechanisms involving the core and other non-structural proteins. The result is the loss of equilibrium between oxidants and antioxidant defenses, which causes oxidative damage to liver cells and interference with the mechanisms of DNA repair, rendering hepatocytes more susceptible to mutageninduced alterations [34] and favouring fibrogenesis through increased proliferation of hepatic stellate cells [35]. The production of ROS may also be involved in the peroxidation of membrane lipids and structural proteins, such as those involved in lipid trafficking, therefore blocking very low density lipoprotein (VLDL) secretion and leading to steatosis [36]. HCV and steatosis Steatosis is a typical feature of CHC, with a reported prevalence of 40%-80% [37]. It is so frequent that, in the past, it has been used as a diagnostic tool for the diagnosis of non-a non-b chronic hepatitis [38,39]. Among viral hepatitides, the association between HCV and steatosis seems somehow specific, since, for example, steatosis in HBV infection is as frequent as in the general population and related to metabolic factors [40]. On the contrary, during CHC, steatosis prevalence remains so high also when adjusted for metabolic risk factors (30%-40%) [41]. In fact, although non-alcoholic fatty liver disease (NAFLD) and CHC are both highly prevalent, epidemiological data confirmed that the rate of steatosis in CHC is greater than twice that expected on the basis of a simple random coexistence [42]. A direct viral effect on steatogenesis is relevant, more frequent and severe in G3 [43], where a strong association is further supported by two observations: the correlation between steatosis grade and intrahepatic RNA titers and viral core protein expression [44,45] ; the reduced or disappeared content of fat in the liver after a successful antiviral treatment [46,47]. The exact mechanisms at the base of HCV-induced steatosis are not definitely explained. HCV core protein is able to increase free fatty acids synthesis [48], favours the intracytoplasmic accumulation of lipids and reduces their mechanisms of export and degradation [48,49]. The entire HCV life cycle is in strict contact with lipid metabolism. HCV entry may be mediated by the low density lipoprotein (LDL) receptor [50] ; HCV core protein modifies VLDL secretion [51] ; the virus diverts the host lipoprotein assembly and secretion pathways for virion export [52] ; virions circulate complexed with lipoproteins in low density lipo-viro particles that facilitate reuptake by hepatocytes by fastening to the LDL receptor [53]. In addition, it has been recently demonstrated that HCVinduced overexpression of seipin, a protein implicated in maturation of lipid droplets whose surface is the seat of the virus start of assembly [54], decreases virion export and induces steatosis, possibly representing a defensive mechanism against viral export. If confirmed, this evidence will lead to consider viral steatosis a defensive mechanism. The accumulation of fatty acids in the form of triglycerides may in fact represent a mechanism through which render them not available for replication complexes involving HCV. This hypothesis is supported by the evidence that, when the degree of steatosis correlates with virus replication level, viral replication precedes fat accumulation and not viceversa [46,55,56]. On the contrary, in metabolic patients, whose steatosis precedes viral infection, the level of viral replication is not associated with the severity of fatty liver. Going back to mechanisms specifically involved in triglyceride accumulation, impaired secretion of lipids 2827 March 21, 2014 Volume 20 Issue 11

109 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism from the infected hepatocytes has been the first historically considered. In fact, patients with CHC have low levels of total cholesterol and triglycerides [57] and phenotypic similarities with familiar hypobetalipoprotinemia [58]. HCV induced hypobetalipoproteinemia is more commonly seen with G3 infection than with G1 [59]. Moreover, in patients with G3 infection, but not in those with G1, sustained virological response (SVR) significantly reduced steatosis [46], and the disappearance of steatosis in patients who responded to therapy was parallel to the normalization of cholesterol and apolipoprotein B levels [59,60]. Experimental models in transgenic mouse showed that HCV core protein interfere with VLDL assembly by reducing the activity of microsomal triglyceride transfer protein (MTTP) [61,62], which is a rate-limiting enzyme in lipoprotein metabolism. These data are confirmed by the reduced intrahepatic levels of MTTP mrna observed in human liver of patients with CHC, especially in those with G3 [61]. Another contribute to the blockage of lipoprotein secretion may be offered by oxidative stress. In fact, the HCV core protein may accumulate in mitochondria and induce liver damage through reactive oxygen species production [63], lipid peroxidation of microsomal membranes and impaired VLDL secretion. HCV induces steatosis also via ex-novo synthesis of fatty acids. The virus activates the steroid responsive element binding proteins (SREBP 1c e 2) that control expression of enzymes involved in the fatty acid and cholesterol metabolism [64], inducing de novo lipogenesis. The virus can cause steatosis also by impairing metabolism and degradation of fatty acids. Indeed, HCV has been shown to inhibit transcription of the nuclear factor PPAR-α and this inhibition would reduce transcription of enzymes involved in fatty acid oxidation, such as the carnitine palmitoyltransferase-1 (CPT-1), which is the rate-limiting enzyme of mitochondrial beta oxidation [65,66]. Finally, a great attention has been pointed on the cytokines secreted by adipose tissue. For example, serum adiponectin levels are low in patients with CHC, with the lowest value observed in G3 infection [67], and HCV can induce the overexpression of retinol binding protein (RBP)-4 which is a steatogenic adipokine associated with the development of steatosis not related to insulin resistance [68-70]. All these evidences are very important because they highlight different possible meanings of the word steatosis in a patient with CHC. The virus can induce two types of steatosis, i.e., metabolic and viral, with different pathogenetic mechanisms, often overlapped. In addition, virus-induced steatosis may exist together with a fatty liver due to other causes. The degree of steatosis does not always have a direct correlation with the degree of IR. It has been shown that patients with G1 and G4 infection have a level of IR, measured by the HOMA-index, greater than that of patients with G3 infection but with a lower degree of steatosis (greater in G3) [8,9,19,57]. In most patients with non-g3 infection the steatosis score is not correlated with HCV-RNA but with BMI [37], and the steatosis is not or it is only partially modified by antiviral treatment. Therefore, in patients with non-g3 infection, steatosis is regarded as more metabolic and less viral, while in G3 ones, as more viral and less metabolic. At the same time, it is not possible to assign exclusively a type of steatosis to a specific or to a group of genotypes. Indeed, it is clear that also genotypes non-3 may induce some degree of viral steatosis and, at the same time, also G3 may induce metabolic abnormalities. Many mechanisms, such as oxidative stress induced by core protein, may simultaneously induce steatosis ( viral ) and impair insulin signalling ( metabolic ). In conclusion, the two types of steatosis can be observed in all genotypes but steatosis phenotype, modulated by metabolic abnormalities (primary metabolic dysfunctions and host factors) and by all microheterogeneities in viral genomic regions, will be more viral in G3 and more metabolic in others. Insulin resistance and steatosis: synergism with the virus in the progression of liver disease The clinical relevance of IR and steatosis in CHC resides in the role played by insulin and fat accumulation in the progression of fibrosis, response to antiviral therapy and occurrence of hepatocarcinoma (HCC). While the annual risk of developing HCC in HCV-related cirrhosis has been estimated to be 3% (2%-6%) per year [71], a recent metanalysis calculated that it is increased 17% by overweight and 90%, almost doubled, by obesity [72]. Moreover, this risk is increased 3-fold by the presence of DM, 37-fold by the co-existence of HCV and DM and up to 100-fold by the association between HCV, DM and obesity [42,72]. Despite most studies described an association between steatosis and the degree of fibrosis, at present, data are not univocal. Most of these studies have a low statistical power and often lack multivariate analysis. Moreover, this association may not be causal as both conditions may simply represent the marker and the consequence of the inflammatory activity [73-75]. In this sense, in particular metabolic steatosis would also be a marker of IR, responsible for both steatosis and increasing fibrosis. In fact, by multivariate analysis, it was IR and not steatosis that correlated with fibrosis, also in G3 [76,77]. IR represents a link between steatosis and fibrosis through the capability of insulin, glucose, and leptin, whose receptors are expressed on stellate cells, to induce the production of connective tissue growth factor [78]. Although the exact pathogenetic mechanisms are not clearly understood, available data suggest a role also for oxidative stress, lipid peroxidation and the higher levels of proinflammatory cytokines, which are able to activate stellate cells [79,80]. Concerning antiviral treatment, many studies reported that hepatic steatosis is negatively correlated with SVR rates after peg-interferon and ribavirin treatment [69,81]. This association may be explained through mechanisms that involve IR-induced SOCS, which in 2828 March 21, 2014 Volume 20 Issue 11

110 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism turn are responsible for a reduced activation of signal transducer and activator of transcription (STAT) proteins involved in interferon signalling [82]. On the other side, hepatic IR increases viral replication [83] and produces lipo-viro particles [84]. Since steatosis observed in G3 patients has not been related to decreased likelihoods of SVR [47], it seems that the central and more specific role is played by metabolic steatosis. At the same time, the rationale of reducing IR to increase response to antiviral treatment is not completely supported. A recent randomized clinical trial (TRIC-1) examined the effect of adding metformin to standard therapy in the treatment of CHC. The study demonstrated that patients infected with G1 and with HOMA index > 2, treated with metformin, showed an early greater drop in viral load and doubled SVR in women [85]. On the other hand, the correction of IR with pioglitazone didn t improve response to therapy in two different trials [86,87]. The different genotypes and design of the studies could explain, at least in part, the discrepancies between these results. Further evidence is needed in order to define the optimal therapeutic strategy for improving response to therapy in insulin resistant patients undergoing antiviral treatment. HCV INFECTION AND ATHEROSCLEROSIS As previously described, HCV is able to directly induce metabolic and inflammatory alterations and is responsible for the occurrence of IR and DM. In view of this complex interplay between HCV infection, metabolic disorders and classical cardiovascular risk factors, several studies aimed to evaluate the possible role of HCV in the development and progression of atherosclerosis and in the incidence of vascular events and vascular mortality (Table 1). To note, several retrospective and cross-sectional studies have clearly demonstrated that different infectious agents, such as chlamydia pneumoniae [88,89], cytomegalovirus [90], herpes simplex virus [91], and hepatitis A virus [92], can participate the process of atherosclerosis [93], suggesting that also HCV may play a role through the potentiation of the inflammatory boost, which is a key event in atherosclerosis. Clinical evidences of the association between HCV and atherosclerosis In 2002 and 2003, Ishizaka et al [94,95] firstly described the association between the presence of anti-hcv antibodies and/or serum HCV core protein and an increased risk of carotid artery plaques. These findings were corroborated by other studies, which found intima-media thickness (IMT) and the prevalence of carotid plaques to be increased in HCV patients [96-100], and in which HCV genomic and antigenomic RNA strands were identified within carotid plaques tissue of HCV-positive patients (even in three patients positive for anti-hcv antibodies but with undetectable HCV-RNA in serum) [98,101], suggesting a possible direct local pathogenetic role of HCV in atherosclerotic plaque formation. More recently, HCV seropositivity was identified as an independent predictor of increased coronary atherosclerosis [ ], even though an increased incidence of acute myocardial infarction (AMI) was demonstrated only in HIV/HCV coinfected patients [105,106], but not in HCV mono infected ones [ ]. Furthermore, the incidences of vascular events and of cardiovascular mortality of HCV-positive patients were reported to be either higher [104,105, ] or, at least, comparable to those observed in the general population [117,118]. In contrast with these data, other studies failed to demonstrate any significant difference in IMT and in the prevalence of carotid plaques between HCV-positive and HCV-negative patients [107,119,120], and some others reported an even lower risk of atherosclerosis in HCV patients with respects to controls [ ]. Three large population studies gave conflicting results concerning the association between HCV-infection and the incidence of stroke [107,113,124] and, recently, Younossi et al [125] found HCV infection to be independently associated with IR, hypertension and congestive heart failure, but not with ischemic heart disease and stroke. Many possible confounding elements should be considered while comparing these different studies and trying to interpret their sometimes divergent results. First of all, the study populations were recruited from different contexts, namely hepatitis or cardiology outpatient clinics, population registries or general health screening programs. Some studies included and some others excluded HIV and HBV coinfected patients. Moreover, not in all of these studies multivariate models were created in order to analyze if the association between HCVinfection and markers of subclinical atherosclerosis or incidences of vascular events/cardiovascular mortality was independent from the other metabolic risk factors. In this regard, it should also be stressed that data on the duration of HCV infection and of DM are not available in any of these works, and that liver histology of HCV patients, which gives the opportunity to correlate vascular outcomes with the histological grading and staging of the hepatic disease, was available from only one study [99]. Finally, another important point to be considered is that cirrhotic patients were frequently excluded or poorly represented in the study populations. Notwithstanding epidemiological data are very limited, cirrhosis is currently considered a condition associated with a decreased risk of cardiovascular events [126]. Indeed, although clearly predisposing to DM, cirrhosis is characterized by an overall favourable risk profile (low blood pressure, low cholesterol, impaired procoagulative cascade and low platelet count). In conclusion, even if literature on this topic is scant and sometimes ambiguous, current evidence seems to support an association between HCV and atherosclerosis, which can account for the increased prevalence and incidence of vascular disease in patients with HCV infection. As supported by some studies, it seems reason March 21, 2014 Volume 20 Issue 11

111 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism Table 1 Overview of the main studies assessing the association between hepatitis C virus infection and the prevalence or incidence of cardio-cerebrovascular disease Ref. Study design Country-setting Total patients (%HCV + ) Main results Prevalence of cardio- or cerebrovascular disease Ishizaka et al [94], 2002 Cross-sectional Japan-general health screening Bilora et al [121], 2002 Case-control Italy-hepatitis outpatient clinic Ishizaka et al [95], 2003 Cross-sectional Japan-general health screening Fukui et al [96], 2003 Cross-sectional Japan-ultrasound carotid screening Volzke et al [107], 2004 Cross-sectional Germany-population registry data 4784 (2.1) HCV + independently associated with increased IMT [OR = 2.9 ( )] and CP [OR = 1.9 ( )] 98 (49) HCV + have lower prevalence of CP, no significant difference of FP 1992 (1.3) HCV + associated with CP [OR = 5.5 ( )] and IMT [OR = NA] HCV + independently associated with CP [OR = 5.6 ( )], but not with IMT 210 (14.8) HCV + have higher prevalence of increased IMT and CP. HCV + is independently associated with CP [OR = NA] 4266 (5.5) HCV + or HBV + not associated with IMT, CP, MI or S Vassalle et al [102], 2004 Case-control Not specified 686 (5.1) HCV + independently associated with CAD [OR = 4.2 (1.4-13)] Arcari et al [108], 2006 Case-control United States-United 582 (8.9) HCV + not associated with MI States army Targher et al [97], 2007 Cross-sectional United Kingdomoutpatient clinic 120 (50) HCV + independently associated with IMT [OR = 1.6 ( )] Boddi et al [98], 2007 Cross-sectional Italy-cardiovascular risk factor centre 151 (20.5) HCV + independently associated with IMT [OR = 4.4 ( )], but not with CP Alyan et al [103], 2008 Case-control Turkey-cardiology unit 364 (38.2) HCV + independently associated with CAD [OR = 2.0 ( )] Tien et al [119], Cross-sectional United States-women s interagency HIV study 503 (10.5) HCV + not associated with IMT or CP Mostafa et al [120], 2010 Cross-sectional Egypt-village metabolic study Adinolfi et al [100], 2012 Case-control Italy-liver outpatient clinic and general population screening Petta et al [99], 2012 Case-control Italy-liver and cardiology outpatient unit Younossi et al [125], 2013 Cross-sectional United States-NHANES database 494 (37.9) IMT and CP not different in HCV + ; HCV + independently associated with IMT and CP [OR = 3.5 ( )] 803 (40.6) Increased IMT and CP more prevalent in HCV + ; HCV-RNA independently associated with CP [OR = 5.2 ( )] 348 (50) Increased IMT and CP more prevalent in HCV + ; HCV + independently associated with IMT [OR = NA]. In HCV patient, older age [OR = 1.04 ( )] and severe fibrosis [OR = 2.18 ( )] are independently associated with CP (0.9) HCV + independently associated with CHF [OR = 2.5 (1.1-6)], but not with CHD Miyajima et al [123], 2013 Cross-sectional Japan-seven country study 1908 (2.1) IMT significantly reduced in HCV + Incidence of cardio- or cerebrovascular disease Younossi et al [116], Retrospective 24.6 yr FU United States-transplant centre Haji et al [104], Retrospective 4.2 yr FU United States-transplant centre Amin et al [111], Retrospective Australia-Australian national death index 54 (22.2) HCV + associated with CHD mortality [HR NA], but not with CHD 417 (8.2) HCV + independently associated with increased mortality [HR 2.8 ( )] and CAD [HR 3.1 ( )] (66.7) HCV + independently associated with cardiovascular mortality [HR 1.3 ( )] Neal et al [117], 2007 Bilora et al [122], 2008 Caliskan et al [133], Butt et al [109], 2009 Lee et al [113], 2010 Bedimo et al [105], Ohsawa et al [114], Prospective 6.7 yr FU Case-control prospective 5 yr FU Prospective 59 mo FU Prospective 5 yr FU Prospective 16.9 yr FU Retrospective 3.9 yr FU Prospective 5 yr FU United Kingdom-trent HCV + not associated with cardiovascular mortality hepatitis C cohort Italy-not specified 67 (50.7) HCV + have lower prevalence of CP, no difference in FP Turkey-hemodialysis unit United States- ERCHIVES database Taiwan-general population United States-HIV infected United States veterans 72 (50) HCV + have lower increase of IMT, not significant difference in increase of CP and FP No differences in IMT, FMD and CP in HCV (47.8) HCV + not associated with CHD in univariate analysis, but independently associated with CHD [HR 1.25 ( )], in adjusted models (5.5) HCV + independently associated with CVD mortality [HR 2.2 ( )]. CVD risk increases with HCV-RNA (31.6) HCV + independently associated with CVD [HR 1.2 ( )], but not MI Japan-KAREN Study 1077 (10.1) HCV + independently associated with cardiovascular mortality [HR 1.8 (1.1-3)] 2830 March 21, 2014 Volume 20 Issue 11

112 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism Freiberg et al [106], Kristiansen et al [118], 2011 Forde et al [110], 2012 Lee et al [115], 2012 Hsu et al [124], 2013 Retrospective 7.5 yr FU Prospective 7 yr FU Retrospective 3.9 yr FU Prospective 16.9 yr FU Retrospective case-control 5 yr FU United States-veterans aging cohort study Norway-population registry data United Kingdom-health improvement network Taiwan-general population Taiwan-Taiwan national health insurance program 8579 (16.8) HCV + /HIV + independently associated with incident CHD as compared with HCV - /HIV+ or controls. HCV + not associated with incident CHD HCV + not associated with increased risk of cardiovascular mortality 4809 (6.3) HCV + not associated with incident MI 1095 (5.6) HCV + associated with vascular mortality [HR 1.5 (1.1-2)] 3113 (20) HCV + independently associated with S [HR 1.2 ( )] 1 Carried out in hepatitis C virus (HCV) and/or hepatitis B virus patient; 2 Carried out in patients in hemodialysis; 3 Carried out in human immunodeficiency virus (HIV) mono-infected and HIV/HCV coinfected veterans; 4 Carried out in HIV and/or HCV United States veterans (only males); 5 Carried out in women HIV and/or HCV positive: 220 HCV + /HIV + ; 53 HCV + ; 950 HIV + ; 452 controls; 6 Carried out in kidney transplant recipients with allografts functioning over 20 years; 7 Carried out in cardiac transplant recipients who received hearths from HCV+ or - donors; 8 Carried out on HCV patients compared to their reference general population. IMT: Intima-media thickness; CP: Carotid plaques; FP: Femoral plaques; FMD: Flow-mediated-dilation; FU: Follow-up; CAD: Coronary artery disease, angiographically documented; MI: Myocardial infarction; S: Stroke; CHD: Coronary hearth disease (myocardial infarction, unstable angina, need for revascularization procedures); CHF: Congestive hearth failure; CVD: Cerebrovascular disease (transient ischemic attack or stroke); NA: Not available. Cardiovascular risk Hepatic oxidative stress IR and diabetes mellitus Systemic chronic inflammation Direct HCV effect Low cholesterol Low platelets Low blood pressure Impaired coagulation Progressive fibrosis Compensated Decompensated Chronic hepatitis C HCV infection Cirrhosis Figure 1 Hypothetical trend of cardiovascular risk during the natural history of hepatitis C virus infection, from chronic hepatitis to decompensated cirrhosis. IR: Insulin resistance; HCV: Hepatitis C virus. able to speculate that the contribution of HCV to the atherogenic process, either direct or indirect, or both, could increase with the duration of the infection, the development of IR and eventually DM, and the increase of circulating products of oxidative stress and inflammation. On the contrary, once cirrhosis has developed, several mechanisms determining a reduction of the cardiovascular risk progressively come into play (Figure 1). Hypothetical pathogenic processes directly or indirectly linking HCV to atherosclerosis Nowadays, it is widely accepted that infective agents contribute to the progression of chronic immuno-mediated cell inflammation underlying atherosclerosis through the inflammatory response elicited in the host [127]. They can accelerate the occurrence of several key steps in the plaque formation since they can promote endothelial dysfunction, potentiate the recruitment and activation of T-lympho-monocytes and enhance the proliferation and migration of smooth-muscle cells. However, the detection of HCV-RNA in carotid atherosclerotic plaques, predominantly in patients with G2 HCVinfection, strongly suggested also a direct local role of HCV in atherogenesis [98,101]. Consistent with this finding, viral load has been recently associated with carotid atherosclerosis [100], and with the risk of cerebrovascular mortality [113]. This hypothesis is also supported by several experimental studies. For instance, some HCV proteins can enhance local oxidative stress [128], and increase the concentration of soluble intracellular adhesion molecules [129]. HCV particles have affinity with circulating lipoproteins in the blood and HCV G2 seems to be the most closely associated with these lipoproteins [130]. In addition to hepatocytes, HCV can also infect lymphocytes and through these can induce vasculitis and the production of anti-endothelial antibodies [131]. HCV may also indirectly favour atherosclerosis, via liver damage or virus-induced, metabolic disorders. Ac March 21, 2014 Volume 20 Issue 11

113 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism PP2A SOCS3 IRS PPAR Hepatitis C virus Direct viral effect Hepatic IR Viral steatosis Inflammation PBMC Fibrosis CD4 CD4 Oxidative stress Metabolic steatosis HSC activation Pro-inflammatory cytokines TNF-a, IL-6, IL-18 Hypercoagulation and hypofibrinolysis Increases in fibrinogen, PAI-1 and coagulation factors Hyper insulinemia Peripheral IR Atherosclerosis? Adipose tissue Muscle Dysglycemia Diabetes mellitus Indirect viral effect Figure 2 Mechanisms of hepatitis C virus-induced insulin resistance and steatosis and their impact on the progression of fibrosis and cardiovascular disease. In the hepatocyte, the virus interferes with insulin signalling, leads to overexpression of protein phosphatase 2A (PP2A) and suppressor of cytokine signalling-3 (SOCS-3), and down-regulates the expression of peroxisome proliferator activated receptors (PPAR) and of insulin receptor substrate (IRS): all these mechanisms lead to hepatic insulin resistance (IR). By inducing hepatic injury and activating peripheral blood mononuclear cells (PBMC), HCV increases circulating levels of proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin-6 and -18 (IL-6 and IL-18), and leads to peripheral IR and hyperinsulinemia. Viral and metabolic steatosis, together with the direct stimulus of increased insulin levels on hepatic stellate cells (HSCs), likely stimulate the progression of fibrosis. Furthermore, systemic inflammation, the procoagulative state and direct viral effects may contribute to the atherogenic process. cordingly, in biopsy-proven chronic hepatitis C patients, IMT and prevalence of carotid plaques were recently found to be associated with the severity of fibrosis [99]. It can be speculated that oxidative stress and inflammation, which are associated with the evolution of liver fibrosis, can be associated or directly contribute also to the atherogenic process. After all, the well-known relationship between NAFLD and cardiovascular disease has already demonstrated how liver damage could be directly involved in the pathogenesis of cardiovascular disease, through the systemic release of proatherogenic mediators from the steatotic and inflamed liver or through the worsening of IR and of atherogenic dyslipidemia [132]. However, in contrast with NAFLD, HCV is associated with a favourable lipoprotein profile, namely hypobetalipoproteinemia. The net effect of increased IR and favourable lipoprotein profile on the cardiovascular risk was recently investigated by Mostafa et al [120], who found IMT and carotid plaques to be significantly associated with HCV-infection only after adjustment for classical cardiovascular risk factors, particularly LDL cholesterol and systolic blood pressure. Accordingly, in a larger prospective study, including HCV infected patient owning better cardiovascular risk profile (lower prevalence of DM and lower cholesterol), HCV-infection was found to be associated with coronary heart disease only after correction for potential metabolic confounders [109]. These results may suggest that HCV affects the cardiovascular risk mainly via non-conventional pathways, and not by virus-induced metabolic modifications, i.e., IR and good lipoprotein profile, which possibly balance each other. In agreement with this hypothesis, in studies where HCV was found to be independently associated with vascular disease, the relationship between HCV infection and vascular outcomes was generally adjusted for metabolic risk factors, in contrast to what has been done in the majority of studies failing to demonstrate this association [108,117,118,123,133]. One exception is a big 2832 March 21, 2014 Volume 20 Issue 11

114 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism retrospective population study in which HCV was not associated with AMI even after adjusting for all the metabolic confounders [110]. HCV INFECTION AND METABOLIC DISORDERS: SUMMARY OF A COMPLEX INTERPLAY All the data provided above suggest a strong interrelationship between HCV infection and metabolic disorders, which is likely implicated in the progression both of liver damage and of the atherogenic process (Figure 2). HCV can directly interact with intracellular mediators of insulin activity, such as PP2A, SOCS3, IRS and PPARs [22-29], or indirectly hamper the insulin message by inducing hepatic and low-grade systemic inflammation [17,18]. Moreover, the virus increases the synthesis of free fatty acids and reduces their mechanisms of export and degradation [48,49], therefore inducing a viral steatosis which is often superimposed to a metabolic one. Progression of liver damage is favoured by the steatosisinduced hepatic reduction of antioxidant defenses and by a direct stimulatory effect of hyperinsulinemia, oxidative stress and lipid peroxidation on hepatic fibrogenic cells. At the same time, HCV-induced alterations of glucose metabolism and the systemic release of inflammatory and procoagulative mediators by the diseased liver may well contribute to the atherogenic process. Moreover, experimental evidences support a direct role of HCV proteins, which, for example, can enhance oxidative stress and increase the concentration of soluble intracellular adhesion molecules at the atherosclerotic plaque level [128,129]. CONCLUSION In the present manuscript, an overview of the mechanisms which link HCV infection with insulin resistance and metabolic disorders has been provided, as well as the clinical data confirming that this association may contribute both to the progression of liver damage and to atherosclerosis. All together, a complex scenario emerges where the multiple interactions between the host and the virus determine much more complications than those possibly induced only by the virus itself. Together with cryoglobulinemia, HCV-related arthritis and keratoconjunctivitis sicca, these evidences prompt to consider CHC a systemic disease rather than a simple infection of the liver. ACKNOWLEDGMENTS We thank Roberto Piccinocchi for his kind technical assistance in the production of Figure 2. REFERENCES 1 Lavanchy D. The global burden of hepatitis C. Liver Int 2009; 29 Suppl 1: [PMID: DOI: / j x] 2 Zimmet P. The burden of type 2 diabetes: are we doing enough? Diabetes Metab 2003; 29: 6S9-618 [PMID: ] 3 Mehta SH, Brancati FL, Sulkowski MS, Strathdee SA, Szklo M, Thomas DL. Prevalence of type 2 diabetes mellitus among persons with hepatitis C virus infection in the United States. Ann Intern Med 2000; 133: [PMID: ] 4 Mehta SH, Brancati FL, Strathdee SA, Pankow JS, Netski D, Coresh J, Szklo M, Thomas DL. Hepatitis C virus infection and incident type 2 diabetes. Hepatology 2003; 38: [PMID: DOI: /jhep ] 5 Chen T, Jia H, Li J, Chen X, Zhou H, Tian H. New onset diabetes mellitus after liver transplantation and hepatitis C virus infection: meta-analysis of clinical studies. Transpl Int 2009; 22: [PMID: DOI: /j x] 6 Simó R, Lecube A, Genescà J, Esteban JI, Hernández C. Sustained virological response correlates with reduction in the incidence of glucose abnormalities in patients with chronic hepatitis C virus infection. Diabetes Care 2006; 29: [PMID: DOI: /dc ] 7 Deltenre P, Louvet A, Lemoine M, Mourad A, Fartoux L, Moreno C, Henrion J, Mathurin P, Serfaty L. Impact of insulin resistance on sustained response in HCV patients treated with pegylated interferon and ribavirin: a meta-analysis. J Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 8 Moucari R, Asselah T, Cazals-Hatem D, Voitot H, Boyer N, Ripault MP, Sobesky R, Martinot-Peignoux M, Maylin S, Nicolas-Chanoine MH, Paradis V, Vidaud M, Valla D, Bedossa P, Marcellin P. Insulin resistance in chronic hepatitis C: association with genotypes 1 and 4, serum HCV RNA level, and liver fibrosis. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 9 Hui JM, Sud A, Farrell GC, Bandara P, Byth K, Kench JG, McCaughan GW, George J. Insulin resistance is associated with chronic hepatitis C virus infection and fibrosis progression [corrected]. Gastroenterology 2003; 125: [PMID: ] 10 Picardi A, D Avola D, Gentilucci UV, Galati G, Fiori E, Spataro S, Afeltra A. Diabetes in chronic liver disease: from old concepts to new evidence. Diabetes Metab Res Rev 2006; 22: [PMID: DOI: /dmrr.636] 11 Romero-Gómez M, Fernández-Rodríguez CM, Andrade RJ, Diago M, Alonso S, Planas R, Solá R, Pons JA, Salmerón J, Barcena R, Perez R, Carmona I, Durán S. Effect of sustained virological response to treatment on the incidence of abnormal glucose values in chronic hepatitis C. J Hepatol 2008; 48: [PMID: DOI: /j.jhep ] 12 Kawaguchi T, Ide T, Taniguchi E, Hirano E, Itou M, Sumie S, Nagao Y, Yanagimoto C, Hanada S, Koga H, Sata M. Clearance of HCV improves insulin resistance, beta-cell function, and hepatic expression of insulin receptor substrate 1 and 2. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] 13 Arase Y, Suzuki F, Suzuki Y, Akuta N, Kobayashi M, Kawamura Y, Yatsuji H, Sezaki H, Hosaka T, Hirakawa M, Ikeda K, Kumada H. Sustained virological response reduces incidence of onset of type 2 diabetes in chronic hepatitis C. Hepatology 2009; 49: [PMID: DOI: /hep.22703] 14 Giordanino C, Bugianesi E, Smedile A, Ciancio A, Abate ML, Olivero A, Pellicano R, Cassader M, Gambino R, Bo S, Ciccone G, Rizzetto M, Saracco G. Incidence of type 2 diabetes mellitus and glucose abnormalities in patients with chronic hepatitis C infection by response to treatment: results of a cohort study. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 15 Mihm S. Hepatitis C virus, diabetes and steatosis: clinical evidence in favor of a linkage and role of genotypes. Dig Dis 2010; 28: [PMID: DOI: / ] 2833 March 21, 2014 Volume 20 Issue 11

115 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism 16 Sheikh MY, Choi J, Qadri I, Friedman JE, Sanyal AJ. Hepatitis C virus infection: molecular pathways to metabolic syndrome. Hepatology 2008; 47: [PMID: DOI: /hep.22269] 17 Vanni E, Abate ML, Gentilcore E, Hickman I, Gambino R, Cassader M, Smedile A, Ferrannini E, Rizzetto M, Marchesini G, Gastaldelli A, Bugianesi E. Sites and mechanisms of insulin resistance in nonobese, nondiabetic patients with chronic hepatitis C. Hepatology 2009; 50: [PMID: DOI: /hep.23031] 18 Milner KL, van der Poorten D, Trenell M, Jenkins AB, Xu A, Smythe G, Dore GJ, Zekry A, Weltman M, Fragomeli V, George J, Chisholm DJ. Chronic hepatitis C is associated with peripheral rather than hepatic insulin resistance. Gastroenterology 2010; 138: e1-3 [PMID: DOI: /j.gastro ] 19 Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Tsukamoto K, Kimura S, Moriya K, Koike K. Hepatitis C virus infection and diabetes: direct involvement of the virus in the development of insulin resistance. Gastroenterology 2004; 126: [PMID: ] 20 Perseghin G, Mazzaferro V, Sereni LP, Regalia E, Benedini S, Bazzigaluppi E, Pulvirenti A, Leão AA, Calori G, Romito R, Baratti D, Luzi L. Contribution of reduced insulin sensitivity and secretion to the pathogenesis of hepatogenous diabetes: effect of liver transplantation. Hepatology 2000; 31: [PMID: DOI: /hep ] 21 Tietge UJ, Selberg O, Kreter A, Bahr MJ, Pirlich M, Burchert W, Müller MJ, Manns MP, Böker KH. Alterations in glucose metabolism associated with liver cirrhosis persist in the clinically stable long-term course after liver transplantation. Liver Transpl 2004; 10: [PMID: DOI: / lt.20147] 22 Aytug S, Reich D, Sapiro LE, Bernstein D, Begum N. Impaired IRS-1/PI3-kinase signaling in patients with HCV: a mechanism for increased prevalence of type 2 diabetes. Hepatology 2003; 38: [PMID: DOI: / j.hep ] 23 Bernsmeier C, Duong FH, Christen V, Pugnale P, Negro F, Terracciano L, Heim MH. Virus-induced over-expression of protein phosphatase 2A inhibits insulin signalling in chronic hepatitis C. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 24 Christen V, Treves S, Duong FH, Heim MH. Activation of endoplasmic reticulum stress response by hepatitis viruses up-regulates protein phosphatase 2A. Hepatology 2007; 46: [PMID: DOI: /hep.21611] 25 Kawaguchi T, Yoshida T, Harada M, Hisamoto T, Nagao Y, Ide T, Taniguchi E, Kumemura H, Hanada S, Maeyama M, Baba S, Koga H, Kumashiro R, Ueno T, Ogata H, Yoshimura A, Sata M. Hepatitis C virus down-regulates insulin receptor substrates 1 and 2 through up-regulation of suppressor of cytokine signaling 3. Am J Pathol 2004; 165: [PMID: DOI: /S (10) ] 26 Miyamoto H, Moriishi K, Moriya K, Murata S, Tanaka K, Suzuki T, Miyamura T, Koike K, Matsuura Y. Involvement of the PA28gamma-dependent pathway in insulin resistance induced by hepatitis C virus core protein. J Virol 2007; 81: [PMID: DOI: /JVI ] 27 Dharancy S, Malapel M, Perlemuter G, Roskams T, Cheng Y, Dubuquoy L, Podevin P, Conti F, Canva V, Philippe D, Gambiez L, Mathurin P, Paris JC, Schoonjans K, Calmus Y, Pol S, Auwerx J, Desreumaux P. Impaired expression of the peroxisome proliferator-activated receptor alpha during hepatitis C virus infection. Gastroenterology 2005; 128: [PMID: ] 28 de Gottardi A, Pazienza V, Pugnale P, Bruttin F, Rubbia- Brandt L, Juge-Aubry CE, Meier CA, Hadengue A, Negro F. Peroxisome proliferator-activated receptor-alpha and -gamma mrna levels are reduced in chronic hepatitis C with steatosis and genotype 3 infection. Aliment Pharmacol Ther 2006; 23: [PMID: DOI: /j x] 29 Pazienza V, Vinciguerra M, Andriulli A, Mangia A. Hepatitis C virus core protein genotype 3a increases SOCS-7 expression through PPAR-{gamma} in Huh-7 cells. J Gen Virol 2010; 91: [PMID: DOI: /vir ] 30 Picardi A, Gentilucci UV, Zardi EM, Caccavo D, Petitti T, Manfrini S, Pozzilli P, Afeltra A. TNF-alpha and growth hormone resistance in patients with chronic liver disease. J Interferon Cytokine Res 2003; 23: [PMID: DOI: / ] 31 Nelson DR, Lim HL, Marousis CG, Fang JW, Davis GL, Shen L, Urdea MS, Kolberg JA, Lau JY. Activation of tumor necrosis factor-alpha system in chronic hepatitis C virus infection. Dig Dis Sci 1997; 42: [PMID: ] 32 Lecube A, Hernández C, Genescà J, Simó R. Proinflammatory cytokines, insulin resistance, and insulin secretion in chronic hepatitis C patients: A case-control study. Diabetes Care 2006; 29: [PMID: DOI: /diacare ] 33 Cua IH, Hui JM, Bandara P, Kench JG, Farrell GC, Mc- Caughan GW, George J. Insulin resistance and liver injury in hepatitis C is not associated with virus-specific changes in adipocytokines. Hepatology 2007; 46: [PMID: DOI: /hep.21703] 34 Farinati F, Cardin R, Bortolami M, Burra P, Russo FP, Rugge M, Guido M, Sergio A, Naccarato R. Hepatitis C virus: from oxygen free radicals to hepatocellular carcinoma. J Viral Hepat 2007; 14: [PMID: DOI: / j x] 35 Poli G. Pathogenesis of liver fibrosis: role of oxidative stress. Mol Aspects Med 2000; 21: [PMID: ] 36 Clément S, Pascarella S, Negro F. Hepatitis C virus infection: molecular pathways to steatosis, insulin resistance and oxidative stress. Viruses 2009; 1: [PMID: DOI: /v ] 37 Adinolfi LE, Gambardella M, Andreana A, Tripodi MF, Utili R, Ruggiero G. Steatosis accelerates the progression of liver damage of chronic hepatitis C patients and correlates with specific HCV genotype and visceral obesity. Hepatology 2001; 33: [PMID: DOI: / jhep ] 38 Dienes HP, Popper H, Arnold W, Lobeck H. Histologic observations in human hepatitis non-a, non-b. Hepatology 1982; 2: [PMID: ] 39 Wiese M, Haupt R. [Histomorphologic picture of chronic non-a, non-b hepatitis]. Dtsch Z Verdau Stoffwechselkr 1985; 45: [PMID: ] 40 Machado MV, Oliveira AG, Cortez-Pinto H. Hepatic steatosis in hepatitis B virus infected patients: meta-analysis of risk factors and comparison with hepatitis C infected patients. J Gastroenterol Hepatol 2011; 26: [PMID: DOI: /j x] 41 Lonardo A, Adinolfi LE, Loria P, Carulli N, Ruggiero G, Day CP. Steatosis and hepatitis C virus: mechanisms and significance for hepatic and extrahepatic disease. Gastroenterology 2004; 126: [PMID: ] 42 Chen CL, Yang HI, Yang WS, Liu CJ, Chen PJ, You SL, Wang LY, Sun CA, Lu SN, Chen DS, Chen CJ. Metabolic factors and risk of hepatocellular carcinoma by chronic hepatitis B/C infection: a follow-up study in Taiwan. Gastroenterology 2008; 135: [PMID: DOI: / j.gastro ] 43 Mihm S, Fayyazi A, Hartmann H, Ramadori G. Analysis of histopathological manifestations of chronic hepatitis C virus infection with respect to virus genotype. Hepatology 1997; 25: [PMID: DOI: /hep ] 2834 March 21, 2014 Volume 20 Issue 11

116 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism 44 Fujie H, Yotsuyanagi H, Moriya K, Shintani Y, Tsutsumi T, Takayama T, Makuuchi M, Matsuura Y, Miyamura T, Kimura S, Koike K. Steatosis and intrahepatic hepatitis C virus in chronic hepatitis. J Med Virol 1999; 59: [PMID: ] 45 Rubbia-Brandt L, Quadri R, Abid K, Giostra E, Malé PJ, Mentha G, Spahr L, Zarski JP, Borisch B, Hadengue A, Negro F. Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. J Hepatol 2000; 33: [PMID: ] 46 Kumar D, Farrell GC, Fung C, George J. Hepatitis C virus genotype 3 is cytopathic to hepatocytes: Reversal of hepatic steatosis after sustained therapeutic response. Hepatology 2002; 36: [PMID: DOI: / jhep ] 47 Poynard T, Ratziu V, McHutchison J, Manns M, Goodman Z, Zeuzem S, Younossi Z, Albrecht J. Effect of treatment with peginterferon or interferon alfa-2b and ribavirin on steatosis in patients infected with hepatitis C. Hepatology 2003; 38: [PMID: DOI: /jhep ] 48 Abid K, Pazienza V, de Gottardi A, Rubbia-Brandt L, Conne B, Pugnale P, Rossi C, Mangia A, Negro F. An in vitro model of hepatitis C virus genotype 3a-associated triglycerides accumulation. J Hepatol 2005; 42: [PMID: DOI: /j.jhep ] 49 Negro F. Mechanisms and significance of liver steatosis in hepatitis C virus infection. World J Gastroenterol 2006; 12: [PMID: ] 50 Agnello V, Abel G, Elfahal M, Knight GB, Zhang QX. Hepatitis C virus and other flaviviridae viruses enter cells via low density lipoprotein receptor. Proc Natl Acad Sci USA 1999; 96: [PMID: ] 51 Perlemuter G, Sabile A, Letteron P, Vona G, Topilco A, Chrétien Y, Koike K, Pessayre D, Chapman J, Barba G, Bréchot C. Hepatitis C virus core protein inhibits microsomal triglyceride transfer protein activity and very low density lipoprotein secretion: a model of viral-related steatosis. FASEB J 2002; 16: [PMID: DOI: /fj com] 52 Syed GH, Amako Y, Siddiqui A. Hepatitis C virus hijacks host lipid metabolism. Trends Endocrinol Metab 2010; 21: [PMID: DOI: /j.tem ] 53 Negro F. HCV infection and metabolic syndrome: which is the chicken and which is the egg? Gastroenterology 2012; 142: [PMID: DOI: /j.gastro ] 54 Clément S, Fauvelle C, Branche E, Kaddai V, Conzelmann S, Boldanova T, Bartosch B, Minehira K, Negro F. Role of seipin in lipid droplet morphology and hepatitis C virus life cycle. J Gen Virol 2013; 94: [PMID: DOI: / vir ] 55 Rubbia-Brandt L, Leandro G, Spahr L, Giostra E, Quadri R, Malé PJ, Negro F. Liver steatosis in chronic hepatitis C: a morphological sign suggesting infection with HCV genotype 3. Histopathology 2001; 39: [PMID: ] 56 Rubbia-Brandt L, Giostra E, Mentha G, Quadri R, Negro F. Expression of liver steatosis in hepatitis C virus infection and pattern of response to alpha-interferon. J Hepatol 2001; 35: 307 [PMID: ] 57 Negro F. Abnormalities of lipid metabolism in hepatitis C virus infection. Gut 2010; 59: [PMID: DOI: /gut ] 58 Tarugi P, Averna M, Di Leo E, Cefalù AB, Noto D, Magnolo L, Cattin L, Bertolini S, Calandra S. Molecular diagnosis of hypobetalipoproteinemia: an ENID review. Atherosclerosis 2007; 195: e19-e27 [PMID: DOI: /j.atheroscl erosis ] 59 Serfaty L, Andreani T, Giral P, Carbonell N, Chazouillères O, Poupon R. Hepatitis C virus induced hypobetalipoproteinemia: a possible mechanism for steatosis in chronic hepatitis C. J Hepatol 2001; 34: [PMID: ] 60 Hofer H, Bankl HC, Wrba F, Steindl-Munda P, Peck-Radosavljevic M, Osterreicher C, Mueller C, Gangl A, Ferenci P. Hepatocellular fat accumulation and low serum cholesterol in patients infected with HCV-3a. Am J Gastroenterol 2002; 97: [PMID: DOI: / j x] 61 Mirandola S, Realdon S, Iqbal J, Gerotto M, Dal Pero F, Bortoletto G, Marcolongo M, Vario A, Datz C, Hussain MM, Alberti A. Liver microsomal triglyceride transfer protein is involved in hepatitis C liver steatosis. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 62 Bugianesi E, Salamone F, Negro F. The interaction of metabolic factors with HCV infection: does it matter? J Hepatol 2012; 56 Suppl 1: S56-S65 [PMID: DOI: / S (12) ] 63 Okuda M, Li K, Beard MR, Showalter LA, Scholle F, Lemon SM, Weinman SA. Mitochondrial injury, oxidative stress, and antioxidant gene expression are induced by hepatitis C virus core protein. Gastroenterology 2002; 122: [PMID: ] 64 Su AI, Pezacki JP, Wodicka L, Brideau AD, Supekova L, Thimme R, Wieland S, Bukh J, Purcell RH, Schultz PG, Chisari FV. Genomic analysis of the host response to hepatitis C virus infection. Proc Natl Acad Sci USA 2002; 99: [PMID: DOI: /pnas ] 65 Yamaguchi A, Tazuma S, Nishioka T, Ohishi W, Hyogo H, Nomura S, Chayama K. Hepatitis C virus core protein modulates fatty acid metabolism and thereby causes lipid accumulation in the liver. Dig Dis Sci 2005; 50: [PMID: ] 66 Cheng Y, Dharancy S, Malapel M, Desreumaux P. Hepatitis C virus infection down-regulates the expression of peroxisome proliferator-activated receptor alpha and carnitine palmitoyl acyl-coa transferase 1A. World J Gastroenterol 2005; 11: [PMID: ] 67 Petit JM, Minello A, Jooste V, Bour JB, Galland F, Duvillard L, Verges B, Olsson NO, Gambert P, Hillon P. Decreased plasma adiponectin concentrations are closely related to steatosis in hepatitis C virus-infected patients. J Clin Endocrinol Metab 2005; 90: [PMID: DOI: / jc ] 68 Larter CZ, Farrell GC. Insulin resistance, adiponectin, cytokines in NASH: Which is the best target to treat? J Hepatol 2006; 44: [PMID: DOI: /j.jhep ] 69 Cammà C, Bruno S, Di Marco V, Di Bona D, Rumi M, Vinci M, Rebucci C, Cividini A, Pizzolanti G, Minola E, Mondelli MU, Colombo M, Pinzello G, Craxì A. Insulin resistance is associated with steatosis in nondiabetic patients with genotype 1 chronic hepatitis C. Hepatology 2006; 43: [PMID: DOI: /hep.20983] 70 Petta S, Tripodo C, Grimaudo S, Cabibi D, Cammà C, Di Cristina A, Di Marco V, Di Vita G, Ingrao S, Mazzola A, Marchesini G, Pipitone R, Craxì A. High liver RBP4 protein content is associated with histological features in patients with genotype 1 chronic hepatitis C and with nonalcoholic steatohepatitis. Dig Liver Dis 2011; 43: [PMID: DOI: /j.dld ] 71 Gomez EV, Rodriguez YS, Bertot LC, Gonzalez AT, Perez YM, Soler EA, Garcia AY, Blanco LP. The natural history of compensated HCV-related cirrhosis: a prospective longterm study. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 72 Larsson SC, Wolk A. Overweight, obesity and risk of liver cancer: a meta-analysis of cohort studies. Br J Cancer 2007; 97: [PMID: DOI: /sj.bjc ] 73 Asselah T, Boyer N, Guimont MC, Cazals-Hatem D, Tubach F, Nahon K, Daïkha H, Vidaud D, Martinot M, Vidaud M, Degott C, Valla D, Marcellin P. Liver fibrosis is not associated with steatosis but with necroinflammation in French patients with chronic hepatitis C. Gut 2003; 52: March 21, 2014 Volume 20 Issue 11

117 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism [PMID: ] 74 Ghany MG, Kleiner DE, Alter H, Doo E, Khokar F, Promrat K, Herion D, Park Y, Liang TJ, Hoofnagle JH. Progression of fibrosis in chronic hepatitis C. Gastroenterology 2003; 124: [PMID: DOI: /gast ] 75 Ryder SD, Irving WL, Jones DA, Neal KR, Underwood JC. Progression of hepatic fibrosis in patients with hepatitis C: a prospective repeat liver biopsy study. Gut 2004; 53: [PMID: ] 76 Bugianesi E, Marchesini G, Gentilcore E, Cua IH, Vanni E, Rizzetto M, George J. Fibrosis in genotype 3 chronic hepatitis C and nonalcoholic fatty liver disease: Role of insulin resistance and hepatic steatosis. Hepatology 2006; 44: [PMID: DOI: /hep.21429] 77 Svegliati-Baroni G, Bugianesi E, Bouserhal T, Marini F, Ridolfi F, Tarsetti F, Ancarani F, Petrelli E, Peruzzi E, Lo Cascio M, Rizzetto M, Marchesini G, Benedetti A. Post-load insulin resistance is an independent predictor of hepatic fibrosis in virus C chronic hepatitis and in non-alcoholic fatty liver disease. Gut 2007; 56: [PMID: DOI: /gut ] 78 Aleffi S, Petrai I, Bertolani C, Parola M, Colombatto S, Novo E, Vizzutti F, Anania FA, Milani S, Rombouts K, Laffi G, Pinzani M, Marra F. Upregulation of proinflammatory and proangiogenic cytokines by leptin in human hepatic stellate cells. Hepatology 2005; 42: [PMID: DOI: /hep.20965] 79 Kitase A, Hino K, Furutani T, Okuda M, Gondo T, Hidaka I, Hara Y, Yamaguchi Y, Okita K. In situ detection of oxidized n-3 polyunsaturated fatty acids in chronic hepatitis C: correlation with hepatic steatosis. J Gastroenterol 2005; 40: [PMID: DOI: /s x] 80 Gochee PA, Jonsson JR, Clouston AD, Pandeya N, Purdie DM, Powell EE. Steatosis in chronic hepatitis C: association with increased messenger RNA expression of collagen I, tumor necrosis factor-alpha and cytochrome P450 2E1. J Gastroenterol Hepatol 2003; 18: [PMID: ] 81 Petta S, Amato M, Cabibi D, Cammà C, Di Marco V, Giordano C, Galluzzo A, Craxì A. Visceral adiposity index is associated with histological findings and high viral load in patients with chronic hepatitis C due to genotype 1. Hepatology 2010; 52: [PMID: DOI: /hep.23859] 82 Walsh MJ, Jonsson JR, Richardson MM, Lipka GM, Purdie DM, Clouston AD, Powell EE. Non-response to antiviral therapy is associated with obesity and increased hepatic expression of suppressor of cytokine signalling 3 (SOCS-3) in patients with chronic hepatitis C, viral genotype 1. Gut 2006; 55: [PMID: DOI: /gut ] 83 Ishida H, Li K, Yi M, Lemon SM. p21-activated kinase 1 is activated through the mammalian target of rapamycin/p70 S6 kinase pathway and regulates the replication of hepatitis C virus in human hepatoma cells. J Biol Chem 2007; 282: [PMID: DOI: /jbc.M ] 84 Nielsen SU, Bassendine MF, Burt AD, Martin C, Pumeechockchai W, Toms GL. Association between hepatitis C virus and very-low-density lipoprotein (VLDL)/LDL analyzed in iodixanol density gradients. J Virol 2006; 80: [PMID: DOI: /JVI ] 85 Romero-Gómez M, Diago M, Andrade RJ, Calleja JL, Salmerón J, Fernández-Rodríguez CM, Solà R, García-Samaniego J, Herrerías JM, De la Mata M, Moreno-Otero R, Nuñez O, Olveira A, Durán S, Planas R. Treatment of insulin resistance with metformin in naïve genotype 1 chronic hepatitis C patients receiving peginterferon alfa-2a plus ribavirin. Hepatology 2009; 50: [PMID: DOI: / hep.23206] 86 Overbeck K, Genné D, Golay A, Negro F. Pioglitazone in chronic hepatitis C not responding to pegylated interferonalpha and ribavirin. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 87 Conjeevaram H, Burant CF, McKenna Harsh D, Kang H, Das AK, Everett L, White D, Lok ASF. A randomized, double-blind, placebo-controlled study of PPAR-gamma agonist pioglitazone given in combination with peginterferon and ribavirin in patients with genotype-1 chronic hepatitis C. Hepatology 2008; 384A 88 Muhlestein JB, Anderson JL, Hammond EH, Zhao L, Trehan S, Schwobe EP, Carlquist JF. Infection with Chlamydia pneumoniae accelerates the development of atherosclerosis and treatment with azithromycin prevents it in a rabbit model. Circulation 1998; 97: [PMID: DOI: /01.CIR ] 89 Shimada K, Daida H, Mokuno H, Watanabe Y, Sawano M, Iwama Y, Seki E, Kurata T, Sato H, Ohashi S, Suzuki H, Miyauchi K, Takaya J, Sakurai H, Yamaguchi H. Association of seropositivity for antibody to Chlamydia-specific lipopolysaccharide and coronary artery disease in Japanese men. Jpn Circ J 2001; 65: [PMID: DOI: / jcj ] 90 Adam E, Melnick JL, Probtsfield JL, Petrie BL, Burek J, Bailey KR, McCollum CH, DeBakey ME. High levels of cytomegalovirus antibody in patients requiring vascular surgery for atherosclerosis. Lancet 1987; 2: [PMID: DOI: /S (87) ] 91 Yamashiroya HM, Ghosh L, Yang R, Robertson AL. Herpesviridae in the coronary arteries and aorta of young trauma victims. Am J Pathol 1988; 130: [PMID: ] 92 Zhu J, Quyyumi AA, Norman JE, Costello R, Csako G, Epstein SE. The possible role of hepatitis A virus in the pathogenesis of atherosclerosis. J Infect Dis 2000; 182: [PMID: DOI: /317613] 93 Espinola-Klein C, Rupprecht HJ, Blankenberg S, Bickel C, Kopp H, Victor A, Hafner G, Prellwitz W, Schlumberger W, Meyer J. Impact of infectious burden on progression of carotid atherosclerosis. Stroke 2002; 33: [PMID: DOI: /01.STR A4] 94 Ishizaka N, Ishizaka Y, Takahashi E, Tooda Ei, Hashimoto H, Nagai R, Yamakado M. Association between hepatitis C virus seropositivity, carotid-artery plaque, and intima-media thickening. Lancet 2002; 359: [PMID: DOI: /S (02) ] 95 Ishizaka Y, Ishizaka N, Takahashi E, Unuma T, Tooda E, Hashimoto H, Nagai R, Yamakado M. Association between hepatitis C virus core protein and carotid atherosclerosis. Circ J 2003; 67: [PMID: ] 96 Fukui M, Kitagawa Y, Nakamura N, Yoshikawa T. Hepatitis C virus and atherosclerosis in patients with type 2 diabetes. JAMA 2003; 289: [PMID: ] 97 Targher G, Bertolini L, Padovani R, Rodella S, Arcaro G, Day C. Differences and similarities in early atherosclerosis between patients with non-alcoholic steatohepatitis and chronic hepatitis B and C. J Hepatol 2007; 46: [PMID: DOI: /j.jhep ] 98 Boddi M, Abbate R, Chellini B, Giusti B, Solazzo V, Soft F, Pratesi G, Pratesi C, Gensini G, Zignego AL. HCV infection facilitates asymptomatic carotid atherosclerosis: preliminary report of HCV RNA localization in human carotid plaques. Dig Liver Dis 2007; 39 Suppl 1: S55-S60 [PMID: ] 99 Petta S, Torres D, Fazio G, Cammà C, Cabibi D, Di Marco V, Licata A, Marchesini G, Mazzola A, Parrinello G, Novo S, Licata G, Craxì A. Carotid atherosclerosis and chronic hepatitis C: a prospective study of risk associations. Hepatology 2012; 55: [PMID: DOI: /hep.25508] 100 Adinolfi LE, Restivo L, Zampino R, Guerrera B, Lonardo A, Ruggiero L, Riello F, Loria P, Florio A. Chronic HCV infection is a risk of atherosclerosis. Role of HCV and HCVrelated steatosis. Atherosclerosis 2012; 221: [PMID: DOI: /j.atherosclerosis ] 2836 March 21, 2014 Volume 20 Issue 11

118 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism 101 Boddi M, Abbate R, Chellini B, Giusti B, Giannini C, Pratesi G, Rossi L, Pratesi C, Gensini GF, Paperetti L, Zignego AL. Hepatitis C virus RNA localization in human carotid plaques. J Clin Virol 2010; 47: [PMID: DOI: /j.jcv ] 102 Vassalle C, Masini S, Bianchi F, Zucchelli GC. Evidence for association between hepatitis C virus seropositivity and coronary artery disease. Heart 2004; 90: [PMID: DOI: /hrt ] 103 Alyan O, Kacmaz F, Ozdemir O, Deveci B, Astan R, Celebi AS, Ilkay E. Hepatitis C infection is associated with increased coronary artery atherosclerosis defined by modified Reardon severity score system. Circ J 2008; 72: [PMID: ] 104 Haji SA, Starling RC, Avery RK, Mawhorter S, Tuzcu EM, Schoenhagen P, Cook DJ, Ratliff NB, McCarthy PM, Young JB, Yamani MH. Donor hepatitis-c seropositivity is an independent risk factor for the development of accelerated coronary vasculopathy and predicts outcome after cardiac transplantation. J Heart Lung Transplant 2004; 23: [PMID: DOI: /S (03) ] 105 Bedimo R, Westfall AO, Mugavero M, Drechsler H, Khanna N, Saag M. Hepatitis C virus coinfection and the risk of cardiovascular disease among HIV-infected patients. HIV Med 2010; 11: [PMID: DOI: /j x] 106 Freiberg MS, Chang CC, Skanderson M, McGinnis K, Kuller LH, Kraemer KL, Rimland D, Goetz MB, Butt AA, Rodriguez Barradas MC, Gibert C, Leaf D, Brown ST, Samet J, Kazis L, Bryant K, Justice AC. The risk of incident coronary heart disease among veterans with and without HIV and hepatitis C. Circ Cardiovasc Qual Outcomes 2011; 4: [PMID: DOI: /CIRCOUTCOMES ] 107 Völzke H, Schwahn C, Wolff B, Mentel R, Robinson DM, Kleine V, Felix SB, John U. Hepatitis B and C virus infection and the risk of atherosclerosis in a general population. Atherosclerosis 2004; 174: [PMID: DOI: / j.atherosclerosis ] 108 Arcari CM, Nelson KE, Netski DM, Nieto FJ, Gaydos CA. No association between hepatitis C virus seropositivity and acute myocardial infarction. Clin Infect Dis 2006; 43: e53-e56 [PMID: DOI: /507031] 109 Butt AA, Xiaoqiang W, Budoff M, Leaf D, Kuller LH, Justice AC. Hepatitis C virus infection and the risk of coronary disease. Clin Infect Dis 2009; 49: [PMID: DOI: /599371] 110 Forde KA, Haynes K, Troxel AB, Trooskin S, Osterman MT, Kimmel SE, Lewis JD, Lo Re V. Risk of myocardial infarction associated with chronic hepatitis C virus infection: a population-based cohort study. J Viral Hepat 2012; 19: [PMID: DOI: /j x] 111 Amin J, Law MG, Bartlett M, Kaldor JM, Dore GJ. Causes of death after diagnosis of hepatitis B or hepatitis C infection: a large community-based linkage study. Lancet 2006; 368: [PMID: DOI: /S (06) ] 112 Guiltinan AM, Kaidarova Z, Custer B, Orland J, Strollo A, Cyrus S, Busch MP, Murphy EL. Increased all-cause, liver, and cardiac mortality among hepatitis C virus-seropositive blood donors. Am J Epidemiol 2008; 167: [PMID: DOI: /aje/kwm370] 113 Lee MH, Yang HI, Wang CH, Jen CL, Yeh SH, Liu CJ, You SL, Chen WJ, Chen CJ. Hepatitis C virus infection and increased risk of cerebrovascular disease. Stroke 2010; 41: [PMID: DOI: /STROKEAHA ] 114 Ohsawa M, Kato K, Tanno K, Itai K, Fujishima Y, Okayama A, Turin TC, Onoda T, Suzuki K, Nakamura M, Kawamura K, Akiba T, Sakata K, Fujioka T. Seropositivity for anti-hcv core antigen is independently associated with increased allcause, cardiovascular, and liver disease-related mortality in hemodialysis patients. J Epidemiol 2011; 21: [PMID: ] 115 Lee MH, Yang HI, Lu SN, Jen CL, You SL, Wang LY, Wang CH, Chen WJ, Chen CJ. Chronic hepatitis C virus infection increases mortality from hepatic and extrahepatic diseases: a community-based long-term prospective study. J Infect Dis 2012; 206: [PMID: DOI: /infdis/ jis385] 116 Younossi ZM, Braun WE, Protiva DA, Gifford RW, Straffon RA. Chronic viral hepatitis in renal transplant recipients with allografts functioning for more than 20 years. Transplantation 1999; 67: [PMID: ] 117 Neal KR, Ramsay S, Thomson BJ, Irving WL. Excess mortality rates in a cohort of patients infected with the hepatitis C virus: a prospective study. Gut 2007; 56: [PMID: DOI: /gut ] 118 Kristiansen MG, Løchen ML, Gutteberg TJ, Mortensen L, Eriksen BO, Florholmen J. Total and cause-specific mortality rates in a prospective study of community-acquired hepatitis C virus infection in northern Norway. J Viral Hepat 2011; 18: [PMID: DOI: /j x] 119 Tien PC, Schneider MF, Cole SR, Cohen MH, Glesby MJ, Lazar J, Young M, Mack W, Hodis HN, Kaplan RC. Association of hepatitis C virus and HIV infection with subclinical atherosclerosis in the women s interagency HIV study. AIDS 2009; 23: [PMID: DOI: / QAD.0b013e32832d7aa8] 120 Mostafa A, Mohamed MK, Saeed M, Hasan A, Fontanet A, Godsland I, Coady E, Esmat G, El-Hoseiny M, Abdul-Hamid M, Hughes A, Chaturvedi N. Hepatitis C infection and clearance: impact on atherosclerosis and cardiometabolic risk factors. Gut 2010; 59: [PMID: DOI: / gut ] 121 Bilora F, Rinaldi R, Boccioletti V, Petrobelli F, Girolami A. Chronic viral hepatitis: a prospective factor against atherosclerosis. A study with echo-color Doppler of the carotid and femoral arteries and the abdominal aorta. Gastroenterol Clin Biol 2002; 26: [PMID: ] 122 Bilora F, Campagnolo E, Rinaldi R, Rossato A, Arzenton M, Petrobelli F. Carotid and femoral atherosclerosis in chronic hepatitis C: a 5-year follow-up. Angiology 2008; 59: [PMID: DOI: / ] 123 Miyajima I, Kawaguchi T, Fukami A, Nagao Y, Adachi H, Sasaki S, Imaizumi T, Sata M. Chronic HCV infection was associated with severe insulin resistance and mild atherosclerosis: a population-based study in an HCV hyperendemic area. J Gastroenterol 2013; 48: [PMID: DOI: /s ] 124 Hsu CS, Kao JH, Chao YC, Lin HH, Fan YC, Huang CJ, Tsai PS. Interferon-based therapy reduces risk of stroke in chronic hepatitis C patients: a population-based cohort study in Taiwan. Aliment Pharmacol Ther 2013; 38: [PMID: DOI: /apt.12391] 125 Younossi ZM, Stepanova M, Nader F, Younossi Z, Elsheikh E. Associations of chronic hepatitis C with metabolic and cardiac outcomes. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12234] 126 Marchesini G, Ronchi M, Forlani G, Bugianesi E, Bianchi G, Fabbri A, Zoli M, Melchionda N. Cardiovascular disease in cirrhosis--a point-prevalence study in relation to glucose tolerance. Am J Gastroenterol 1999; 94: [PMID: DOI: /S (98) ] 127 Stoll G, Bendszus M. Inflammation and atherosclerosis: novel insights into plaque formation and destabilization. Stroke 2006; 37: [PMID: DOI: /01. STR ] 128 Tardif KD, Waris G, Siddiqui A. Hepatitis C virus, ER stress, and oxidative stress. Trends Microbiol 2005; 13: [PMID: DOI: /j.tim ] 2837 March 21, 2014 Volume 20 Issue 11

119 Vespasiani-Gentilucci U et al. Chronic hepatitis C and metabolism 129 Peng YS, Chiang CK, Hsu SP, Pai MF, Hung KY, Kao JH. Influence of hepatitis C virus infection on soluble cellular adhesion molecules in hemodialysis patients. Blood Purif 2005; 23: [PMID: DOI: / ] 130 Kono Y, Hayashida K, Tanaka H, Ishibashi H, Harada M. High-density lipoprotein binding rate differs greatly between genotypes 1b and 2a/2b of hepatitis C virus. J Med Virol 2003; 70: [PMID: DOI: /jmv.10372] 131 Zignego AL, Craxì A. Extrahepatic manifestations of hepatitis C virus infection. Clin Liver Dis 2008; 12: , ix [PMID: DOI: /j.cld ] 132 Targher G, Day CP, Bonora E. Risk of cardiovascular disease in patients with nonalcoholic fatty liver disease. N Engl J Med 2010; 363: [PMID: DOI: /NEJMra ] 133 Caliskan Y, Oflaz H, Pusuroglu H, Boz H, Yazici H, Tamer S, Karsidag K, Yildiz A. Hepatitis C virus infection in hemodialysis patients is not associated with insulin resistance, inflammation and atherosclerosis. Clin Nephrol 2009; 71: [PMID: ] P- Reviewers: Cucchetti A, Wang CC S- Editor: Cui XM L- Editor: A E- Editor: Zhang DN 2838 March 21, 2014 Volume 20 Issue 11

120 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Individualization of chronic hepatitis C treatment according to the host characteristics Nikolaos K Gatselis, Kalliopi Zachou, Asterios Saitis, Maria Samara, George N Dalekos Nikolaos K Gatselis, Kalliopi Zachou, Asterios Saitis, George N Dalekos, Department of Medicine and Research Laboratory of Internal Medicine, School of Medicine, University of Thessaly, Larissa, Greece Maria Samara, Department of Pathology, School of Medicine, University of Thessaly, Larissa, Greece Author contributions: Gatselis NK, Zachou K and Dalekos GN had the original idea, designed the chapters and wrote the first draft of the review; Saitis A, Gatselis NK, Samara M and Zachou K collected and summarized the published literature while, made many critical comments on the manuscript; Dalekos GN made the final critical revision of the manuscript for important intellectual content; all authors have seen and approved the final version of the manuscript. Correspondence to: George N Dalekos, MD, PhD, Professor, Head, Department of Medicine and Research Laboratory of Internal Medicine, School of Medicine, University of Thessaly, Biopolis, Larissa, Greece. dalekos@med.uth.gr Telephone: Fax: Received: September 19, 2013 Revised: November 19, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) infection is a global health problem that affects more than 170 million people worldwide. It is a major cause of cirrhosis and hepatocellular carcinoma, making the virus the most common cause of liver failure and transplantation. The standardof-care treatment for chronic hepatitis C (CHC) has been changed during the last decade and direct acting antiviral drugs have already been used. Besides, understanding of the pathogenesis of CHC has evolved rapidly during the last years and now several host factors are known to affect the natural history and response to treatment. Recent genome-wide association studies have shown the important role of interleukin-28b and inosine triphosphatase in HCV infection. The present review article attempts to summarize the current knowledge on the role of host factors towards individualization of HCV treatment Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Chronic hepatitis C; Hepatitis C virus host factors; Interleukin 28B; Inosine triphosphatase; Single nucleotide polymorphism Core tip: Hepatitis C virus (HCV) is a major health problem with personal, social and economic implications. In the past few years, advances in HCV molecular virology and host genetics revealed a complex interplay between the virus and the host that influence the natural history of chronic hepatitis C (CHC) and response to treatment. Besides, the management of CHC has evolved with the development of direct acting antiviral agents (DAAs). In this review, we have summarized the knowledge regarding host determinants of HCV treatment outcome and consider how this knowledge might help to individualize clinical management in the era of DAAs. Gatselis NK, Zachou K, Saitis A, Samara M, Dalekos GN. Individualization of chronic hepatitis C treatment according to the host characteristics. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/2839.htm DOI: i INTRODUCTION Chronic hepatitis C (CHC) is one of the most important health issues problem worldwide with more than 170 million people infected and significant personal, social, and economic impact [1]. The long-term sequelae of CHC 2839 March 21, 2014 Volume 20 Issue 11

121 Gatselis NK et al. Host factors and HCV treatment Liver fibrosis SNPs Race Host factors BMI Age have identified several clinically important genetic determinants of PEG-IFN/RBV treatment outcomes. The most important are single nucleotide polymorphisms (SNPs) in interleukin 28B (IL28B) gene, which is associated with spontaneous clearance and response to anti- HCV treatment [16-18] and in inosine triphosphatase (ITPA) gene, which protects against ribavirin-related hemolytic anaemia and subsequent dose reductions [19,20]. In this review, we present in brief the major host factors that can modify the response to treatment of CHC, focusing on the clinical utility of IL28B and ITPA genotyping for pretreatment counseling and individualization of therapy modalities. Lipids Insulin resistance Figure 1 Host factors associated with treatment outcomes of chronic hepatitis C. SNP: Single nucleotide polymorphism; BMI: Body mass index. include cirrhosis, decompensation, hepatocellular carcinoma and liver related death [2,3]. The standard-of-care (SOC) treatment for CHC during the last decade has been the combination therapy of pegylated-interferon-α (PEG-IFN) with ribavirin (RBV), a guanosine analogue that interrupts the viral RNA metabolism [4,5]. However, the rate of sustained virological response (SVR), defined as having undetectable serum hepatitis C virus (HCV) RNA at week 24 after treatment discontinuation, is suboptimal for genotype 1 hepatitis C virus (HCV-1), with less than 50% of patients achieving viral eradication [4,6,7]. Moreover, PEG-IFN/RBV therapy is associated with significant adverse effects, which increase morbidity, while treatment is prolonged ranging from 24 to 48 wk or more, according to EASL and AASLD guidelines [8,9]. As a result clinicians often have to weigh the various viral and host characteristics for each patient before initiating treatment [10]. Antiviral therapy is currently changing and various direct acting antiviral drugs (DAAs) have been developed, which are directed against essential components of viral replication [11,12]. In addition, understanding of the pathogenesis of CHC has evolved rapidly, leading to development of novel compounds, targeting host factors that are potentially modifiable [13]. Given the high cost of treatment and the increased possibility of adverse events, identification of factors predicting SVR and the need to individualize HCV therapy by incorporating new predictive data in clinical decision-making is urgent. Several host factors such as age, gender, race-ethnicity, fibrosis stage, obesity, hepatic steatosis, low-density lipoprotein cholesterol (LDLc), insulin resistance, and genetic variances of the host [14,15], are known to affect the spontaneous clearance and treatment outcomes (Figure 1). Recently, genome-wide association studies (GWAS) Sex NON-GENETIC HOST FACTORS Demographic host factors It is well documented that race is associated with treatment response either with SOC or triple (SOC plus DAAs) therapy [21-31]. In several controlled trials, it was demonstrated that SOC in African-American patients has a reduced likelihood of SVR, ranging between 19% and 28%, compared to non-african-americans in whom SVR rate was 39%-52%, especially when HCV-1 is taken into account [22,23,25]. The same was true for triple therapy in naïve patients infected with HCV-1; SPRINT-2 trial (boceprevir-based therapy) [30] as well as ADVANCED study (telaprevir-based therapy) [29] showed that Black ethnic origin negatively affected SVR. In addition, HCV infected individuals of Asian origin seem to achieve better SVR rates in comparison to Caucasians [26,31]. Differences in population frequency of the favorable IL28B genotype may explain the recognized ethnic disparity in treatment response rates [16,32]. However, the response to treatment in Black populations was poorer across all IL28B genotypes, suggesting that there may be other viral and/or host factors influencing SVR [27,28]. Hispanics also tended to have poorer SVR rates compared to Caucasian patients [21,24,27]. Although female gender was considered a positive predictor of SVR in IFN plus RBV era [33], in PEG- IFN/RBV trials no statistically significant correlation was found on multivariate analysis between gender and SVR [4,6,34-36]. Age has also been considered a significant factor for predicting response to treatment. In particular, large prospective studies of PEG-IFN/RBV combination therapy showed that patients younger than years achieved significantly higher SVR rates compared to older patients [4,6,33,34]. In triple therapy trials with boceprevir, age was also significant [30,37] regarding the achievement of SVR in univariate investigation but not after multivariate analysis, especially when IL28B genotype was taken into account [38]. Metabolic parameters Obesity is traditionally considered a significant predictor of disease progression in CHC, probably due to increased inflammatory milieu, which promotes liver injury in overweight individuals [39]. In a prospective trial [40], 2840 March 21, 2014 Volume 20 Issue 11

122 Gatselis NK et al. Host factors and HCV treatment fibrosis progression was associated with body mass index (BMI). A high BMI was also inversely correlated with SVR in both IFN and SOC treated HCV patients [41,42]. Furthermore, a lower baseline body weight was significantly associated with SVR across all genotypes in the era of PEG-IFN/RBV combination therapy [4,6,34,42]. However, when RBV weight-based dosing was implicated, BMI and body weight were no longer significant parameters of SVR [43,44]. On the contrary, in a retrospective analysis of SPRINT-2 [30] and RESPOND-2 [37] studies by Poordad et al [38], low BMI proved to be one of the significant factors for achieving SVR in boceprevir-based therapy of treatment-naïve patients. In two recent meta-analyses, insulin resistance (IR) was strongly associated with the probability of achieving SVR to dual treatment [45,46]. In Spanish [47] as well as Japanese [48] patients, IR seemed to be an independent predictor of response irrespective of the IL28B genotype. Concerning triple therapy, IR did not have any effect on SVR when telaprevir was used in the combination [49]. Recent studies suggest that pretreatment serum lipid levels may be important predictors of treatment response. Several studies indicate that high pretreatment LDLc and total cholesterol levels are associated with higher rates of SVR to dual PEG-IFN/RBV therapy in multivariate analysis [50-56]. In addition, pretreatment triglyceride levels may also play a role in SVR [56]. LDLc remained a significant independent predictor of SVR in post hoc analysis of the telaprevir-based REALIZE study [57] in treatment experienced patients [58]. The abovementioned associations between serum lipids and treatment response are supported by potential biological mechanisms. In vitro studies suggest relationships between lipoproteins and HCV that are important for viral entry into hepatocytes, viral replication and secretion. Indeed, several studies have shown that HCV may combine with lipoproteins in the serum, obscuring the virus from the host immune response, which may in turn help viral entry into the hepatocytes [59-61]. Various receptors involved in lipoprotein-viral particle entry into hepatocytes are posited, including the scavenger receptor B1 (SR-B1) and LDLc receptor [62-65]. IFN therapy leads to down-regulation of SR-B1 expression [66]. Finally, statin use in HCV-1 has been associated with increased SVR to dual PEG-IFN/RBV therapy [55] and in boceprevir-based triple therapy [30]. Taken together the above studies support the notion that decreased lipoprotein expression may in turn impact serum lipoproteins and lipids profile measures affecting SVR. However, these associations need to be interpreted with caution, because the favourable IL28B CC genotype is also associated with increased LDLc [67-69]. Histologic parameters The presence of advanced liver fibrosis and cirrhosis has long been recognized to be associated with lower SVR rates to IFN-based treatment [33,34,70]. Actually, advanced fibrosis and cirrhosis have been shown to be major independent predictors of non-response to SOC [34,44,70]. Furthermore, in treatment-naïve patients, triple therapies with boceprevir and telaprevir (SPRINT-2 [30] and ADVANCE [29] studies, respectively), showed that the severity of liver fibrosis together with IL28B genotype affect treatment outcome. Similar results were found when treatment-experienced patients were taken into account [57,71], although in these patients other factors such as IL28B genotype and pattern of previous response seemed to be the best predictors of response to triple therapy [38]. GENETIC FACTORS OF THE HOST Host genetic factors have long been suggested that might play an important role for the observed differences in HCV clearance and response to treatment among different ethnic groups. Over 40 genes have been linked to modulation of anti-hcv therapy affecting either response to treatment or side effects to drugs [72,73]. However, only after sequencing of the entire human genome in 2001, major advances have been made in genotyping technologies, with the large-scale discovery of SNPs and the implementation of GWAS. Initial studies investigated candidate genes to identify differences or SNPs between two populations. Several SNPs were identified in genes that are involved in the innate defense against HCV including MxA, OAS1, EI- F2AK2, IFNAR1, IL-6, MHC, MAPKAPK3 and KIR receptors [74-82]. In addition, pretreatment hepatic gene expression such as an 8-gene subset (GIP2/IFI15/ISG15, ATF5, IFIT1, MX1, USP18/UBP43, DUSP1, CEB1, and RPS28) [83] and a two-gene signature (IFI27 and CXLC9) [84] predicted the response to treatment with a sufficient predictive accuracy in the majority of patients studied. Interestingly, in a recent paper by Chen et al [85], treatment response was linked to cell-specific activation patterns: interferon-stimulated gene 15 (ISG 15) protein up-regulation was more pronounced in hepatocytes of non-responders but also in Kupffer cells of responders. Even more recently, the same group showed that the gene expression pattern, at either the mrna or the protein level, is more predictive of treatment outcome than the host (IL28B) or viral genotype [86]. Furthermore, the level of expression of intrahepatic mir-122 has been associated with HCV treatment response [87]. Expression of mir-122 was significantly lower in primary nonresponders compared to early responders [86], while 8 other micrornas (mir-34b, mir-145, mir-143, mir-652, mir-18a, mir-27b, mir-422b, and mir-378) were also found to be differentially expressed in responders and nonresponders [88]. However, the validity of the reported associations varies, since a small number of them have repeatedly been reported from several independent large cohorts and have been verified to apply to different ethnicities. For this reason, it is till now IL28B polymorphisms that are considered as state of the art in HCV pharmacogenetics, which can potentially tailor future therapies [89] March 21, 2014 Volume 20 Issue 11

123 Gatselis NK et al. Host factors and HCV treatment A IL28B Chromosome 19q13 IL28A IL29 rs rs B ITPA Chromosome 20p rs rs Figure 2 Single nucleotide polymorphisms of IL28B and ITPA gene location. ITPA: Inosine triphosphatase. IL-28B Independent GWAS have identified genetic variants near the IL28B gene that are strongly associated with treatment response [16-18] and spontaneous HCV clearance [32,90,91]. Two bi-allelic SNPs, in linkage disequilibrium [92], were most strongly associated with favourable response; SNP rs located 3 kb upstream of the IL28B gene (favourable response CC genotype, and unfavourable CT/TT genotypes) and rs located 8 kb downstream of the IL28B gene and 16 kb upstream of the IL28A gene (favourable response TT genotype, and unfavourable GT/GG genotypes) (Figure 2A). Subsequently, these treatment response findings were confirmed by many studies in different populations such as HCV-1 patients [27,93-97], HCV-4 patients [98-101], patients with recent HCV infection [102], adults and children with spontaneous HCV clearance [ ], HCV/HIV co-infected patients [ ], and patients with recurrent HCV infection after orthotopic liver transplantation [109]. The results were reproduced in five recent meta-analyses in Asian, Caucasian and African patients [ ]. The influence of IL28B on treatment response in genotype 2 or genotype 3 infections is less clinically relevant. Several studies from Europe and Japan have demonstrated an association between IL28B and SVR rates [115,116], while other studies failed to show a clear effect [117,118] although some studies showed that viral elimination within the first weeks of treatment and the achievement of rapid virological response (RVR) was significantly faster in CCrs and TTrs patients [118,119]. Thus, determination of IL28B genotype may be more relevant in slow responders to treatment (e.g., non-rvr patients) [120]. Recently, a meta-analysis of 23 studies involving 3042 patients showed that in HCV-2 and HCV-3 patients with favourable IL28B polymorphisms (either CCrs or TTrs patients), RVR rates were increased by 13%-15% and SVR rates by 5% [121]. The mechanisms behind these associations are related to the host innate immune response [122,123]. IL28B gene along with IL28A and IL29 belong to the type Ⅲ IFN family, also named IFN-λ and they are located on the hu- man chromosome 19. In particular, IL28A corresponds to IFN-λ 2, IL28B to IFN-λ 3 and IL29 to IFN-λ 1 [124]. The corresponding cytokines are induced by viral infection and their antiviral activity is mediated by triggering the Janus kinase-signal Transducer and Activator of Transcription (JAK-STAT) pathway, following to their interaction with a heterodimeric class Ⅱ cytokine receptor that consists of IL-10 and IL-28 receptors [ ]. The JAK-STAT pathway activates ISGs which are known to cause apoptosis, growth inhibition, and inhibition of viral replication [128]. IL28B genotype has strongly been associated with intrahepatic ISGs expression, with the unfavourable genotypes expressing higher baseline ISGs levels compared with the favourable genotype [129,130]. This finding could indicate an exhaustion of innate immunity prior to treatment in patients with unfavourable IL28B genotype. Raglow et al [131] showed that this relationship is reversed in normal liver tissue, where TTrs genotype expresses lower levels of ISGs than CCrs genotype. Recently, two independent studies identified dysregulation in several pathways of innate immunity and natural killer cells activity in patients with unfavourable IL28B genotype, resulting in a muted response to IFN therapy [132,133]. However, it is not clear so far, if there is a direct correlation between IL28B polymorphisms and IL28B expression level. IL28 mrna in the peripheral blood mononuclear cells (PBMCs) of patients with favourable IL28B genotype was significantly higher, whereas the presence of the risk alleles CT/CCrs were associated with lower expression of IFN-λ [17,18]. Shi et al [134] demonstrated that mrna and serum levels of IL28B were lower in patients with CT/TTrs unfavourable genotypes. Moreover, in the era of liver transplantation, these genetic variations were significantly associated with IL28B mrna expression in both the resected liver derived from the recipients and the donated liver [109]. On the contrary, other studies have not found such a correlation between IL28B genotype and IL28B gene expression [129,135]. Abe et al [136] showed that the expression levels of IL28B in the liver were lower in patients with the favorable IL28B genotype. This is in discordance with what happens in 2842 March 21, 2014 Volume 20 Issue 11

124 Gatselis NK et al. Host factors and HCV treatment the periphery (PBMCs). Knowledge about the impact of IL28B SNPs on the different phases of viral elimination shed light on the functional implications of IL28B variability. The favourable IL28B genotypes enhance the reduction of HCV RNA during the early phases ( first and second ) of viral kinetics. This is translated into increased rates of RVR, complete early virological response (EVR) ontreatment and finally SVR [27,133, ]. In fact, most RVR patients carry the good-response IL28B genotype. Furthermore, IL28B genotype can be combined with a chemotactic chemokine, the interferon-gamma inducible protein 10 kda (IP-10), which strongly predicts the HCV RNA decline during the first days of therapy for all HCV genotypes [144]. In fact, it has been shown that the combination of increased baseline plasma IP-10 levels in association with IL28B non-favourable genotypes can accurately predict the first-phase decline of HCV RNA during treatment [135,145,146]. Besides, in acute HCV infection, IL28B genotype together with serum IP-10 levels can identify patients who are most likely to undergo spontaneous clearance and those in need of early antiviral therapy [147]. The new DAAs along with PEG-IFN/RBV combination are the new SOC in HCV-1 patients. Thus, it is necessary to redefine the role of the IL28B genotype in the decision to treat and how to treat these patients. SNPs in the IL28B region are the best baseline predictors of SVR and could be used as independent factors for treatment decision-making. In particular, treatment-naïve HCV-1 patients with genotype CCrs have the same probability (more than 80%) in achieving SVR either with dual therapy or triple therapy with telaprevir or boceprevir [27,29,30]. So, in these patients, the best therapeutic choice would be the standard PEG-IFN/RBV therapy, in order to avoid the higher costs and significant side effects of triple therapy [148,149]. However, during treatment, monitoring of HCV kinetics with milestones such as RVR and/ or EVR, has been proved stronger predictor of treatment outcome [150,151]. Therefore, treatment-naïve HCV-1 patients with favorable IL28B genotype who do not achieve RVR should be considered candidates for more effective therapy with DAAs. Response-guided therapy has become standard practice for HCV-1 patients and guidelines recommend shortening or prolongation of treatment duration, based on-treatment virological response. However, since the discovery of its significance, the incorporation of IL28B genotype in HCV management algorithms is intensively investigated. Huang et al [152] showed that IL28B genotype combined with baseline viral load might help in identifying HCV-1 patients who will or will not benefit from a shortened 24-wk regimen. The positive predictive value of these two factors (TTrs and lower baseline viral load) was 80% and the negative predictive value 91%. In the same line, Liu et al [153] showed that HCV-1 patients with the TTrs genotype and low baseline viral load (HCV RNA < IU/mL) could benefit from a shorter duration of combination therapy. Sarrazin et al [154] in a following study showed that the CCrs polymorphism was significantly associated with SVR, but in patients with on-treatment virologic response, SVR rates were similar for different IL28B genotypes. This finding indicates that virological response during therapy seems to determine the chance to achieve an SVR in an IL28B-independent way. In addition, two cohorts [155,156] have analyzed the efficacy of prolongation of treatment duration in HCV-1 slow-responders up to 72 wk and demonstrated that the benefits of extended therapy were restricted only to patients with CT/TTrs genotype. Despite the fact that DAAs clearly attenuates the association between IL28B genotype and HCV treatment response, there are studies suggesting that the favourable IL28B alleles could also predict response to triple therapy in treatment-naïve and treatment-experienced HCV-1 patients [ ]. In SPRINT-2 [30] and RESPOND-2 [37], where treatment-naïve or prior relapsers/non-responders were included respectively, CCrs genotype was significantly associated with increased SVR rates and could be used as a predictor for shortening therapy [161]. However, the sub-analysis of the REALISE study [57] failed to prove a significant association [162]. Further studies with DAAs are needed to identify whether the predictive role of IL28B genotype remains. For the time being, studies with new DAAs and/or IFN-free therapy regimens are being conducted. In IN- FORM-1 study, where 83 patients were treated with mericitabine plus danoprevir or placebo, CCrs was associated with an increased second phase decline of HCV RNA [163]. In parallel, PROPEL [164] and JUMP-C [165] studies showed higher SVR rates in IL28B CCrs genotype patients receiving mericitabine plus PEG-IFN/RBV. The efficacy of interferon-free combination of faldaprevir and deleobuvir with RBV for the treatment of HCV-1 patients was also associated with IL28B genotype [166] though in other IFN-free regimens [167,168] the effect of IL28B genotype was unclear. For example, the ATOMIC study [169], where the efficacy of treatment with sofosbuvir along with PEG-IFN/RBV was investigated, showed promising results in shortening the duration of treatment to 12 wk, independently of the IL28B genotype. The importance of IL28B genotype on response to future interferon-free combination DAA regimens remains to be determined with larger and longer duration studies. ITPA RBV is a main component in the currently available antiviral regimens for the treatment of CHC. One of the most common side effects of RBV therapy is anemia that may result in dose reduction or discontinuation in up to 15% of patients [4,7,10], which may have deleterious impact on SVR. The mechanisms of hemolytic anemia induced by RBV administration are complex. RBV causes a relative deficiency of ATP in human erythrocytes by depleting guanosine triphosphate (GTP) and subsequently leading 2843 March 21, 2014 Volume 20 Issue 11

125 Gatselis NK et al. Host factors and HCV treatment rs rs ITPase activity CC CC CA CC CA AA AC AA CC AC AA AA < 5% 100% Protection from RBV-related anemia Figure 3 Inosine triphosphatase activity according to ITPA genotype. ITPA: Inosine triphosphatase; RBV: Ribavirin. to inhibition of the ATP-dependent oxidative metabolism. This causes oxidative damage to the erythrocyte membranes and leads to extravascular hemolysis by the reticuloendothelial system [ ]. ITPA gene, which encodes a protein that hydrolyses inosine triphosphate (ITP), has been found to play a significant role in RBVinduced anemia. A reduced ITPA activity leads to the accumulation of ITP in erythrocytes, which allows for the substitution of ITP for GTP in ATP biosynthesis. This substitution reduces ATP depletion and protects against hemolytic anemia [ ]. In two large GWAS [19,20], two functional SNPs, rs and rs , within the ITPA gene were strongly associated with protection from RBV treatmentrelated hemolytic anemia and decreased the need for RBV dose reduction. The rs SNP is a missense variant in exon 2 of ITPA gene, while rs is located in ITPA intron 2 and alters splicing (Figure 2B). The AA/ACrs protective genotypes, as well as the CC/CArs protective genotypes, are associated with decreased ITPase activity and as a consequence decreased hemolytic side effects from RBV therapy (Figure 3). Following studies steadily reproduces the finding that polymorphic variation of the ITPA gene leads to enzymatic deficiency, which in turn is a major determinant of RBV-induced hemolytic anemia in HCV-1 patients [ ]. However, ITPA SNPs effect on therapeutic outcome is unclear. Some studies have shown no association [19,178,180,186,191], and others have reported a possible association with treatment outcomes in CHC patients [20,181,182,192]. These discrepancies could be attributed to the geographic variance of ITPA SNPs and different inclusion/exclusion criteria used for patient recruitment. Taking into account that anemia is one of the main adverse events leading to premature termination of therapy, any marker able to predict the risk of severe anemia before treatment would be of outmost importance. For this purpose, Tsubota et al [193] and Kurosaki et al [192] constructed predictions models incorporating ITPA genotype along with baseline hemoglobin, creatinine clearance and quantitative hemoglobin decline at week 2 of treatment. We need of course, further validation before entering these algorithms into clinical practice Prediction of anemia remains important in the era - + of DAAs, because these newer therapies still require RBV and PEG-IFN in combination, while in addition increases the frequency as well as the severity, and hence, clinical relevance of this adverse event [30, ]. Suzuki et al [198] studied 61 patients receiving triple telaprevir-based therapy and showed that decreases in haemoglobin levels were greater in patients with unfavourable (CCrs ) than favourable (CA/AArs ) genotypes in the ITPA gene, especially during the first 12 wk of treatment. Mean RBV dose during the first 12 wk was lower in patients with CCrs than CA/AArs genotypes, but the total dose of RBV and SVR rates were not different. Similar results obtained by Chayama et al [158] in a study of 94 Japanese HCV-1 patients treated with PEG-IFN/RBV and telaprevir. Patients with the anemia-susceptible ITPA SNP CCrs typically required ribavirin dose reduction earlier than did patients with other genotypes. However, this polymorphism was not proved to be a predictive marker of SVR. Recently, Ogawa et al [199] in a prospective multicenter study with 292 Japanese patients showed that CCrs genotype along with baseline hemoglobin less than 13.5 g/dl and estimated glomerular filtration rate < 80 ml/min per 1.73 m 2 were independent pretreatment predictors for developing severe anemia (Hb < 8.5 g/dl) during the treatment period. No effect on treatment outcome was proved. In sum, ITPA genotyping is able to detect HCV-infected patients who are at higher risk of developing anaemia. These patients should be monitored more closely in order to avoid premature withdrawals from treatment. CONCLUSION Prediction of SVR, which is translated in stopping disease progression, is the main requirement in CHC. Factors that predict SVR in turn have impact on treatment decision making, treatment duration and planning for the individual patient. Major advances in genetics during the last decade allow the identification of specific markers associated with viral response. Among them, IL-28B has been strongly associated with response to current treatment for HCV-1, in all reports, including large cohorts of patients. However, for the single patient, the use of IL- 28B alone as a predictive factor of treatment outcome and decision to treat is not sufficient. An important question arising and needing an urgent answer is how host and viral factors could be integrated in clinical practice. However, since in the same patient various host and viral factors interact, predictive analysis should be cautious, considering all these factors in combination. In the upcoming years of personalized medicine, the comprehension of HCV pathogenesis based on the knowledge of both host and viral genotypes could lead to individually tailored HCV therapies. REFERENCES 1 Shepard CW, Finelli L, Alter MJ. Global epidemiology of hepatitis C virus infection. Lancet Infect Dis 2005; 5: March 21, 2014 Volume 20 Issue 11

126 Gatselis NK et al. Host factors and HCV treatment [PMID: DOI: /S (05) ] 2 Manesis EK, Papatheodoridis GV, Touloumi G, Karafoulidou A, Ketikoglou J, Kitis GE, Antoniou A, Kanatakis S, Koutsounas SJ, Vafiadis I. Natural course of treated and untreated chronic HCV infection: results of the nationwide Hepnet. Greece cohort study. Aliment Pharmacol Ther 2009; 29: [PMID: DOI: /j x] 3 Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 2006; 45: [PMID: DOI: / j.jhep ] 4 Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL, Häussinger D, Diago M, Carosi G, Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: / NEJMoa020047] 5 Furusyo N, Katoh M, Tanabe Y, Kajiwara E, Maruyama T, Shimono J, Sakai H, Nakamuta M, Nomura H, Masumoto A, Shimoda S, Takahashi K, Azuma K, Hayashi J. Interferon alpha plus ribavirin combination treatment of Japanese chronic hepatitis C patients with HCV genotype 2: a project of the Kyushu University Liver Disease Study Group. World J Gastroenterol 2006; 12: [PMID: ] 6 Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001; 358: [PMID: ] 7 Hadziyannis SJ, Sette H, Morgan TR, Balan V, Diago M, Marcellin P, Ramadori G, Bodenheimer H, Bernstein D, Rizzetto M, Zeuzem S, Pockros PJ, Lin A, Ackrill AM. Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 2004; 140: [PMID: ] 8 European Association for the Study of the Liver. EASL Clinical Practice Guidelines: management of hepatitis C virus infection. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 9 Ghany MG, Nelson DR, Strader DB, Thomas DL, Seeff LB, American Association for Study of Liver Diseases. An update on treatment of genotype 1 chronic hepatitis C virus infection: 2011 practice guideline by the American Association for the Study of Liver Diseases. Hepatology 2011; 54: [PMID: DOI: /hep.24641] 10 Fried MW. Side effects of therapy of hepatitis C and their management. Hepatology 2002; 36: S237-S244 [PMID: DOI: /jhep ] 11 Jang JY, Chung RT. New treatments for chronic hepatitis C. Korean J Hepatol 2010; 16: [PMID: DOI: /kjhep ] 12 Welsch C, Jesudian A, Zeuzem S, Jacobson I. New directacting antiviral agents for the treatment of hepatitis C virus infection and perspectives. Gut 2012; 61 Suppl 1: i36-i46 [PMID: DOI: /gutjnl ] 13 Zeisel MB, Lupberger J, Fofana I, Baumert TF. Host-targeting agents for prevention and treatment of chronic hepatitis C - perspectives and challenges. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 14 Chuang WL, Yu ML. Host factors determining the efficacy of hepatitis C treatment. J Gastroenterol 2013; 48: [PMID: DOI: /s x] 15 Asselah T, Estrabaud E, Bieche I, Lapalus M, De Muynck S, Vidaud M, Saadoun D, Soumelis V, Marcellin P. Hepatitis C: viral and host factors associated with non-response to pegylated interferon plus ribavirin. Liver Int 2010; 30: [PMID: DOI: /j x] 16 Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ, Sulkowski M, McHutchison JG, Goldstein DB. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 461: [PMID: DOI: /nature08309] 17 Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino K, Hige S, Ito Y, Mita E, Tanaka E, Mochida S, Murawaki Y, Honda M, Sakai A, Hiasa Y, Nishiguchi S, Koike A, Sakaida I, Imamura M, Ito K, Yano K, Masaki N, Sugauchi F, Izumi N, Tokunaga K, Mizokami M. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet 2009; 41: [PMID: DOI: /ng.449] 18 Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, Abate ML, Bassendine M, Spengler U, Dore GJ, Powell E, Riordan S, Sheridan D, Smedile A, Fragomeli V, Müller T, Bahlo M, Stewart GJ, Booth DR, George J. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet 2009; 41: [PMID: DOI: /ng.447] 19 Fellay J, Thompson AJ, Ge D, Gumbs CE, Urban TJ, Shianna KV, Little LD, Qiu P, Bertelsen AH, Watson M, Warner A, Muir AJ, Brass C, Albrecht J, Sulkowski M, McHutchison JG, Goldstein DB. ITPA gene variants protect against anaemia in patients treated for chronic hepatitis C. Nature 2010; 464: [PMID: DOI: /nature08825] 20 Ochi H, Maekawa T, Abe H, Hayashida Y, Nakano R, Kubo M, Tsunoda T, Hayes CN, Kumada H, Nakamura Y, Chayama K. ITPA polymorphism affects ribavirin-induced anemia and outcomes of therapy--a genome-wide study of Japanese HCV virus patients. Gastroenterology 2010; 139: [PMID: DOI: /j.gastro ] 21 Hepburn MJ, Hepburn LM, Cantu NS, Lapeer MG, Lawitz EJ. Differences in treatment outcome for hepatitis C among ethnic groups. Am J Med 2004; 117: [PMID: DOI: /j.amjmed ] 22 Jeffers LJ, Cassidy W, Howell CD, Hu S, Reddy KR. Peginterferon alfa-2a (40 kd) and ribavirin for black American patients with chronic HCV genotype 1. Hepatology 2004; 39: [PMID: DOI: /hep.20212] 23 Muir AJ, Bornstein JD, Killenberg PG, Atlantic Coast Hepatitis Treatment Group. Peginterferon alfa-2b and ribavirin for the treatment of chronic hepatitis C in blacks and non- Hispanic whites. N Engl J Med 2004; 350: [PMID: DOI: /NEJMoa032502] 24 Cheung RC, Currie S, Shen H, Ho SB, Bini EJ, Anand BS, Bräu N, Wright TL. Chronic hepatitis C in Latinos: natural history, treatment eligibility, acceptance, and outcomes. Am J Gastroenterol 2005; 100: [PMID: DOI: /j x] 25 Conjeevaram HS, Fried MW, Jeffers LJ, Terrault NA, Wiley- Lucas TE, Afdhal N, Brown RS, Belle SH, Hoofnagle JH, Kleiner DE, Howell CD. Peginterferon and ribavirin treatment in African American and Caucasian American patients with hepatitis C genotype 1. Gastroenterology 2006; 131: [PMID: DOI: /j.gastro ] 26 Missiha S, Heathcote J, Arenovich T, Khan K. Impact of asian race on response to combination therapy with peginterferon alfa-2a and ribavirin in chronic hepatitis C. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] 27 Thompson AJ, Muir AJ, Sulkowski MS, Ge D, Fellay J, Shianna KV, Urban T, Afdhal NH, Jacobson IM, Esteban R, Poordad F, Lawitz EJ, McCone J, Shiffman ML, Galler GW, Lee WM, Reindollar R, King JW, Kwo PY, Ghalib RH, Freilich B, Nyberg LM, Zeuzem S, Poynard T, Vock DM, Pieper KS, Patel K, Tillmann HL, Noviello S, Koury K, Pedicone LD, Brass CA, Albrecht JK, Goldstein DB, McHutchison 2845 March 21, 2014 Volume 20 Issue 11

127 Gatselis NK et al. Host factors and HCV treatment JG. Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus. Gastroenterology 2010; 139: e18 [PMID: DOI: / j.gastro ] 28 Clark PJ, Thompson AJ, McHutchison JG. IL28B genomicbased treatment paradigms for patients with chronic hepatitis C infection: the future of personalized HCV therapies. Am J Gastroenterol 2011; 106: [PMID: DOI: /ajg ] 29 Jacobson IM, McHutchison JG, Dusheiko G, Di Bisceglie AM, Reddy KR, Bzowej NH, Marcellin P, Muir AJ, Ferenci P, Flisiak R, George J, Rizzetto M, Shouval D, Sola R, Terg RA, Yoshida EM, Adda N, Bengtsson L, Sankoh AJ, Kieffer TL, George S, Kauffman RS, Zeuzem S. Telaprevir for previously untreated chronic hepatitis C virus infection. N Engl J Med 2011; 364: [PMID: DOI: / NEJMoa ] 30 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 31 Nguyen LH, Nguyen MH. Systematic review: Asian patients with chronic hepatitis C infection. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12300] 32 Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O Huigin C, Kidd J, Kidd K, Khakoo SI, Alexander G, Goedert JJ, Kirk GD, Donfield SM, Rosen HR, Tobler LH, Busch MP, McHutchison JG, Goldstein DB, Carrington M. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 2009; 461: [PMID: DOI: /nature08463] 33 Poynard T, McHutchison J, Goodman Z, Ling MH, Albrecht J. Is an a la carte combination interferon alfa-2b plus ribavirin regimen possible for the first line treatment in patients with chronic hepatitis C? The ALGOVIRC Project Group. Hepatology 2000; 31: [PMID: DOI: / hep ] 34 Shiffman ML, Suter F, Bacon BR, Nelson D, Harley H, Solá R, Shafran SD, Barange K, Lin A, Soman A, Zeuzem S, ACCEL- ERATE Investigators. Peginterferon alfa-2a and ribavirin for 16 or 24 weeks in HCV genotype 2 or 3. N Engl J Med 2007; 357: [PMID: DOI: /NEJMoa066403] 35 Dalgard O, Bjøro K, Ring-Larsen H, Bjornsson E, Holberg- Petersen M, Skovlund E, Reichard O, Myrvang B, Sundelöf B, Ritland S, Hellum K, Frydén A, Florholmen J, Verbaan H, North-C Group. Pegylated interferon alfa and ribavirin for 14 versus 24 weeks in patients with hepatitis C virus genotype 2 or 3 and rapid virological response. Hepatology 2008; 47: [PMID: DOI: /hep.21975] 36 Lagging M, Langeland N, Pedersen C, Färkkilä M, Buhl MR, Mørch K, Dhillon AP, Alsiö A, Hellstrand K, Westin J, Norkrans G, NORDynamIC Study Group. Randomized comparison of 12 or 24 weeks of peginterferon alpha-2a and ribavirin in chronic hepatitis C virus genotype 2/3 infection. Hepatology 2008; 47: [PMID: DOI: /hep.22253] 37 Bacon BR, Gordon SC, Lawitz E, Marcellin P, Vierling JM, Zeuzem S, Poordad F, Goodman ZD, Sings HL, Boparai N, Burroughs M, Brass CA, Albrecht JK, Esteban R, HCV RE- SPOND-2 Investigators. Boceprevir for previously treated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 38 Poordad F, Bronowicki JP, Gordon SC, Zeuzem S, Jacobson IM, Sulkowski MS, Poynard T, Morgan TR, Molony C, Pedicone LD, Sings HL, Burroughs MH, Sniukiene V, Boparai N, Goteti VS, Brass CA, Albrecht JK, Bacon BR, SPRINT-2 and RESPOND-2 Investigators. Factors that predict response of patients with hepatitis C virus infection to boceprevir. Gastroenterology 2012; 143: e1-5 [PMID: DOI: /j.gastro ] 39 Palmer C, Corpuz T, Guirguis M, O Toole S, Yan K, Bu Y, Jorgenson J, Talbot M, Loi K, Lloyd A, Zekry A. The effect of obesity on intrahepatic cytokine and chemokine expression in chronic hepatitis C infection. Gut 2010; 59: [PMID: DOI: /gut ] 40 Ortiz V, Berenguer M, Rayón JM, Carrasco D, Berenguer J. Contribution of obesity to hepatitis C-related fibrosis progression. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 41 Bressler BL, Guindi M, Tomlinson G, Heathcote J. High body mass index is an independent risk factor for nonresponse to antiviral treatment in chronic hepatitis C. Hepatology 2003; 38: [PMID: DOI: /jhep ] 42 Berg T, von Wagner M, Nasser S, Sarrazin C, Heintges T, Gerlach T, Buggisch P, Goeser T, Rasenack J, Pape GR, Schmidt WE, Kallinowski B, Klinker H, Spengler U, Martus P, Alshuth U, Zeuzem S. Extended treatment duration for hepatitis C virus type 1: comparing 48 versus 72 weeks of peginterferon-alfa-2a plus ribavirin. Gastroenterology 2006; 130: [PMID: DOI: / j.gastro ] 43 Zeuzem S, Hultcrantz R, Bourliere M, Goeser T, Marcellin P, Sanchez-Tapias J, Sarrazin C, Harvey J, Brass C, Albrecht J. Peginterferon alfa-2b plus ribavirin for treatment of chronic hepatitis C in previously untreated patients infected with HCV genotypes 2 or 3. J Hepatol 2004; 40: [PMID: DOI: /j.jhep ] 44 Jacobson IM, Brown RS, Freilich B, Afdhal N, Kwo PY, Santoro J, Becker S, Wakil AE, Pound D, Godofsky E, Strauss R, Bernstein D, Flamm S, Pauly MP, Mukhopadhyay P, Griffel LH, Brass CA. Peginterferon alfa-2b and weight-based or flat-dose ribavirin in chronic hepatitis C patients: a randomized trial. Hepatology 2007; 46: [PMID: DOI: /hep.21932] 45 Deltenre P, Louvet A, Lemoine M, Mourad A, Fartoux L, Moreno C, Henrion J, Mathurin P, Serfaty L. Impact of insulin resistance on sustained response in HCV patients treated with pegylated interferon and ribavirin: a meta-analysis. J Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 46 Eslam M, Aparcero R, Kawaguchi T, Del Campo JA, Sata M, Khattab MA, Romero-Gomez M. Meta-analysis: insulin resistance and sustained virological response in hepatitis C. Aliment Pharmacol Ther 2011; 34: [PMID: DOI: /j x] 47 Del Campo JA, Ampuero J, Rojas L, Conde M, Rojas A, Maraver M, Millán R, García-Valdecasas M, García-Lozano JR, González-Escribano MF, Romero-Gómez M. Insulin resistance predicts sustained virological response to treatment of chronic hepatitis C independently of the IL28b rs polymorphism. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12113] 48 Ogawa E, Furusyo N, Murata M, Ikezaki H, Ihara T, Hayashi T, Toyoda K, Taniai H, Okada K, Kainuma M, Hayashi J. Insulin resistance undermines the advantages of IL28B polymorphism in the pegylated interferon alpha-2b and ribavirin treatment of chronic hepatitis C patients with genotype 1. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 49 Serfaty L, Forns X, Goeser T, Ferenci P, Nevens F, Carosi G, Drenth JP, Lonjon-Domanec I, DeMasi R, Picchio G, Beumont M, Marcellin P. Insulin resistance and response to telaprevir plus peginterferon α and ribavirin in treatment-naive patients infected with HCV genotype 1. Gut 2012; 61: [PMID: DOI: /gutjnl ] 50 Gopal K, Johnson TC, Gopal S, Walfish A, Bang CT, Suwandhi P, Pena-Sahdala HN, Clain DJ, Bodenheimer HC, Min 2846 March 21, 2014 Volume 20 Issue 11

128 Gatselis NK et al. Host factors and HCV treatment AD. Correlation between beta-lipoprotein levels and outcome of hepatitis C treatment. Hepatology 2006; 44: [PMID: DOI: /hep.21261] 51 Akuta N, Suzuki F, Kawamura Y, Yatsuji H, Sezaki H, Suzuki Y, Hosaka T, Kobayashi M, Kobayashi M, Arase Y, Ikeda K, Kumada H. Predictive factors of early and sustained responses to peginterferon plus ribavirin combination therapy in Japanese patients infected with hepatitis C virus genotype 1b: amino acid substitutions in the core region and low-density lipoprotein cholesterol levels. J Hepatol 2007; 46: [PMID: DOI: /j.jhep ] 52 Backus LI, Boothroyd DB, Phillips BR, Mole LA. Predictors of response of US veterans to treatment for the hepatitis C virus. Hepatology 2007; 46: [PMID: DOI: /hep.21662] 53 Economou M, Milionis H, Filis S, Baltayiannis G, Christou L, Elisaf M, Tsianos E. Baseline cholesterol is associated with the response to antiviral therapy in chronic hepatitis C. J Gastroenterol Hepatol 2008; 23: [PMID: DOI: /j x] 54 Sheridan DA, Price DA, Schmid ML, Toms GL, Donaldson P, Neely D, Bassendine MF. Apolipoprotein B-associated cholesterol is a determinant of treatment outcome in patients with chronic hepatitis C virus infection receiving anti-viral agents interferon-alpha and ribavirin. Aliment Pharmacol Ther 2009; 29: [PMID: DOI: / j x] 55 Harrison SA, Rossaro L, Hu KQ, Patel K, Tillmann H, Dhaliwal S, Torres DM, Koury K, Goteti VS, Noviello S, Brass CA, Albrecht JK, McHutchison JG, Sulkowski MS. Serum cholesterol and statin use predict virological response to peginterferon and ribavirin therapy. Hepatology 2010; 52: [PMID: DOI: /hep.23787] 56 Ramcharran D, Wahed AS, Conjeevaram HS, Evans RW, Wang T, Belle SH, Yee LJ, Virahep-C Study Group. Associations between serum lipids and hepatitis C antiviral treatment efficacy. Hepatology 2010; 52: [PMID: DOI: /hep.23796] 57 Zeuzem S, Andreone P, Pol S, Lawitz E, Diago M, Roberts S, Focaccia R, Younossi Z, Foster GR, Horban A, Ferenci P, Nevens F, Müllhaupt B, Pockros P, Terg R, Shouval D, van Hoek B, Weiland O, Van Heeswijk R, De Meyer S, Luo D, Boogaerts G, Polo R, Picchio G, Beumont M. Telaprevir for retreatment of HCV infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 58 Berg T, Andreone P, Pol S, Roberts S, Younossi Z, Diago M, Lawitz E, Focaccia R, Foster GR, Horban A, Lonjon-Domanec I, DeMasi R, Picchio G, Witek J, Zeuzem S. Predictors of virologic response with telaprevir-based combination treatment in HCV genotype 1-infected patients with prior peginterferon/ribavirin treatment failure: post hoc analysis of the phase III REALIZE study. Hepatology 2011; 54 (Suppl 1): S24 [DOI: /S (12) ] 59 André P, Komurian-Pradel F, Deforges S, Perret M, Berland JL, Sodoyer M, Pol S, Bréchot C, Paranhos-Baccalà G, Lotteau V. Characterization of low- and very-low-density hepatitis C virus RNA-containing particles. J Virol 2002; 76: [PMID: ] 60 André P, Perlemuter G, Budkowska A, Bréchot C, Lotteau V. Hepatitis C virus particles and lipoprotein metabolism. Semin Liver Dis 2005; 25: [PMID: DOI: /s ] 61 Dreux M, Cosset FL. HCV and lipoproteins: is oxldl an Achilles heel of the Trojan horse? Hepatology 2006; 43: [PMID: DOI: /hep.21202] 62 Monazahian M, Böhme I, Bonk S, Koch A, Scholz C, Grethe S, Thomssen R. Low density lipoprotein receptor as a candidate receptor for hepatitis C virus. J Med Virol 1999; 57: [PMID: ] 63 Carrière M, Rosenberg AR, Conti F, Chouzenoux S, Terris B, Sogni P, Soubrane O, Calmus Y, Podevin P. Low density lipoprotein receptor transcripts correlates with liver hepatitis C virus RNA in patients with alcohol consumption. J Viral Hepat 2006; 13: [PMID: DOI: / j x] 64 Molina S, Castet V, Fournier-Wirth C, Pichard-Garcia L, Avner R, Harats D, Roitelman J, Barbaras R, Graber P, Ghersa P, Smolarsky M, Funaro A, Malavasi F, Larrey D, Coste J, Fabre JM, Sa-Cunha A, Maurel P. The low-density lipoprotein receptor plays a role in the infection of primary human hepatocytes by hepatitis C virus. J Hepatol 2007; 46: [PMID: DOI: /j.jhep ] 65 Petit JM, Minello A, Duvillard L, Jooste V, Monier S, Texier V, Bour JB, Poussier A, Gambert P, Verges B, Hillon P. Cell surface expression of LDL receptor in chronic hepatitis C: correlation with viral load. Am J Physiol Endocrinol Metab 2007; 293: E416-E420 [PMID: DOI: /ajpendo ] 66 Murao K, Imachi H, Yu X, Cao WM, Nishiuchi T, Chen K, Li J, Ahmed RA, Wong NC, Ishida T. Interferon alpha decreases expression of human scavenger receptor class BI, a possible HCV receptor in hepatocytes. Gut 2008; 57: [PMID: DOI: /gut ] 67 Li JH, Lao XQ, Tillmann HL, Rowell J, Patel K, Thompson A, Suchindran S, Muir AJ, Guyton JR, Gardner SD, McHutchison JG, McCarthy JJ. Interferon-lambda genotype and low serum low-density lipoprotein cholesterol levels in patients with chronic hepatitis C infection. Hepatology 2010; 51: [PMID: DOI: /hep.23592] 68 Clark PJ, Thompson AJ, Zhu M, Vock DM, Zhu Q, Ge D, Patel K, Harrison SA, Urban TJ, Naggie S, Fellay J, Tillmann HL, Shianna K, Noviello S, Pedicone LD, Esteban R, Kwo P, Sulkowski MS, Afdhal N, Albrecht JK, Goldstein DB, McHutchison JG, Muir AJ. Interleukin 28B polymorphisms are the only common genetic variants associated with lowdensity lipoprotein cholesterol (LDL-C) in genotype-1 chronic hepatitis C and determine the association between LDL-C and treatment response. J Viral Hepat 2012; 19: [PMID: DOI: /j x] 69 Sheridan DA, Bridge SH, Felmlee DJ, Crossey MM, Thomas HC, Taylor-Robinson SD, Toms GL, Neely RD, Bassendine MF. Apolipoprotein-E and hepatitis C lipoviral particles in genotype 1 infection: evidence for an association with interferon sensitivity. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 70 Everson GT, Hoefs JC, Seeff LB, Bonkovsky HL, Naishadham D, Shiffman ML, Kahn JA, Lok AS, Di Bisceglie AM, Lee WM, Dienstag JL, Ghany MG, Morishima C, HALT-C Trial Group. Impact of disease severity on outcome of antiviral therapy for chronic hepatitis C: Lessons from the HALT-C trial. Hepatology 2006; 44: [PMID: DOI: /hep.21440] 71 Jacobson IM, Marcellin P, Zeuzem S, Sulkowski MS, Esteban R, Poordad F, Bruno S, Burroughs MH, Pedicone LD, Boparai N, Deng W, DiNubile MJ, Gottesdiener KM, Brass CA, Albrecht JK, Bronowicki JP. Refinement of stopping rules during treatment of hepatitis C genotype 1 infection with boceprevir and peginterferon/ribavirin. Hepatology 2012; 56: [PMID: DOI: /hep.25865] 72 Schlecker C, Ultsch A, Geisslinger G, Lötsch J. The pharmacogenetic background of hepatitis C treatment. Mutat Res 2012; Epub ahead of print [PMID: DOI: / j.mrrev ] 73 Estrabaud E, Vidaud M, Marcellin P, Asselah T. Genomics and HCV infection: progression of fibrosis and treatment response. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 74 Knapp S, Yee LJ, Frodsham AJ, Hennig BJ, Hellier S, Zhang L, Wright M, Chiaramonte M, Graves M, Thomas HC, Hill AV, Thursz MR. Polymorphisms in interferon-induced 2847 March 21, 2014 Volume 20 Issue 11

129 Gatselis NK et al. Host factors and HCV treatment genes and the outcome of hepatitis C virus infection: roles of MxA, OAS-1 and PKR. Genes Immun 2003; 4: [PMID: DOI: /sj.gene ] 75 Matsuyama N, Mishiro S, Sugimoto M, Furuichi Y, Hashimoto M, Hijikata M, Ohta Y. The dinucleotide microsatellite polymorphism of the IFNAR1 gene promoter correlates with responsiveness of hepatitis C patients to interferon. Hepatol Res 2003; 25: [PMID: ] 76 Naito M, Matsui A, Inao M, Nagoshi S, Nagano M, Ito N, Egashira T, Hashimoto M, Mishiro S, Mochida S, Fujiwara K. SNPs in the promoter region of the osteopontin gene as a marker predicting the efficacy of interferon-based therapies in patients with chronic hepatitis C. J Gastroenterol 2005; 40: [PMID: DOI: /s ] 77 Huang Y, Yang H, Borg BB, Su X, Rhodes SL, Yang K, Tong X, Tang G, Howell CD, Rosen HR, Thio CL, Thomas DL, Alter HJ, Sapp RK, Liang TJ. A functional SNP of interferongamma gene is important for interferon-alpha-induced and spontaneous recovery from hepatitis C virus infection. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 78 Rhodes SL, Erlich H, Im KA, Wang J, Li J, Bugawan T, Jeffers L, Tong X, Su X, Rosen HR, Yee LJ, Liang TJ, Yang H, Virahep-C Study Group. Associations between the human MHC and sustained virologic response in the treatment of chronic hepatitis C virus infection. Genes Immun 2008; 9: [PMID: DOI: /gene ] 79 Tsukada H, Ochi H, Maekawa T, Abe H, Fujimoto Y, Tsuge M, Takahashi H, Kumada H, Kamatani N, Nakamura Y, Chayama K. A polymorphism in MAPKAPK3 affects response to interferon therapy for chronic hepatitis C. Gastroenterology 2009; 136: e6 [PMID: DOI: /j.gastro ] 80 Yee LJ, Im K, Borg B, Yang H, Liang TJ. Interleukin-6 haplotypes and the response to therapy of chronic hepatitis C virus infection. Genes Immun 2009; 10: [PMID: DOI: /gene ] 81 Knapp S, Warshow U, Hegazy D, Brackenbury L, Guha IN, Fowell A, Little AM, Alexander GJ, Rosenberg WM, Cramp ME, Khakoo SI. Consistent beneficial effects of killer cell immunoglobulin-like receptor 2DL3 and group 1 human leukocyte antigen-c following exposure to hepatitis C virus. Hepatology 2010; 51: [PMID: DOI: /hep.23477] 82 Vidal-Castiñeira JR, López-Vázquez A, Díaz-Peña R, Alonso- Arias R, Martínez-Borra J, Pérez R, Fernández-Suárez J, Melón S, Prieto J, Rodrigo L, López-Larrea C. Effect of killer immunoglobulin-like receptors in the response to combined treatment in patients with chronic hepatitis C virus infection. J Virol 2010; 84: [PMID: DOI: /JVI ] 83 Chen L, Borozan I, Feld J, Sun J, Tannis LL, Coltescu C, Heathcote J, Edwards AM, McGilvray ID. Hepatic gene expression discriminates responders and nonresponders in treatment of chronic hepatitis C viral infection. Gastroenterology 2005; 128: [PMID: ] 84 Asselah T, Bieche I, Narguet S, Sabbagh A, Laurendeau I, Ripault MP, Boyer N, Martinot-Peignoux M, Valla D, Vidaud M, Marcellin P. Liver gene expression signature to predict response to pegylated interferon plus ribavirin combination therapy in patients with chronic hepatitis C. Gut 2008; 57: [PMID: DOI: /gut ] 85 Chen L, Borozan I, Sun J, Guindi M, Fischer S, Feld J, Anand N, Heathcote J, Edwards AM, McGilvray ID. Cell-type specific gene expression signature in liver underlies response to interferon therapy in chronic hepatitis C infection. Gastroenterology 2010; 138: e1-3 [PMID: DOI: /j.gastro ] 86 McGilvray I, Feld JJ, Chen L, Pattullo V, Guindi M, Fischer S, Borozan I, Xie G, Selzner N, Heathcote EJ, Siminovitch K. Hepatic cell-type specific gene expression better predicts HCV treatment outcome than IL28B genotype. Gastroenterology 2012; 142: e1 [PMID: DOI: / j.gastro ] 87 Sarasin-Filipowicz M, Krol J, Markiewicz I, Heim MH, Filipowicz W. Decreased levels of microrna mir-122 in individuals with hepatitis C responding poorly to interferon therapy. Nat Med 2009; 15: [PMID: DOI: / nm.1902] 88 Murakami Y, Tanaka M, Toyoda H, Hayashi K, Kuroda M, Tajima A, Shimotohno K. Hepatic microrna expression is associated with the response to interferon treatment of chronic hepatitis C. BMC Med Genomics 2010; 3: 48 [PMID: DOI: / ] 89 Afdhal NH, McHutchison JG, Zeuzem S, Mangia A, Pawlotsky JM, Murray JS, Shianna KV, Tanaka Y, Thomas DL, Booth DR, Goldstein DB, Pharmacogenetics and Hepatitis C Meeting Participants. Hepatitis C pharmacogenetics: state of the art in Hepatology 2011; 53: [PMID: DOI: /hep.24052] 90 Tillmann HL, Thompson AJ, Patel K, Wiese M, Tenckhoff H, Nischalke HD, Lokhnygina Y, Kullig U, Göbel U, Capka E, Wiegand J, Schiefke I, Güthoff W, Grüngreiff K, König I, Spengler U, McCarthy J, Shianna KV, Goldstein DB, McHutchison JG, Timm J, Nattermann J, German Anti-D Study Group. A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice. Gastroenterology 2010; 139: , 1592.e1 [PMID: DOI: /j.gastro ] 91 Duggal P, Thio CL, Wojcik GL, Goedert JJ, Mangia A, Latanich R, Kim AY, Lauer GM, Chung RT, Peters MG, Kirk GD, Mehta SH, Cox AL, Khakoo SI, Alric L, Cramp ME, Donfield SM, Edlin BR, Tobler LH, Busch MP, Alexander G, Rosen HR, Gao X, Abdel-Hamid M, Apps R, Carrington M, Thomas DL. Genome-wide association study of spontaneous resolution of hepatitis C virus infection: data from multiple cohorts. Ann Intern Med 2013; 158: [PMID: DOI: / ] 92 Kobayashi M, Suzuki F, Akuta N, Sezaki H, Suzuki Y, Hosaka T, Kawamura Y, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Chayama K, Miyakawa Y, Kumada H. Association of two polymorphisms of the IL28B gene with viral factors and treatment response in 1,518 patients infected with hepatitis C virus. J Gastroenterol 2012; 47: [PMID: DOI: /s ] 93 McCarthy JJ, Li JH, Thompson A, Suchindran S, Lao XQ, Patel K, Tillmann HL, Muir AJ, McHutchison JG. Replicated association between an IL28B gene variant and a sustained response to pegylated interferon and ribavirin. Gastroenterology 2010; 138: [PMID: DOI: / j.gastro ] 94 Montes-Cano MA, García-Lozano JR, Abad-Molina C, Romero-Gómez M, Barroso N, Aguilar-Reina J, Núñez-Roldán A, González-Escribano MF. Interleukin-28B genetic variants and hepatitis virus infection by different viral genotypes. Hepatology 2010; 52: [PMID: DOI: /hep.23624] 95 Hayes CN, Kobayashi M, Akuta N, Suzuki F, Kumada H, Abe H, Miki D, Imamura M, Ochi H, Kamatani N, Nakamura Y, Chayama K. HCV substitutions and IL28B polymorphisms on outcome of peg-interferon plus ribavirin combination therapy. Gut 2011; 60: [PMID: DOI: /gut ] 96 Venegas M, Villanueva RA, González K, Brahm J. IL28B polymorphisms associated with therapy response in Chilean chronic hepatitis C patients. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 97 Cieśla A, Bociąga-Jasik M, Sobczyk-Krupiarz I, Głowacki MK, Owczarek D, Cibor D, Sanak M, Mach T. IL28B polymorphism as a predictor of antiviral response in chronic hepatitis C. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 2848 March 21, 2014 Volume 20 Issue 11

130 Gatselis NK et al. Host factors and HCV treatment 98 De Nicola S, Aghemo A, Rumi MG, Galmozzi E, Valenti L, Soffredini R, De Francesco R, Prati GM, D Ambrosio R, Cheroni C, Donato MF, Colombo M. Interleukin 28B polymorphism predicts pegylated interferon plus ribavirin treatment outcome in chronic hepatitis C genotype 4. Hepatology 2012; 55: [PMID: DOI: /hep.24683] 99 Asselah T, De Muynck S, Broët P, Masliah-Planchon J, Blanluet M, Bièche I, Lapalus M, Martinot-Peignoux M, Lada O, Estrabaud E, Zhang Q, El Ray A, Vidaud D, Ripault MP, Boyer N, Bedossa P, Valla D, Vidaud M, Marcellin P. IL28B polymorphism is associated with treatment response in patients with genotype 4 chronic hepatitis C. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 100 Derbala M, Rizk N, Shebl F, Alkaabi S, Eldweik N, John A, Sharma M, Yaqoob R, Almohanadi M, Butt M, Alejji K. Interleukin-28 and hepatitis C virus genotype-4: treatmentinduced clearance and liver fibrosis. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18. i ] 101 Antaki N, Bibert S, Kebbewar K, Asaad F, Baroudi O, Alideeb S, Hadad M, Abboud D, Sabah H, Bochud PY, Negro F. IL28B polymorphisms predict response to therapy among chronic hepatitis C patients with HCV genotype 4. J Viral Hepat 2013; 20: [PMID: DOI: /j x] 102 Grebely J, Petoumenos K, Hellard M, Matthews GV, Suppiah V, Applegate T, Yeung B, Marks P, Rawlinson W, Lloyd AR, Booth D, Kaldor JM, George J, Dore GJ, ATAHC Study Group. Potential role for interleukin-28b genotype in treatment decision-making in recent hepatitis C virus infection. Hepatology 2010; 52: [PMID: DOI: /hep.23850] 103 di Iulio J, Ciuffi A, Fitzmaurice K, Kelleher D, Rotger M, Fellay J, Martinez R, Pulit S, Furrer H, Günthard HF, Battegay M, Bernasconi E, Schmid P, Hirschel B, Barnes E, Klenerman P, Telenti A, Rauch A, Swiss HIV Cohort Study. Estimating the net contribution of interleukin-28b variation to spontaneous hepatitis C virus clearance. Hepatology 2011; 53: [PMID: DOI: /hep.24263] 104 Ruiz-Extremera A, Muñoz-Gámez JA, Salmerón-Ruiz MA, de Rueda PM, Quiles-Pérez R, Gila-Medina A, Casado J, Belén Martín A, Sanjuan-Nuñez L, Carazo A, Pavón EJ, Ocete-Hita E, León J, Salmerón J. Genetic variation in interleukin 28B with respect to vertical transmission of hepatitis C virus and spontaneous clearance in HCV-infected children. Hepatology 2011; 53: [PMID: DOI: /hep.24298] 105 Grebely J, Page K, Sacks-Davis R, van der Loeff MS, Rice TM, Bruneau J, Morris MD, Hajarizadeh B, Amin J, Cox AL, Kim AY, McGovern BH, Schinkel J, George J, Shoukry NH, Lauer GM, Maher L, Lloyd AR, Hellard M, Dore GJ, Prins M, InC3 Study Group. The effects of female sex, viral genotype, and IL28B genotype on spontaneous clearance of acute hepatitis C virus infection. Hepatology 2014; 59: [PMID: DOI: /hep.26639] 106 Rallón NI, Naggie S, Benito JM, Medrano J, Restrepo C, Goldstein D, Shianna KV, Vispo E, Thompson A, McHutchison J, Soriano V. Association of a single nucleotide polymorphism near the interleukin-28b gene with response to hepatitis C therapy in HIV/hepatitis C virus-coinfected patients. AIDS 2010; 24: F23-F29 [PMID: DOI: /QAD.0b013e d6d] 107 Pineda JA, Caruz A, Rivero A, Neukam K, Salas I, Camacho A, Palomares JC, Mira JA, Martínez A, Roldán C, de la Torre J, Macías J. Prediction of response to pegylated interferon plus ribavirin by IL28B gene variation in patients coinfected with HIV and hepatitis C virus. Clin Infect Dis 2010; 51: [PMID: DOI: /656235] 108 Aparicio E, Parera M, Franco S, Pérez-Alvarez N, Tural C, Clotet B, Martínez MA. IL28B SNP rs is strongly associated with pegylated interferon-α and ribavirin therapy treatment failure in HCV/HIV-1 coinfected patients. PLoS One 2010; 5: e13771 [PMID: DOI: /journal. pone ] 109 Fukuhara T, Taketomi A, Motomura T, Okano S, Ninomiya A, Abe T, Uchiyama H, Soejima Y, Shirabe K, Matsuura Y, Maehara Y. Variants in IL28B in liver recipients and donors correlate with response to peg-interferon and ribavirin therapy for recurrent hepatitis C. Gastroenterology 2010; 139: , 1585.e1-3 [PMID: DOI: /j.gastro ] 110 Chen Y, Xu HX, Wang LJ, Liu XX, Mahato RI, Zhao YR. Meta-analysis: IL28B polymorphisms predict sustained viral response in HCV patients treated with pegylated interferon-α and ribavirin. Aliment Pharmacol Ther 2012; 36: [PMID: DOI: /j x] 111 Rangnekar AS, Fontana RJ. Meta-analysis: IL-28B genotype and sustained viral clearance in HCV genotype 1 patients. Aliment Pharmacol Ther 2012; 36: [PMID: DOI: /j x] 112 Jia Z, Ding Y, Tian S, Niu J, Jiang J. Test of IL28B polymorphisms in chronic hepatitis C patients treated with PegIFN and ribavirin depends on HCV genotypes: results from a meta-analysis. PLoS One 2012; 7: e45698 [PMID: DOI: /journal.pone ] 113 Luo Y, Jin C, Ling Z, Mou X, Zhang Q, Xiang C. Association study of IL28B: rs and rs polymorphisms with SVR in patients infected with chronic HCV genotype 1 to PEG-INF/RBV therapy using systematic meta-analysis. Gene 2013; 513: [PMID: DOI: / j.gene ] 114 Jiménez-Sousa MA, Fernández-Rodríguez A, Guzmán- Fulgencio M, García-Álvarez M, Resino S. Meta-analysis: implications of interleukin-28b polymorphisms in spontaneous and treatment-related clearance for patients with hepatitis C. BMC Med 2013; 11: 6 [PMID: DOI: / ] 115 Sarrazin C, Susser S, Doehring A, Lange CM, Müller T, Schlecker C, Herrmann E, Lötsch J, Berg T. Importance of IL28B gene polymorphisms in hepatitis C virus genotype 2 and 3 infected patients. J Hepatol 2011; 54: [PMID: DOI: /j.jhep ] 116 Kawaoka T, Hayes CN, Ohishi W, Ochi H, Maekawa T, Abe H, Tsuge M, Mitsui F, Hiraga N, Imamura M, Takahashi S, Kubo M, Tsunoda T, Nakamura Y, Kumada H, Chayama K. Predictive value of the IL28B polymorphism on the effect of interferon therapy in chronic hepatitis C patients with genotypes 2a and 2b. J Hepatol 2011; 54: [PMID: DOI: /j.jhep ] 117 Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J, Mueller T, Bochud M, Battegay M, Bernasconi E, Borovicka J, Colombo S, Cerny A, Dufour JF, Furrer H, Günthard HF, Heim M, Hirschel B, Malinverni R, Moradpour D, Müllhaupt B, Witteck A, Beckmann JS, Berg T, Bergmann S, Negro F, Telenti A, Bochud PY. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology 2010; 138: , e1-7 [PMID: DOI: /j.gastro ] 118 Yu ML, Huang CF, Huang JF, Chang NC, Yang JF, Lin ZY, Chen SC, Hsieh MY, Wang LY, Chang WY, Li YN, Wu MS, Dai CY, Juo SH, Chuang WL. Role of interleukin-28b polymorphisms in the treatment of hepatitis C virus genotype 2 infection in Asian patients. Hepatology 2011; 53: 7-13 [PMID: DOI: /hep.23976] 119 Moghaddam A, Melum E, Reinton N, Ring-Larsen H, Verbaan H, Bjøro K, Dalgard O. IL28B genetic variation and treatment response in patients with hepatitis C virus genotype 3 infection. Hepatology 2011; 53: [PMID: DOI: /hep.24154] 120 Mangia A, Thompson AJ, Santoro R, Piazzolla V, Tillmann HL, Patel K, Shianna KV, Mottola L, Petruzzellis D, Bacca D, 2849 March 21, 2014 Volume 20 Issue 11

131 Gatselis NK et al. Host factors and HCV treatment Carretta V, Minerva N, Goldstein DB, McHutchison JG. An IL28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response. Gastroenterology 2010; 139: , 827.e1 [PMID: DOI: /j.gastro ] 121 Schreiber J, Moreno C, Garcia BG, Louvet A, Trepo E, Henrion J, Thabut D, Mathurin P, Deltenre P. Meta-analysis: the impact of IL28B polymorphisms on rapid and sustained virological response in HCV-2 and -3 patients. Aliment Pharmacol Ther 2012; 36: [PMID: DOI: / j x] 122 Asahina Y, Tsuchiya K, Muraoka M, Tanaka K, Suzuki Y, Tamaki N, Hoshioka Y, Yasui Y, Katoh T, Hosokawa T, Ueda K, Nakanishi H, Itakura J, Takahashi Y, Kurosaki M, Enomoto N, Nitta S, Sakamoto N, Izumi N. Association of gene expression involving innate immunity and genetic variation in interleukin 28B with antiviral response. Hepatology 2012; 55: [PMID: DOI: /hep.24623] 123 Heim MH. Innate immunity and HCV. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 124 Meager A, Visvalingam K, Dilger P, Bryan D, Wadhwa M. Biological activity of interleukins-28 and -29: comparison with type I interferons. Cytokine 2005; 31: [PMID: DOI: /j.cyto ] 125 Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, Langer JA, Sheikh F, Dickensheets H, Donnelly RP. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 2003; 4: [PMID: DOI: /ni875] 126 Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, Kuestner R, Garrigues U, Birks C, Roraback J, Ostrander C, Dong D, Shin J, Presnell S, Fox B, Haldeman B, Cooper E, Taft D, Gilbert T, Grant FJ, Tackett M, Krivan W, McKnight G, Clegg C, Foster D, Klucher KM. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol 2003; 4: [PMID: DOI: /ni873] 127 Zhang L, Jilg N, Shao RX, Lin W, Fusco DN, Zhao H, Goto K, Peng LF, Chen WC, Chung RT. IL28B inhibits hepatitis C virus replication through the JAK-STAT pathway. J Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 128 Maher SG, Sheikh F, Scarzello AJ, Romero-Weaver AL, Baker DP, Donnelly RP, Gamero AM. IFNalpha and IFNlambda differ in their antiproliferative effects and duration of JAK/STAT signaling activity. Cancer Biol Ther 2008; 7: [PMID: ] 129 Urban TJ, Thompson AJ, Bradrick SS, Fellay J, Schuppan D, Cronin KD, Hong L, McKenzie A, Patel K, Shianna KV, McHutchison JG, Goldstein DB, Afdhal N. IL28B genotype is associated with differential expression of intrahepatic interferon-stimulated genes in patients with chronic hepatitis C. Hepatology 2010; 52: [PMID: DOI: /hep.23912] 130 Dill MT, Duong FH, Vogt JE, Bibert S, Bochud PY, Terracciano L, Papassotiropoulos A, Roth V, Heim MH. Interferoninduced gene expression is a stronger predictor of treatment response than IL28B genotype in patients with hepatitis C. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 131 Raglow Z, Thoma-Perry C, Gilroy R, Wan YJ. IL28B genotype and the expression of ISGs in normal liver. Liver Int 2013; 33: [PMID: DOI: /liv.12148] 132 Golden-Mason L, Bambha KM, Cheng L, Howell CD, Taylor MW, Clark PJ, Afdhal N, Rosen HR, Virahep-C Study Group. Natural killer inhibitory receptor expression associated with treatment failure and interleukin-28b genotype in patients with chronic hepatitis C. Hepatology 2011; 54: [PMID: DOI: /hep.24556] 133 Naggie S, Osinusi A, Katsounas A, Lempicki R, Herrmann E, Thompson AJ, Clark PJ, Patel K, Muir AJ, McHutchison JG, Schlaak JF, Trippler M, Shivakumar B, Masur H, Polis MA, Kottilil S. Dysregulation of innate immunity in hepatitis C virus genotype 1 IL28B-unfavorable genotype patients: impaired viral kinetics and therapeutic response. Hepatology 2012; 56: [PMID: DOI: /hep.25647] 134 Shi X, Pan Y, Wang M, Wang D, Li W, Jiang T, Zhang P, Chi X, Jiang Y, Gao Y, Zhong J, Sun B, Xu D, Jiang J, Niu J. IL28B genetic variation is associated with spontaneous clearance of hepatitis C virus, treatment response, serum IL-28B levels in Chinese population. PLoS One 2012; 7: e37054 [PMID: DOI: /journal.pone ] 135 Honda M, Sakai A, Yamashita T, Nakamoto Y, Mizukoshi E, Sakai Y, Yamashita T, Nakamura M, Shirasaki T, Horimoto K, Tanaka Y, Tokunaga K, Mizokami M, Kaneko S, Hokuriku Liver Study Group. Hepatic ISG expression is associated with genetic variation in interleukin 28B and the outcome of IFN therapy for chronic hepatitis C. Gastroenterology 2010; 139: [PMID: DOI: / j.gastro ] 136 Abe H, Hayes CN, Ochi H, Maekawa T, Tsuge M, Miki D, Mitsui F, Hiraga N, Imamura M, Takahashi S, Kubo M, Nakamura Y, Chayama K. IL28 variation affects expression of interferon stimulated genes and peg-interferon and ribavirin therapy. J Hepatol 2011; 54: [PMID: DOI: /j.jhep ] 137 Scott J, Holte S, Urban T, Burgess C, Coppel E, Wang C, Corey L, McHutchison J, Goldstein D. IL28B genotype effects during early treatment with peginterferon and ribavirin in difficult-to-treat hepatitis C virus infection. J Infect Dis 2011; 204: [PMID: DOI: /infdis/jir264] 138 Lindh M, Lagging M, Arnholm B, Eilard A, Nilsson S, Norkrans G, Söderholm J, Wahlberg T, Wejstål R, Westin J, Hellstrand K. IL28B polymorphisms determine early viral kinetics and treatment outcome in patients receiving peginterferon/ribavirin for chronic hepatitis C genotype 1. J Viral Hepat 2011; 18: e325-e331 [PMID: DOI: / j x] 139 Bochud PY, Bibert S, Negro F, Haagmans B, Soulier A, Ferrari C, Missale G, Zeuzem S, Pawlotsky JM, Schalm S, Hellstrand K, Neumann AU, Lagging M. IL28B polymorphisms predict reduction of HCV RNA from the first day of therapy in chronic hepatitis C. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 140 Arends JE, Fransen JH, Hoepelman AI, van Baarle D. Association between IL28B polymorphisms and first-phase viral load decrease in chronic hepatitis C virus-infected patients treated with peginterferon alfa-2b/ribavirin. Int J Antimicrob Agents 2011; 38: [PMID: DOI: / j.ijantimicag ] 141 Hsu CS, Hsu SJ, Chen HC, Tseng TC, Liu CH, Niu WF, Jeng J, Liu CJ, Lai MY, Chen PJ, Kao JH, Chen DS. Association of IL28B gene variations with mathematical modeling of viral kinetics in chronic hepatitis C patients with IFN plus ribavirin therapy. Proc Natl Acad Sci USA 2011; 108: [PMID: DOI: /pnas ] 142 Lindh M, Lagging M, Färkkilä M, Langeland N, Mørch K, Nilsson S, Norkrans G, Pedersen C, Buhl MR, Westin J, Hellstrand K. Interleukin 28B gene variation at rs determines early viral kinetics during treatment in patients carrying genotypes 2 or 3 of hepatitis C virus. J Infect Dis 2011; 203: [PMID: DOI: /infdis/ jir193] 143 Howell CD, Gorden A, Ryan KA, Thompson AJ, Ibrahim C, Fried M, Afdhal NH, McHutchison JG, Shianna KV, Goldstein DB, Shuldiner AR, Mitchell BD. Single nucleotide polymorphism upstream of interleukin 28B associated with phase 1 and phase 2 of early viral kinetics in patients infected with HCV genotype 1. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 144 Askarieh G, Alsiö A, Pugnale P, Negro F, Ferrari C, Neu March 21, 2014 Volume 20 Issue 11

132 Gatselis NK et al. Host factors and HCV treatment mann AU, Pawlotsky JM, Schalm SW, Zeuzem S, Norkrans G, Westin J, Söderholm J, Hellstrand K, Lagging M, DITTO- HCV and NORDynamIC Study Groups. Systemic and intrahepatic interferon-gamma-inducible protein 10 kda predicts the first-phase decline in hepatitis C virus RNA and overall viral response to therapy in chronic hepatitis C. Hepatology 2010; 51: [PMID: DOI: / hep.23509] 145 Fattovich G, Covolo L, Bibert S, Askarieh G, Lagging M, Clément S, Malerba G, Pasino M, Guido M, Puoti M, Gaeta GB, Santantonio T, Raimondo G, Bruno R, Bochud PY, Donato F, Negro F, ITAHEC Study Group. IL28B polymorphisms, IP-10 and viral load predict virological response to therapy in chronic hepatitis C. Aliment Pharmacol Ther 2011; 33: [PMID: DOI: /j x] 146 Lagging M, Askarieh G, Negro F, Bibert S, Söderholm J, Westin J, Lindh M, Romero A, Missale G, Ferrari C, Neumann AU, Pawlotsky JM, Haagmans BL, Zeuzem S, Bochud PY, Hellstrand K, DITTO-HCV Study Group. Response prediction in chronic hepatitis C by assessment of IP-10 and IL28B-related single nucleotide polymorphisms. PLoS One 2011; 6: e17232 [PMID: DOI: /journal. pone ] 147 Beinhardt S, Aberle JH, Strasser M, Dulic-Lakovic E, Maieron A, Kreil A, Rutter K, Staettermayer AF, Datz C, Scherzer TM, Strassl R, Bischof M, Stauber R, Bodlaj G, Laferl H, Holzmann H, Steindl-Munda P, Ferenci P, Hofer H. Serum level of IP-10 increases predictive value of IL28B polymorphisms for spontaneous clearance of acute HCV infection. Gastroenterology 2012; 142: e2 [PMID: DOI: /j.gastro ] 148 Cammà C, Petta S, Enea M, Bruno R, Bronte F, Capursi V, Cicchetti A, Colombo GL, Di Marco V, Gasbarrini A, Craxì A, WEF Study Group. Cost-effectiveness of boceprevir or telaprevir for untreated patients with genotype 1 chronic hepatitis C. Hepatology 2012; 56: [PMID: DOI: /hep.25734] 149 Liu S, Cipriano LE, Holodniy M, Owens DK, Goldhaber- Fiebert JD. New protease inhibitors for the treatment of chronic hepatitis C: a cost-effectiveness analysis. Ann Intern Med 2012; 156: [PMID: DOI: / ] 150 Mangia A, Thompson AJ, Santoro R, Piazzolla V, Copetti M, Minerva N, Petruzzellis D, Mottola L, Bacca D, McHutchison JG. Limited use of interleukin 28B in the setting of response-guided treatment with detailed on-treatment virological monitoring. Hepatology 2011; 54: [PMID: DOI: /hep.24458] 151 Liu CH, Liang CC, Liu CJ, Tseng TC, Lin CL, Yang SS, Su TH, Lin JW, Chen JH, Chen PJ, Chen DS, Kao JH. Interleukin 28B genetic polymorphisms play a minor role in identifying optimal treatment duration in HCV genotype 1 slow responders to pegylated interferon plus ribavirin. Antivir Ther 2012; 17: [PMID: DOI: / IMP2322] 152 Huang CF, Huang JF, Yang JF, Hsieh MY, Lin ZY, Chen SC, Wang LY, Juo SH, Chen KC, Chuang WL, Kuo HT, Dai CY, Yu ML. Interleukin-28B genetic variants in identification of hepatitis C virus genotype 1 patients responding to 24 weeks peginterferon/ribavirin. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 153 Liu CH, Liang CC, Liu CJ, Tseng TC, Lin CL, Yang SS, Su TH, Hsu SJ, Lin JW, Chen JH, Chen PJ, Chen DS, Kao JH. Interleukin 28B genetic polymorphisms and viral factors help identify HCV genotype-1 patients who benefit from 24-week pegylated interferon plus ribavirin therapy. Antivir Ther 2012; 17: [PMID: DOI: / IMP2026] 154 Sarrazin C, Schwendy S, Möller B, Dikopoulos N, Buggisch P, Encke J, Teuber G, Goeser T, Thimme R, Klinker H, Boecher WO, Schulte-Frohlinde E, Prinzing R, Herrmann E, Zeuzem S, Berg T. Improved responses to pegylated interferon alfa-2b and ribavirin by individualizing treatment for weeks. Gastroenterology 2011; 141: [PMID: DOI: /j.gastro ] 155 Pearlman BL, Ehleben C. The IL-28B genotype predicts which slow-responding hepatitis C-infected patients will benefit from treatment extension. Am J Gastroenterol 2011; 106: [PMID: DOI: /ajg ] 156 Scherzer TM, Stättermayer AF, Strasser M, Laferl H, Maieron A, Stauber R, Datz C, Dulic-Lakovic E, Steindl-Munda P, Hofer H, Ferenci P. Impact of IL28B on treatment outcome in hepatitis C virus G1/4 patients receiving responseguided therapy with peginterferon alpha-2a (40KD)/ribavirin. Hepatology 2011; 54: [PMID: DOI: /hep.24546] 157 Akuta N, Suzuki F, Hirakawa M, Kawamura Y, Yatsuji H, Sezaki H, Suzuki Y, Hosaka T, Kobayashi M, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Chayama K, Nakamura Y, Kumada H. Amino acid substitution in hepatitis C virus core region and genetic variation near the interleukin 28B gene predict viral response to telaprevir with peginterferon and ribavirin. Hepatology 2010; 52: [PMID: DOI: /hep.23690] 158 Chayama K, Hayes CN, Abe H, Miki D, Ochi H, Karino Y, Toyota J, Nakamura Y, Kamatani N, Sezaki H, Kobayashi M, Akuta N, Suzuki F, Kumada H. IL28B but not ITPA polymorphism is predictive of response to pegylated interferon, ribavirin, and telaprevir triple therapy in patients with genotype 1 hepatitis C. J Infect Dis 2011; 204: [PMID: DOI: /infdis/jir210] 159 Furusyo N, Ogawa E, Nakamuta M, Kajiwara E, Nomura H, Dohmen K, Takahashi K, Satoh T, Azuma K, Kawano A, Tanabe Y, Kotoh K, Shimoda S, Hayashi J, Kyushu University Liver Disease Study (KULDS) Group. Telaprevir can be successfully and safely used to treat older patients with genotype 1b chronic hepatitis C. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 160 Akuta N, Suzuki F, Fukushima T, Kawamura Y, Sezaki H, Suzuki Y, Hosaka T, Kobayashi M, Hara T, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Kumada H. Prediction of treatment efficacy and telaprevir-resistant variants after triple therapy in patients infected with hepatitis C virus genotype 1. J Clin Microbiol 2013; 51: [PMID: DOI: /JCM ] 161 Poordad F, Bronowicki JP, Gordon SC, Zeuzem S, Jacobson I, Sulkowski M, Poynard T, Morgan TR, Burroughs M, Sniukiene V, Boparai N, Brass C. IL28B Polymorphism Predicts Virologic Response in Patients with Hepatitis C Genotype 1 Treated with Boceprevir Combination Therapy. J Hepatol 2011; 54 (Suppl 1): S6 [DOI: /S (11) ] 162 Pol S, Aerssens J, Zeuzem S, Andreone P, Lawitz EJ, Roberts S, Younossi Z, Foster GR, Focaccia R, Horban A, Pockros PJ, Van Heeswijk RP, De Meyer S, Luo D, Botfield M, Beumont M, Picchio G. Limited impact of IL28B genotype on response rates in telaprevir-treated patients with prior treatment failure. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 163 Chu TW, Kulkarni R, Gane EJ, Roberts SK, Stedman C, Angus PW, Ritchie B, Lu XY, Ipe D, Lopatin U, Germer S, Iglesias VA, Elston R, Smith PF, Shulman NS. Effect of IL28B genotype on early viral kinetics during interferonfree treatment of patients with chronic hepatitis C. Gastroenterology 2012; 142: [PMID: DOI: / j.gastro ] 164 Wedemeyer H, Jensen D, Herring R, Ferenci P, Ma MM, Zeuzem S, Rodriguez-Torres M, Bzowej N, Pockros P, Vierling J, Ipe D, Munson ML, Chen YC, Najera I, Thommes J, PROPEL Investigators. PROPEL: a randomized trial of mericitabine plus peginterferon alpha-2a/ribavirin therapy 2851 March 21, 2014 Volume 20 Issue 11

133 Gatselis NK et al. Host factors and HCV treatment in treatment-naïve HCV genotype 1/4 patients. Hepatology 2013; 58: [PMID: DOI: /hep.26274] 165 Pockros PJ, Jensen D, Tsai N, Taylor R, Ramji A, Cooper C, Dickson R, Tice A, Kulkarni R, Vierling JM, Lou Munson M, Chen YC, Najera I, Thommes J, JUMP-C Investigators. JUMP-C: a randomized trial of mericitabine plus pegylated interferon alpha-2a/ribavirin for 24 weeks in treatment-naïve HCV genotype 1/4 patients. Hepatology 2013; 58: [PMID: DOI: /hep.26275] 166 Zeuzem S, Soriano V, Asselah T, Bronowicki JP, Lohse AW, Müllhaupt B, Schuchmann M, Bourlière M, Buti M, Roberts SK, Gane EJ, Stern JO, Vinisko R, Kukolj G, Gallivan JP, Böcher WO, Mensa FJ. Faldaprevir and deleobuvir for HCV genotype 1 infection. N Engl J Med 2013; 369: [PMID: DOI: /NEJMoa ] 167 Poordad F, Lawitz E, Kowdley KV, Everson GT, Freilich B, Cohen CJ, Siggelkow S, Heckaman M, Menon H, Pilot- Matias T, Podsadecki T, Bernstein B. 12-week interferonfree regimen of ABT-450/r ABT-333 ribavirin achieved SVR12 in more than 90% of treatment-naïve HCV genotype- 1-infected subjects and 47% of previous non-responders. J Hepatol 2012; 56 Suppl 2: S549-S550 [DOI: /S (12)61410-X] 168 Sulkowski M, Gardiner D, Lawitz E, Hinestrosa F, Nelson DR, Thuluvath P, Rodriguez-Torres M, Lok A, Schwartz H, Reddy KR, Eley T, Wind-Rotolo M, Huang S-P, Gao M, McPhee F, Hindes RG, Symonds WT, Pasquinelli C, Grasela D. Potent viral suppression with all-oral combination of daclatasvir (NS5A inhibitor) an GS-7977 (NS5B inhibitor), / ribavirin, in treatment-naive patients with chronic HCV GT1, 2, or 3. J Hepatol 2012; 56 (Suppl 2): S560 [DOI: / S (12) ] 169 Kowdley KV, Lawitz E, Crespo I, Hassanein T, Davis MN, DeMicco M, Bernstein DE, Afdhal N, Vierling JM, Gordon SC, Anderson JK, Hyland RH, Dvory-Sobol H, An D, Hindes RG, Albanis E, Symonds WT, Berrey MM, Nelson DR, Jacobson IM. Sofosbuvir with pegylated interferon alfa-2a and ribavirin for treatment-naive patients with hepatitis C genotype-1 infection (ATOMIC): an open-label, randomised, multicentre phase 2 trial. Lancet 2013; 381: [PMID: DOI: /S (13) ] 170 De Franceschi L, Fattovich G, Turrini F, Ayi K, Brugnara C, Manzato F, Noventa F, Stanzial AM, Solero P, Corrocher R. Hemolytic anemia induced by ribavirin therapy in patients with chronic hepatitis C virus infection: role of membrane oxidative damage. Hepatology 2000; 31: [PMID: DOI: /he ] 171 Russmann S, Grattagliano I, Portincasa P, Palmieri VO, Palasciano G. Ribavirin-induced anemia: mechanisms, risk factors and related targets for future research. Curr Med Chem 2006; 13: [PMID: ] 172 Homma M, Hosono H, Hasegawa Y, Kohda Y. Morphological transformation and phosphatidylserine exposure in erythrocytes treated with ribavirin. Biol Pharm Bull 2009; 32: [PMID: ] 173 Sumi S, Marinaki AM, Arenas M, Fairbanks L, Shobowale- Bakre M, Rees DC, Thein SL, Ansari A, Sanderson J, De Abreu RA, Simmonds HA, Duley JA. Genetic basis of inosine triphosphate pyrophosphohydrolase deficiency. Hum Genet 2002; 111: [PMID: DOI: / s z] 174 Cao H, Hegele RA. DNA polymorphisms in ITPA including basis of inosine triphosphatase deficiency. J Hum Genet 2002; 47: [PMID: DOI: /s ] 175 Arenas M, Duley J, Sumi S, Sanderson J, Marinaki A. The ITPA c.94c>a and g.ivs2+21a>c sequence variants contribute to missplicing of the ITPA gene. Biochim Biophys Acta 2007; 1772: [PMID: DOI: / j.bbadis ] 176 Stepchenkova EI, Tarakhovskaya ER, Spitler K, Frahm C, Menezes MR, Simone PD, Kolar C, Marky LA, Borgstahl GE, Pavlov YI. Functional study of the P32T ITPA variant associated with drug sensitivity in humans. J Mol Biol 2009; 392: [PMID: DOI: /j.jmb ] 177 Hitomi Y, Cirulli ET, Fellay J, McHutchison JG, Thompson AJ, Gumbs CE, Shianna KV, Urban TJ, Goldstein DB. Inosine triphosphate protects against ribavirin-induced adenosine triphosphate loss by adenylosuccinate synthase function. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 178 Thompson AJ, Fellay J, Patel K, Tillmann HL, Naggie S, Ge D, Urban TJ, Shianna KV, Muir AJ, Fried MW, Afdhal NH, Goldstein DB, McHutchison JG. Variants in the ITPA gene protect against ribavirin-induced hemolytic anemia and decrease the need for ribavirin dose reduction. Gastroenterology 2010; 139: [PMID: DOI: / j.gastro ] 179 Sakamoto N, Tanaka Y, Nakagawa M, Yatsuhashi H, Nishiguchi S, Enomoto N, Azuma S, Nishimura-Sakurai Y, Kakinuma S, Nishida N, Tokunaga K, Honda M, Ito K, Mizokami M, Watanabe M. ITPA gene variant protects against anemia induced by pegylated interferon-α and ribavirin therapy for Japanese patients with chronic hepatitis C. Hepatol Res 2010; 40: [PMID: DOI: / j x x] 180 Thompson AJ, Santoro R, Piazzolla V, Clark PJ, Naggie S, Tillmann HL, Patel K, Muir AJ, Shianna KV, Mottola L, Petruzzellis D, Romano M, Sogari F, Facciorusso D, Goldstein DB, McHutchison JG, Mangia A. Inosine triphosphatase genetic variants are protective against anemia during antiviral therapy for HCV2/3 but do not decrease dose reductions of RBV or increase SVR. Hepatology 2011; 53: [PMID: DOI: /hep.24068] 181 Azakami T, Hayes CN, Sezaki H, Kobayashi M, Akuta N, Suzuki F, Kumada H, Abe H, Miki D, Tsuge M, Imamura M, Kawakami Y, Takahashi S, Ochi H, Nakamura Y, Kamatani N, Chayama K. Common genetic polymorphism of ITPA gene affects ribavirin-induced anemia and effect of peg-interferon plus ribavirin therapy. J Med Virol 2011; 83: [PMID: DOI: /jmv.22069] 182 Kurosaki M, Tanaka Y, Tanaka K, Suzuki Y, Hoshioka Y, Tamaki N, Kato T, Yasui Y, Hosokawa T, Ueda K, Tsuchiya K, Kuzuya T, Nakanishi H, Itakura J, Takahashi Y, Asahina Y, Matsuura K, Sugauchi F, Enomoto N, Nishida N, Tokunaga K, Mizokami M, Izumi N. Relationship between polymorphisms of the inosine triphosphatase gene and anaemia or outcome after treatment with pegylated interferon and ribavirin. Antivir Ther 2011; 16: [PMID: DOI: /IMP1796] 183 Domingo P, Guardiola JM, Salazar J, Torres F, Mateo MG, Pacho C, Del Mar Gutierrez M, Lamarca K, Fontanet A, Martin J, Muñoz J, Vidal F, Baiget M. Association of ITPA gene polymorphisms and the risk of ribavirin-induced anemia in HIV/hepatitis C virus (HCV)-coinfected patients receiving HCV combination therapy. Antimicrob Agents Chemother 2012; 56: [PMID: DOI: /AAC ] 184 Nishimura T, Osaki R, Shioya M, Imaeda H, Aomatsu T, Takeuchi T, Okumura Y, Fujiyama Y, Andoh A. Polymorphism of the inosine triphosphate pyrophosphatase gene predicts ribavirin-induced anemia in chronic hepatitis C patients. Mol Med Rep 2012; 5: [PMID: DOI: /mmr ] 185 Miyamura T, Kanda T, Nakamoto S, Wu S, Jiang X, Arai M, Fujiwara K, Imazeki F, Yokosuka O. Roles of ITPA and IL28B genotypes in chronic hepatitis C patients treated with peginterferon plus ribavirin. Viruses 2012; 4: [PMID: DOI: /v ] 186 Eskesen AN, Melum E, Moghaddam A, Bjøro K, Verbaan H, Ring-Larsen H, Dalgard O. Genetic variants at the ITPA locus protect against ribavirin-induced hemolytic anemia and 2852 March 21, 2014 Volume 20 Issue 11

134 Gatselis NK et al. Host factors and HCV treatment dose reduction in an HCV G2/G3 cohort. Eur J Gastroenterol Hepatol 2012; 24: [PMID: DOI: / MEG.0b013e efd] 187 Ahmed WH, Furusyo N, Zaky S, Eldin AS, Aboalam H, Ogawa E, Murata M, Hayashi J. Pre-treatment role of inosine triphosphate pyrophosphatase polymorphism for predicting anemia in Egyptian hepatitis C virus patients. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i9.1387] 188 Scherzer TM, Stättermayer AF, Stauber R, Maieron A, Strasser M, Laferl H, Schwarzer R, Datz C, Rutter K, Beinhardt S, Steindl-Munda P, Hofer H, Ferenci P. Effect of gender and ITPA polymorphisms on ribavirin-induced anemia in chronic hepatitis C patients. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 189 Rau M, Stickel F, Russmann S, Manser CN, Becker PP, Weisskopf M, Schmitt J, Dill MT, Dufour JF, Moradpour D, Semela D, Müllhaupt B, Geier A. Impact of genetic SLC28 transporter and ITPA variants on ribavirin serum level, hemoglobin drop and therapeutic response in patients with HCV infection. J Hepatol 2013; 58: [PMID: DOI: / j.jhep ] 190 Fujino T, Aoyagi Y, Takahashi M, Yada R, Yamamoto N, Ohishi Y, Nishiura A, Kohjima M, Yoshimoto T, Fukuizumi K, Nakashima M, Kato M, Kotoh K, Nakamuta M, Enjoji M. Association of ITPA polymorphism with outcomes of peginterferon-α plus ribavirin combination therapy. World J Gastrointest Pharmacol Ther 2013; 4: [PMID: DOI: /wjgpt.v4.i3.54] 191 Di Marco V, Calvaruso V, Grimaudo S, Ferraro D, Pipitone RM, Di Stefano R, Craxì A. Role of IL-28B and inosine triphosphatase polymorphisms in efficacy and safety of Peg- Interferon and ribavirin in chronic hepatitis C compensated cirrhosis with and without oesophageal varices. J Viral Hepat 2013; 20: [PMID: DOI: / j x] 192 Kurosaki M, Tanaka Y, Nishida N, Sakamoto N, Enomoto N, Matsuura K, Asahina Y, Nakagawa M, Watanabe M, Sakamoto M, Maekawa S, Tokunaga K, Mizokami M, Izumi N. Model incorporating the ITPA genotype identifies patients at high risk of anemia and treatment failure with pegylated-interferon plus ribavirin therapy for chronic hepatitis C. J Med Virol 2013; 85: [PMID: DOI: /jmv.23497] 193 Tsubota A, Shimada N, Abe H, Yoshizawa K, Agata R, Yumoto Y, Ika M, Namiki Y, Nagatsuma K, Matsudaira H, Fujise K, Tada N, Aizawa Y. Several factors including ITPA polymorphism influence ribavirin-induced anemia in chronic hepatitis C. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 194 Hézode C, Forestier N, Dusheiko G, Ferenci P, Pol S, Goeser T, Bronowicki JP, Bourlière M, Gharakhanian S, Bengtsson L, McNair L, George S, Kieffer T, Kwong A, Kauffman RS, Alam J, Pawlotsky JM, Zeuzem S, PROVE2 Study Team. Telaprevir and peginterferon with or without ribavirin for chronic HCV infection. N Engl J Med 2009; 360: [PMID: DOI: /NEJMoa ] 195 McHutchison JG, Everson GT, Gordon SC, Jacobson IM, Sulkowski M, Kauffman R, McNair L, Alam J, Muir AJ, PROVE1 Study Team. Telaprevir with peginterferon and ribavirin for chronic HCV genotype 1 infection. N Engl J Med 2009; 360: [PMID: DOI: / NEJMoa ] 196 Kwo PY, Lawitz EJ, McCone J, Schiff ER, Vierling JM, Pound D, Davis MN, Galati JS, Gordon SC, Ravendhran N, Rossaro L, Anderson FH, Jacobson IM, Rubin R, Koury K, Pedicone LD, Brass CA, Chaudhri E, Albrecht JK, SPRINT-1 investigators. Efficacy of boceprevir, an NS3 protease inhibitor, in combination with peginterferon alfa-2b and ribavirin in treatment-naive patients with genotype 1 hepatitis C infection (SPRINT-1): an open-label, randomised, multicentre phase 2 trial. Lancet 2010; 376: [PMID: DOI: /S (10) ] 197 McHutchison JG, Manns MP, Muir AJ, Terrault NA, Jacobson IM, Afdhal NH, Heathcote EJ, Zeuzem S, Reesink HW, Garg J, Bsharat M, George S, Kauffman RS, Adda N, Di Bisceglie AM, PROVE3 Study Team. Telaprevir for previously treated chronic HCV infection. N Engl J Med 2010; 362: [PMID: DOI: /NEJMoa ] 198 Suzuki F, Suzuki Y, Akuta N, Sezaki H, Hirakawa M, Kawamura Y, Hosaka T, Kobayashi M, Saito S, Arase Y, Ikeda K, Kobayashi M, Chayama K, Kamatani N, Nakamura Y, Miyakawa Y, Kumada H. Influence of ITPA polymorphisms on decreases of hemoglobin during treatment with pegylated interferon, ribavirin, and telaprevir. Hepatology 2011; 53: [PMID: DOI: /hep.24058] 199 Ogawa E, Furusyo N, Nakamuta M, Kajiwara E, Nomura H, Dohmen K, Takahashi K, Satoh T, Azuma K, Kawano A, Tanabe Y, Kotoh K, Shimoda S, Hayashi J, Kyushu University Liver Disease Study (KULDS) Group. Clinical milestones for the prediction of severe anemia by chronic hepatitis C patients receiving telaprevir-based triple therapy. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] P- Reviewers: Arain SA, Muratori L S- Editor: Zhai HH L- Editor: A E- Editor: Ma S 2853 March 21, 2014 Volume 20 Issue 11

135 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Non-invasive diagnosis of liver fibrosis in chronic hepatitis C Leonardo de Lucca Schiavon, Janaína Luz Narciso-Schiavon, Roberto José de Carvalho-Filho Leonardo de Lucca Schiavon, Janaína Luz Narciso-Schiavon, Gastroenterology Division, Department of Internal Medicine, Federal University of Santa Catarina, Florianópolis, SC , Brazil Roberto José de Carvalho-Filho, Gastroenterology Division, Department of Medicine, Federal University of Sao Paulo, Sao Paulo, SP , Brazil Author contributions: Schiavon LL, Narciso-Schiavon JL and Carvalho-Filho RJ contributed equally to this work, designed the review and wrote the paper. Correspondence to: Leonardo de Lucca Schiavon, MD, PhD, Gastroenterology Division, Department of Internal Medicine, Federal University of Santa Catarina, 3 andar, Trindade, Florianópolis, SC , Brazil. leo-jf@uol.com.br Telephone: Fax: Received: October 29, 2013 Revised: December 10, 2013 Accepted: January 14, 2014 Published online: March 21, 2014 Abstract Assessment of liver fibrosis in chronic hepatitis C virus (HCV) infection is considered a relevant part of patient care and key for decision making. Although liver biopsy has been considered the gold standard for staging liver fibrosis, it is an invasive technique and subject to sampling errors and significant intra- and inter-observer variability. Over the last decade, several noninvasive markers were proposed for liver fibrosis diagnosis in chronic HCV infection, with variable performance. Besides the clear advantage of being noninvasive, a more objective interpretation of test results may overcome the mentioned intra- and inter-observer variability of liver biopsy. In addition, these tests can theoretically offer a more accurate view of fibrogenic events occurring in the entire liver with the advantage of providing frequent fibrosis evaluation without additional risk. However, in general, these tests show low accuracy in discriminating between intermediate stages of fibrosis and may be influenced by several hepatic and extrahepatic conditions. These methods are either serum markers (usually combined in a mathematical model) or imaging modalities that can be used separately or combined in algorithms to improve accuracy. In this review we will discuss the different noninvasive methods that are currently available for the evaluation of liver fibrosis in chronic hepatitis C, their advantages, limitations and application in clinical practice Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Liver fibrosis; Liver cirrhosis; Hepatitis C; Diagnosis; Elasticity imaging techniques Core tip: There is increased interest in non-invasive markers of fibrosis, especially in chronic hepatitis C virus infection. Although several methodologies have been proposed over the last few years, the limited availability and concerns regarding the true accuracy of these techniques has restricted their clinical application. In this review we will discuss the different noninvasive methods that are currently available for the evaluation of liver fibrosis in chronic hepatitis C, their advantages, limitations and application in clinical practice. Schiavon LL, Narciso-Schiavon JL, Carvalho-Filho RJ. Noninvasive diagnosis of liver fibrosis in chronic hepatitis C. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Assessment of liver fibrosis in chronic hepatitis C virus (HCV) infection is considered a relevant part of patient care and key for decision making. Liver fibrosis stage is probably the most robust prognostic factor in several liver diseases; including hepatitis C. Higher stages of fibrosis have been shown to be associated with progression to decompensated cirrhosis, the need for liver trans March 21, 2014 Volume 20 Issue 11

136 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis Table 1 Major advantages and limitations of liver biopsy and noninvasive fibrosis markers Advantages Limitations Liver biopsy Validated scoring systems Differential diagnosis and associated conditions Simultaneous evaluation of necro-inflammation Invasive High cost Sampling errors and intra- and inter-observer variability Noninvasive markers Absence of significant discomfort and risks Allows frequent re-evaluation Objective interpretation Patient acceptance Low accuracy to discriminate between intermediate stages of fibrosis Nonspecific for the liver (biomarkers) Influence of several extra-hepatic factors plantation and liver-related death in HCV infection [1,2]. In addition, the severity of fibrosis may be used as a selection criterion for antiviral therapy and can indicate the need for further evaluations, such as surveillance for hepatocellular carcinoma (HCC) and esophageal varices screening [3,4]. For many years, liver biopsy has been considered the gold standard for staging liver fibrosis. Histological evaluation also provides information on necroinflammatory activity and other features such as steatosis and iron overload. Several scoring systems have been developed, the most common being the METAVIR, Scheuer s, the Batts-Ludwig, the International Association for the Study of the Liver (IASL) and the Ishak scoring systems [5-9]. However, besides its advantages, liver biopsy is an invasive technique with associated morbidity. Minor complications are relatively common and about one fourth of patients have pain in the right upper quadrant or right shoulder after liver biopsy [10]. Severe complications are infrequent, with significant bleeding rates varying from 0.05% to 5.3% and mortality of less than 0.15% in the largest series [10]. The performance of liver biopsy for fibrosis staging has also been questioned and concerns regarding the possibility of sampling errors and significant intra- and inter-observer variability were raised over the last few years. Since biopsy represents 1/50000 of the liver, the heterogeneity of liver fibrosis in HCV infection and the inadequacy of sample size can cause considerable bias in the assessment of hepatic histology [11-13]. A study which included 124 patients with chronic HCV infection who underwent simultaneous laparoscopy-guided biopsies of the right and left hepatic lobes showed that 33.1% of the subjects had a difference of at least one stage between the two lobes [11]. Similarly, a study on virtual liver biopsy indicated that a non-fragmented specimen of at least 25 mm in length would be necessary to correctly evaluate fibrosis with a semiquantitative score, a goal not always achievable in daily practice [14]. Over the last few years, several noninvasive markers were proposed for liver fibrosis diagnosis in chronic HCV infection. Table 1 summarizes the major advantages and limitations of these methods in relation to liver biopsy. Besides the clear advantage of being noninvasive, a more objective interpretation of test results may overcome the mentioned intra- and inter-observer variability of liver biopsy. In addition, these tests can theoretically offer a more accurate view of fibrogenic events occurring in the entire liver with the advantage of providing frequent fibrosis evaluation without additional risk. However, in general, these tests show low accuracy in discriminating between intermediate stages of fibrosis and may be influenced by several hepatic and extrahepatic conditions. In this review we will discuss the different noninvasive methods that are currently available for the evaluation of liver fibrosis in chronic hepatitis C, their advantages, limitations and application in clinical practice. NONINVASIVE MARKERS OF LIVER FIBROSIS General considerations of noninvasive fibrosis markers Because fibrosis denotes morphological changes, liver biopsy became the natural gold standard for staging the disease. However, the mentioned limitations of biopsy make it very difficult to interpret the real performance of surrogate markers of fibrosis in studies. In the vast majority of studies, the diagnostic performance of noninvasive markers of liver fibrosis was evaluated by calculating the area under the receiver operating characteristic (ROC) curve. The ROC curve is the plot that depicts the trade-off between the sensitivity and 1-specificity across a series of cut-off points when the diagnostic test is a continuously variable [15]. Mehta et al [16] demonstrated that, when a range of accuracies of biopsy and a range of prevalence of fibrosis are taken into account, even in the best scenario an area under receiver operating characteristic curve > 0.90 cannot be achieved even for a perfect marker. The perceived limitation in diagnostic accuracy of noninvasive markers of liver fibrosis is probably the major reason why these tests have not been widely adopted in clinical practice. Noninvasive markers of liver fibrosis can be divided into two groups: serum biomarkers and imaging techniques. These methodologies will be presented separately and a combined approach will also be discussed in this review. Serum biomarkers Indirect (or class Ⅱ) markers of liver fibrosis: This group comprises, in general, routine tests usually com March 21, 2014 Volume 20 Issue 11

137 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis Table 2 Selected models including indirect markers of liver fibrosis Score (original reference) Variables Performance in HCV patients 1 Median AUROC Significant fibrosis ( F2) Cirrhosis ( F4) Median sensitivity 2 Median specificity 2 Median AUROC Median sensitivity 2 Median specificity 2 APRI [24] AST and platelet count % 95% % 94% FIB-4 3[41] Age, AST, ALT and platelet count % 79% % 92% Forns index [48] Age, platelet count, cholesterol levels, and GGT % 94% % 91% Fibro index [50] Platelet count, AST, and gamma globulin % 97% % 91% 1 Based on reference number 49; 2 Sensitivity values are presented for the lower cutoff and specificity for the upper cutoff (when multiple cutoffs are presented); 3 Model originally proposed for HIV/HCV co-infected patients. HCV: Hepatitis C virus; AUROC: Area under the receiver operating characteristic curve; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; GGT: Gamma-glutamyltransferase; HIV: Human immunodeficiency virus. bined with other laboratory or clinical parameters in a specific model. The most commonly studied indirect markers in HCV infection include aspartate aminotransferase (AST), alanine aminotransferase (ALT), platelet count, gamma-glutamyltransferase (GGT), bilirubin, haptoglobin, apolipoprotein A1, and alpha-2-macroglobulin. Models that combined indirect markers are usually devised from retrospective studies and, as a rule for noninvasive fibrosis markers, are limited in discriminating between intermediate stages of fibrosis. Table 2 depicts the most common models including indirect markers proposed for fibrosis estimation in hepatitis C. The AST/ALT ratio has been used for several years as a noninvasive method for assessing the severity of chronic liver diseases, including chronic HCV infection [17-20]. Although some studies have found promising results, its performance as a noninvasive marker of fibrosis is generally low, especially in the diagnosis of less advanced stages of fibrosis [21,22]. In a recent study, we showed that the AST/ALT ratio had a low diagnostic accuracy in detecting significant fibrosis (AUROC of 0.661) as compared to other simple models, such as APRI (AU- ROC 0.793) and FIB-4 (AUROC 0.811) [23]. The AST-to-Platelet Ratio Index (APRI) is calculated as (AST/upper limit of normal range)/platelet count (10 9 /L) 100. This index was originally proposed by Wai et al [24] in 2003 and became one of the most studied noninvasive fibrosis markers in chronic HCV infection. The APRI is based on the rationale that worsening of fibrosis and increasing portal pressure are associated with reduced production of thrombopoietin by hepatocytes, increased platelet sequestration within the spleen and reduced clearance of AST [25-27]. A meta-analysis exploring the performance of this model in HCV infection was published in 2011 and included 40 studies and a total of 8739 subjects [28]. This study showed only a moderate degree of accuracy for APRI in the detection of HCVrelated fibrosis. The summary AUROC of the APRI for the diagnosis of significant fibrosis ( F2 according to METAVIR), severe fibrosis ( F3), and cirrhosis was 0.77, 0.80, and 0.83, respectively [28]. In this meta-analysis, the best cutoff for diagnosing significant fibrosis was 0.7, with a summary sensitivity and specificity of 77% and 72%, respectively. For the detection of cirrhosis, the optimal cutoff was 1.0, with a summary sensitivity and specificity of 76% and 72%, respectively. A threshold of 2.0 exhibited a specificity of 91% for diagnosing cirrhosis, but a low sensitivity of 46% [28]. A major advantage of APRI is that it was validated in special populations, such as HIV/HCV co-infection [28-37], in whom the overall performance seems to be lower than in HCV mono-infected individuals [28], and adjusted cutoffs may increase sensitivity and specificity, as we previously demonstrated [30]. APRI also proved to be a valuable tool in hemodialysis patients with chronic HCV infection. In a study which included 203 subjects, we demonstrated good performance of this model, especially in excluding significant fibrosis, with a negative predictive value (NPV) of 93% for a prevalence of significant fibrosis of 24% [38]. These results were further validated in a cohort of 279 hemodialysis patients [39] and Canbakan et al [40] showed that APRI was superior to FibroTest in this population. The FIB-4 is also a noninvasive method for the evaluation of liver fibrosis, based on simple variables such as age, AST, ALT and platelet count. It was initially proposed by researchers in the APRICOT study (AIDS Pegasys Ribavirin International Coinfection Trial) to evaluate the presence of liver fibrosis in HIV/HCV coinfected patients [41]. It was subsequently validated in a large cohort of HCV mono-infected patients in whom values < 1.45 had a NPV of 94.7% to exclude severe fibrosis (F3-F4) with a sensitivity of 74.3% [42]. A FIB-4 value higher than 3.25 had a positive predictive value (PPV) of 82.1% with a specificity of 98.2% [42]. The authors also showed a similar performance between FIB-4 and FibroTest [42]. Several other studies reported that the FIB-4 index had a variable degree of accuracy in HCVinfected subjects [43-47]. We performed a comparison between FIB-4 and APRI and found similar AUROCs for both models (0.811 vs 0.793) [23]. However, the proportion of biopsies that could have been correctly avoided was substantially higher with FIB-4 than with APRI (63% vs 47%) suggesting that FIB-4 is probably a more useful tool for incorporation into daily practice [23]. The Forns index is based on age and three additional simple tests: platelet count, cholesterol levels, and GGT [48]. In the original study, the AUROC was 0.86 for the estimation group and 0.81 for the validation group in diagnosing significant fibrosis [48]. However, in a recent systematic review, the median AUROC from 22 studies 2856 March 21, 2014 Volume 20 Issue 11

138 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis was 0.76 for significant fibrosis and 0.87 for cirrhosis [49]. When evaluating those studies that performed direct comparisons, the Forns index and APRI showed a very similar performance for both significant fibrosis and cirrhosis [49]. The Fibroindex was originally proposed for diagnosis of HCV-related fibrosis and includes the following variables: platelet count, AST, and gamma globulin [50]. In the original study, this model exhibited a higher AUROC (0.83) for diagnosing significant fibrosis as compared to APRI and the Forns index [50]. Fibro index was also correlated significantly with variation in fibrosis stage when a subset of 30 patients who had undergone a liver biopsy twice was evaluated [50]. Nevertheless, in the mentioned systematic review, the median AUROC for significant fibrosis detection was 0.76 and for cirrhosis was 0.86 [49]. Direct comparisons showed no superiority of Fibroindex over APRI for both significant fibrosis and cirrhosis detection [49]. Direct (or class Ⅰ) markers of liver fibrosis: Multiple etiologies of liver disease, including chronic HCV infection, can lead to liver fibrosis through integrated signaling networks that regulate the deposition of extracellular matrix [51]. This sequence of events drives the activation of hepatic stellate cells into a myofibroblast-like phenotype that is contractile, proliferative and fibrogenic [51]. Collagen and other extracellular matrix (ECM) components are deposited as the liver generates a woundhealing response to encapsulate injury [51]. The direct (or class Ⅰ) markers of liver fibrosis are usually fragments of the liver matrix components produced by hepatic stellate cells during the process of ECM remodeling, usually reflecting the deposition or removal of ECM [52]. The most studied direct markers are hyaluronic acid (HA), YKL-40, laminin, fibronectin, alpha-2-macroglobulin, procollagen type Ⅰ carboxy terminal peptide (PICP), procollagen type Ⅲ amino-terminal peptide (PIIINP), N-terminal propeptide of type Ⅱ collagen, metalloproteinases (MMPs), tissue inhibitors of matrix metalloproteinases (TIMPs) and transforming growth factor-b1 (TGF-b1). As stated for indirect tests, direct biomarkers are usually combined in composite scores to increase the diagnostic performance (Table 3). It is important to point out that these models are not liver-specific and have limitations, such as low accuracy for intermediate stages of fibrosis and limited availability (patented formulas or tests not routinely performed). Below, we discuss the most studied models combining direct and indirect biomarkers for the diagnosis of liver fibrosis in chronic hepatitis C. The FibroTest score was originally proposed in 2001 and is one of the most validated models for predicting liver fibrosis in HCV-infected patients [53]. It is computed by accessing a proprietary website and entering the patient s age, sex, and serum haptoglobin, α2- macroglobulin, apolipoprotein A1, GGT, and total bilirubin. A meta-analysis published in 2007 showed a pooled adjusted AUROC of 0.83 for the FibroTest in HCV patients [54]. However, the systematic review published by Chou and Wasson [49] revealed that when only studies that performed direct comparisons were considered, the APRI was associated with only a slightly lower AUROC than the FibroTest for significant fibrosis (median difference between AUROCs, -0.03; range, to 0.07), but there was no difference for cirrhosis (median difference between AUROCs, 0.0; range, to 0.06). In addition, the FibroTest was not superior to FIB-4 and other models such as the Fibrometer and Hepascore for the diagnosis HCV-related fibrosis, as shown in the same review [49]. Beyond the absence of a clear superiority of the FibroTest over other free and readily available models, and given the variability of components of assays and analyzers, FibroTest assays can only be performed in validated laboratories. In addition, the existence of hemolysis or Gilbert syndrome can lead to false-positive results and must be taken into account [55]. The enhanced liver fibrosis (ELF) score provides a single value by an algorithm combining age as well as quantitative serum measurements of TIMP-1, PIIINP and HA [56]. Age was removed from the simplified ELF score [56]. It was originally proposed in a cohort study including 1021 subjects with various chronic liver diseases (496 with chronic hepatitis C). In contrast to the good performance observed for alcoholic liver disease (AUROC 0.944) and non-alcoholic fatty liver disease (AUROC 0.870), a relatively low accuracy was observed in chronic HCV infection (AUROC 0.773) [56]. ELF was further validated in HCV patients [57-59], but it was not superior to APRI for the detection of both significant fibrosis and cirrhosis in studies that performed a direct comparison between the two models [49,58]. A recent study has shown that the ELF score is significantly influenced by gender (higher values in men) and age (higher scores in older persons), and this should be taken into account when interpreting the results of this scoring system [60]. The Fibrometer is a patented and commercially available proprietary panel of tests that combines platelet count, prothrombin index, AST, α2-macroglobulin, HA, blood urea nitrogen and age [61]. In addition to the typical results of fibrosis stage corresponding to the METAVIR system, the Fibrometer may also indicate the amount of liver fibrosis as a percentage of fibrous tissue within the liver (area of fibrosis) [62]. In the systematic review published by Chou and Wasson, the Fibrometer exhibited a pooled AUROC of 0.82 for significant fibrosis and 0.91 for cirrhosis [49]. Direct comparisons showed that the Fibrometer performed better than APRI and the FibroTest in detecting both significant fibrosis and cirrhosis [43,49]. FIBROspect Ⅱ is also a commercially available panel that includes TIMP-1, α2-macroglobulin and HA levels [63]. It was generated from a cohort of 696 HCVinfected patients and exhibited an AUROC of for diagnosing significant fibrosis in the original study [63]. FIBROspect Ⅱ was subsequently validated [64,65] and the 2857 March 21, 2014 Volume 20 Issue 11

139 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis Table 3 Most studied models combining direct and indirect biomarkers for the diagnosis of liver fibrosis in chronic hepatitis C Score (original reference) Variables Performance in HCV patients 1 Median AUROC Significant fibrosis ( F2) Cirrhosis ( F4) Median sensitivity 2 Median specificity 2 Median AUROC Median sensitivity 2 Median specificity 2 FibroTest [53] Age, sex, serum haptoglobin, α2-macroglobulin, apolipoprotein % 96% % 81% A1, GGT, and total bilirubin ELF [56] Age, TIMP-1, PIIINP and hyaluronic acid % 70% Fibrometer [61] Platelet count, prothrombin index, AST, α2-macroglobulin, % 81% hyaluronic acid, blood urea nitrogen and age FIBROspect Ⅱ [63] TIMP-1, α2-macroglobulin and hyaluronic acid % 70% Hepascore [66] Age, sex, α2-macroglobulin, hyaluronic acid, GGT and total bilirubin % 79% % 86% 1 Based on reference number 49; 2 Sensitivity values are presented for the lower cutoff and specificity for the upper cutoff (when multiple cutoffs are presented). ELF: Enhanced liver fibrosis; HCV: Hepatitis C virus; AUROC: Area under the receiver operating characteristic curve; GGT: Gamma-glutamyltransferase; TIMP: Tissue inhibitor of matrix metalloproteinases; PIIINP: Procollagen type Ⅲ amino-terminal peptide; AST: Aspartate aminotransferase. pooled AUROC in the mentioned systematic review was 0.86 for significant fibrosis [49]. The Hepascore is a patented model that combines age, sex and four biomarkers (α2-macroglobulin, HA, GGT and total bilirubin) [66]. It was devised in a cohort of chronic HCV patients [66] and further validated in several studies [67-72]. An interesting advantage of Hepascore is that it can be totally automated using a single analyzer and only one serum sample [69]. However, data from comparative studies showed that this test was not superior to APRI and FibroTest in diagnosing significant fibrosis and only slightly better for the detection of cirrhosis [49]. Imaging techniques Transient hepatic elastography (TE) by FibroScan : TE, as assessed by FibroScan (Echosens, Paris, France), is a simple non-invasive method to measure liver stiffness, based on unidimensional transient elastography, a technique that uses elastic waves and low frequency ultrasounds (50 Hz). The equipment is composed of a probe, an in-built ultrasound system and an electronic unit for data processing. Through a transductor, low amplitude vibrations produced by the probe are transmitted to liver tissue. Simultaneously, the ultrasound system generates pulses that track and determine the rapidity of propagation of elastic waves within the parenchyma. The velocity of propagation is directly related to elasticity: the harder the tissue, the faster the propagation of elastic waves. Hence, tests with high results generally indicate the presence of significant fibrosis in liver parenchyma. The final result is the median of all valid acquisitions, which is considered to be representative of the hepatic elasticity, expressed in kilopascals (kpa), within a range of kpa. The test is simple, fast (usually performed in less than 5 min), and can be easily carried out in both inpatient and outpatient settings. Neither special preparation nor laboratory tests are necessary. TE has been evaluated in several non-viral chronic liver diseases [73-75] in both adults and children [76], it was, initially projected and then validated in patients with chronic hepatitis C [77-81]. Several studies have shown a significant correlation between TE and fibrosis stage, as assessed by the META- VIR scoring system [78-80], as well as by computer-assisted morphometric image analysis [81]. TE by the FibroScan shows a similar performance for predicting significant fibrosis and higher accuracy to identify liver cirrhosis, as compared to other noninvasive tests. This has been shown by Castera et al [78] who evaluated and compared the performance of FibroScan, FibroTest (FT, Biopredictive, Paris, France) and the AST-to-platelet ratio index (APRI) in 183 HCV patients. AUROCs of FibroScan, FibroTest and APRI for the diagnosis of significant fibrosis (F 2) were 0.83, 0.85 and 0.78, respectively. To predict the presence of cirrhosis (F4), the AUROCs for each method were 0.95, 0.87 and 0.83, respectively. The diagnostic superiority of TE was further confirmed in a study of 298 HCV patients by comparing the performance of FibroScan, FT, APRI, Lok index, platelet count (PC), prothrombin index (PI) and AST/ALT ratio (AAR) for the early detection of cirrhosis. In this study, TE was the most accurate method for predicting cirrhosis (AUROCs: TE 0.96 vs FT 0.82, Lok and APRI 0.80, PC 0.79, PI 0.73, AAR 0.61, P < ) [82]. The most validated TE cutoff points are 7.1 kpa to identify patients with significant fibrosis and 12.5 kpa to recognize those with cirrhosis [78,82,83]. TE values 14.6 kpa exhibit a positive predictive value of 90% to predict liver cirrhosis, with a positive likelihood ratio of 35.5 [82]. TE was also evaluated in special populations of HCV patients, such as those with HCV-HIV co-infection [84,85] and post-transplant hepatitis C [86-88], with similar accuracy to that observed in the general population of HCV patients. Besides estimating fibrosis stage, TE has been used to identify cirrhotic patients at risk of developing portal hypertension and liver-related complications [82,85,89,90]. However, several cutoff values have been used and many of these studies have found weak correlation coefficients, particularly among patients with high HVPG (> 10 mmhg). Altogether, these data indicate that the relationship between TE and HVPG is insufficiently linear to be 2858 March 21, 2014 Volume 20 Issue 11

140 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis clinically useful. In contrast to HCV, few studies with appropriate methodology have evaluated the accuracy of TE in patients with chronic hepatitis B virus (HBV) infection [83,91-94]. An algorithm has been proposed to adjust the interpretation of TE values according to ALT levels. Values < 6.0 kpa and < 7.5 kpa accurately predict the absence of advanced fibrosis or cirrhosis in patients with serum ALT levels inferior to the upper limit of normality (ULN) and in subjects with ALT activity between 1 and 5 times the ULN, respectively [93]. Similarly, TE values > 9.0 kpa and > 12.0 kpa predict advanced fibrosis or cirrhosis in subjects with normal ALT and in those with ALT 1-5 times the ULN, respectively. A recent study suggested that TE exhibits a similar diagnostic performance in HBV infection as compared to HCV patients [83]. Acoustic radiation force impulse imaging: Although the acoustic radiation force impulse imaging technique has been developed by two companies, Siemens and Philips, most clinical studies have used the Siemens S2000 conventional ultrasound equipment which uses short-duration acoustic pulses (push-pulses) emitted with a frequency around 2.6 MHz. The compression induced by the pulse in the evaluated tissue generates shear waves which propagate perpendicularly into the tissue. These shear waves are tracked by the pulse-echo ultrasound acquisitions and their velocity of propagation is measured inside a small region-of-interest (ROI) of 5 mm 10 mm located up to 8 cm in depth. The stiffer the tissue, the faster the shear wave velocity, which means that the speed of the shear wave increases with the severity of liver fibrosis [95-97]. The results are expressed in meters per second (m/s), ranging from 0.5 to 4.4 m/s (± 20% accuracy over the range). Higher values are generally found in the left hepatic lobe, but higher accuracy is obtained with ARFI measurements in the right hepatic lobe [98-100]. Although not formally recommended by the manufacturer, good quality technical parameters (especially an interquartile ratio < 30%) yielded better correlations between elastometry measurements and liver fibrosis, as well as higher accuracies for predicting fibrosis stages than those with inadequate parameters [101,102]. Evaluating 106 subjects with HCV infection, Bota et al [101] observed discordance of at least two stages of fibrosis between ARFI results and histological assessment in 31.7% of patients; in multivariate analysis, female gender and IQR 30% were associated with discordance. Finally, as observed with TE, high aminotransferase levels (> 5 times the upper limit of normal) are associated with higher liver stiffness as assessed by ARFI, which should be taken into account in order to interpret results adequately [103]. It is intuitive to consider that the impact of higher aminotransferase levels reflects the influence of higher levels of necroinflammatory activity, which has indeed been demonstrated by Chen et al [104]. ARFI elastography is an easy, fast (usually performed within five minutes), and reproducible noninvasive method for liver fibrosis assessment, especially in cirrhotic patients. However, ARFI reproducibility was lower in women, in patients with high BMI ( 25 kg/m 2 ), in the presence of ascites and in the absence of liver cirrhosis [105]. Being included into a conventional ultrasound machine and the possibility of being performed in patients with ascites are relevant advantages of ARFI elastography over TE by FibroScan. A standard procedure should include measuring in a supine position with the convex transducer (4C1) without specific breathing maneuvers (the patient is simply asked to stop breathing for a moment). Elastometry values increase after food intake, and measurements should be performed in the fasting state (or at least 3 h after the last meal) [106,107]. Although in a limited number of studies, the method has been evaluated in a variety of liver conditions, such as metabolic liver diseases [ ], autoimmune liver diseases [113], hepatic tumors [114,115], and chronic hepatitis B [116,117]. However, like TE, ARFI has been most studied in patients with chronic HCV infection [ ]. In a pooled meta-analysis, Friedrich-Rust et al [129] evaluated the original data of 518 patients from eight studies (73% with HCV). The optimal cut-offs for diagnosing significant fibrosis (F 2), advanced fibrosis (F 3) and cirrhosis were 1.34, 1.55, and 1.80 m/s, respectively, with diagnostic accuracies (represented by AUROCs) of 0.87, 0.91, and 0.93, respectively. In a large, international multicenter study, Sporea et al [119] retrospectively evaluated 914 HCV subjects. They observed a significant positive correlation between liver stiffness by ARFI and fibrosis stage (Spearman r = 0.654; P < ), and a good diagnostic performance for predicting fibrosis stage according to the METAVIR score. Although with significant overlapping of ARFI measurements for fibrosis F0-F2, advanced fibrosis (F 3) and cirrhosis could be accurately excluded. Generally, the correlation with histological fibrosis was similar between TE and ARFI elastography. Nevertheless, TE was better than ARFI for predicting the presence of liver cirrhosis and fibrosis (F 1) [119]. A recent metaanalysis which included 13 studies and 1163 patients with different hepatopathies demonstrated that for the detection of both significant fibrosis (F 2) and cirrhosis, the diagnostic performance of ARFI and TE were comparable, but ARFI showed a higher rate of reliable measurements as compared to TE [130]. Combined approach Algorithms combining different fibrosis tests have been proposed to improve the accuracy of noninvasive methods for the correct diagnosis of liver fibrosis in HCV infection. They use two serum-based models either simultaneously or in a sequential procedure [72,131,132]. They may also be based on agreement between a blood test and an imaging technique [133,134]. The Leroy algorithm was proposed in a study that evaluated six non-invasive scores in 180 HCV patients [72]. In this approach, the APRI and 2859 March 21, 2014 Volume 20 Issue 11

141 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis Clinical evidence of cirrhosis: (ascites, jaundice, hepatic encephalopathy) Chronic HCV infection Screening for esophageal varices and hepatocellular carcinoma Model using routine laboratory tests (APRI or FIB-4) + imaging technique Concordant results No significant fibrosis (< F 2) Discordant results Concordant results Significant fibrosis ( F 2) Liver biopsy Figure 1 Suggested algorithm for diagnosing liver fibrosis in chronic hepatitis C. Patients with concordant results in two techniques (serum and imaging) may be followed without liver biopsy and histological analysis can be reserved for those with discordant results. HCV: Hepatitis C virus. FibroTest were calculated simultaneously and concordant results below the lower cutoffs (FibroTest < 0.22 and APRI < 0.5) could rule out significant fibrosis with a NPV of 94.1%. Results above the upper cutoffs (FibroTest > 0.59 and APRI > 2) exhibited a PPV for significant fibrosis of 96.7% and for extensive fibrosis (F3-F4) of 92.2% [72]. However, only 32% of patients presented concordant results. Therefore, a significant proportion of subjects are expected to require a liver biopsy when using this system [72]. The sequential algorithm (SAFE for fibrosis evaluation) biopsy algorithm was proposed in a study that included 2035 HCV patients [131]. The SAFE biopsy for simultaneous detection of significant fibrosis and cirrhosis produced only 52 (2.6%) misclassified cases, with an overall accuracy of 97.4%. However, as stated for the Leroy algorithm, liver biopsy would be required in the majority of cases (64%) [131]. A different approach was proposed by Castéra et al [133] in an algorithm combining FibroTest and TE simultaneously. In this method (called the Castera algorithm or Bordeaux algorithm), the diagnosis of significant fibrosis is based in the finding of concordant results for both methods, and liver biopsy is recommended in discordant results or for those individuals in whom liver stiffness measurement was not possible [133]. For the diagnosis of significant fibrosis, the number of saved liver biopsies was significantly higher using Castera than the SAFE biopsy algorithm (71.9% vs 48.3%, respectively). However, accuracy of the SAFE biopsy algorithm was significantly higher than the Castera algorithm (97.0% vs 87.7%, respectively). More recently, a combination of Fibrometer and FibroScan was proposed in a study including 1785 patients with chronic hepatitis C [134]. The so-called FM+FS classification includes 6 fibrosis classes (F0/1; F1/2; F2±1; F2/3; F3±1 and F4) and requires no liver biopsy [134]. Using this approach, the proportion of discordant results decreased as compared to the SAFE biopsy and Castera algorithm. Although this new classification of liver fibrosis appears to be more a formalization of uncertainty, it may also be an astute tactic for the practical application of noninvasive fibrosis markers, allowing a more precise interpretation of its results. However, the employment of two relatively expensive methods will increase costs and may limit application of the FM+FS classification. Although algorithms including every previously studied noninvasive marker are obviously not available, based on the above data, a simple and plausible approach would be to simultaneously perform two tests (serum and imaging technique), and reserve liver biopsy for discordant results (Figure 1). We suggest using models based on simple blood tests, such as APRI or FIB-4, as there is no clear evidence for the use of more complex and expensive tests in this setting. Similar methodology was proposed in other review articles [135,136]. Using this system, it is probable that liver biopsy will still be necessary in a significant proportion of patients. However, the number of misclassifications is likely to be low. COST-EFFECTIVENESS OF NONINVASIVE MARKERS OF FIBROSIS The total cost of each strategy for diagnosing liver fibrosis depends on several factors such as the need for hospitalization or sedation in the case of liver biopsy, potential risks, the modality of noninvasive tests and finally, the diagnostic accuracy. Although the procedure protocol varies greatly, liver biopsy usually requires short March 21, 2014 Volume 20 Issue 11

142 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis term hospitalization, the administration of sedatives and specialized nursing staff for post-biopsy care. In addition, ultrasonography is often used to mark or guide the biopsy. These particularities and the need for interpretation are responsible for the relatively high cost of liver biopsy, ranging from $1200 in the United Kingdom [137] to $2200 in the United States [138]. There are limited data regarding the cost-effectiveness of noninvasive strategies for liver fibrosis assessment, especially for indirect markers. However, recent studies evaluating the FibroScan and FibroTest showed a favorable cost-effectiveness profile for both noninvasive tests as compared to the traditional approach based on liver biopsy [ ]. There is a need for studies evaluating the cost-effectiveness of different strategies of noninvasive liver fibrosis assessment, such as the combined approach and the use of indirect markers. This information would be of special interest in low-income countries where the costs of liver biopsy are expected to be lower, but with limited availability. CONCLUSION The accurate diagnosis of liver fibrosis is essential for decision-making in chronic hepatitis C. Even though, over the last decade, remarkable achievements have been made in the noninvasive diagnosis of fibrosis, this is an evolving field and there is still room for improvement. It is possible that, in the near future, the incorporation of other methodologies such as genetic, proteomic, and metabolomics profiles will allow the diagnosis of fibrosis at earlier stages, even permitting the identification of stellate cell activation in pre-fibrotic stages. In addition, extensive validation of currently available tools, including the investigation of their prognostic value may extend the applicability of noninvasive fibrosis markers in clinical practice. Although noninvasive tests are now routinely used in several countries, they are still very limited in differentiating between early stages of fibrosis, and this fact, at least in part, may be related to liver biopsy limitations. Along with the improvement in current noninvasive markers, there is also a need for changes in the way we look at fibrosis in the near future. REFERENCES 1 Everhart JE, Wright EC, Goodman ZD, Dienstag JL, Hoefs JC, Kleiner DE, Ghany MG, Mills AS, Nash SR, Govindarajan S, Rogers TE, Greenson JK, Brunt EM, Bonkovsky HL, Morishima C, Litman HJ. Prognostic value of Ishak fibrosis stage: findings from the hepatitis C antiviral long-term treatment against cirrhosis trial. Hepatology 2010; 51: [PMID: DOI: /hep.23315] 2 Lawson A, Hagan S, Rye K, Taguri N, Ratib S, Zaitoun AM, Neal KR, Ryder SD, Irving WL. The natural history of hepatitis C with severe hepatic fibrosis. J Hepatol 2007; 47: [PMID: DOI: /j.jhep ] 3 Ghany MG, Strader DB, Thomas DL, Seeff LB. Diagnosis, management, and treatment of hepatitis C: an update. Hepatology 2009; 49: [PMID: DOI: / hep.22759] 4 European Association for the Study of the Liver. EASL Clinical Practice Guidelines: management of hepatitis C virus infection. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 5 Scheuer PJ. Classification of chronic viral hepatitis: a need for reassessment. J Hepatol 1991; 13: [PMID: ] 6 Desmet VJ, Gerber M, Hoofnagle JH, Manns M, Scheuer PJ. Classification of chronic hepatitis: diagnosis, grading and staging. Hepatology 1994; 19: [PMID: ] 7 Batts KP, Ludwig J. Chronic hepatitis. An update on terminology and reporting. Am J Surg Pathol 1995; 19: [PMID: ] 8 Bedossa P, Poynard T. An algorithm for the grading of activity in chronic hepatitis C. The METAVIR Cooperative Study Group. Hepatology 1996; 24: [PMID: DOI: /hep ] 9 Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F, Denk H, Desmet V, Korb G, MacSween RN. Histological grading and staging of chronic hepatitis. J Hepatol 1995; 22: [PMID: ] 10 Rockey DC, Caldwell SH, Goodman ZD, Nelson RC, Smith AD. Liver biopsy. Hepatology 2009; 49: [PMID: DOI: /hep.22742] 11 Regev A, Berho M, Jeffers LJ, Milikowski C, Molina EG, Pyrsopoulos NT, Feng ZZ, Reddy KR, Schiff ER. Sampling error and intraobserver variation in liver biopsy in patients with chronic HCV infection. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 12 Siddique I, El-Naga HA, Madda JP, Memon A, Hasan F. Sampling variability on percutaneous liver biopsy in patients with chronic hepatitis C virus infection. Scand J Gastroenterol 2003; 38: [PMID: ] 13 Scheuer PJ. Liver biopsy size matters in chronic hepatitis: bigger is better. Hepatology 2003; 38: [PMID: DOI: /j.hep ] 14 Bedossa P, Dargère D, Paradis V. Sampling variability of liver fibrosis in chronic hepatitis C. Hepatology 2003; 38: [PMID: DOI: /j.hep ] 15 van Erkel AR, Pattynama PM. Receiver operating characteristic (ROC) analysis: basic principles and applications in radiology. Eur J Radiol 1998; 27: [PMID: ] 16 Mehta SH, Lau B, Afdhal NH, Thomas DL. Exceeding the limits of liver histology markers. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 17 Giannini E, Botta F, Fasoli A, Ceppa P, Risso D, Lantieri PB, Celle G, Testa R. Progressive liver functional impairment is associated with an increase in AST/ALT ratio. Dig Dis Sci 1999; 44: [PMID: ] 18 Giannini E, Risso D, Botta F, Chiarbonello B, Fasoli A, Malfatti F, Romagnoli P, Testa E, Ceppa P, Testa R. Validity and clinical utility of the aspartate aminotransferase-alanine aminotransferase ratio in assessing disease severity and prognosis in patients with hepatitis C virus-related chronic liver disease. Arch Intern Med 2003; 163: [PMID: ] 19 Sheth SG, Flamm SL, Gordon FD, Chopra S. AST/ALT ratio predicts cirrhosis in patients with chronic hepatitis C virus infection. Am J Gastroenterol 1998; 93: [PMID: DOI: /j _c.x] 20 Williams AL, Hoofnagle JH. Ratio of serum aspartate to alanine aminotransferase in chronic hepatitis. Relationship to cirrhosis. Gastroenterology 1988; 95: [PMID: ] 21 Parise ER, Oliveira AC, Figueiredo-Mendes C, Lanzoni V, Martins J, Nader H, Ferraz ML. Noninvasive serum markers in the diagnosis of structural liver damage in chronic hepatitis C virus infection. Liver Int 2006; 26: [PMID: DOI: /j x] 22 Shaikh S, Memon MS, Ghani H, Baloch GH, Jaffery M, Shaikh K. Validation of three non-invasive markers in assessing the severity of liver fibrosis in chronic hepatitis C. J Coll Physicians Surg Pak 2009; 19: [PMID: ] 2861 March 21, 2014 Volume 20 Issue 11

143 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis 23 Amorim TG, Staub GJ, Lazzarotto C, Silva AP, Manes J, Ferronato Mda G, Shiozawa MB, Narciso-Schiavon JL, Dantas- Correa EB, Schiavon Lde L. Validation and comparison of simple noninvasive models for the prediction of liver fibrosis in chronic hepatitis C. Ann Hepatol 2012; 11: [PMID: ] 24 Wai CT, Greenson JK, Fontana RJ, Kalbfleisch JD, Marrero JA, Conjeevaram HS, Lok AS. A simple noninvasive index can predict both significant fibrosis and cirrhosis in patients with chronic hepatitis C. Hepatology 2003; 38: [PMID: DOI: /jhep ] 25 Aster RH. Pooling of platelets in the spleen: role in the pathogenesis of hypersplenic thrombocytopenia. J Clin Invest 1966; 45: [PMID: DOI: /JCI105380] 26 Kamimoto Y, Horiuchi S, Tanase S, Morino Y. Plasma clearance of intravenously injected aspartate aminotransferase isozymes: evidence for preferential uptake by sinusoidal liver cells. Hepatology 1985; 5: [PMID: ] 27 Kawasaki T, Takeshita A, Souda K, Kobayashi Y, Kikuyama M, Suzuki F, Kageyama F, Sasada Y, Shimizu E, Murohisa G, Koide S, Yoshimi T, Nakamura H, Ohno R. Serum thrombopoietin levels in patients with chronic hepatitis and liver cirrhosis. Am J Gastroenterol 1999; 94: [PMID: DOI: /j x] 28 Lin ZH, Xin YN, Dong QJ, Wang Q, Jiang XJ, Zhan SH, Sun Y, Xuan SY. Performance of the aspartate aminotransferaseto-platelet ratio index for the staging of hepatitis C-related fibrosis: an updated meta-analysis. Hepatology 2011; 53: [PMID: DOI: /hep.24105] 29 Singal AG, Thomassen LV, Gretch DR, Shuhart MC. Use of the AST to platelet ratio index in HCV/HIV co-infected patients. Aliment Pharmacol Ther 2011; 33: [PMID: DOI: /j x] 30 Carvalho-Filho RJ, Schiavon LL, Narciso-Schiavon JL, Sampaio JP, Lanzoni VP, Ferraz ML, Silva AE. Optimized cutoffs improve performance of the aspartate aminotransferase to platelet ratio index for predicting significant liver fibrosis in human immunodeficiency virus/hepatitis C virus coinfection. Liver Int 2008; 28: [PMID: DOI: /j x] 31 Al-Mohri H, Cooper C, Murphy T, Klein MB. Validation of a simple model for predicting liver fibrosis in HIV/hepatitis C virus-coinfected patients. HIV Med 2005; 6: [PMID: DOI: /j x] 32 Loko MA, Castera L, Dabis F, Le Bail B, Winnock M, Coureau G, Bioulac-Sage P, de Ledinghen V, Neau D. Validation and comparison of simple noninvasive indexes for predicting liver fibrosis in HIV-HCV-coinfected patients: ANRS CO3 Aquitaine cohort. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 33 Kelleher TB, Mehta SH, Bhaskar R, Sulkowski M, Astemborski J, Thomas DL, Moore RE, Afdhal NH. Prediction of hepatic fibrosis in HIV/HCV co-infected patients using serum fibrosis markers: the SHASTA index. J Hepatol 2005; 43: [PMID: DOI: /j.jhep ] 34 Macías J, Girón-González JA, González-Serrano M, Merino D, Cano P, Mira JA, Arizcorreta-Yarza A, Ruíz-Morales J, Lomas-Cabeza JM, García-García JA, Corzo JE, Pineda JA. Prediction of liver fibrosis in human immunodeficiency virus/hepatitis C virus coinfected patients by simple noninvasive indexes. Gut 2006; 55: [PMID: DOI: /gut ] 35 Nunes D, Fleming C, Offner G, O Brien M, Tumilty S, Fix O, Heeren T, Koziel M, Graham C, Craven DE, Stuver S, Horsburgh CR. HIV infection does not affect the performance of noninvasive markers of fibrosis for the diagnosis of hepatitis C virus-related liver disease. J Acquir Immune Defic Syndr 2005; 40: [PMID: ] 36 Shire NJ, Rao MB, Succop P, Buncher CR, Andersen JA, Butt AA, Chung RT, Sherman KE. Improving noninvasive methods of assessing liver fibrosis in patients with hepatitis C virus/human immunodeficiency virus co-infection. Clin Gastroenterol Hepatol 2009; 7: , 480.e1-2 [PMID: DOI: /j.cgh ] 37 Trang T, Petersen JR, Snyder N. Non-invasive markers of hepatic fibrosis in patients co-infected with HCV and HIV: comparison of the APRI and FIB-4 index. Clin Chim Acta 2008; 397: [PMID: DOI: /j.cca ] 38 Schiavon LL, Schiavon JL, Filho RJ, Sampaio JP, Lanzoni VP, Silva AE, Ferraz ML. Simple blood tests as noninvasive markers of liver fibrosis in hemodialysis patients with chronic hepatitis C virus infection. Hepatology 2007; 46: [PMID: DOI: /hep.21681] 39 Liu CH, Liang CC, Liu CJ, Hsu SJ, Lin JW, Chen SI, Hung PH, Tsai HB, Lai MY, Chen PJ, Chen JH, Chen DS, Kao JH. The ratio of aminotransferase to platelets is a useful index for predicting hepatic fibrosis in hemodialysis patients with chronic hepatitis C. Kidney Int 2010; 78: [PMID: DOI: /ki ] 40 Canbakan M, Senturk H, Canbakan B, Toptas T, Tabak O, Ozaras R, Tabak F, Balcı H, Sut N, Ozbay G. Validation of biochemical markers for the prediction of liver fibrosis and necroinflammatory activity in hemodialysis patients with chronic hepatitis C. Nephron Clin Pract 2011; 117: c289-c295 [PMID: DOI: / ] 41 Sterling RK, Lissen E, Clumeck N, Sola R, Correa MC, Montaner J, S Sulkowski M, Torriani FJ, Dieterich DT, Thomas DL, Messinger D, Nelson M. Development of a simple noninvasive index to predict significant fibrosis in patients with HIV/HCV coinfection. Hepatology 2006; 43: [PMID: DOI: /hep.21178] 42 Vallet-Pichard A, Mallet V, Nalpas B, Verkarre V, Nalpas A, Dhalluin-Venier V, Fontaine H, Pol S. FIB-4: an inexpensive and accurate marker of fibrosis in HCV infection. comparison with liver biopsy and fibrotest. Hepatology 2007; 46: [PMID: DOI: /hep.21669] 43 Zarski JP, Sturm N, Guechot J, Paris A, Zafrani ES, Asselah T, Boisson RC, Bosson JL, Guyader D, Renversez JC, Bronowicki JP, Gelineau MC, Tran A, Trocme C, De Ledinghen V, Lasnier E, Poujol-Robert A, Ziegler F, Bourliere M, Voitot H, Larrey D, Rosenthal-Allieri MA, Fouchard Hubert I, Bailly F, Vaubourdolle M. Comparison of nine blood tests and transient elastography for liver fibrosis in chronic hepatitis C: the ANRS HCEP-23 study. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 44 Hsieh YY, Tung SY, Lee K, Wu CS, Wei KL, Shen CH, Chang TS, Lin YH. Routine blood tests to predict liver fibrosis in chronic hepatitis C. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i8.746] 45 Ahmad W, Ijaz B, Javed FT, Gull S, Kausar H, Sarwar MT, Asad S, Shahid I, Sumrin A, Khaliq S, Jahan S, Pervaiz A, Hassan S. A comparison of four fibrosis indexes in chronic HCV: development of new fibrosis-cirrhosis index (FCI). BMC Gastroenterol 2011; 11: 44 [PMID: DOI: / X-11-44] 46 Güzelbulut F, Çetınkaya ZA, Sezıklı M, Yaşar B, Ozkara S, Övünç AO. AST-platelet ratio index, Forns index and FIB-4 in the prediction of significant fibrosis and cirrhosis in patients with chronic hepatitis C. Turk J Gastroenterol 2011; 22: [PMID: ] 47 Schiavon LL, Filho RJ, Narciso JL, Sampaio JP, Lanzoni VP, Ferraz ML, Silva AE. Expanding the applicability of noninvasive fibrosis markers in HIV/HCV co-infected patients. Hepatology 2007; 45: [PMID: DOI: / hep.21507] 48 Forns X, Ampurdanès S, Llovet JM, Aponte J, Quintó L, Martínez-Bauer E, Bruguera M, Sánchez-Tapias JM, Rodés J. Identification of chronic hepatitis C patients without hepatic fibrosis by a simple predictive model. Hepatology 2002; 36: [PMID: DOI: /jhep ] 49 Chou R, Wasson N. Blood tests to diagnose fibrosis or cir March 21, 2014 Volume 20 Issue 11

144 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis rhosis in patients with chronic hepatitis C virus infection: a systematic review. Ann Intern Med 2013; 158: [PMID: DOI: / ] 50 Koda M, Matunaga Y, Kawakami M, Kishimoto Y, Suou T, Murawaki Y. FibroIndex, a practical index for predicting significant fibrosis in patients with chronic hepatitis C. Hepatology 2007; 45: [PMID: DOI: / hep.21520] 51 Lee UE, Friedman SL. Mechanisms of hepatic fibrogenesis. Best Pract Res Clin Gastroenterol 2011; 25: [PMID: DOI: /j.bpg ] 52 Baranova A, Lal P, Birerdinc A, Younossi ZM. Non-invasive markers for hepatic fibrosis. BMC Gastroenterol 2011; 11: 91 [PMID: DOI: / X-11-91] 53 Imbert-Bismut F, Ratziu V, Pieroni L, Charlotte F, Benhamou Y, Poynard T. Biochemical markers of liver fibrosis in patients with hepatitis C virus infection: a prospective study. Lancet 2001; 357: [PMID: DOI: / S (00) ] 54 Poynard T, Morra R, Halfon P, Castera L, Ratziu V, Imbert- Bismut F, Naveau S, Thabut D, Lebrec D, Zoulim F, Bourliere M, Cacoub P, Messous D, Munteanu M, de Ledinghen V. Meta-analyses of FibroTest diagnostic value in chronic liver disease. BMC Gastroenterol 2007; 7: 40 [PMID: DOI: / X-7-40] 55 Poynard T, Munteanu M, Imbert-Bismut F, Charlotte F, Thabut D, Le Calvez S, Messous D, Thibault V, Benhamou Y, Moussalli J, Ratziu V. Prospective analysis of discordant results between biochemical markers and biopsy in patients with chronic hepatitis C. Clin Chem 2004; 50: [PMID: DOI: /clinchem ] 56 Rosenberg WM, Voelker M, Thiel R, Becka M, Burt A, Schuppan D, Hubscher S, Roskams T, Pinzani M, Arthur MJ. Serum markers detect the presence of liver fibrosis: a cohort study. Gastroenterology 2004; 127: [PMID: ] 57 Catanzaro R, Milazzo M, Arona S, Sapienza C, Vasta D, Arcoria D, Marotta F. Diagnostic accuracy of enhanced liver fibrosis test to assess liver fibrosis in patients with chronic hepatitis C. Hepatobiliary Pancreat Dis Int 2013; 12: [PMID: ] 58 Petersen JR, Stevenson HL, Kasturi KS, Naniwadekar A, Parkes J, Cross R, Rosenberg WM, Xiao SY, Snyder N. Evaluation of the Aspartate Aminotransferase/Platelet Ratio Index and Enhanced Liver Fibrosis Tests to Detect Significant Fibrosis Due to Chronic Hepatitis C. J Clin Gastroenterol 2013; Epub ahead of print [PMID: DOI: / MCG.0b013e3182a87e78] 59 Guéchot J, Trocmé C, Renversez JC, Sturm N, Zarski JP. Independent validation of the Enhanced Liver Fibrosis (ELF) score in the ANRS HC EP 23 Fibrostar cohort of patients with chronic hepatitis C. Clin Chem Lab Med 2012; 50: [PMID: DOI: /cclm ] 60 Lichtinghagen R, Pietsch D, Bantel H, Manns MP, Brand K, Bahr MJ. The Enhanced Liver Fibrosis (ELF) score: normal values, influence factors and proposed cut-off values. J Hepatol 2013; 59: [PMID: DOI: / j.jhep ] 61 Calès P, Oberti F, Michalak S, Hubert-Fouchard I, Rousselet MC, Konaté A, Gallois Y, Ternisien C, Chevailler A, Lunel F. A novel panel of blood markers to assess the degree of liver fibrosis. Hepatology 2005; 42: [PMID: DOI: /hep.20935] 62 Calès P, Boursier J, Oberti F, Hubert I, Gallois Y, Rousselet MC, Dib N, Moal V, Macchi L, Chevailler A, Michalak S, Hunault G, Chaigneau J, Sawadogo A, Lunel F. FibroMeters: a family of blood tests for liver fibrosis. Gastroenterol Clin Biol 2008; 32: [PMID: DOI: / S (08) ] 63 Patel K, Gordon SC, Jacobson I, Hézode C, Oh E, Smith KM, Pawlotsky JM, McHutchison JG. Evaluation of a panel of non-invasive serum markers to differentiate mild from moderate-to-advanced liver fibrosis in chronic hepatitis C patients. J Hepatol 2004; 41: [PMID: DOI: /j.jhep ] 64 Patel K, Nelson DR, Rockey DC, Afdhal NH, Smith KM, Oh E, Hettinger K, Vallée M, Dev A, Smith-Riggs M, McHutchison JG. Correlation of FIBROSpect II with histologic and morphometric evaluation of liver fibrosis in chronic hepatitis C. Clin Gastroenterol Hepatol 2008; 6: [PMID: DOI: /j.cgh ] 65 Snyder N, Nguyen A, Gajula L, Soloway R, Xiao SY, Lau DT, Petersen J. The APRI may be enhanced by the use of the FI- BROSpect II in the estimation of fibrosis in chronic hepatitis C. Clin Chim Acta 2007; 381: [PMID: DOI: /j.cca ] 66 Adams LA, Bulsara M, Rossi E, DeBoer B, Speers D, George J, Kench J, Farrell G, McCaughan GW, Jeffrey GP. Hepascore: an accurate validated predictor of liver fibrosis in chronic hepatitis C infection. Clin Chem 2005; 51: [PMID: DOI: /clinchem ] 67 Kalantari H, Hoseini H, Babak A, Yaran M. Validation of hepascore as a predictor of liver fibrosis in patients with chronic hepatitis C infection. Hepat Res Treat 2011; 2011: [PMID: DOI: /2011/972759] 68 Boursier J, de Ledinghen V, Zarski JP, Rousselet MC, Sturm N, Foucher J, Leroy V, Fouchard-Hubert I, Bertrais S, Gallois Y, Oberti F, Dib N, Calès P. A new combination of blood test and fibroscan for accurate non-invasive diagnosis of liver fibrosis stages in chronic hepatitis C. Am J Gastroenterol 2011; 106: [PMID: DOI: /ajg ] 69 Guéchot J, Lasnier E, Sturm N, Paris A, Zarski JP. Automation of the Hepascore and validation as a biochemical index of liver fibrosis in patients with chronic hepatitis C from the ANRS HC EP 23 Fibrostar cohort. Clin Chim Acta 2010; 411: [PMID: DOI: /j.cca ] 70 Becker L, Salameh W, Sferruzza A, Zhang K, ng Chen R, Malik R, Reitz R, Nasser I, Afdhal NH. Validation of hepascore, compared with simple indices of fibrosis, in patients with chronic hepatitis C virus infection in United States. Clin Gastroenterol Hepatol 2009; 7: [PMID: ] 71 Bourliere M, Penaranda G, Ouzan D, Renou C, Botta-Fridlund D, Tran A, Rosenthal E, Wartelle-Bladou C, Delasalle P, Oules V, Portal I, Castellani P, Lecomte L, Rosenthal- Allieri MA, Halfon P. Optimized stepwise combination algorithms of non-invasive liver fibrosis scores including Hepascore in hepatitis C virus patients. Aliment Pharmacol Ther 2008; 28: [PMID: DOI: / j x] 72 Leroy V, Hilleret MN, Sturm N, Trocme C, Renversez JC, Faure P, Morel F, Zarski JP. Prospective comparison of six non-invasive scores for the diagnosis of liver fibrosis in chronic hepatitis C. J Hepatol 2007; 46: [PMID: DOI: /j.jhep ] 73 Adhoute X, Foucher J, Laharie D, Terrebonne E, Vergniol J, Castéra L, Lovato B, Chanteloup E, Merrouche W, Couzigou P, de Lédinghen V. Diagnosis of liver fibrosis using FibroScan and other noninvasive methods in patients with hemochromatosis: a prospective study. Gastroenterol Clin Biol 2008; 32: [PMID: ] 74 Yoneda M, Yoneda M, Mawatari H, Fujita K, Endo H, Iida H, Nozaki Y, Yonemitsu K, Higurashi T, Takahashi H, Kobayashi N, Kirikoshi H, Abe Y, Inamori M, Kubota K, Saito S, Tamano M, Hiraishi H, Maeyama S, Yamaguchi N, Togo S, Nakajima A. Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with nonalcoholic fatty liver disease (NAFLD). Dig Liver Dis 2008; 40: [PMID: DOI: /j.dld ] 75 Corpechot C, El Naggar A, Poujol-Robert A, Ziol M, Wendum D, Chazouillères O, de Lédinghen V, Dhumeaux D, Marcellin P, Beaugrand M, Poupon R. Assessment of biliary 2863 March 21, 2014 Volume 20 Issue 11

145 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis fibrosis by transient elastography in patients with PBC and PSC. Hepatology 2006; 43: [PMID: DOI: /hep.21151] 76 de Lédinghen V, Le Bail B, Rebouissoux L, Fournier C, Foucher J, Miette V, Castéra L, Sandrin L, Merrouche W, Lavrand F, Lamireau T. Liver stiffness measurement in children using FibroScan: feasibility study and comparison with Fibrotest, aspartate transaminase to platelets ratio index, and liver biopsy. J Pediatr Gastroenterol Nutr 2007; 45: [PMID: DOI: /MPG.0b013e31812e56ff] 77 Sandrin L, Fourquet B, Hasquenoph JM, Yon S, Fournier C, Mal F, Christidis C, Ziol M, Poulet B, Kazemi F, Beaugrand M, Palau R. Transient elastography: a new noninvasive method for assessment of hepatic fibrosis. Ultrasound Med Biol 2003; 29: [PMID: ] 78 Castéra L, Vergniol J, Foucher J, Le Bail B, Chanteloup E, Haaser M, Darriet M, Couzigou P, De Lédinghen V. Prospective comparison of transient elastography, Fibrotest, APRI, and liver biopsy for the assessment of fibrosis in chronic hepatitis C. Gastroenterology 2005; 128: [PMID: ] 79 Ziol M, Handra-Luca A, Kettaneh A, Christidis C, Mal F, Kazemi F, de Lédinghen V, Marcellin P, Dhumeaux D, Trinchet JC, Beaugrand M. Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with chronic hepatitis C. Hepatology 2005; 41: [PMID: DOI: / hep.20506] 80 Arena U, Vizzutti F, Abraldes JG, Corti G, Stasi C, Moscarella S, Milani S, Lorefice E, Petrarca A, Romanelli RG, Laffi G, Bosch J, Marra F, Pinzani M. Reliability of transient elastography for the diagnosis of advanced fibrosis in chronic hepatitis C. Gut 2008; 57: [PMID: DOI: /gut ] 81 Nitta Y, Kawabe N, Hashimoto S, Harata M, Komura N, Kobayashi K, Arima Y, Shimazaki H, Nakano T, Murao M, Ichino N, Osakabe K, Aoki H, Hosoe Y, Sugiyama H, Nishikawa T, Yoshioka K. Liver stiffness measured by transient elastography correlates with fibrosis area in liver biopsy in patients with chronic hepatitis C. Hepatol Res 2009; 39: [PMID: DOI: /j X x] 82 Castéra L, Le Bail B, Roudot-Thoraval F, Bernard PH, Foucher J, Merrouche W, Couzigou P, de Lédinghen V. Early detection in routine clinical practice of cirrhosis and oesophageal varices in chronic hepatitis C: comparison of transient elastography (FibroScan) with standard laboratory tests and noninvasive scores. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 83 Cardoso AC, Carvalho-Filho RJ, Stern C, Dipumpo A, Giuily N, Ripault MP, Asselah T, Boyer N, Lada O, Castelnau C, Martinot-Peignoux M, Valla DC, Bedossa P, Marcellin P. Direct comparison of diagnostic performance of transient elastography in patients with chronic hepatitis B and chronic hepatitis C. Liver Int 2012; 32: [PMID: DOI: /j x] 84 de Lédinghen V, Douvin C, Kettaneh A, Ziol M, Roulot D, Marcellin P, Dhumeaux D, Beaugrand M. Diagnosis of hepatic fibrosis and cirrhosis by transient elastography in HIV/hepatitis C virus-coinfected patients. J Acquir Immune Defic Syndr 2006; 41: [PMID: ] 85 Vergara S, Macías J, Rivero A, Gutiérrez-Valencia A, González-Serrano M, Merino D, Ríos MJ, García-García JA, Camacho A, López-Cortés L, Ruiz J, de la Torre J, Viciana P, Pineda JA. The use of transient elastometry for assessing liver fibrosis in patients with HIV and hepatitis C virus coinfection. Clin Infect Dis 2007; 45: [PMID: DOI: /521857] 86 Carrión JA, Navasa M, Bosch J, Bruguera M, Gilabert R, Forns X. Transient elastography for diagnosis of advanced fibrosis and portal hypertension in patients with hepatitis C recurrence after liver transplantation. Liver Transpl 2006; 12: [PMID: DOI: /lt.20857] 87 Rigamonti C, Donato MF, Fraquelli M, Agnelli F, Ronchi G, Casazza G, Rossi G, Colombo M. Transient elastography predicts fibrosis progression in patients with recurrent hepatitis C after liver transplantation. Gut 2008; 57: [PMID: DOI: /gut ] 88 Harada N, Soejima Y, Taketomi A, Yoshizumi T, Ikegami T, Yamashita Y, Itoh S, Kuroda Y, Maehara Y. Assessment of graft fibrosis by transient elastography in patients with recurrent hepatitis C after living donor liver transplantation. Transplantation 2008; 85: [PMID: DOI: /01.tp ] 89 Foucher J, Chanteloup E, Vergniol J, Castéra L, Le Bail B, Adhoute X, Bertet J, Couzigou P, de Lédinghen V. Diagnosis of cirrhosis by transient elastography (FibroScan): a prospective study. Gut 2006; 55: [PMID: DOI: /gut ] 90 Vizzutti F, Arena U, Romanelli RG, Rega L, Foschi M, Colagrande S, Petrarca A, Moscarella S, Belli G, Zignego AL, Marra F, Laffi G, Pinzani M. Liver stiffness measurement predicts severe portal hypertension in patients with HCVrelated cirrhosis. Hepatology 2007; 45: [PMID: DOI: /hep.21665] 91 Coco B, Oliveri F, Maina AM, Ciccorossi P, Sacco R, Colombatto P, Bonino F, Brunetto MR. Transient elastography: a new surrogate marker of liver fibrosis influenced by major changes of transaminases. J Viral Hepat 2007; 14: [PMID: DOI: /j x] 92 Kim SU, Ahn SH, Park JY, Kang W, Kim do Y, Park YN, Chon CY, Han KH. Liver stiffness measurement in combination with noninvasive markers for the improved diagnosis of B-viral liver cirrhosis. J Clin Gastroenterol 2009; 43: [PMID: DOI: /MCG.0b013e31816f212e] 93 Chan HL, Wong GL, Choi PC, Chan AW, Chim AM, Yiu KK, Chan FK, Sung JJ, Wong VW. Alanine aminotransferasebased algorithms of liver stiffness measurement by transient elastography (Fibroscan) for liver fibrosis in chronic hepatitis B. J Viral Hepat 2009; 16: [PMID: DOI: /j x] 94 Marcellin P, Ziol M, Bedossa P, Douvin C, Poupon R, de Lédinghen V, Beaugrand M. Non-invasive assessment of liver fibrosis by stiffness measurement in patients with chronic hepatitis B. Liver Int 2009; 29: [PMID: DOI: /j x] 95 Mauldin FW, Zhu HT, Behler RH, Nichols TC, Gallippi CM. Robust principal component analysis and clustering methods for automated classification of tissue response to ARFI excitation. Ultrasound Med Biol 2008; 34: [PMID: DOI: /j.ultrasmedbio ] 96 Nightingale K, Soo MS, Nightingale R, Trahey G. Acoustic radiation force impulse imaging: in vivo demonstration of clinical feasibility. Ultrasound Med Biol 2002; 28: [PMID: ] 97 Piscaglia F, Marinelli S, Bota S, Serra C, Venerandi L, Leoni S, Salvatore V. The role of ultrasound elastographic techniques in chronic liver disease: Current status and future perspectives. Eur J Radiol 2014; 83: [PMID: DOI: /j.ejrad ] 98 Piscaglia F, Salvatore V, Di Donato R, D Onofrio M, Gualandi S, Gallotti A, Peri E, Borghi A, Conti F, Fattovich G, Sagrini E, Cucchetti A, Andreone P, Bolondi L. Accuracy of VirtualTouch Acoustic Radiation Force Impulse (ARFI) imaging for the diagnosis of cirrhosis during liver ultrasonography. Ultraschall Med 2011; 32: [PMID: DOI: /s ] 99 Karlas T, Pfrepper C, Wiegand J, Wittekind C, Neuschulz M, Mössner J, Berg T, Tröltzsch M, Keim V. Acoustic radiation force impulse imaging (ARFI) for non-invasive detection of liver fibrosis: examination standards and evaluation of interlobe differences in healthy subjects and chronic liver disease. Scand J Gastroenterol 2011; 46: [PMID: March 21, 2014 Volume 20 Issue 11

146 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis DOI: / ] 100 Toshima T, Shirabe K, Takeishi K, Motomura T, Mano Y, Uchiyama H, Yoshizumi T, Soejima Y, Taketomi A, Maehara Y. New method for assessing liver fibrosis based on acoustic radiation force impulse: a special reference to the difference between right and left liver. J Gastroenterol 2011; 46: [PMID: DOI: /s ] 101 Bota S, Sporea I, Sirli R, Popescu A, Dănilă M, Sendroiu M. Factors that influence the correlation of acoustic radiation force impulse (ARFI), elastography with liver fibrosis. Med Ultrason 2011; 13: [PMID: ] 102 Goertz RS, Sturm J, Pfeifer L, Wildner D, Wachter DL, Neurath MF, Strobel D. ARFI cut-off values and significance of standard deviation for liver fibrosis staging in patients with chronic liver disease. Ann Hepatol 2013; 12: [PMID: ] 103 Bota S, Sporea I, Peck-Radosavljevic M, Sirli R, Tanaka H, Iijima H, Saito H, Ebinuma H, Lupsor M, Badea R, Fierbinteanu-Braticevici C, Petrisor A, Friedrich-Rust M, Sarrazin C, Takahashi H, Ono N, Piscaglia F, Marinelli S, D Onofrio M, Gallotti A, Salzl P, Popescu A, Danila M. The influence of aminotransferase levels on liver stiffness assessed by Acoustic Radiation Force Impulse Elastography: a retrospective multicentre study. Dig Liver Dis 2013; 45: [PMID: DOI: /j.dld ] 104 Chen SH, Li YF, Lai HC, Kao JT, Peng CY, Chuang PH, Su WP, Chiang IP. Effects of patient factors on noninvasive liver stiffness measurement using acoustic radiation force impulse elastography in patients with chronic hepatitis C. BMC Gastroenterol 2012; 12: 105 [PMID: DOI: / X ] 105 Bota S, Sporea I, Sirli R, Popescu A, Danila M, Costachescu D. Intra- and interoperator reproducibility of acoustic radiation force impulse (ARFI) elastography--preliminary results. Ultrasound Med Biol 2012; 38: [PMID: DOI: /j.ultrasmedbio ] 106 Goertz RS, Egger C, Neurath MF, Strobel D. Impact of food intake, ultrasound transducer, breathing maneuvers and body position on acoustic radiation force impulse (ARFI) elastometry of the liver. Ultraschall Med 2012; 33: [PMID: DOI: /s ] 107 Popescu A, Bota S, Sporea I, Sirli R, Danila M, Racean S, Suseanu D, Gradinaru O, Ivascu Siegfried C. The influence of food intake on liver stiffness values assessed by acoustic radiation force impulse elastography-preliminary results. Ultrasound Med Biol 2013; 39: [PMID: DOI: /j.ultrasmedbio ] 108 Yoneda M, Suzuki K, Kato S, Fujita K, Nozaki Y, Hosono K, Saito S, Nakajima A. Nonalcoholic fatty liver disease: USbased acoustic radiation force impulse elastography. Radiology 2010; 256: [PMID: DOI: /radiol ] 109 Friedrich-Rust M, Romen D, Vermehren J, Kriener S, Sadet D, Herrmann E, Zeuzem S, Bojunga J. Acoustic radiation force impulse-imaging and transient elastography for non-invasive assessment of liver fibrosis and steatosis in NAFLD. Eur J Radiol 2012; 81: e325-e331 [PMID: DOI: / j.ejrad ] 110 Fierbinteanu Braticevici C, Sporea I, Panaitescu E, Tribus L. Value of acoustic radiation force impulse imaging elastography for non-invasive evaluation of patients with nonalcoholic fatty liver disease. Ultrasound Med Biol 2013; 39: [PMID: DOI: /j.ultrasmedbio ] 111 Behrens CB, Langholz JH, Eiler J, Jenewein R, Naehrlich L, Fuchs K, Harth S, Krombach GA, Alzen GF. A pilot study of the characterization of hepatic tissue strain in children with cystic-fibrosis-associated liver disease (CFLD) by acoustic radiation force impulse imaging. Pediatr Radiol 2013; 43: [PMID: DOI: /s ] 112 Karlas T, Hempel M, Tröltzsch M, Huster D, Günther P, Tenckhoff H, Mössner J, Berg T, Keim V, Wiegand J. Noninvasive evaluation of hepatic manifestation in Wilson disease with transient elastography, ARFI, and different fibrosis scores. Scand J Gastroenterol 2012; 47: [PMID: DOI: / ] 113 Righi S, Fiorini E, De Molo C, Cipriano V, Cassani F, Muratori L, Lenzi M, Morselli Labate AM, Serra C. ARFI elastography in patients with chronic autoimmune liver diseases: A preliminary study. J Ultrasound 2012; 15: [PMID: DOI: /j.jus ] 114 Park H, Park JY, Kim do Y, Ahn SH, Chon CY, Han KH, Kim SU. Characterization of focal liver masses using acoustic radiation force impulse elastography. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19. i2.219] 115 Frulio N, Laumonier H, Carteret T, Laurent C, Maire F, Balabaud C, Bioulac-Sage P, Trillaud H. Evaluation of liver tumors using acoustic radiation force impulse elastography and correlation with histologic data. J Ultrasound Med 2013; 32: [PMID: ] 116 Sporea I, Sirli R, Bota S, Popescu A, Sendroiu M, Jurchis A. Comparative study concerning the value of acoustic radiation force impulse elastography (ARFI) in comparison with transient elastography (TE) for the assessment of liver fibrosis in patients with chronic hepatitis B and C. Ultrasound Med Biol 2012; 38: [PMID: DOI: /j.ultr asmedbio ] 117 Friedrich-Rust M, Buggisch P, de Knegt RJ, Dries V, Shi Y, Matschenz K, Schneider MD, Herrmann E, Petersen J, Schulze F, Zeuzem S, Sarrazin C. Acoustic radiation force impulse imaging for non-invasive assessment of liver fibrosis in chronic hepatitis B. J Viral Hepat 2013; 20: [PMID: DOI: /j x] 118 Sporea I, Sirli R, Bota S, Fierbinţeanu-Braticevici C, Petrişor A, Badea R, Lupşor M, Popescu A, Dănilă M. Is ARFI elastography reliable for predicting fibrosis severity in chronic HCV hepatitis? World J Radiol 2011; 3: [PMID: DOI: /wjr.v3.i7.188] 119 Sporea I, Bota S, Peck-Radosavljevic M, Sirli R, Tanaka H, Iijima H, Badea R, Lupsor M, Fierbinteanu-Braticevici C, Petrisor A, Saito H, Ebinuma H, Friedrich-Rust M, Sarrazin C, Takahashi H, Ono N, Piscaglia F, Borghi A, D Onofrio M, Gallotti A, Ferlitsch A, Popescu A, Danila M. Acoustic Radiation Force Impulse elastography for fibrosis evaluation in patients with chronic hepatitis C: an international multicenter study. Eur J Radiol 2012; 81: [PMID: DOI: /j.ejrad ] 120 Friedrich-Rust M, Wunder K, Kriener S, Sotoudeh F, Richter S, Bojunga J, Herrmann E, Poynard T, Dietrich CF, Vermehren J, Zeuzem S, Sarrazin C. Liver fibrosis in viral hepatitis: noninvasive assessment with acoustic radiation force impulse imaging versus transient elastography. Radiology 2009; 252: [PMID: DOI: /radiol ] 121 Rizzo L, Calvaruso V, Cacopardo B, Alessi N, Attanasio M, Petta S, Fatuzzo F, Montineri A, Mazzola A, L abbate L, Nunnari G, Bronte F, Di Marco V, Craxì A, Cammà C. Comparison of transient elastography and acoustic radiation force impulse for non-invasive staging of liver fibrosis in patients with chronic hepatitis C. Am J Gastroenterol 2011; 106: [PMID: DOI: /ajg ] 122 Kircheis G, Sagir A, Vogt C, Vom Dahl S, Kubitz R, Häussinger D. Evaluation of acoustic radiation force impulse imaging for determination of liver stiffness using transient elastography as a reference. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 123 Lupsor M, Badea R, Stefanescu H, Sparchez Z, Branda H, Serban A, Maniu A. Performance of a new elastographic method (ARFI technology) compared to unidimensional transient elastography in the noninvasive assessment of chronic hepatitis C. Preliminary results. J Gastrointestin Liver 2865 March 21, 2014 Volume 20 Issue 11

147 Schiavon LL et al. Non-invasive diagnosis of liver fibrosis Dis 2009; 18: [PMID: ] 124 Takahashi H, Ono N, Eguchi Y, Eguchi T, Kitajima Y, Kawaguchi Y, Nakashita S, Ozaki I, Mizuta T, Toda S, Kudo S, Miyoshi A, Miyazaki K, Fujimoto K. Evaluation of acoustic radiation force impulse elastography for fibrosis staging of chronic liver disease: a pilot study. Liver Int 2010; 30: [PMID: DOI: /j x] 125 Fierbinteanu-Braticevici C, Andronescu D, Usvat R, Cretoiu D, Baicus C, Marinoschi G. Acoustic radiation force imaging sonoelastography for noninvasive staging of liver fibrosis. World J Gastroenterol 2009; 15: [PMID: ] 126 Goertz RS, Zopf Y, Jugl V, Heide R, Janson C, Strobel D, Bernatik T, Haendl T. Measurement of liver elasticity with acoustic radiation force impulse (ARFI) technology: an alternative noninvasive method for staging liver fibrosis in viral hepatitis. Ultraschall Med 2010; 31: [PMID: DOI: /s ] 127 Haque M, Robinson C, Owen D, Yoshida EM, Harris A. Comparison of acoustic radiation force impulse imaging (ARFI) to liver biopsy histologic scores in the evaluation of chronic liver disease: A pilot study. Ann Hepatol 2010; 9: [PMID: ] 128 Sporea I, Sirli RL, Deleanu A, Popescu A, Focsa M, Danila M, Tudora A. Acoustic radiation force impulse elastography as compared to transient elastography and liver biopsy in patients with chronic hepatopathies. Ultraschall Med 2011; 32 Suppl 1: S46-S52 [PMID: DOI: / s ] 129 Friedrich-Rust M, Nierhoff J, Lupsor M, Sporea I, Fierbinteanu-Braticevici C, Strobel D, Takahashi H, Yoneda M, Suda T, Zeuzem S, Herrmann E. Performance of Acoustic Radiation Force Impulse imaging for the staging of liver fibrosis: a pooled meta-analysis. J Viral Hepat 2012; 19: e212-e219 [PMID: DOI: /j x] 130 Bota S, Herkner H, Sporea I, Salzl P, Sirli R, Neghina AM, Peck-Radosavljevic M. Meta-analysis: ARFI elastography versus transient elastography for the evaluation of liver fibrosis. Liver Int 2013; 33: [PMID: DOI: /liv.12240] 131 Sebastiani G, Halfon P, Castera L, Pol S, Thomas DL, Mangia A, Di Marco V, Pirisi M, Voiculescu M, Guido M, Bourliere M, Noventa F, Alberti A. SAFE biopsy: a validated method for large-scale staging of liver fibrosis in chronic hepatitis C. Hepatology 2009; 49: [PMID: DOI: /hep.22859] 132 Bourliere M, Penaranda G, Renou C, Botta-Fridlund D, Tran A, Portal I, Lecomte L, Castellani P, Rosenthal-Allieri MA, Gerolami R, Ouzan D, Deydier R, Degott C, Halfon P. Validation and comparison of indexes for fibrosis and cirrhosis prediction in chronic hepatitis C patients: proposal for a pragmatic approach classification without liver biopsies. J Viral Hepat 2006; 13: [PMID: DOI: / j x] 133 Castéra L, Sebastiani G, Le Bail B, de Lédinghen V, Couzigou P, Alberti A. Prospective comparison of two algorithms combining non-invasive methods for staging liver fibrosis in chronic hepatitis C. J Hepatol 2010; 52: [PMID: DOI: /j.jhep ] 134 Boursier J, de Ledinghen V, Zarski JP, Fouchard-Hubert I, Gallois Y, Oberti F, Calès P. Comparison of eight diagnostic algorithms for liver fibrosis in hepatitis C: new algorithms are more precise and entirely noninvasive. Hepatology 2012; 55: [PMID: DOI: /hep.24654] 135 Bhogal H, Sterling RK. Staging of liver disease: which option is right for my patient? Infect Dis Clin North Am 2012; 26: [PMID: DOI: /j.idc ] 136 Smith JO, Sterling RK. Systematic review: non-invasive methods of fibrosis analysis in chronic hepatitis C. Aliment Pharmacol Ther 2009; 30: [PMID: DOI: /j x] 137 Chalmers RJ, Kirby B, Smith A, Burrows P, Little R, Horan M, Hextall JM, Smith CH, Klaber M, Rogers S. Replacement of routine liver biopsy by procollagen III aminopeptide for monitoring patients with psoriasis receiving long-term methotrexate: a multicentre audit and health economic analysis. Br J Dermatol 2005; 152: [PMID: DOI: /j x] 138 Crockett SD, Kaltenbach T, Keeffe EB. Do we still need a liver biopsy? Are the serum fibrosis tests ready for prime time? Clin Liver Dis 2006; 10: , viii [PMID: DOI: /j.cld ] 139 Whitty JA, Tallis C, Nguyen KH, Scuffham PA, Crosland P, Hewson K, Pai Mangalore R, Black M, Holtmann G. Cost and time savings from a rapid access model of care using transient elastography to screen and triage patients with chronic Hepatitis C infection. J Med Econ 2014; 17: [PMID: DOI: / ] 140 Canavan C, Eisenburg J, Meng L, Corey K, Hur C. Ultrasound elastography for fibrosis surveillance is cost effective in patients with chronic hepatitis C virus in the UK. Dig Dis Sci 2013; 58: [PMID: DOI: / s y] 141 García-Jurado L, Oyagüez I, Casado MÁ, Tural C, González- García J, Ortega E, Pineda JA. [Evaluation of the costs of transient elastography (FibroScan( )) in the diagnosis of liver fibrosis in HIV patients with hepatitis C virus]. Enferm Infecc Microbiol Clin 2012; 30: [PMID: DOI: /j.eimc ] 142 Liu S, Schwarzinger M, Carrat F, Goldhaber-Fiebert JD. Cost effectiveness of fibrosis assessment prior to treatment for chronic hepatitis C patients. PLoS One 2011; 6: e26783 [PMID: DOI: /journal.pone ] P- Reviewers: Mei S, Yoshiji H S- Editor: Qi Y L- Editor: Webster JR E- Editor: Liu XM 2866 March 21, 2014 Volume 20 Issue 11

148 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Chronic hepatitis C genotype 1 virus: Who should wait for treatment? Cristiane Valle Tovo, Angelo Alves de Mattos, Paulo Roberto Lerias de Almeida Cristiane Valle Tovo, Angelo Alves de Mattos, Department of Gastroenterology, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre , Brasil Cristiane Valle Tovo, Paulo Roberto Lerias de Almeida, Department of Gastroenterology, Hospital Nossa Senhora da Conceição, Porto Alegre , Brasil Author contributions: Tovo CV wrote the paper with significant contributions from Alves de Mattos A and Lerias de Almeida PR; Alves de Mattos A and Lerias de Almeida PR also performed the final review of the manuscript. Correspondence to: Cristiane Valle Tovo, MD, PhD, Department of Gastroenterology, Universidade Federal de Ciências da Saúde de Porto Alegre, Rua Cel Aurélio Bitencourt 115 apto 201, Porto Alegre , Brasil. cris.tovo@terra.com.br Telephone: Fax: Received: September 20, 2013 Revised: November 21, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract Elucidation of the natural history of chronic hepatitis C (CHC) and the identification of risk factors for its progression to advanced liver disease have allowed many physicians to recommend deferral treatment (triple therapy) in favour of waiting for new drug availability for patients who are at low risk of progression to significant liver disease. Newer generation drugs are currently under development, and are expected to feature improved efficacy and safety profiles, as well as less complex and shorter duration delivery regimens, compared to the current standards of care. In addition, patients with cirrhosis and prior null responders have a low rate (around 15%) of achieving sustained virological response (SVR) with triple therapy, and physicians must also consider the decision to wait for new treatments in the future for these patients as well. Naïve patients are the most likely to achieve a close to 100% SVR rate; therefore, it may be advisable to recommend that patients with mild to moderate CHC should wait for the newer therapy options. In contrast, patients with advanced fibrosis and cirrhosis will be those with the greatest need for expedited therapeutic intervention. There remains a need, however, for establishing definitive clinical management guidelines to maximize the benefit of waiting for new drugs and minimize risk of side effects and non-response to the current triple therapy Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Chronic hepatitis C; Treatment of hepatitis C; Cirrhosis; Protease inhibitors Core tip: Identification of risk factors for progression of chronic hepatitis C has allowed physicians to recommend treatment deferral (triple therapy) to wait for anticipated new drugs with better efficacy and safety profiles for patients with mild to moderate disease. Patients with cirrhosis and prior null responders rarely obtain sustained virological response with triple therapy and the decision to wait for new treatments must be considered. For each patient population, definitive clinical management guidelines are needed to maximize the benefit of waiting for new drugs and minimize risk of side effects and non-response to the current triple therapy. Tovo CV, Alves de Mattos A, Lerias de Almeida PR. Chronic hepatitis C genotpype 1 virus: Who should wait for treatment? World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION More than 170 million people worldwide suffer from chronic infection with the hepatitis C virus (HCV) [1]. In 2867 March 21, 2014 Volume 20 Issue 11

149 Tovo CV et al. Hepatitis C: Wait for treatment? Brazil, a nationwide population-based survey conducted in all macro-regions to estimate the seroprevalence of HCV antibodies in the urban population showed an overall prevalence of 1.38% (95%CI: 1.12%-1.64%) [2]. Chronic hepatitis C (CHC) is a leading cause of endstage liver disease and hepatocellular carcinoma (HCC) [3,4], as well as the most common indicator for orthotopic liver transplantation in the Western world [1,5]. Following the development of HCV-related cirrhosis, the annual risks of clinical decompensation, death or transplantation, and HCC are 6% (range, 4%-8%), 3% (range, 2%-6%), and 3% (range, 2%-6%), respectively [6-10]. A recent study estimated that the 5-year cumulative incidences of mortality, hepatic decompensation, and HCC were significantly higher (9%, 31%, and 17%, respectively) in HCV-related compensated cirrhotic patients with esophageal varices than in those without esophageal varices (2%, 7%, and 9%, respectively) [9]. The aim of therapeutic intervention for CHC patients is to halt disease evolution to cirrhosis, or if already established, to prevent its complications [11] ; these effects will facilitate regression of fibrosis and help to avoid reinfection of allograft in patients who underwent liver transplantation [12]. CLASSICAL MANAGEMENT Interferon (IFN) has been the keystone of HCV therapy for more than 20 years. In the early 1990s, only 5%-10% of patients achieved sustained virological response (SVR) after 24 wk of therapy with IFN [13], and extending the treatment period to 48 wk only increased the rate of SVR to nearly 20%. A considerable and clinically meaningful increase in the rate of SVR (38%-43%) achieved with IFN was finally obtained by the co-administration of ribavirin (RBV), but this combination therapy was limited by additional side effects [14,15]. Modification of the standard IFN molecule to couple with a polyethylene glycol (PEG) further improved the success rates of achieving SVR (54%-56%); unfortunately, the overall safety profile of IFN-based HCV targeted therapy was not correspondingly improved, and the modification might have further increased side effects [16,17]. Nonetheless, the combination treatment with PEG-IFN and RBV has been the standard-of-care (SOC) therapy for CHC since 2003, despite that fact that the related rate of response is suboptimal particularly for genotype 1 HCV (HCV-1), with a less than 46% cure rate [16,17]. PEG-IFN AND RBV IN REAL LIFE CONTEXT There remains a lack of independent studies on PEG- IFN and RBV therapies that have been carried out in a real life context (i.e., outside the context of clinical assays). Aiming to fill this gap, we performed an intentionto-treat (ITT) analysis to evaluate the SVR rates in CHC HCV-1 patients who had participated in a public therapeutic intervention program in southern Brazil. In the cohort of 323 individuals treated with PEG-IFN and RBV for 48 wk, SVR was achieved in 114 (35.3%) of the patients. Thus, the SVR rate in patients with CHC HCV-1 achieved by PEG-IFN and RBV combination treatment in a public health system did not reproduce the results reported from the major clinical trials [18]. The effectiveness of PEG-IFN and RBV combination treatment of hepatitis C has also been evaluated in urban ethnic minority patients [19]. Specifically, ITT analysis of 255 patients with a mean age of 50 years (60% male; 68% genotype 1; 29% with cirrhosis) showed that SVR was achieved in 14% of the genotype 1 patients and 37% of the genotype 2/3 patients (P < 0.001). Thus, the dual treatment was less effective in this population than in that reported from controlled trials, suggesting that new strategies are needed to care for such patients. One explanation for the differences between these two effectiveness studies may be the fact that the Feuerstadt et al [19] study lost 26% of the patients to follow-up, whereas the study conducted by de Almeida et al [18] did not have such a problem. It is important to remember that losses of more than 20% in cohort studies may reduce the reliability of their results [20]. Nonetheless, in a recent real life multicentric study evaluating more than 7000 patients, Marcellin et al [21] observed SVR in only 41.8% of HCV-1 patients. PREDICTORS OF RESPONSE TO PEG-IFN AND RBV THERAPY The ability to identify which individuals will respond to HCV treatment remains limited. Pre-treatment predictors of response have became crucial to selecting therapy candidates, and include HCV genotype (2/3 best response), ethnicity (Asians responding best and African Americans worst, with Caucasians and Hispanics in-between), low HCV baseline viral load, younger age, histology (low fibrosis and little or no steatosis), metabolic syndrome, and interleukin 28B (IL28B) genotype [22,23]. Genetic variants in the region of the IL28B gene were recently shown to have a strong association with the outcome of PEG-IFN and RBV therapy [24,25]. In the cohort from the Individualized Dosing Efficacy vs Flat Dosing to Assess Optimal Pegylated Interferon Therapy (IDEAL) study, carriage of the favourable IL28B genotype was associated with SVR rates of 70%-80% in Caucasian patients treated with 48 wk of PEG-IFN and RBV, compared to 30%-40% in patients carrying one of the unfavourable genotypes. IL28B genotyping was recommended and immediately proved useful for pre-treatment counselling for HCV-1 patients [26]. The rapid virological response (RVR) and early virological response (EVR) parameters are used as the ontreatment predictors of response. Clinical studies have identified RVR as a valuable early predictor of SVR in patients with CHC [27]. RVR is defined as undetectable serum HCV-RNA level at week 4 of treatment, and is 2868 March 21, 2014 Volume 20 Issue 11

150 Tovo CV et al. Hepatitis C: Wait for treatment? considered an important milestone in the treatment of patients with CHC. Patients who reach RVR have a 90% chance of attaining SVR, regardless of genotype. RVR assessment is also being used to individualize treatment duration, and represents a key opportunity to individualize a patient s therapy according to treatment-related viral kinetics [27]. The other response predictor, EVR, is observed as a viral load decline at week 12 and is capable of sufficiently distinguishing non-responders from potential responders [28] ; as such, EVR is used to modify treatment according to the negative predictive value. In an assessment of HCV-1 patients treated with PEG-IFN and RBV, we observed that the worst results were obtained in patients with partial EVR, age > 40 years, high viral load, and pronounced fibrosis (F4 stage); the expected probability of SVR was only 3.8% for these patients. Thus, presence of these conditions also represents a low chance of achieving SVR, especially if the patient did not show negative PCR results in treatment week 12; it was recommended that treatment discontinuation be considered for such patients [29]. FIRST DIRECTLY ACTING ANTIVIRALS Elucidation of the natural history of CHC and the identification of risk factors for its progression to advanced liver disease have allowed many physicians to recommend deferral of treatment (triple therapy) in favour of waiting for new drug availability for patients who are at low risk of progression to significant liver disease. Nearly a decade passed after the licensing of PEG-IFN before a new and more effective therapy was developed. Studies published in 2011 introduced the directly acting antivirals (DAAs), providing a promising new therapeutic approach for treating HCV-1 patients in particular [30-34]. Telaprevir and boceprevir are non-structural serine (NS3/4) protease inhibitors and the first DAAs approved for use in the United States and in the European Union, although many others are in the research and development pipeline [35]. Release of these drugs for clinical use marked a new era in HCV therapy. For many patients with HCV-1, DAA-based therapy has offered a significant improvement from the previous SOC [30,31]. Triple therapy consisting of the immunomodulator PEG-IFN, RBV and DAA agents rapidly became the gold standard for this patient population. Both telaprevir and boceprevir stop HCV replication by inhibiting the NS3/4 protease, which is required for processing the HCV polyprotein [36]. Although protease inhibitors are potent antiviral agents, they must be given in combination with PEG-IFN and RBV to prevent the rapid selection of resistant variants [37,38]. Thus, optimizing the rates of SVR by this approach will require strategies that promote appropriate use and avoid misuse of these drugs. Five distinct phase-Ⅲ trials have been performed with boceprevir and telaprevir to date [30-34]. For outcomes of treatment in naïve patients, the SPRINT-2 [30] trial examined the effects of PEG-IFN-α-2b in association with RBV and boceprevir, whereas the ADVANCE [31] and ILLUMINATE [34] studies investigated the effects of PEG-IFN-α-2a associated with RBV and telaprevir. These studies observed SVR rates ranging between 63% and 75%. Treatment-experienced patients were included in the re-treatment groups with boceprevir and PEG- IFNα2b plus RBV for the RESPOND-2 study [32] and with telaprevir and PEG-IFN-α-2a plus RBV in the RE- ALIZE study [33]. The SVR rates were between 69% and 88% for the prior relapsers, between 40% and 59% for the prior partial responders, and between 29% and 33% for the prior null responders. The phase-Ⅲ trials for boceprevir and telaprevir have provided several important insights into the opportunities and limitations of triple therapy for diverse populations; many patients given boceprevir and telaprevir were able to receive a reduced duration of treatment without compromising efficacy. Among the treatment-experienced patients, prior relapsers showed the best responses, whereas less than one-third of the prior null responders attained SVR. For some other patient populations, such as those with advanced fibrosis or cirrhosis, lower rates of SVR were obtained even when the triple therapy approach was applied. The many adverse effects related to telaprevir and boceprevir have limited their preferred status among patients and health professionals alike. Approximately 60% of patients who initiate the triple therapy regimen achieve an extended RVR [39,40], giving them at higher chance of achieving SVR. For patients who do not achieve an RVR, a delayed virological response (undetectable HCV-RNA before week 24 of treatment) is still beneficial, as it is associated with SVR rates between 64% and 75% if these patients retain the HCV- RNA undetectable status throughout the 48-wk treatment period [30-34]. Such a delayed virological response has been estimated to occur in 15%-20% of HCV patients [41]. The good rates of SVR achieved with triple therapy have led to this therapeutic intervention strategy being recommended as the SOC by the guidelines from the various national Associations for the Study of Liver Disease, including the United States of America (AASLD) [39], Europe (EASL) [42], Latin-America (ALEH) [43], Canada [44], the United Kingdom [45], and France [46]. As with most previous improvements in therapy for HCV, both of the currently licensed DAAs, boceprevir and telaprevir, significantly increase the rate and severity of adverse events. Thus, the higher efficacy that they provide is gained at the cost of additional and potentially severe adverse effects (SAE), mainly in patients with advanced fibrosis [47]. Furthermore, it is important to emphasize that the DAAs can interact with other drugs, as well as induce the emergence of HCV resistant variants [48] ; the clinical significance of these potentially complicating features are not yet definitely established. The most significant real life study of triple therapy treatment of cirrhotic patients was recently published by 2869 March 21, 2014 Volume 20 Issue 11

151 Tovo CV et al. Hepatitis C: Wait for treatment? Table 1 New drugs for treating chronic hepatitis C Class Drug Phase of study NS3/4A protease inhibitors Telaprevir Approved Boceprevir Approved Simeprevir Ⅲ Faldaprevir Ⅲ Danoprevir Ⅱ Vaniprevir Ⅱ Narlaprevir Ⅱ Asunaprevir Ⅱ GS-9256 Ⅱ GW-9451 Ⅱ ABT-450/r Ⅱ ACH-1625 Ⅱ ACH-2684 Ⅰb MK-5172 Ⅱ Nucleoside/nucleotide analogue Sofosbuvir Ⅲ inhibitors of HCV-RNA Mericitabine Ⅱ dependent RNA polymerase IDX184 Ⅱ PSI-938 Ⅱ INX-189 Ⅰb Non-nucleoside inhibitors of Tegobuvir Ⅱ HCV-RNA dependent RNA Filibuvir Ⅱ polymerase Setrobuvir Ⅱ BI Ⅱ ABT-333 Ⅱ VX-222 Ⅱ TMC Ⅰb NS5A inhibitors of HCV-RNA Daclatasvir Ⅱ dependent RNA polymerase PPI-461 Ⅰb GS-5885 Ⅰb GSK Ⅰb Adapted from Pawlotsky et al [50]. HCV: Hepatitis C virus. On-going clinical trials hold considerable promises for advances in HCV therapy. A newer generation of NS3/ 4A protease inhibitors are currently under development to deliver more effective, safe, less complex and shorter duration therapy than the current SOC. These new drugs include the NS5A polymerase inhibitors, NS5B polymerase inhibitors, lambda interferon, and cyclophilin inhibitors (Table 1). It is believed that agents featuring increased potency that allow for simultaneous targeting of various aspects of HCV replication using multiple agents will result in IFN-free therapy [50-61]. Amongst the many new drugs that were introduced in mid-2013, two deserve distinction: sofosbuvir and simeprevir. Both of these drugs have concluded the phase-Ⅲ trials and been submitted to the appropriate regulatory agencies. The results thus far have shown that besides favouring a high SVR, both of these drugs present excellent safety profiles (Table 2). Sofosbuvir is a nucleotide analogue HCV NS5B polymerase inhibitor with similar in vitro activities against all HCV genotypes (in phase-Ⅱ studies). SVR rates of 87%-90% were obtained in previously untreated patients with HCV-1 infection [62]. Moreover, no virologic breakthrough has been observed during therapy with sofosbuvir in clinical trials, which is consistent with the drug s mechanism of action and high genetic barrier to resistance. The phase-Ⅲ studies have mainly evaluated patients with HCV-1 infection who had not received previous treatment and the SVR rate is estimated to be 90% at 12 wk, supporting the use of sofosbuvir as an effective drug to treat CHC [63]. The new protease inhibitors simeprevir and faldaprevir are currently completing phase-Ⅲ clinical trials as well. Similar to the currently available protease inhibitors, these agents will be applied as triple therapy with PEG- IFN and RBV combination treatment. In the phase-Ⅱ clinical trials of both of these protease inhibitors, the overall SVR rates in the treatment-naive population were between 70% and 85% [51,60], for patients with a prior partial response to PEG-IFN and RBV the SVR rates were between 40% and 70%, and for prior non-responders the SVR rates were between 30% and 50%. These results are similar to those observed with the current SOC [54,59]. The advantages of these two new protease inhibitors are a reduced pill burden and a more favourable adverse event profile when compared with telaprevir and boceprevir [67]. When determining which patients should receive therapy, some authors [68] have suggested considering treating a broader population of patients who might have had treatment delayed in the past. However, concerns about adverse events from PEG-IFN-based regimens remain an obstacle. Additionally, patients with the CC polythe Compassionate Use of Protease Inhibitors in Viral C Cirrhosis (CUPIC) study group. CUPIC is an earlyaccess French program consisting of cirrhotic prior nonresponders. The study s results indicated that the telaprevir and boceprevir-based treatments produced a smaller virological response and had a general poor tolerability [47]. Specifically, a 16-wk analysis of 292 patients receiving telaprevir and 205 patients receiving boceprevir showed a significantly higher number of patients with SAE compared to published clinical trials (32.7%-45.2% SAE in CUPIC vs 9%-14% in the clinical trials). In addition, death or severe complications were shown to be related to platelet count of /mm 3 and albumin of < 3.5 g/dl, with a risk of 44.1% being estimated for patients with both factors. Future real life studies assessing patients with different fibrosis grade are expected to show lower SVR rates (adherence to treatment will be an important factor in this regard) and higher adverse effects than clinical trials. It is interesting to consider that even in the United States of America - the first country to approve the new DAAs - a retrospective cross-sectional study [49] found that boceprevir and telaprevir triple therapies were administered to only 18.7% of patients with HCV-1 infection in the 12 mo after the Food and Drug Administration ap- proval was given. This low percentage might reflect concerns about the related side effects and/or anticipation for more effective medications becoming available in the near future. NEW DRUGS 2870 March 21, 2014 Volume 20 Issue 11

152 Tovo CV et al. Hepatitis C: Wait for treatment? Table 2 New directly acting antivirals submitted to regulatory agencies Ref Phase Drug Gen n Status PEG-IFN RBV SVR Kowdley et al [62] Ⅱ Sofosbuvir Naïve Y Y 87%-89% (ATOMIC) Lawitz et al [63] Ⅱ Sofosbuvir Naïve Y Y 90% 2, % Gane et al [56] Ⅱa Sofosbuvir 2, 3 40 Naïve Y/N Y/N 60%-100% (ELECTRON) 1 35 Naïve/experienced N Y 10%-84% Lawitz et al [64] Ⅲ Sofosbuvir 1, 4, 5, Naïve Y Y 90% (NEUTRINO/FISSION) 2, Naïve N Y 67% Jacobson et al [65] Ⅲ Sofosbuvir 2, Naïve N Y 78% (POSITRON/FUSION) 2, Experienced 50% Fried et al [51] Ⅱb Simeprevir Naïve Y Y 75%-86% (PILLAR) Zeuzem et al [54] Ⅱb Simeprevir 1 Experienced Y Y 70%-96% (ASPIRE) Jacobson et al [66] Ⅲ Simeprevir Naïve Y Y 80% (QUEST 1) Manns et al [67] Ⅲ Simeprevir Naïve Y Y 81% (QUEST 2) Gen: Genotype; RBV: Ribavirin; PEG-IFN: Polyethylene glycol-interferon; Y: Yes; N: No; SVR: Sustained virological response. morphism of IL28B, which is associated with increased response to therapy, should be able to achieve SVR from dual therapy that is comparable to that anticipated for the triple therapy; no randomized clinical trials testing this assertion have been published though [24]. Boceprevir and telaprevir must not be administered as monotherapies and should only be given in combination with PEG-IFN and RBV in order to minimize and prevent development of viral resistance [39]. The importance of adherence to all drugs in the triple therapy regimen must be fully explained to each patient, and potential barriers to adherence should be addressed prior to initiation of the therapy regimen [68]. Regardless of the noteworthy increase in the chance of obtaining SVR with these protease inhibitors, the current treatment with DAAs is more complex; it also increases the chance of SAE, can promote viral resistance, and may not be effective in some sub-groups [69,70]. Patients with cirrhosis who are prior null responders have a particularly low chance of obtaining SVR with triple therapy (about 15%), and the decision to wait for new treatments in the future must be confronted with the consequences of not starting treatment immediately. WHO SHOULD WAIT FOR TREATMENT? Correct selection of patients for therapy initiation or delay is also necessary to make treatment as cost-effective as possible. For the newly introduced DAA agents, professionals may be unable to initially treat all patients requesting therapy and will be forced to allocate scarce resources appropriately. Some authors have shown that both universal triple therapy and IL-28B-guided triple therapy are cost-effective when the least-expensive protease inhibitor is used for patients with advanced fibrosis [71]. With the expectation of highly effective and bettertolerated new therapies becoming available in the near future (including those that are IFN-free), the decision about whether or not to treat patients immediately may present a challenge to clinical management. This decision must take many factors into consideration, such as the probability of obtaining SVR, the urgency of treatment, contraindications, tolerability, motivation, and the actual perspective of access to the new drugs. Though treatment duration of the new drugs is still evolving, a close to 100% SVR rate is almost certain to become a reality within the next 3 years, at least for treatment-naïve patients; cirrhotic patients will likely remain more difficult to treat. Thus, the major clinical question facing physicians caring for patients with CHC in 2013 is: Does the patient need treatment now or is there time to wait for the anticipated very promising newer treatments? In favour of immediate treatment, independently from other factors, one should consider that triple therapy enhances the chances of achieving SVR. Certainly, earlier initiation of therapy increases the chance of success; from a practical standpoint, if SVR is achieved, disease progression can be arrested. Furthermore, it is important to consider the present difficulties in predicting the stage or time of progression of a particular patient s disease. Uncertainties regarding the time of approval, dispensing, and cost of these anticipated future drugs and therapies can affect the decision as well [72]. The reasoning to defer therapy must consider the fact that the first generation DAAs are associated with SAE; if the therapy fails, it will affect future treatments. The progression of liver disease is generally slow, and future treatments will produce higher rates of SVR, including for special patient populations. In addition, it is anticipated that the regimen for these future drugs will be simple (greater adhesion), with less adverse events, and probably IFN-free, and that the future treatments will be effective in patients with non-genotype 1 HCV [72] March 21, 2014 Volume 20 Issue 11

153 Tovo CV et al. Hepatitis C: Wait for treatment? Shiffman and Benhamou [73] present a rather interesting position, suggesting to treat patients with F1/F2, as not treating them would favour the reduction of SVR in the population. Paradoxically, they consider postponing treatment in patients who are difficult to treat (non-white, high viral load, IL28 TT polymorphism carrier, advanced fibrosis, and null responder). Given the scenarios presented herein, we deem that patients with mild to moderate disease should be advised to wait for the newer drugs and therapies to become available, as IFN-free treatments are likely to emerge with greater chance for SVR and fewer side effects than the current treatments. In contrast, patients with advanced fibrosis (F3), and more so those with cirrhosis (F4), will be those with the greatest need for more expedited treatment. We are particularly intrigued by the United Kingdom s consensus guidelines for the use of the protease inhibitors boceprevir and telaprevir in HCV-1 patients [45] for cirrhotic patients who are also prior null responders. The decision to wait for novel therapies or to use a 4-wk leadin with PEG-IFN and RBV to identify patients more likely to achieve SVR should be made following careful and balanced discussion with the patient. Patients with < 1 log decline during the lead-in phase have been shown to have low SVR (about 6%), indicating that there is a low chance of achieving SVR for those failing to reach the 1 log decline by week 4 in the lead-in period [32,74]. Therefore, it is important to determine whether and the extent of treatment that should be given to prior null responder cirrhotic patients, considering the high risk of SAE and low chance of SVR. In conclusion, we propose that treatment-naïve patients with HCV-1 CHC be evaluated for IL28B genotype and fibrosis grade (by invasive or non-invasive methods). Those with a favourable IL28B genotype (CC) and with mild fibrosis can be treated with PEG-IFN and RBV. If the IL28B TC or TT polymorphisms are present, along with mild fibrosis (F1-F2), then treatment may be deferred. In patients with pronounced fibrosis (F3-F4), DAAs are indicated. On the other hand, for patients who are prior relapsers, DAAs are recommended; DAAs may be considered for prior partial responders, and prior nullresponders should be evaluated for fibrosis grade (by invasive or non-invasive methods). If advanced fibrosis is present (F3), treatment may be indicated. With cirrhosis (F4), lead-in is recommended; in this case, if < 1 log decline occurs during the lead-in phase, then treatment could be deferred, and if > 1 log decline occurs, then DAAs may be indicated. REFERENCES 1 Strader DB, Wright T, Thomas DL, Seeff LB; American Association for the Study of Liver Diseases. Diagnosis, management, and treatment of hepatitis C. Hepatology 2004; 39: [PMID: DOI: /hep.20119] 2 Pereira LM, Martelli CM, Moreira RC, Merchan-Hamman E, Stein AT, Cardoso MR, Figueiredo GM, Montarroyos UR, Braga C, Turchi MD, Coral G, Crespo D, Lima ML, Alencar LC, Costa M, dos Santos AA, Ximenes RA. Prevalence and risk factors of Hepatitis C virus infection in Brazil, 2005 through 2009: a cross-sectional study. BMC Infect Dis 2013; 13: 60 [PMID: DOI: / ] 3 Bruno S, Facciotto C. The natural course of HCV infection and the need for treatment. Ann Hepatol 2008; 7: [PMID: ] 4 Williams R. Global challenges in liver disease. Hepatology 2006; 44: [PMID: DOI: /hep.21347] 5 Wise M, Bialek S, Finelli L, Bell BP, Sorvillo F. Changing trends in hepatitis C-related mortality in the United States, Hepatology 2008; 47: [PMID: DOI: /hep.22165] 6 Sangiovanni A, Prati GM, Fasani P, Ronchi G, Romeo R, Manini M, Del Ninno E, Morabito A, Colombo M. The natural history of compensated cirrhosis due to hepatitis C virus: A 17-year cohort study of 214 patients. Hepatology 2006; 43: [PMID: DOI: /hep.21176] 7 Benvegnù L, Gios M, Boccato S, Alberti A. Natural history of compensated viral cirrhosis: a prospective study on the incidence and hierarchy of major complications. Gut 2004; 53: [PMID: DOI: /gut ] 8 Lok AS, Seeff LB, Morgan TR, di Bisceglie AM, Sterling RK, Curto TM, Everson GT, Lindsay KL, Lee WM, Bonkovsky HL, Dienstag JL, Ghany MG, Morishima C, Goodman ZD. Incidence of hepatocellular carcinoma and associated risk factors in hepatitis C-related advanced liver disease. Gastroenterology 2009; 136: [PMID: DOI: / j.gastro ] 9 Bruno S, Zuin M, Crosignani A, Rossi S, Zadra F, Roffi L, Borzio M, Redaelli A, Chiesa A, Silini EM, Almasio PL, Maisonneuve P. Predicting mortality risk in patients with compensated HCV-induced cirrhosis: a long-term prospective study. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 10 Dienstag JL, Ghany MG, Morgan TR, Di Bisceglie AM, Bonkovsky HL, Kim HY, Seeff LB, Szabo G, Wright EC, Sterling RK, Everson GT, Lindsay KL, Lee WM, Lok AS, Morishima C, Stoddard AM, Everhart JE. A prospective study of the rate of progression in compensated, histologically advanced chronic hepatitis C. Hepatology 2011; 54: [PMID: DOI: /hep.24370] 11 Singal AG, Volk ML, Jensen D, Di Bisceglie AM, Schoenfeld PS. A sustained viral response is associated with reduced liver-related morbidity and mortality in patients with hepatitis C virus. Clin Gastroenterol Hepatol 2010; 8: , 288. e1 [PMID: DOI: /j.cgh ] 12 Mallet V, Gilgenkrantz H, Serpaggi J, Verkarre V, Vallet- Pichard A, Fontaine H, Pol S. Brief communication: the relationship of regression of cirrhosis to outcome in chronic hepatitis C. Ann Intern Med 2008; 149: [PMID: DOI: / ] 13 Di Bisceglie AM, Martin P, Kassianides C, Lisker-Melman M, Goodman Z, Banks SM, Hoofnagle JH. A randomized, double-blind, placebo-controlled trial of recombinant human alpha-interferon therapy for chronic non-a, non-b (type C) hepatitis. J Hepatol 1990; 11 Suppl 1: S36-S42 [PMID: ] 14 McHutchison JG, Gordon SC, Schiff ER, Shiffman ML, Lee WM, Rustgi VK, Goodman ZD, Ling MH, Cort S, Albrecht JK. Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. Hepatitis Interventional Therapy Group. N Engl J Med 1998; 339: [PMID: DOI: /NEJM ] 15 Poynard T, Marcellin P, Lee SS, Niederau C, Minuk GS, Ideo G, Bain V, Heathcote J, Zeuzem S, Trepo C, Albrecht J. Randomised trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT). Lancet 1998; 352: [PMID: 2872 March 21, 2014 Volume 20 Issue 11

154 Tovo CV et al. Hepatitis C: Wait for treatment? ] 16 Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001; 358: [PMID: ] 17 Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL, Häussinger D, Diago M, Carosi G, Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: / NEJMoa020047] 18 de Almeida PR, de Mattos AA, Amaral KM, Feltrin AA, Zamin P, Tovo CV, Picon PD. Treatment of hepatitis C with peginterferon and ribavirin in a public health program. Hepatogastroenterology 2009; 56: [PMID: ] 19 Feuerstadt P, Bunim AL, Garcia H, Karlitz JJ, Massoumi H, Thosani AJ, Pellecchia A, Wolkoff AW, Gaglio PJ, Reinus JF. Effectiveness of hepatitis C treatment with pegylated interferon and ribavirin in urban minority patients. Hepatology 2010; 51: [PMID: DOI: / hep.23429] 20 de Mattos AZ, de Almeida PR, Tovo CV, de Mattos AA. Pegylated interferon and ribavirin in real life: efficacy versus effectiveness. Hepatology 2010; 52: 1867 [PMID: DOI: /hep.23824] 21 Marcellin P, Cheinquer H, Curescu M, Dusheiko GM, Ferenci P, Horban A, Jensen D, Lengyel G, Mangia A, Ouzan D, Puoti M, Rodriguez-Torres M, Shiffman ML, Schmitz M, Tatsch F, Rizzetto M. High sustained virologic response rates in rapid virologic response patients in the large realworld PROPHESYS cohort confirm results from randomized clinical trials. Hepatology 2012; 56: [PMID: DOI: /hep.25892] 22 Kau A, Vermehren J, Sarrazin C. Treatment predictors of a sustained virologic response in hepatitis B and C. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 23 Afdhal NH, McHutchison JG, Zeuzem S, Mangia A, Pawlotsky JM, Murray JS, Shianna KV, Tanaka Y, Thomas DL, Booth DR, Goldstein DB. Hepatitis C pharmacogenetics: state of the art in Hepatology 2011; 53: [PMID: DOI: /hep.24052] 24 Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ, Sulkowski M, McHutchison JG, Goldstein DB. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 461: [PMID: DOI: /nature08309] 25 Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino K, Hige S, Ito Y, Mita E, Tanaka E, Mochida S, Murawaki Y, Honda M, Sakai A, Hiasa Y, Nishiguchi S, Koike A, Sakaida I, Imamura M, Ito K, Yano K, Masaki N, Sugauchi F, Izumi N, Tokunaga K, Mizokami M. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet 2009; 41: [PMID: DOI: /ng.449] 26 McHutchison JG, Lawitz EJ, Shiffman ML, Muir AJ, Galler GW, McCone J, Nyberg LM, Lee WM, Ghalib RH, Schiff ER, Galati JS, Bacon BR, Davis MN, Mukhopadhyay P, Koury K, Noviello S, Pedicone LD, Brass CA, Albrecht JK, Sulkowski MS. Peginterferon alfa-2b or alfa-2a with ribavirin for treatment of hepatitis C infection. N Engl J Med 2009; 361: [PMID: DOI: /NEJMoa ] 27 Poordad F, Reddy KR, Martin P. Rapid virologic response: a new milestone in the management of chronic hepatitis C. Clin Infect Dis 2008; 46: [PMID: DOI: /523585] 28 Awad T, Thorlund K, Hauser G, Stimac D, Mabrouk M, Gluud C. Peginterferon alpha-2a is associated with higher sustained virological response than peginterferon alfa-2b in chronic hepatitis C: systematic review of randomized trials. Hepatology 2010; 51: [PMID: DOI: /hep.23504] 29 Lerias de Almeida PR, Alves de Mattos A, Valle Tovo C. Sustained virological response according to the type of early virological response in HCV and HCV/HIV. Ann Hepatol 2010; 9: [PMID: ] 30 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 31 Jacobson IM, McHutchison JG, Dusheiko G, Di Bisceglie AM, Reddy KR, Bzowej NH, Marcellin P, Muir AJ, Ferenci P, Flisiak R, George J, Rizzetto M, Shouval D, Sola R, Terg RA, Yoshida EM, Adda N, Bengtsson L, Sankoh AJ, Kieffer TL, George S, Kauffman RS, Zeuzem S. Telaprevir for previously untreated chronic hepatitis C virus infection. N Engl J Med 2011; 364: [PMID: DOI: / NEJMoa ] 32 Bacon BR, Gordon SC, Lawitz E, Marcellin P, Vierling JM, Zeuzem S, Poordad F, Goodman ZD, Sings HL, Boparai N, Burroughs M, Brass CA, Albrecht JK, Esteban R. Boceprevir for previously treated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 33 Zeuzem S, Andreone P, Pol S, Lawitz E, Diago M, Roberts S, Focaccia R, Younossi Z, Foster GR, Horban A, Ferenci P, Nevens F, Müllhaupt B, Pockros P, Terg R, Shouval D, van Hoek B, Weiland O, Van Heeswijk R, De Meyer S, Luo D, Boogaerts G, Polo R, Picchio G, Beumont M. Telaprevir for retreatment of HCV infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 34 Sherman KE, Flamm SL, Afdhal NH, Nelson DR, Sulkowski MS, Everson GT, Fried MW, Adler M, Reesink HW, Martin M, Sankoh AJ, Adda N, Kauffman RS, George S, Wright CI, Poordad F. Response-guided telaprevir combination treatment for hepatitis C virus infection. N Engl J Med 2011; 365: [PMID: DOI: /NEJMoa ] 35 Aronsohn A, Muir AJ, Swan T, Jensen D. Is the HCV pipeline heading in the right direction? Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] 36 Steinkühler C, Biasiol G, Brunetti M, Urbani A, Koch U, Cortese R, Pessi A, De Francesco R. Product inhibition of the hepatitis C virus NS3 protease. Biochemistry 1998; 37: [PMID: DOI: /bi980313v] 37 Lin C, Gates CA, Rao BG, Brennan DL, Fulghum JR, Luong YP, Frantz JD, Lin K, Ma S, Wei YY, Perni RB, Kwong AD. In vitro studies of cross-resistance mutations against two hepatitis C virus serine protease inhibitors, VX-950 and BILN J Biol Chem 2005; 280: [PMID: DOI: /jbc.M ] 38 Sarrazin C, Kieffer TL, Bartels D, Hanzelka B, Müh U, Welker M, Wincheringer D, Zhou Y, Chu HM, Lin C, Weegink C, Reesink H, Zeuzem S, Kwong AD. Dynamic hepatitis C virus genotypic and phenotypic changes in patients treated with the protease inhibitor telaprevir. Gastroenterology 2007; 132: [PMID: DOI: /j.gastro ] 39 Ghany MG, Nelson DR, Strader DB, Thomas DL, Seeff LB. An update on treatment of genotype 1 chronic hepatitis C virus infection: 2011 practice guideline by the American Association for the Study of Liver Diseases. Hepatology 2011; 54: [PMID: DOI: /hep.24641] 40 Asselah T, Marcellin P. Direct acting antivirals for the treatment of chronic hepatitis C: one pill a day for tomorrow. Liver Int 2012; 32 Suppl 1: [PMID: DOI: /j ] 2873 March 21, 2014 Volume 20 Issue 11

155 Tovo CV et al. Hepatitis C: Wait for treatment? 41 Shiffman ML, Esteban R. Triple therapy for HCV genotype 1 infection: telaprevir or boceprevir? Liver Int 2012; 32 Suppl 1: [PMID: DOI: /j x] 42 European Association for the Study of the Liver. EASL Clinical Practice Guidelines: management of hepatitis C virus infection. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 43 Chávez-Tapia NC, Ridruejo E, Alves de Mattos A, Bessone F, Daruich J, Sánchez-Ávila JF, Cheinquer H, Zapata R, Uribe M, Bosques-Padilla F, Gadano A, Sosa A, Dávalos-Moscol M, Marroni C, Muñoz-Espinoza L, Castro-Narro G, Paraná R, Méndez-Sánchez N. An update on the management of hepatitis C: guidelines for protease inhibitor-based triple therapy from the Latin American Association for the Study of the Liver. Ann Hepatol 2013; 12 Suppl 2: s3-35 [PMID: ] 44 Myers RP, Ramji A, Bilodeau M, Wong S, Feld JJ. An update on the management of hepatitis C: consensus guidelines from the Canadian Association for the Study of the Liver. Can J Gastroenterol 2012; 26: [PMID: ] 45 Ramachandran P, Fraser A, Agarwal K, Austin A, Brown A, Foster GR, Fox R, Hayes PC, Leen C, Mills PR, Mutimer DJ, Ryder SD, Dillon JF. UK consensus guidelines for the use of the protease inhibitors boceprevir and telaprevir in genotype 1 chronic hepatitis C infected patients. Aliment Pharmacol Ther 2012; 35: [PMID: DOI: /j ] 46 Leroy V, Serfaty L, Bourlière M, Bronowicki JP, Delasalle P, Pariente A, Pol S, Zoulim F, Pageaux GP. Protease inhibitorbased triple therapy in chronic hepatitis C: guidelines by the French Association for the Study of the Liver. Liver Int 2012; 32: [PMID: DOI: / j ] 47 Hézode C, Fontaine H, Dorival C, Larrey D, Zoulim F, Canva V, de Ledinghen V, Poynard T, Samuel D, Bourlière M, Zarski JP, Raabe JJ, Alric L, Marcellin P, Riachi G, Bernard PH, Loustaud-Ratti V, Métivier S, Tran A, Serfaty L, Abergel A, Causse X, Di Martino V, Guyader D, Lucidarme D, Grando- Lemaire V, Hillon P, Feray C, Dao T, Cacoub P, Rosa I, Attali P, Petrov-Sanchez V, Barthe Y, Pawlotsky JM, Pol S, Carrat F, Bronowicki JP. Triple therapy in treatment-experienced patients with HCV-cirrhosis in a multicentre cohort of the French Early Access Programme (ANRS CO20-CUPIC) - NCT J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 48 Jacobson IM, Pawlotsky JM, Afdhal NH, Dusheiko GM, Forns X, Jensen DM, Poordad F, Schulz J. A practical guide for the use of boceprevir and telaprevir for the treatment of hepatitis C. J Viral Hepat 2012; 19 Suppl 2: 1-26 [PMID: DOI: /j ] 49 Chen EY, Sclair SN, Czul F, Apica B, Dubin P, Martin P, Lee WM. A small percentage of patients with hepatitis C receive triple therapy with boceprevir or telaprevir. Clin Gastroenterol Hepatol 2013; 11: e1-2 [PMID: DOI: /j.cgh ] 50 Pawlotsky JM. New antiviral agents for hepatitis C. F1000 Biol Rep 2012; 4: 5 [PMID: DOI: /B4-5] 51 Fried MW, Buti M, Dore GJ, Flisiak R, Ferenci P, Jacobson I, Marcellin P, Manns M, Nikitin I, Poordad F, Sherman M, Zeuzem S, Scott J, Gilles L, Lenz O, Peeters M, Sekar V, De Smedt G, Beumont-Mauviel M. Once-daily simeprevir (TMC435) with pegylated interferon and ribavirin in treatment-naïve genotype 1 hepatitis C: the randomized PILLAR study. Hepatology 2013; 58: [PMID: DOI: /hep.26641] 52 Sulkowski MS, Asselah T, Lalezari J, Ferenci P, Fainboim H, Leggett B, Bessone F, Mauss S, Heo J, Datsenko Y, Stern JO, Kukolj G, Scherer J, Nehmiz G, Steinmann GG, Böcher WO. Faldaprevir combined with pegylated interferon alfa-2a and ribavirin in treatment-naïve patients with chronic genotype 1 HCV: SILEN-C1 trial. Hepatology 2013; 57: [PMID: DOI: /hep.26276] 53 Zeuzem S, Soriano V, Asselah T, Bronowicki JP, Lohse AW, Müllhaupt B, Schuchmann M, Bourlière M, Buti M, Roberts SK, Gane EJ, Stern JO, Vinisko R, Kukolj G, Gallivan JP, Böcher WO, Mensa FJ. Faldaprevir and deleobuvir for HCV genotype 1 infection. N Engl J Med 2013; 369: [PMID: DOI: /NEJMoa ] 54 Zeuzem S, Berg T, Gane E, Ferenci P, Foster GR, Fried MW, Hezode C, Hirschfield, Jacobson I, Niditin I, Pocros P, Poordad F, Lenz O, Peeters M, Sekar V, De Smedt G, Beaumont- Mauviel M. TMC435 in HCV genotype 1 patients who have failed previous pegylated interferon/ ribavirin treatment: Final SVR24 results of the ASPIRE trial. J Hepatol 2012; 56 (Suppl 2): S1 55 Lawitz E, Lalezari J, Hassanein T. PROTON: PSI-7977 & Peg/RBV in treatment-naïve patients with HCV GT1: sustained virologic response. San Francisco: AASLD, Gane EJ, Stedman CA, Hyland RH, Ding X, Svarovskaia E, Symonds WT, Hindes RG, Berrey MM. Nucleotide polymerase inhibitor sofosbuvir plus ribavirin for hepatitis C. N Engl J Med 2013; 368: [PMID: DOI: / NEJMoa ] 57 Everson G, Lawitz E, Thompson A, Sulkowski MS, Zhu Y, Brainard BM, Mendelson L, McHucthison JG, Pang PS, Yang JC, Marcellin P, Afdhal N. The NS5A inhibitor GS-5885 is safe and well tolerated in more than 1000 patients treated in phase 2 studies. Boston: AASLD, 2012: Abstract Kowdley K, Lawitz E, Poordad F. A 12-week interferonfree treatment regimen with ABT-450/r, ABT 267, ABT-333, and ribavirin achieves SVR12 rates (observed data) of 99% in treatment-naïve patients and 93% in prior null responders with HCV genotype 1 infection. Boston: AASLD, 2012: Abstract LB-1 59 Sulkowski MS, Bourlière M, Bronowicki JP, Asselah T, Pawlotsky JM, Shafran SD, Pol S, Mauss S, Larrey D, Datsenko Y, Stern JO, Kukolj G, Scherer J, Nehmiz G, Steinmann GG, Böcher WO. Faldaprevir combined with peginterferon alfa-2a and ribavirin in chronic hepatitis C virus genotype-1 patients with prior nonresponse: SILEN-C2 trial. Hepatology 2013; 57: [PMID: DOI: /hep.26386] 60 Sulkowski M, Ceasu E, Asselah T, Caruntu Fa, Lalezari J, Ferenci P, Streinu-Cercel A, Fainboim H, Tanno H, Preotescu L, Leggett B, Bessone F, Mauss S, Stern JO, Hafner C, Datsenko Y, nehmiz G, Bocher W, Steinmann G. Sustained virologic response and safety of BI combined with peginterferon alfa-2a and ribavirin in treatment-naive patients with chronic genotype 1 HCV. J Hepatol 2011; 54 (Suppl 1): S27 61 Lok A, Gardiner D, Hezode C, Lawitz E, Bourliere M, Everson GT, Marcellin P, Rodriguez-Torres M, Pol S, Serfaty L, Eley T, Huang SP, Wind-Rotolo M, McPhee F, Grasela DM, Pasquinelli C. Sustained virologic response in chronic HCV genotype (GT) 1-infected null responders with combination of daclatasvir (DCV; NS5A inhibitor) and asunaprevir (ASV; NS3 inhibitor) with or without peginterferon alfa-2a/ribavirin (PEG/RBV). Boston: AASLD, 2012: Abstract Kowdley KV, Lawitz E, Crespo I, Hassanein T, Davis MN, DeMicco M, Bernstein DE, Afdhal N, Vierling JM, Gordon SC, Anderson JK, Hyland RH, Dvory-Sobol H, An D, Hindes RG, Albanis E, Symonds WT, Berrey MM, Nelson DR, Jacobson IM. Sofosbuvir with pegylated interferon alfa-2a and ribavirin for treatment-naive patients with hepatitis C genotype-1 infection (ATOMIC): an open-label, randomised, multicentre phase 2 trial. Lancet 2013; 381: [PMID: DOI: /S (13) ] 63 Lawitz E, Lalezari JP, Hassanein T, Kowdley KV, Poordad FF, Sheikh AM, Afdhal NH, Bernstein DE, Dejesus E, Freilich B, Nelson DR, Dieterich DT, Jacobson IM, Jensen D, Abrams GA, Darling JM, Rodriguez-Torres M, Reddy KR, Sulkowski MS, Bzowej NH, Hyland RH, Mo H, Lin M, Mader M, Hindes R, Albanis E, Symonds WT, Berrey MM, Muir 2874 March 21, 2014 Volume 20 Issue 11

156 Tovo CV et al. Hepatitis C: Wait for treatment? A. Sofosbuvir in combination with peginterferon alfa-2a and ribavirin for non-cirrhotic, treatment-naive patients with genotypes 1, 2, and 3 hepatitis C infection: a randomised, double-blind, phase 2 trial. Lancet Infect Dis 2013; 13: [PMID: DOI: /S (13) ] 64 Lawitz E, Mangia A, Wyles D, Rodriguez-Torres M, Hassanein T, Gordon SC, Schultz M, Davis MN, Kayali Z, Reddy KR, Jacobson IM, Kowdley KV, Nyberg L, Subramanian GM, Hyland RH, Arterburn S, Jiang D, McNally J, Brainard D, Symonds WT, McHutchison JG, Sheikh AM, Younossi Z, Gane EJ. Sofosbuvir for previously untreated chronic hepatitis C infection. N Engl J Med 2013; 368: [PMID: DOI: /NEJMoa ] 65 Jacobson IM, Gordon SC, Kowdley KV, Yoshida EM, Rodriguez-Torres M, Sulkowski MS, Shiffman ML, Lawitz E, Everson G, Bennett M, Schiff E, Al-Assi MT, Subramanian GM, An D, Lin M, McNally J, Brainard D, Symonds WT, McHutchison JG, Patel K, Feld J, Pianko S, Nelson DR. Sofosbuvir for hepatitis C genotype 2 or 3 in patients without treatment options. N Engl J Med 2013; 368: [PMID: DOI: /NEJMoa ] 66 Jacobson I, Dore GJ, Foster GR, Fried MW, Radu M, Rafalskiy VV, Moroz L, Craxi A, Peeters M, Lenz O, Ouwerkerk- Mahadevan S, Kalmeijer R, Beumont-Mauviel M. Simeprevir (TMC435) with peginterferon/ribavirin for treatment of chronic HCV genotype 1 infection in treatment-naïve patients: results from QUEST-1 a phase III trial. 48th Annual Meeting of the EASL; 2013 April Amsterdam: Netherlands, 2013: Abstract Manns M, Marcellin P, Poordad F, Araujo ESA, Buti M, Horsmans Y, Janczewska EJE, Villamil F, Peeters M, Lenz O, Ouwerkerk-Mahadevan S, Kalmeijer R, Beumont-Mauviel M. Simeprevir (TMC435) with peginterferon/ribavirin for treatment of chronic HCV genotype 1 infection in treatmentnaive patients: results from QUEST-2 a phase III trial. 48th Annual Meeting of the EASL; 2013 April Amsterdam: Netherlands, 2013: Abstract Barritt AS, Fried MW. Maximizing opportunities and avoiding mistakes in triple therapy for hepatitis C virus. Gastroenterology 2012; 142: e1 [PMID: DOI: /j.gastro ] 69 Aloia AL, Locarnini S, Beard MR. Antiviral resistance and direct-acting antiviral agents for HCV. Antivir Ther 2012; 17: [PMID: DOI: /IMP2426] 70 Chae HB, Park SM, Youn SJ. Direct-acting antivirals for the treatment of chronic hepatitis C: open issues and future perspectives. ScientificWorldJournal 2013; 2013: [PMID: DOI: /2013/704912] 71 Liu S, Cipriano LE, Holodniy M, Owens DK, Goldhaber- Fiebert JD. New protease inhibitors for the treatment of chronic hepatitis C: a cost-effectiveness analysis. Ann Intern Med 2012; 156: [PMID: DOI: / ] 72 Aronsohn A, Jensen D. Expanding access to hepatitis C virus care: a call to deconstruct individualized therapy. Hepatology 2014; 59: [PMID: DOI: /hep.26590] 73 Shiffman ML, Benhamou Y. Patients with HCV and F1 and F2 fibrosis stage: treat now or wait? Liver Int 2013; 33 Suppl 1: [PMID: DOI: /liv.12066] 74 Foster GR, Zeuzem S, Andreone P, Pol S, Lawitz EJ, Diago M, Roberts S, Pockros PJ, Younossi Z, Lonjon-Domanec I, De Meyer S, Luo D, George S, Beumont M, Picchio G. Sustained virologic response rates with telaprevir by response after 4 weeks of lead-in therapy in patients with prior treatment failure. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] P- Reviewers: Costantini S, El-Sayed MH, Grasso A, Takaki A S- Editor: Zhai HH L- Editor: A E- Editor: Ma S 2875 March 21, 2014 Volume 20 Issue 11

157 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Hepatitis C-related liver cirrhosis - strategies for the prevention of hepatic decompensation, hepatocarcinogenesis, and mortality Nobuyuki Toshikuni, Tomiyasu Arisawa, Mikihiro Tsutsumi Nobuyuki Toshikuni, Tomiyasu Arisawa, Department of Gastroenterology, Kanazawa Medical University, Ishikawa , Japan Mikihiro Tsutsumi, Department of Hepatology, Kanazawa Medical University, Ishikawa , Japan Author contributions: Toshikuni N wrote this paper; Arisawa T and Tsutsumi M supervised the work. Correspondence to: Nobuyuki Toshikuni, MD, Department of Gastroenterology, Kanazawa Medical University, 1-1 Daigaku, Uchinada-machi, Ishikawa , Japan. n.toshikuni@gmail.com Telephone: Fax: Received: September 22, 2013 Revised: January 14, 2014 Accepted: February 17, 2014 Published online: March 21, 2014 Abstract Liver cirrhosis (LC) is a critical stage of chronic liver disease, including that caused by hepatitis C virus (HCV). In the absence of antiviral therapy, 67%-91% of patients with HCV-related LC patients die of liver-related causes, including hepatocellular carcinoma (HCC) and liver failure. Among the therapeutic strategies used to prevent liver-related complications in these patients is standard therapy with pegylated interferon and ribavirin, which induces a sustained virological response (SVR) in 25% of HCV genotype 1-infected patients and in 69% of patients infected with genotypes 2 and 3. SVR in patients with HCV-related LC has been associated with reduced rates of hepatic decompensation, HCC, and mortality. More recently developed direct-acting antiviral agents have shown excellent antiviral efficacy, with preliminary data demonstrating that an interferon-free regimen that includes these direct-acting antiviral agents achieved SVR in more than 50% of patients with HCV genotype 1 LC. Branched-chain amino acid supplementation, improvement of insulin resistance, and the use of β-blockers for portal hypertension may also reduce liverrelated complications. Here, we review advances in antiviral and adjunctive therapies for improved outcomes in patients with HCV-associated LC Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Liver cirrhosis; Hepatic decompensation; Hepatocellular carcinoma; Mortality; Prevention; Interferon; Direct-acting antiviral agents Core tip: Liver cirrhosis (LC) is the critical stage of hepatitis C virus (HCV)-related chronic liver disease. Many studies of HCV-related LC patients have indicated that sustained virological response (SVR) after interferon therapy is highly associated with reductions in hepatic decompensation, hepatocellular carcinoma incidence, and mortality. Furthermore, direct-acting antiviral agents have shown excellent antiviral efficacy. Preliminary data have indicated that an interferon-free regimen achieved SVR for more than 50% of patients with LC due to HCV genotype 1. Branched-chain amino acid supplementation, improvement of insulin resistance, and the use of β-blockers for portal hypertension may also contribute to a reduction in liver-related complications. Toshikuni N, Arisawa T, Tsutsumi M. Hepatitis C-related liver cirrhosis - strategies for the prevention of hepatic decompensation, hepatocarcinogenesis, and mortality. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2876.htm DOI: org/ /wjg.v20.i INTRODUCTION Hepatitis C virus (HCV) infection is one of the most 2876 March 21, 2014 Volume 20 Issue 11

158 Toshikuni N et al. Hepatitis C-related liver cirrhosis Table 1 Comparison of natural histories among patients with hepatitis B virus-related, hepatitis C virus-related, nonalcoholic steatohepatitis-related, and alcoholic compensated liver cirrhosis Natural history HCV HBV Alcoholic NASH Ref. Hepatic decompensation 5.6% 3.2% [5] 5.6% 4.4% [7] 6.0% 4.5% [11] Hepatocarcinogenesis 2.0% 1.8% [5] 8.3% 3.3% [6] 4.7% 0.6% [7] 6.1% 2.3% [12] Mortality 3.2% 2.8% [5] 6.3% 3.6% [6] 5.1% 4.3% [7] 2.0% 0.4% [11] 5.2% 5.0% [12] All figures are expressed as average annual percentage rates. HBV: Hepatitis B virus; HCV: Hepatitis C virus; NASH: Nonalcoholic steatohepatitis; LC: Liver cirrhosis. serious global health problems. The incidence of HCV infection is increasing, with over 185 million people infected worldwide [1]. Moreover, approximately HCV-infected individuals die of liver-related causes each year [2]. HCV-related liver disease can progress in an insidious manner over several decades. The advanced forms of the disease are liver cirrhosis (LC) and hepatocellular carcinoma (HCC). Approximately 20%-30% of subjects chronically infected with HCV are estimated to develop LC years later [3]. A recent systematic review found that, in HCV-infected patients with compensated LC, 2.8%-11.7% develop hepatic decompensation, 1.8%-8.3% develop HCC, and 2.7%-6.7% die or undergo liver transplantation each year [4]. In the absence of antiviral therapy, 67%-91% of patients with HCV-related LC die due to liver-related causes, including HCC or hepatic failure [5-7]. Hence, LC is a critical stage in HCVrelated chronic liver disease, as is LC due to other causes, including hepatitis B virus (HBV) [8], alcohol abuse [9], and nonalcoholic steatohepatitis (NASH) [10]. Here, we review advances in therapeutic strategies to prevent hepatic decompensation, hepatocarcinogenesis, and mortality in patients with HCV-related LC. OUTCOMES IN PATIENTS WITH HCV-RELATED LC AND THOSE WITH LC DUE TO OTHER CAUSES The outcomes of patients with LC due to HCV differ somewhat from the outcomes of patients with LC due to other causes. Table 1 summarizes the outcomes of patients with LC due to HBV, HCV, alcohol, and NASH. A study of a large Asian population compared outcomes in patients with HCV- and HBV-related compensated LC, none of whom had received any antiviral therapy. HCC (8.3% per year vs 3.3% per year, P < 0.001) and mortality (6.3% per year vs 3.6% per year, P < 0.001) rates were significantly higher in patients with HCV- than HBV-related LC [6]. In contrast, a study in a Caucasian population found that 5-year HCC (10% vs 9%, P = 0.66) and mortality (16% vs 14%, P = 0.89) rates were similar in untreated patients with HCV- and HBV-related LC, although the 5-year rate of hepatic decompensation was significantly higher in the former than in the latter group (28% vs 16%, P = ) [5]. In a study that compared outcomes in untreated Asian patients with HCV- and alcohol-related LC, the rates of hepatic decompensation (5.6% per year vs 4.4% per year, P = 0.77) and mortality (5.1% per year vs 4.3% per year, P = 0.76) did not differ significantly, although the HCC rate was significantly higher in the former group than in the latter group (4.7% per year vs 0.6% per year, P = ) [7]. Furthermore, a recent analysis of a Caucasian population found that the 10-year rates of hepatic decompensation (60% vs 45%, P < 0.007) and death (20% vs 4%, P < 0.004) were significantly higher in patients with HCV- than in patients with NASH-related compensated LC. Analysis of the entire cohort also revealed that HCC rates during the entire follow-period were significantly higher in the former group (17% vs 7%, P < 0.01) [11]. However, in Asian patients, the 5-year HCC (30.5% vs 11.3% at 5 years, P = 0.185) and mortality (26.2% vs 24.8% at 5 years, P = 0.393) rates were similar in patients with HCVand NASH-related LC [12]. Altogether, these studies indicate that the rates of hepatic decompensation, HCC occurrence, and death in patients with LC due to HCV are similar to or higher than the rates in patients with LC due to other causes. RISK FACTORS FOR HEPATIC DECOMPENSATION, HEPATOCARCINOGENESIS, AND MORTALITY Knowledge of the prognostic factors in patients with HCV-related LC is essential for patient management. Hepatic decompensation Hepatic decompensation is generally defined as the development of ascites, jaundice, variceal bleeding, and/or 2877 March 21, 2014 Volume 20 Issue 11

159 Toshikuni N et al. Hepatitis C-related liver cirrhosis Table 2 Antiviral therapies for hepatitis C virus-related liver cirrhosis Antiviral therapy Number of treated patients SVR rate Decompensation 1 HCC 1 Mortality 1 Severe Ref. AE rate 2 IFN-based therapy aiming at SVR IFN monotherapy % for genotype 1; 47.2% for 0.65 (0.31) 0.54 (0.05) [32] others IFN + RBV % for genotype 1b; 80.0% for (0.28) 12.1% [33] others Pegylated IFN + RBV % for genotype 1; 70.8% for 10.5% [26] others % for genotype 1/4; 72.1% 25.0% [28] for genotype 2/ % for genotype 1; 54.9% for 29.6% [36] others Pegylated IFN + RBV + boceprevir 39 (all genotype 1) 59.0% [79] Pegylated IFN + RBV + telaprevir 21 (all genotype 1) 61.9% [24] Pegylated IFN + RBV + simeprevir 83 (all genotype 1) 70%-73% for relapsers; 15%-82% for partial responders; 31%-46% for null responders [82] Pegylated IFN + RBV + mericitabine 21 (genotype 1/4) 38.1% [83] IFN-based therapy after treatment for HCC IFN monotherapy 76 (pure HCV, 42) % [74] Pegylated IFN maintenance therapy [57] 311 (portal hypertension, 39) % [56] Faldaprevir + deleobuvir + RBV 34 (all genotype 1) 57% in patients treated thrice daily; 54% in patients treated twice daily [85] 1 The relative risk reduction of clinical events is expressed as a hazard ratio: total cases (SVR cases); 2 Severe AE rate is expressed as the rate of IFN discontinuation due to adverse events; 3 HCC recurrence in adherent patients with pure HCV; 4 Hepatic decompensation in patients with portal hypertension. HCV: Hepatitis C virus; SVR: Sustained virological response; HCC: Hepatocellular carcinoma; AE: Adverse event; IFN: Interferon; RBV: Ribavirin; DAA: Directacting antiviral agent. hepatic encephalopathy. Factors predictive of hepatic decompensation include low serum albumin levels [5,7,13], elevated serum bilirubin levels [14,15], low platelet counts [5,15], and the presence of esophageal varices [14,15]. Hepatocarcinogenesis Older age [5,15-17], male sex [7,14-17], low serum albumin levels [5,15], low platelet counts [16,17], elevated serum α-fetoprotein levels [7,14,15,17,18], and the absence of interferon (IFN) therapy [18,19] have been found to be independent risk factors for hepatocarcinogenesis. Mortality Low serum albumin levels [5-7,13,14,19], older age [5,15], male sex [5,15], and elevated serum α-fetoprotein levels [6,15] have been found to be independent risk factors for patient mortality. THERAPIES TO PREVENT HEPATIC DECOMPENSATION, HEPATOCARCINOGENESIS, AND MORTALITY Various treatments are used to prevent liver-related complications in patients with HCV-related LC. These methods may be classified as either antiviral or adjunctive therapy. We describe their efficacies and limitations. Antiviral therapy Table 2 lists antiviral therapies for HCV-related LC. IFN-based therapy: Early small randomized controlled studies that examined the efficacy of IFN therapy in patients with HCV-related LC yielded conflicting results [18,20,21]. However, accumulated data have shown favorable outcomes in patients receiving IFN therapy, particularly in patients who achieve a sustained virological response (SVR). IFN therapy targeting an SVR: HCV-related liver disease may be cured by methods that eradicate HCV. IFNbased regimens have been established as definitive and curative treatments for patients with chronic hepatitis C without LC. SVR has proven to be the best surrogate marker for HCV eradication by IFN [22]. IFN therapy targeting an SVR is more challenging in HCV patients with than without LC because of the relatively low response rates and high rates of severe adverse events in patients with LC. Studies in treatment-naïve HCV patients, most of whom had chronic hepatitis without LC, demonstrated that the standard combination therapy with pegylated IFN and ribavirin or triple therapy with pegylated IFN, ribavirin, and a nonstructural protein 3/4A (NS3/4A) protease inhibitor (boceprevir or telaprevir) achieved SVR in 63%-75% [23,24] of patients with HCV genotype 1 and in 79%-93% [25] of patients with genotypes 2 and 2878 March 21, 2014 Volume 20 Issue 11

160 Toshikuni N et al. Hepatitis C-related liver cirrhosis 3. In contrast, a study of treatment-naïve HCV patients with compensated LC found that combination therapy with pegylated IFN and ribavirin achieved SVR in 25% of genotype 1-infected patients and in 69% of patients with genotypes 2 and 3 [26]. Similar results have been reported in other studies that included patients infected with genotypes 1, 2, 3, and 4 and advanced fibrosis/lc [27-30]. Severe adverse events were reported for 14.5% of patients with HCV-related LC who received IFN-based treatments, leading to the discontinuation of therapy [31]. Nevertheless, IFN-based therapy that aims to achieve SVR can provide significant benefits for patients with HCV-related LC. The achievement of SVR is highly associated with reductions in clinical events, including hepatic decompensation, HCC, and mortality. A prospective study of patients with HCV-related LC revealed that those who achieved SVR in response to IFN-α monotherapy had lower risks for HCC (HR = 0.31) and death (HR = 0.05) than untreated patients [32]. Furthermore, clinical trials and cohort studies showed that combination therapy with IFN and ribavirin resulted in significant benefits in patients with HCV-related LC. For example, patients who achieved SVR with the combination of IFN-α2b and ribavirin had a significantly lower cumulative 4-year rate of HCC than patients who did not achieve SVR (8% vs 28%, P = 0.018) [33]. In a randomized controlled study in which most LC patients were infected with HCV genotype 1b, the SVR rate tended to be higher in patients treated with pegylated IFN-α2b and ribavirin than in those treated with pegylated IFNα2b alone (21.6% vs 9.8%, P = 0.06), and the rates of liver-related events, including hepatic decompensation and HCC occurrence, were significantly lower in patients who did than did not achieve SVR (P = 0.03) [34]. A recent study analyzing the relationship between response to combination treatment with pegylated IFN and ribavirin and outcomes in HCV patients, more than half of whom had LC, reported that non-achievement of SVR was an independent risk factor for HCC (HR = 3.06), liver-related complications (HR = 4.73), and liver-related mortality (HR = 3.71) [35]. Moreover, a retrospective study involving a large number of patients with HCV-related LC who received pegylated IFN and ribavirin showed that the 5-year event-free survival (91% vs 59%, P < 0.001) and overall survival (98% vs 86%, P = 0.005) rates were significantly higher in patients who did than did not achieve SVR [36]. Meta-analyses have revealed that SVR after IFN therapy significantly reduced the rate of HCC in HCV patients with and without LC [37-39]. Some data have suggested that SVR after IFN therapy can cause reversal of liver fibrosis. In studies that compared the histological findings of liver biopsy specimens between pre- and post-ifn therapy, 44%-66% of HCV-related LC patients who achieved SVR had regression of LC [40-42]. In support of these results, SVR was reported to prevent or delay the de novo onset of esophageal varices in patients with compensated HCV-related LC [43]. LC patients generally have reduced daily activity levels owing to impaired physical and neurocognitive functions [44-46]. As with LC due to other causes, neurocognitive impairment in patients with HCV-related LC has thus far been considered as a sign of hepatic encephalopathy due to liver disease progression. However, recent evidence has suggested that HCV infection per se also can impair neurocognitive function, regardless of the presence or absence of LC. In a recent study that supports the hypothesis that HCV may directly induce neurocognitive impairment, investigators not only detected HCV RNA in brain tissue of individuals infected with HCV but also noted that brain microvascular endothelia and brain endothelial cells expressed all of the major HCV entry receptors [47]. Furthermore, results from a recent study that investigated the effects of combination treatment with pegylated IFN and ribavirin on neurocognitive function in HCV patients revealed that patients who achieved SVR had improved cerebral metabolism and neurocognitive function [48]. Thus, SVR may contribute to the improvement of neurocognitive function in HCV patients, including LC patients, and may lead to increased daily activity levels. Although HCV patients who achieve SVR as a result of IFN-based therapy have the most favorable outcomes, there is evidence that a subset of patients without SVR may achieve equivalent outcomes. An elevated serum α-fetoprotein level has been shown to be an independent risk factor for HCC in patients with HCVrelated LC [7,14,15,17,18]. Thus, therapies that reduce serum α-fetoprotein levels may prevent hepatocarcinogenesis in these patients. A recent study involving a large cohort of Japanese patients with chronic HCV infection, including patients with LC, who were treated with IFN, found that the cumulative rate of HCC was significantly lower in patients with post-treatment serum α-fetoprotein levels below 6.0 ng/ml, even if these patients did not achieve SVR [49]. Conversely, the rate of HCC was significantly higher in patients with post-treatment serum α-fetoprotein levels 10 ng/ml, even if they achieved SVR. Little is known about the relationship between post-ifn serum α-fetoprotein levels and HCC in patients with HCV-related LC, which suggests a need for future studies to assess this relationship. Thus, in conclusion, IFN-based therapy that aims to achieve SVR presents definite advantages for patients with HCV-related LC, although many of these patients may experience severe adverse events during therapy. A recent large retrospective analysis of LC patients with HCV genotype 1 who underwent IFN therapy determined that SVR was associated with reduced all-cause mortality (HR = 0.15) and clinical disease progression (HR = 0.16) [50]. This analysis also estimated that the number needed to treat to prevent clinical endpoints in those patients has markedly declined in relation to the improvement of antiviral therapy over five years, i.e., from 302 at 2% SVR (IFN monotherapy) to 13 at 35% SVR (pegylated 2879 March 21, 2014 Volume 20 Issue 11

161 Toshikuni N et al. Hepatitis C-related liver cirrhosis IFN and ribavirin). Nonetheless, long-term surveillance is essential because even patients who achieve SVR have a long-term risk of hepatocarcinogenesis [51]. Maintenance therapy with pegylated IFN: Despite recent advances in IFN-based therapy, the overall SVR rate in patients with HCV-related LC has been reported to be only approximately 30% [52]. Long-term, low-dose pegylated IFN maintenance therapy was therefore advised for patients who do not achieve SVR. An early randomized trial of maintenance pegylated IFN-α2a in patients with HCV-related compensated LC did not demonstrate significantly enhanced complication-free 12- and 24-mo survival rates, which were 98% and 72.3%, respectively, in treated patients and 90% and 70.7%, respectively, in untreated patients (P = 0.59) [53]. Three independent mega-trials were conducted subsequently to evaluate the efficacy of maintenance pegylated IFN in HCV patients with advanced hepatitis or LC who had failed to achieve SVR with IFN therapy: the Colchicine Versus PegIntron Long-term Therapy (COPILOT) trial [54] ; the Hepatitis C Antiviral Long-term Treatment Against Cirrhosis (HALT-C) trial [55] ; and the Evaluation of PegIntron in Control of Hepatitis C Cirrhosis (EPIC) [56]. The CO- PILOT trial, which included HCV patients with Ishak stages 3-6 who were randomized to treatment with pegylated IFN-α2b or colchicine identified no significant between-group differences in rates of liver-related complications and mortality/liver transplantation, although complications of portal hypertension, mainly variceal bleeding, occurred more frequently in the colchicine group than in the pegylated IFN-α2b group [54]. In the HALT-C trial, approximately 40% of HCV patients had LC, while the remaining patients had advanced chronic hepatitis; all the patients were randomly assigned to either the pegylated IFN-α2a group or the control group. The rates of clinical events, including hepatic decompensation, HCC occurrence, and mortality, were similar in the pegylated IFN-α2a and control groups (34.1% vs 33.8%, P = 0.90) [55]. After a long-term follow-up (median, 6.1 years), the rate of HCC in patients with LC, but not those with fibrosis, was significantly lower in the treatment group than in the control group (7.8% vs 24.2% at 7 years, P = 0.009, HR = 0.45) [57]. In the EPIC 3 trial, all participants had compensated HCV-related LC and were randomly assigned to pegylated IFN-α2b or a control group. The overall rates of clinical events (9% vs 11%, P = 0.14) and HCC were similar in both groups. However, among patients with portal hypertension, the clinical event rate was significantly lower in the pegylated IFNα2b group than in the control group (10% vs 33%, P = 0.016), primarily because of differences in the rates of ascites and variceal bleeding [56]. In summary, these megatrials did not show any overall benefits of maintenance pegylated IFN therapy in patients with HCV-related LC. However, these trial results suggested that certain subsets of patients might benefit from treatment. Combination of statins with IFN-based therapy: The HCV life cycle is unique in that its replication is highly associated with host lipid metabolisms: HCV circulates as lipo-viro particles that contain HCV core protein, cholesterol, triglyceride, and apolipoproteins B and E [58]. HCV-associated cholesterol plays a key role in virion maturation and infectivity [59]. HCV replicates by a mechanism in which the HCV NS5A protein binds to a host geranylgeranylated cellular protein, FBL2 [60]. Statins inhibit the synthesis of cholesterol and geranylgeranylated proteins, suggesting that statins may inhibit HCV replication. Notably, although statin monotherapy was reported to have no or little antiviral effect in HCV patients [61-63], the addition of statin to IFN-based therapy may enhance the efficacy of the latter [64-66]. In a retrospective study involving a large number of patients, multivariate analysis revealed that the addition of statin to pegylated IFN and ribavirin was an independent factor that contributed to a higher SVR rate [67]. A recent metaanalysis of randomized controlled trials found that statin supplementation increased SVR (OR = 2.02) without additional adverse events observed in HCV patients treated with IFN-based therapy [66]. Thus, statin supplementation may be a promising method to enhance the efficacy of standard IFN-based therapy, particularly for patients with HCV genotype 1 and/or contraindications to protease inhibitors [66]. Further studies are needed to establish the efficacy of these combinations in patients with LC. IFN therapy after curative treatment of HCC: Frequent recurrence following curative treatment, such as surgical resection and radiofrequency ablation, is a major issue in the treatment of HCV-related HCC [68,69]. Because IFN reduces the incidence of HCC in HCV patients, clinical trials have addressed whether IFN-based therapy might reduce the recurrence of HCV-related HCC after curative therapy. Earlier randomized controlled trials with small numbers of HCV patients suggested that IFN-α or IFN-β monotherapy might prevent HCC recurrence after curative treatment of HCC [70-73]. In contrast, a randomized controlled study of HCV-related LC patients with HCC reported that adjuvant IFN-α monotherapy after surgical resection failed to reduce overall HCC recurrence, although it reduced late HCC recurrence [74]. Two retrospective studies with small numbers of patients suggested that pegylated IFN-based therapy after curative treatment may increase survival rates for patients with HCV-related HCC and that SVR after IFN therapy may contribute to prolonged patient survival [75,76]. Furthermore, a recent study involving a large number of patients with HCV-related HCC showed that adjuvant therapy with pegylated IFN-α (either 2a or 2b) and ribavirin significantly decreased the rate of HCC recurrence after surgical resection (HR = 0.64) [77]. Taken together, these results indicate that standard pegylated IFN-based therapy may prevent HCC recurrence and mortality after curative treatment of HCC March 21, 2014 Volume 20 Issue 11

162 Toshikuni N et al. Hepatitis C-related liver cirrhosis Studies that focus on patients with HCV-related LC and HCC are warranted to confirm its efficacy. In particular, the relationship between SVR after therapy and the rate of HCC recurrence should be clarified. Direct-acting antiviral agents: IFN-based therapy has limitations, including its relatively low efficacy in patients infected with HCV genotype 1 and its capacity to cause severe adverse events, particularly in patients with HCVrelated LC [26,31]. Hence, more effective, less toxic antiviral agents are urgently needed to manage HCV patients. In recent years, direct-acting antiviral agents (DAAs), including NS3/4A protease inhibitors, NS5A inhibitors, and NS5B polymerase inhibitors, have been developed, and their efficacy and safety have been tested in many clinical trials [78]. Boceprevir and telaprevir are first-generation NS3/4A protease inhibitors and have been used combined with pegylated IFN and ribavirin in the antiviral therapy for HCV patients. Recent randomized controlled trials have demonstrated that triple therapy with pegylated IFN, ribavirin, and boceprevir or telaprevir resulted in a higher SVR rate than the combination of pegylated IFN and ribavirin in HCV genotype 1 patients with advanced fibrosis or LC (40%-68% vs 10%-39%, respectively) [24,79,80]. A large population-based study verified the high efficacy of the triple therapy wherein an SVR rate of 42.7% was reported in HCV genotype 1 patients with LC [81]. Furthermore, several clinical trials with other DAAs for HCV-related LC patients suggested promising results. In a phase 2b trial, previously treated patients with HCV genotype 1, including those with LC, were treated with pegylated IFN, ribavirin, and simeprevir (a NS3/4A protease inhibitor) or pegylated IFN and ribavirin. The SVR rate at 24 wk was generally higher in the triple than in the combination therapy group. Among LC patients, the SVR rates were 70%-73% in relapsed patients, 15%-82% in partial responders, and 31%-46% in null responders [82]. In another phase 2 trial of previously untreated patients with HCV genotype 1 or 4, including patients with LC, the SVR rates in response to triple therapy with pegylated IFN, ribavirin, and mericitabine (a nucleoside analog NS5B polymerase inhibitor) and to combination therapy with pegylated IFN and ribavirin in patients with LC were 38.1% and 21.7%, respectively [83]. The phase 2b Safety and Antiviral Effect of Oral Combinations without Interferon in Patients Diagnosed with Hepatitis C (SOUND-C2) trial tested the efficacy and safety of faldaprevir (a NS3/4A protease inhibitor), deleobuvir (a non-nucleoside NS5B polymerase inhibitor), and ribavirin in previously untreated HCV genotype 1 patients [84]. This trial was the first to report results from patients with HCV-related LC who were treated with an IFN-free regimen. Interim analysis revealed that SVR rates were 57% in patients treated three times daily and 54% in patients treated twice daily [85]. Moreover, fewer than 10% of the latter group discontinued treatment due to adverse events. Clinical trials evaluating the efficacy and safety of antiviral DAAs in HCV-infected patients have only recently begun. Although future studies are required, the high SVR rates reported in patients with HCV-related LC treated with DAA(s)-containing regimens suggest that these treatments may reduce or prevent liver-related complications and deaths. Adjunctive therapy Although antiviral therapy plays a central role in the prevention of hepatic decompensation, hepatocarcinogenesis, and mortality in patients with HCV-related LC, not all such patients may benefit from these treatments, whether due to poor response and/or severe adverse events. However, several adjunctive therapies may prevent liver-related complications in these patients. Branched-chain amino acid supplementation: Analyses of factors that are prognostic of clinical outcomes in patients with HCV-related LC have suggested that low serum albumin levels are highly associated with hepatic decompensation and HCC [5,7,13], suggesting that agents that maintain or increase serum albumin concentrations may improve patient outcomes. Protein-energy malnutrition is frequent in patients with LC and is characterized by low serum albumin concentrations and decreased skeletal muscle volume [86]. Moreover, serum concentrations of branched chain amino acids (BCAAs) are low in LC patients because large amounts of BCAAs must be consumed for ammonia detoxification [87] and energy generation [88]. Experimental and clinical studies have revealed that BCAA supplementation increases serum albumin concentrations and improves protein malnutrition [86]. Based on these findings, clinical trials were performed to determine whether longterm BCAA supplementation might improve event-free survival and overall survival in patients with LC. An early randomized clinical trial in patients with decompensated LC suggested that long-term BCAA supplementation is useful in preventing progressive hepatic failure [89]. Furthermore, a large randomized controlled trial, in which approximately two-thirds of the enrolled patients had HCV-related LC, found that long-term BCAA supplementation increased serum albumin concentrations and was significantly associated with decreases in hepatic failure and mortality [90]. Subgroup analysis showed that the benefits of BCAA treatment in patients with HCV-related LC were similar to those in the entire patient cohort. BCAA supplementation may also prevent HCC occurrence. For example, although a phase 2 randomized controlled trial involving patients with compensated HCV-related LC found no significant difference in HCC occurrence between the BCAA and control groups, subgroup analysis demonstrated that the HCC rate tended to be lower in patients with serum albumin levels < 4.0 g/dl who were assigned to the BCAA group [91]. A recent retrospective study examined the usefulness of BCAA supplementation in preventing hepatocarcinogenesis. Following one-to-one matching of propensity scores, 2881 March 21, 2014 Volume 20 Issue 11

163 Toshikuni N et al. Hepatitis C-related liver cirrhosis the BCAA group had a significantly lower rate of HCC occurrence than the control group (P = 0.032) [92]. Collectively, long-term BCAA supplementation may be a promising method for improving event-free survival and overall survival in patients with HCV-related LC. However, to date, the data remain insufficient, particularly regarding whether BCAA supplementation can prevent hepatocarcinogenesis. Moreover, the timing of BCAA treatment to obtain maximum benefits in patients with HCV-related LC is unclear, although the results of a randomized controlled trial suggested that patients with molar ratios of BCAA to tyrosine (BTR) < 4 undergo BCAA treatment even if they have compensated LC [93]. Further prospective studies are needed to assess the efficacy of BCAA supplementation in the treatment of patients with HCV-related LC. Improvement of insulin resistance: Insulin resistance (IR) is commonly observed in HCV patients, with prevalence rates ranging from 30% to 70% [94]. Virus- and host-related mechanisms have been associated with IR in HCV patients. Accumulated evidence has shown that HCV infection per se induces IR. The HCV core protein activates suppression of cytokine signaling 3, which causes proteasomal degradation of insulin receptor substrates 1 and 2 and inhibits the translocation of glucose transporter 4, thereby resulting in IR. In addition, increases in inflammatory cytokines, such as tumor necrosis factor α and interleukin 6, and decreases in adiponectin may directly cause IR [94,95]. Furthermore, the rates of overweight and obesity are increasing worldwide, with 39%-42% of HCV patients having body mass indices (BMIs) 25 kg/m 2[96,97]. Overweight can cause IR, and many LC patients are overweight. A recent study that examined the nutritional state of Japanese patients with compensated HCV-related LC found that 72.4% of these patients had excess energy and protein intake [98]. The development of IR in HCV patients can cause serious problems, including the progression of fibrosis and enhanced hepatocarcinogenesis. The degrees of IR and hepatic fibrosis are closely related [96,99,100]. A recent study of patients with HCV-related compensated LC demonstrated that a high homeostasis model assessment (HOMA)-IR score could predict the presence of esophageal varices, a manifestation of portal hypertension induced by the progression of fibrosis [101]. IR is largely responsible for the development of type 2 diabetes. A recent meta-analysis found that type 2 diabetes is highly associated with the risk of HCC (summary relative risks, 2.01) [102]. A study in patients with HCV-related or alcoholic LC indicated that overweight and type 2 diabetes correlated significantly with an increased risk of HCC occurrence [103]. Furthermore, a multivariate analysis of results in patients with HCV found that type 2 diabetes was predictive of the development of HCC in Ishak 6 LC patients (HR = 3.28) [104]. IR-associated problems in HCV patients may be prevented or reduced by lifestyle modifications such as improvements in dietary habits, although the therapeutic effects of diet require confirmation. Little is known about the efficacy of medical treatments to improve IR. A large case-control study, in which nearly 40% of the enrolled patients with HCC or LC were infected with HCV, suggested that treatment with metformin, an insulin-sensitizing agent used to treat patients with type 2 diabetes, was associated with a reduced risk of HCC [105]. Moreover, multivariate analysis of the results of a recent prospective study of patients with HCV-related LC and type 2 diabetes found that metformin treatment was independently associated with decreases in HCC occurrence (HR = 0.19) and liver-related death/liver transplantation (HR = 0.22) [106]. Lifestyle modification and treatment with insulin-sensitizing agents may contribute to improved outcomes in patients with HCV-related LC. Extensive efforts should be made to assess the effectiveness of these therapeutic strategies. β-blockers: LC-associated portal hypertension is the driving force behind hepatic decompensation, including variceal bleeding and the development of ascites. Nonselective β-blockers reduce portal venous pressure by reducing cardiac output via the blockage of β1 receptors, produce splanchnic vasoconstriction, and reduce portal flow via the blockage of β2 receptors [107]. Therefore, many studies have assessed the capacity of β-blockers to prevent hepatic decompensation. These agents were shown to prevent variceal bleeding in patients with LC, regardless of the LC etiology [108], although another study found that β-blockers did not prevent variceal formation [109]. Recent studies suggested that carvedilol is superior to propranolol in preventing variceal bleeding [110]. Moreover, a recent study that assessed the capacity of nadolol to prevent ascites in patients with compensated LC complicated with esophageal varices, 75% of whom were infected with HCV, found that a 10% reduction in hepatic venous pressure gradient significantly reduced the risk of the development of ascites and other related complications, such as refractory ascites and hepatorenal syndrome [111]. Because studies have suggested that β-blockers have anticancer effects [112], a retrospective study examined whether propranolol treatment can prevent HCC occurrence in compensated patients with HCV-related LC. Multivariate analysis showed that propranolol treatment was associated with a decreased risk of HCC occurrence (HR = 0.25) and was the only factor independently predictive of HCC in patients with esophageal varices (HR = 0.16) [113]. These results encourage prospective studies to examine the potential of β-blockers to prevent hepatocarcinogenesis. Thus, accumulated evidence supports the usefulness of β-blockers in preventing liver-related complications in LC patients, including those with HCV. However, from a practical standpoint, there are some limitations to β-blocker treatment. Approximately 50% of patients are nonresponders [111]. Although measurement of the 2882 March 21, 2014 Volume 20 Issue 11

164 Toshikuni N et al. Hepatitis C-related liver cirrhosis hepatic venous pressure gradient can best distinguish responders from nonresponders [107], this assessment cannot easily be performed in routine practice. Other limitations include contraindications to β-blockers and limited tolerability to these agents due to adverse effects, such as general fatigue and lightheadedness. CONCLUSION Substantial progress has been made in the development of treatment regimens to prevent liver-related complications and mortality in patients with HCV-related LC. However, treatment results are not completely satisfactory. The key to improved results is the development of more effective, less toxic antiviral agents that can achieve SVR. With regard to antiviral therapy for chronic HCV infection, we are transitioning from the IFN into the DAA era [114]. We anticipate that this new era, along with the DAAs being developed, will enhance outcomes in patients with HCV-related LC. REFERENCES 1 Mohd Hanafiah K, Groeger J, Flaxman AD, Wiersma ST. Global epidemiology of hepatitis C virus infection: new estimates of age-specific antibody to HCV seroprevalence. Hepatology 2013; 57: [PMID: DOI: / hep.26141] 2 Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 2006; 45: [PMID: DOI: / j.jhep ] 3 Alberti A, Chemello L, Benvegnù L. Natural history of hepatitis C. J Hepatol 1999; 31 Suppl 1: [PMID: ] 4 Alazawi W, Cunningham M, Dearden J, Foster GR. Systematic review: outcome of compensated cirrhosis due to chronic hepatitis C infection. Aliment Pharmacol Ther 2010; 32: [PMID: DOI: /j x] 5 Fattovich G, Pantalena M, Zagni I, Realdi G, Schalm SW, Christensen E. Effect of hepatitis B and C virus infections on the natural history of compensated cirrhosis: a cohort study of 297 patients. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 6 Kobayashi M, Ikeda K, Hosaka T, Sezaki H, Someya T, Akuta N, Suzuki F, Suzuki Y, Saitoh S, Arase Y, Miyakawa Y, Kumada H. Natural history of compensated cirrhosis in the Child-Pugh class A compared between 490 patients with hepatitis C and 167 with B virus infections. J Med Virol 2006; 78: [PMID: DOI: /jmv.20562] 7 Toshikuni N, Izumi A, Nishino K, Inada N, Sakanoue R, Yamato R, Suehiro M, Kawanaka M, Yamada G. Comparison of outcomes between patients with alcoholic cirrhosis and those with hepatitis C virus-related cirrhosis. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: / j x] 8 Wilt TJ, Shamliyan T, Shaukat A, Taylor BC, MacDonald R, Yuan JM, Johnson JR, Tacklind J, Rutks I, Kane RL. Management of chronic hepatitis B. Evid Rep Technol Assess (Full Rep) 2008; (174): [PMID: ] 9 Schwartz JM, Reinus JF. Prevalence and natural history of alcoholic liver disease. Clin Liver Dis 2012; 16: [PMID: DOI: /j.cld ] 10 Duvnjak M, Lerotić I, Barsić N, Tomasić V, Virović Jukić L, Velagić V. Pathogenesis and management issues for nonalcoholic fatty liver disease. World J Gastroenterol 2007; 13: [PMID: ] 11 Sanyal AJ, Banas C, Sargeant C, Luketic VA, Sterling RK, Stravitz RT, Shiffman ML, Heuman D, Coterrell A, Fisher RA, Contos MJ, Mills AS. Similarities and differences in outcomes of cirrhosis due to nonalcoholic steatohepatitis and hepatitis C. Hepatology 2006; 43: [PMID: DOI: /hep.21103] 12 Yatsuji S, Hashimoto E, Tobari M, Taniai M, Tokushige K, Shiratori K. Clinical features and outcomes of cirrhosis due to non-alcoholic steatohepatitis compared with cirrhosis caused by chronic hepatitis C. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 13 Hu KQ, Tong MJ. The long-term outcomes of patients with compensated hepatitis C virus-related cirrhosis and history of parenteral exposure in the United States. Hepatology 1999; 29: [PMID: DOI: /hep ] 14 Sangiovanni A, Prati GM, Fasani P, Ronchi G, Romeo R, Manini M, Del Ninno E, Morabito A, Colombo M. The natural history of compensated cirrhosis due to hepatitis C virus: A 17-year cohort study of 214 patients. Hepatology 2006; 43: [PMID: DOI: /hep.21176] 15 Bruno S, Zuin M, Crosignani A, Rossi S, Zadra F, Roffi L, Borzio M, Redaelli A, Chiesa A, Silini EM, Almasio PL, Maisonneuve P. Predicting mortality risk in patients with compensated HCV-induced cirrhosis: a long-term prospective study. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 16 Degos F, Christidis C, Ganne-Carrie N, Farmachidi JP, Degott C, Guettier C, Trinchet JC, Beaugrand M, Chevret S. Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death. Gut 2000; 47: [PMID: ] 17 Ikeda K, Arase Y, Saitoh S, Kobayashi M, Someya T, Hosaka T, Akuta N, Suzuki Y, Suzuki F, Sezaki H, Kumada H, Tanaka A, Harada H. Prediction model of hepatocarcinogenesis for patients with hepatitis C virus-related cirrhosis. Validation with internal and external cohorts. J Hepatol 2006; 44: [PMID: DOI: /j.jhep ] 18 Gramenzi A, Andreone P, Fiorino S, Cammà C, Giunta M, Magalotti D, Cursaro C, Calabrese C, Arienti V, Rossi C, Di Febo G, Zoli M, Craxì A, Gasbarrini G, Bernardi M. Impact of interferon therapy on the natural history of hepatitis C virus related cirrhosis. Gut 2001; 48: [PMID: ] 19 Serfaty L, Aumaître H, Chazouillères O, Bonnand AM, Rosmorduc O, Poupon RE, Poupon R. Determinants of outcome of compensated hepatitis C virus-related cirrhosis. Hepatology 1998; 27: [PMID: DOI: / hep ] 20 Nishiguchi S, Kuroki T, Nakatani S, Morimoto H, Takeda T, Nakajima S, Shiomi S, Seki S, Kobayashi K, Otani S. Randomised trial of effects of interferon-alpha on incidence of hepatocellular carcinoma in chronic active hepatitis C with cirrhosis. Lancet 1995; 346: [PMID: ] 21 Valla DC, Chevallier M, Marcellin P, Payen JL, Trepo C, Fonck M, Bourliere M, Boucher E, Miguet JP, Parlier D, Lemonnier C, Opolon P. Treatment of hepatitis C virus-related cirrhosis: a randomized, controlled trial of interferon alfa-2b versus no treatment. Hepatology 1999; 29: [PMID: DOI: /hep ] 22 Maylin S, Martinot-Peignoux M, Moucari R, Boyer N, Ripault MP, Cazals-Hatem D, Giuily N, Castelnau C, Cardoso AC, Asselah T, Féray C, Nicolas-Chanoine MH, Bedossa P, Marcellin P. Eradication of hepatitis C virus in patients successfully treated for chronic hepatitis C. Gastroenterology 2008; 135: [PMID: DOI: / j.gastro ] 23 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype March 21, 2014 Volume 20 Issue 11

165 Toshikuni N et al. Hepatitis C-related liver cirrhosis infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 24 Jacobson IM, McHutchison JG, Dusheiko G, Di Bisceglie AM, Reddy KR, Bzowej NH, Marcellin P, Muir AJ, Ferenci P, Flisiak R, George J, Rizzetto M, Shouval D, Sola R, Terg RA, Yoshida EM, Adda N, Bengtsson L, Sankoh AJ, Kieffer TL, George S, Kauffman RS, Zeuzem S. Telaprevir for previously untreated chronic hepatitis C virus infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJ- Moa ] 25 Zeuzem S, Hultcrantz R, Bourliere M, Goeser T, Marcellin P, Sanchez-Tapias J, Sarrazin C, Harvey J, Brass C, Albrecht J. Peginterferon alfa-2b plus ribavirin for treatment of chronic hepatitis C in previously untreated patients infected with HCV genotypes 2 or 3. J Hepatol 2004; 40: [PMID: DOI: /j.jhep ] 26 Roffi L, Colloredo G, Pioltelli P, Bellati G, Pozzpi M, Parravicini P, Bellia V, Del Poggio P, Fornaciari G, Ceriani R, Ramella G, Corradi C, Rossini A, Bruno S. Pegylated interferonalpha2b plus ribavirin: an efficacious and well-tolerated treatment regimen for patients with hepatitis C virus related histologically proven cirrhosis. Antivir Ther 2008; 13: [PMID: ] 27 Helbling B, Jochum W, Stamenic I, Knöpfli M, Cerny A, Borovicka J, Gonvers JJ, Wilhelmi M, Dinges S, Müllhaupt B, Esteban A, Meyer-Wyss B, Renner EL. HCV-related advanced fibrosis/cirrhosis: randomized controlled trial of pegylated interferon alpha-2a and ribavirin. J Viral Hepat 2006; 13: [PMID: DOI: /j x] 28 Floreani A, Baldo V, Rizzotto ER, Carderi I, Baldovin T, Minola E. Pegylated interferon alpha-2b plus ribavirin for naive patients with HCV-related cirrhosis. J Clin Gastroenterol 2008; 42: [PMID: DOI: / MCG.0b013e318046ea75] 29 Bruno S, Shiffman ML, Roberts SK, Gane EJ, Messinger D, Hadziyannis SJ, Marcellin P. Efficacy and safety of peginterferon alfa-2a (40KD) plus ribavirin in hepatitis C patients with advanced fibrosis and cirrhosis. Hepatology 2010; 51: [PMID: DOI: /hep.23340] 30 Prati GM, Aghemo A, Rumi MG, D Ambrosio R, De Nicola S, Donato MF, Degasperi E, Colombo M. Hyporesponsiveness to PegIFNα2B plus ribavirin in patients with hepatitis C-related advanced fibrosis. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 31 Bota S, Sporea I, Sirli R, Popescu A, Neghină AM, Dănilă M, Străin M. Severe adverse events during antiviral therapy in hepatitis C virus cirrhotic patients: A systematic review. World J Hepatol 2013; 5: [PMID: DOI: /wjh. v5.i3.120] 32 Shiratori Y, Ito Y, Yokosuka O, Imazeki F, Nakata R, Tanaka N, Arakawa Y, Hashimoto E, Hirota K, Yoshida H, Ohashi Y, Omata M. Antiviral therapy for cirrhotic hepatitis C: association with reduced hepatocellular carcinoma development and improved survival. Ann Intern Med 2005; 142: [PMID: ] 33 Hung CH, Lee CM, Lu SN, Wang JH, Hu TH, Tung HD, Chen CH, Chen WJ, Changchien CS. Long-term effect of interferon alpha-2b plus ribavirin therapy on incidence of hepatocellular carcinoma in patients with hepatitis C virusrelated cirrhosis. J Viral Hepat 2006; 13: [PMID: DOI: /j x] 34 Di Marco V, Almasio PL, Ferraro D, Calvaruso V, Alaimo G, Peralta S, Di Stefano R, Craxì A. Peg-interferon alone or combined with ribavirin in HCV cirrhosis with portal hypertension: a randomized controlled trial. J Hepatol 2007; 47: [PMID: DOI: /j.jhep ] 35 Cardoso AC, Moucari R, Figueiredo-Mendes C, Ripault MP, Giuily N, Castelnau C, Boyer N, Asselah T, Martinot- Peignoux M, Maylin S, Carvalho-Filho RJ, Valla D, Bedossa P, Marcellin P. Impact of peginterferon and ribavirin therapy on hepatocellular carcinoma: incidence and survival in hepatitis C patients with advanced fibrosis. J Hepatol 2010; 52: [PMID: DOI: /j.jhep ] 36 Fernández-Rodríguez CM, Alonso S, Martinez SM, Forns X, Sanchez-Tapias JM, Rincón D, Rodriguez-Caravaca G, Bárcena R, Serra MA, Romero-Gómez M, Fernandez I, Garcia- Samaniego J, Fuente J, Solá R, Moreno-Otero R, Planas R. Peginterferon plus ribavirin and sustained virological response in HCV-related cirrhosis: outcomes and factors predicting response. Am J Gastroenterol 2010; 105: ; quiz 2173 [PMID: DOI: /ajg ] 37 Papatheodoridis GV, Papadimitropoulos VC, Hadziyannis SJ. Effect of interferon therapy on the development of hepatocellular carcinoma in patients with hepatitis C virusrelated cirrhosis: a meta-analysis. Aliment Pharmacol Ther 2001; 15: [PMID: ] 38 Singal AK, Singh A, Jaganmohan S, Guturu P, Mummadi R, Kuo YF, Sood GK. Antiviral therapy reduces risk of hepatocellular carcinoma in patients with hepatitis C virus-related cirrhosis. Clin Gastroenterol Hepatol 2010; 8: [PMID: DOI: /j.cgh ] 39 Morgan RL, Baack B, Smith BD, Yartel A, Pitasi M, Falck- Ytter Y. Eradication of hepatitis C virus infection and the development of hepatocellular carcinoma: a meta-analysis of observational studies. Ann Intern Med 2013; 158: [PMID: DOI: / ] 40 Poynard T, McHutchison J, Manns M, Trepo C, Lindsay K, Goodman Z, Ling MH, Albrecht J. Impact of pegylated interferon alfa-2b and ribavirin on liver fibrosis in patients with chronic hepatitis C. Gastroenterology 2002; 122: [PMID: ] 41 Mallet V, Gilgenkrantz H, Serpaggi J, Verkarre V, Vallet- Pichard A, Fontaine H, Pol S. Brief communication: the relationship of regression of cirrhosis to outcome in chronic hepatitis C. Ann Intern Med 2008; 149: [PMID: ] 42 D'Ambrosio R, Aghemo A, Rumi MG, Ronchi G, Donato MF, Paradis V, Colombo M, Bedossa P. A morphometric and immunohistochemical study to assess the benefit of a sustained virological response in hepatitis C virus patients with cirrhosis. Hepatology 2012; 56: [PMID: DOI: /hep.25606] 43 D'Ambrosio R, Aghemo A, Rumi MG, Primignani M, Dell Era A, Lampertico P, Donato MF, De Nicola S, Prati GM, de Franchis R, Colombo M. The course of esophageal varices in patients with hepatitis C cirrhosis responding to interferon/ribavirin therapy. Antivir Ther 2011; 16: [PMID: DOI: /IMP1807] 44 Hayashi F, Momoki C, Yuikawa M, Simotani Y, Kawamura E, Hagihara A, Fujii H, Kobayashi S, Iwai S, Morikawa H, Enomoto M, Tamori A, Kawada N, Ohfuji S, Fukusima W, Habu D. Nutritional status in relation to lifestyle in patients with compensated viral cirrhosis. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 45 Perry W, Hilsabeck RC, Hassanein TI. Cognitive dysfunction in chronic hepatitis C: a review. Dig Dis Sci 2008; 53: [PMID: DOI: /s z] 46 Weissenborn K, Tryc AB, Heeren M, Worthmann H, Pflugrad H, Berding G, Bokemeyer M, Tillmann HL, Goldbecker A. Hepatitis C virus infection and the brain. Metab Brain Dis 2009; 24: [PMID: DOI: / s ] 47 Fletcher NF, Wilson GK, Murray J, Hu K, Lewis A, Reynolds GM, Stamataki Z, Meredith LW, Rowe IA, Luo G, Lopez- Ramirez MA, Baumert TF, Weksler B, Couraud PO, Kim KS, Romero IA, Jopling C, Morgello S, Balfe P, McKeating JA. Hepatitis C virus infects the endothelial cells of the bloodbrain barrier. Gastroenterology 2012; 142: e6 [PMID: DOI: /j.gastro ] 48 Byrnes V, Miller A, Lowry D, Hill E, Weinstein C, Alsop 2884 March 21, 2014 Volume 20 Issue 11

166 Toshikuni N et al. Hepatitis C-related liver cirrhosis D, Lenkinski R, Afdhal NH. Effects of anti-viral therapy and HCV clearance on cerebral metabolism and cognition. J Hepatol 2012; 56: [PMID: DOI: / j.jhep ] 49 Asahina Y, Tsuchiya K, Nishimura T, Muraoka M, Suzuki Y, Tamaki N, Yasui Y, Hosokawa T, Ueda K, Nakanishi H, Itakura J, Takahashi Y, Kurosaki M, Enomoto N, Nakagawa M, Kakinuma S, Watanabe M, Izumi N. α-fetoprotein levels after interferon therapy and risk of hepatocarcinogenesis in chronic hepatitis C. Hepatology 2013; 58: [PMID: DOI: /hep.26442] 50 van der Meer AJ, Veldt BJ, Feld JJ, Wedemeyer H, Dufour JF, Lammert F, Duarte-Rojo A, Manns MP, Zeuzem S, Hofmann WP, de Knegt RJ, Hansen BE, Janssen HL. The number needed to treat to prevent mortality and cirrhosis-related complications among patients with cirrhosis and HCV genotype 1 infection. J Viral Hepat 2013; Epub ahead of print [PMID: DOI: /jvh.12185] 51 Aleman S, Rahbin N, Weiland O, Davidsdottir L, Hedenstierna M, Rose N, Verbaan H, Stål P, Carlsson T, Norrgren H, Ekbom A, Granath F, Hultcrantz R. A risk for hepatocellular carcinoma persists long-term after sustained virologic response in patients with hepatitis C-associated liver cirrhosis. Clin Infect Dis 2013; 57: [PMID: DOI: /cid/cit234] 52 Bota S, Sporea I, Popescu A, Sirli R, Neghina AM, Danila M, Strain M. Response to standard of care antiviral treatment in patients with HCV liver cirrhosis - a systematic review. J Gastrointestin Liver Dis 2011; 20: [PMID: ] 53 Fartoux L, Degos F, Trépo C, Goria O, Calès P, Tran A, Buffet C, Poynard T, Capron D, Raabe JJ, Roulot D, Naveau S, Grange JD, Poupon RE, Poupon R, Serfaty L. Effect of prolonged interferon therapy on the outcome of hepatitis C virus-related cirrhosis: a randomized trial. Clin Gastroenterol Hepatol 2007; 5: [PMID: DOI: / j.cgh ] 54 Afdhal NH, Levine R, Brown R, Freilich B, O'Brien M, Brass C. Colchicine versus peg-interferon alfa 2b long term therapy: results of the 4 year copilot trial. J Hepatol 2008; 48 Suppl 2: S4 [DOI: /S (08) ] 55 Di Bisceglie AM, Shiffman ML, Everson GT, Lindsay KL, Everhart JE, Wright EC, Lee WM, Lok AS, Bonkovsky HL, Morgan TR, Ghany MG, Morishima C, Snow KK, Dienstag JL. Prolonged therapy of advanced chronic hepatitis C with low-dose peginterferon. N Engl J Med 2008; 359: [PMID: DOI: /NEJMoa ] 56 Bruix J, Poynard T, Colombo M, Schiff E, Burak K, Heathcote EJ, Berg T, Poo JL, Mello CB, Guenther R, Niederau C, Terg R, Bedossa P, Boparai N, Griffel LH, Burroughs M, Brass CA, Albrecht JK. Maintenance therapy with peginterferon alfa-2b does not prevent hepatocellular carcinoma in cirrhotic patients with chronic hepatitis C. Gastroenterology 2011; 140: [PMID: DOI: / j.gastro ] 57 Lok AS, Everhart JE, Wright EC, Di Bisceglie AM, Kim HY, Sterling RK, Everson GT, Lindsay KL, Lee WM, Bonkovsky HL, Dienstag JL, Ghany MG, Morishima C, Morgan TR. Maintenance peginterferon therapy and other factors associated with hepatocellular carcinoma in patients with advanced hepatitis C. Gastroenterology 2011; 140: ; quiz e12 [PMID: DOI: /j.gastro ] 58 Nielsen SU, Bassendine MF, Burt AD, Martin C, Pumeechockchai W, Toms GL. Association between hepatitis C virus and very-low-density lipoprotein (VLDL)/LDL analyzed in iodixanol density gradients. J Virol 2006; 80: [PMID: DOI: /JVI ] 59 Aizaki H, Morikawa K, Fukasawa M, Hara H, Inoue Y, Tani H, Saito K, Nishijima M, Hanada K, Matsuura Y, Lai MM, Miyamura T, Wakita T, Suzuki T. Critical role of virionassociated cholesterol and sphingolipid in hepatitis C virus infection. J Virol 2008; 82: [PMID: DOI: /JVI ] 60 Wang C, Gale M, Keller BC, Huang H, Brown MS, Goldstein JL, Ye J. Identification of FBL2 as a geranylgeranylated cellular protein required for hepatitis C virus RNA replication. Mol Cell 2005; 18: [PMID: DOI: / j.molcel ] 61 Forde KA, Law C, O Flynn R, Kaplan DE. Do statins reduce hepatitis C RNA titers during routine clinical use? World J Gastroenterol 2009; 15: [PMID: ] 62 O'Leary JG, Chan JL, McMahon CM, Chung RT. Atorvastatin does not exhibit antiviral activity against HCV at conventional doses: a pilot clinical trial. Hepatology 2007; 45: [PMID: DOI: /hep.21554] 63 Patel K, Jhaveri R, George J, Qiang G, Kenedi C, Brown K, Cates C, Zekry A, Tillmann HL, Elliott L, Kilaru R, Albrecht J, Conrad A, McHutchison JG. Open-label, ascending dose, prospective cohort study evaluating the antiviral efficacy of Rosuvastatin therapy in serum and lipid fractions in patients with chronic hepatitis C. J Viral Hepat 2011; 18: [PMID: DOI: /j x] 64 Sezaki H, Suzuki F, Akuta N, Yatsuji H, Hosaka T, Kobayashi M, Suzuki Y, Arase Y, Ikeda K, Miyakawa Y, Kumada H. An open pilot study exploring the efficacy of fluvastatin, pegylated interferon and ribavirin in patients with hepatitis C virus genotype 1b in high viral loads. Intervirology 2009; 52: [PMID: DOI: / ] 65 Shimada M, Yoshida S, Masuzaki R, Schuppan D. Pitavastatin enhances antiviral efficacy of standard pegylated interferon plus ribavirin in patients with chronic hepatitis C: a prospective randomized pilot study. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 66 Zhu Q, Li N, Han Q, Zhang P, Yang C, Zeng X, Chen Y, Lv Y, Liu X, Liu Z. Statin therapy improves response to interferon alfa and ribavirin in chronic hepatitis C: a systematic review and meta-analysis. Antiviral Res 2013; 98: [PMID: DOI: /j.antiviral ] 67 Harrison SA, Rossaro L, Hu KQ, Patel K, Tillmann H, Dhaliwal S, Torres DM, Koury K, Goteti VS, Noviello S, Brass CA, Albrecht JK, McHutchison JG, Sulkowski MS. Serum cholesterol and statin use predict virological response to peginterferon and ribavirin therapy. Hepatology 2010; 52: [PMID: DOI: /hep.23787] 68 Sasaki Y, Yamada T, Tanaka H, Ohigashi H, Eguchi H, Yano M, Ishikawa O, Imaoka S. Risk of recurrence in a long-term followup after surgery in 417 patients with hepatitis B- or hepatitis C-related hepatocellular carcinoma. Ann Surg 2006; 244: [PMID: DOI: /01.sla b3] 69 Shiina S, Tateishi R, Arano T, Uchino K, Enooku K, Nakagawa H, Asaoka Y, Sato T, Masuzaki R, Kondo Y, Goto T, Yoshida H, Omata M, Koike K. Radiofrequency ablation for hepatocellular carcinoma: 10-year outcome and prognostic factors. Am J Gastroenterol 2012; 107: ; quiz 578 [PMID: DOI: /ajg ] 70 Ikeda K, Arase Y, Saitoh S, Kobayashi M, Suzuki Y, Suzuki F, Tsubota A, Chayama K, Murashima N, Kumada H. Interferon beta prevents recurrence of hepatocellular carcinoma after complete resection or ablation of the primary tumor-a prospective randomized study of hepatitis C virus-related liver cancer. Hepatology 2000; 32: [PMID: DOI: /jhep ] 71 Kubo S, Nishiguchi S, Hirohashi K, Tanaka H, Shuto T, Yamazaki O, Shiomi S, Tamori A, Oka H, Igawa S, Kuroki T, Kinoshita H. Effects of long-term postoperative interferonalpha therapy on intrahepatic recurrence after resection of hepatitis C virus-related hepatocellular carcinoma. A randomized, controlled trial. Ann Intern Med 2001; 134: [PMID: ] 72 Shiratori Y, Shiina S, Teratani T, Imamura M, Obi S, Sato S, Koike Y, Yoshida H, Omata M. Interferon therapy after tu March 21, 2014 Volume 20 Issue 11

167 Toshikuni N et al. Hepatitis C-related liver cirrhosis mor ablation improves prognosis in patients with hepatocellular carcinoma associated with hepatitis C virus. Ann Intern Med 2003; 138: [PMID: ] 73 Lin SM, Lin CJ, Hsu CW, Tai DI, Sheen IS, Lin DY, Liaw YF. Prospective randomized controlled study of interferon-alpha in preventing hepatocellular carcinoma recurrence after medical ablation therapy for primary tumors. Cancer 2004; 100: [PMID: DOI: /cncr.20004] 74 Mazzaferro V, Romito R, Schiavo M, Mariani L, Camerini T, Bhoori S, Capussotti L, Calise F, Pellicci R, Belli G, Tagger A, Colombo M, Bonino F, Majno P, Llovet JM. Prevention of hepatocellular carcinoma recurrence with alpha-interferon after liver resection in HCV cirrhosis. Hepatology 2006; 44: [PMID: DOI: /hep.21415] 75 Hagihara H, Nouso K, Kobayashi Y, Iwasaki Y, Nakamura S, Kuwaki K, Toshimori J, Miyatake H, Ohnishi H, Shiraha H, Yamamoto K. Effect of pegylated interferon therapy on intrahepatic recurrence after curative treatment of hepatitis C virus-related hepatocellular carcinoma. Int J Clin Oncol 2011; 16: [PMID: DOI: /s x] 76 Tanimoto Y, Tashiro H, Aikata H, Amano H, Oshita A, Kobayashi T, Kuroda S, Tazawa H, Takahashi S, Itamoto T, Chayama K, Ohdan H. Impact of pegylated interferon therapy on outcomes of patients with hepatitis C virus-related hepatocellular carcinoma after curative hepatic resection. Ann Surg Oncol 2012; 19: [PMID: DOI: / s ] 77 Hsu YC, Ho HJ, Wu MS, Lin JT, Wu CY. Postoperative peg-interferon plus ribavirin is associated with reduced recurrence of hepatitis C virus-related hepatocellular carcinoma. Hepatology 2013; 58: [PMID: DOI: /hep.26300] 78 Lange CM, Zeuzem S. Perspectives and challenges of interferon-free therapy for chronic hepatitis C. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 79 Bacon BR, Gordon SC, Lawitz E, Marcellin P, Vierling JM, Zeuzem S, Poordad F, Goodman ZD, Sings HL, Boparai N, Burroughs M, Brass CA, Albrecht JK, Esteban R. Boceprevir for previously treated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 80 Zeuzem S, Andreone P, Pol S, Lawitz E, Diago M, Roberts S, Focaccia R, Younossi Z, Foster GR, Horban A, Ferenci P, Nevens F, Müllhaupt B, Pockros P, Terg R, Shouval D, van Hoek B, Weiland O, Van Heeswijk R, De Meyer S, Luo D, Boogaerts G, Polo R, Picchio G, Beumont M. Telaprevir for retreatment of HCV infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 81 Ioannou GN, Beste LA, Green PK. Similar Effectiveness of Boceprevir and Telaprevir Treatment Regimens for Hepatitis C Virus Infection on the Basis of a Nationwide Study of Veterans. Clin Gastroenterol Hepatol 2013; pii: S (13) [PMID: DOI: /j.cgh ] 82 Zeuzem S, Berg T, Gane E, Ferenci P, Foster GR, Fried MW, Hezode C, Hirschfield GM, Jacobson I, Nikitin I, Pockros PJ, Poordad F, Scott J, Lenz O, Peeters M, Sekar V, De Smedt G, Sinha R, Beumont-Mauviel M. Simeprevir increases rate of sustained virologic response among treatment-experienced patients with HCV genotype-1 infection: a phase IIb trial. Gastroenterology 2014; 146: e6 [PMID: DOI: /j.gastro ] 83 Pockros PJ, Jensen D, Tsai N, Taylor R, Ramji A, Cooper C, Dickson R, Tice A, Kulkarni R, Vierling JM, Lou Munson M, Chen YC, Najera I, Thommes J. JUMP-C: a randomized trial of mericitabine plus pegylated interferon alpha-2a/ribavirin for 24 weeks in treatment-naïve HCV genotype 1/4 patients. Hepatology 2013; 58: [PMID: DOI: / hep.26275] 84 Zeuzem S, Soriano V, Asselah T, Bronowicki JP, Lohse AW, Müllhaupt B, Schuchmann M, Bourlière M, Buti M, Roberts SK, Gane EJ, Stern JO, Vinisko R, Kukolj G, Gallivan JP, Böcher WO, Mensa FJ. Faldaprevir and deleobuvir for HCV genotype 1 infection. N Engl J Med 2013; 369: [PMID: DOI: /NEJMoa ] 85 Soriano V, Gane E, Angus P, Stickel F, Bronowicki JP, Roberts S, Manns M, Zeuzem S, Dai L, Boecher W, Stern J, Mensa F. The efficacy and safety of the interferon-free combination of BI and BI in genotype 1 HCV patients with cirrhosis. Interim analysis from SOUND-C2. J Hepatol 2012; 56 Suppl 2: S559 [DOI: /S (12) ] 86 Moriwaki H, Miwa Y, Tajika M, Kato M, Fukushima H, Shiraki M. Branched-chain amino acids as a protein- and energysource in liver cirrhosis. Biochem Biophys Res Commun 2004; 313: [PMID: ] 87 Holecek M. Three targets of branched-chain amino acid supplementation in the treatment of liver disease. Nutrition 2010; 26: [PMID: DOI: /j.nut ] 88 Kato M, Miwa Y, Tajika M, Hiraoka T, Muto Y, Moriwaki H. Preferential use of branched-chain amino acids as an energy substrate in patients with liver cirrhosis. Intern Med 1998; 37: [PMID: ] 89 Marchesini G, Bianchi G, Merli M, Amodio P, Panella C, Loguercio C, Rossi Fanelli F, Abbiati R. Nutritional supplementation with branched-chain amino acids in advanced cirrhosis: a double-blind, randomized trial. Gastroenterology 2003; 124: [PMID: ] 90 Muto Y, Sato S, Watanabe A, Moriwaki H, Suzuki K, Kato A, Kato M, Nakamura T, Higuchi K, Nishiguchi S, Kumada H. Effects of oral branched-chain amino acid granules on eventfree survival in patients with liver cirrhosis. Clin Gastroenterol Hepatol 2005; 3: [PMID: ] 91 Kobayashi M, Ikeda K, Arase Y, Suzuki Y, Suzuki F, Akuta N, Hosaka T, Murashima N, Saitoh S, Someya T, Tsubota A, Kumada H. Inhibitory effect of branched-chain amino acid granules on progression of compensated liver cirrhosis due to hepatitis C virus. J Gastroenterol 2008; 43: [PMID: DOI: /s ] 92 Tada T, Kumada T, Toyoda H, Kiriyama S, Tanikawa M, Hisanaga Y, Kanamori A, Kitabatake S, Niinomi T, Ito T, Hasegawa R, Ando Y, Yamamoto K, Tanaka T. Oral supplementation with branched-chain amino acid granules prevents hepatocarcinogenesis in patients with hepatitis C-related cirrhosis: A propensity score analysis. Hepatol Res 2013; Epub ahead of print [PMID: DOI: /hepr.12120] 93 Nishiguchi S, Habu D. Effect of oral supplementation with branched-chain amino acid granules in the early stage of cirrhosis. Hepatol Res 2004; 30S: [PMID: DOI: /j.hepres ] 94 Harrison SA. Insulin resistance among patients with chronic hepatitis C: etiology and impact on treatment. Clin Gastroenterol Hepatol 2008; 6: [PMID: DOI: / j.cgh ] 95 El-Zayadi AR, Anis M. Hepatitis C virus induced insulin resistance impairs response to anti viral therapy. World J Gastroenterol 2012; 18: [PMID: DOI: / wjg.v18.i3.212] 96 Moucari R, Asselah T, Cazals-Hatem D, Voitot H, Boyer N, Ripault MP, Sobesky R, Martinot-Peignoux M, Maylin S, Nicolas-Chanoine MH, Paradis V, Vidaud M, Valla D, Bedossa P, Marcellin P. Insulin resistance in chronic hepatitis C: association with genotypes 1 and 4, serum HCV RNA level, and liver fibrosis. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 97 Chen CL, Yang HI, Yang WS, Liu CJ, Chen PJ, You SL, Wang LY, Sun CA, Lu SN, Chen DS, Chen CJ. Metabolic factors and risk of hepatocellular carcinoma by chronic hepatitis B/C infection: a follow-up study in Taiwan. Gastroenterology 2008; 135: [PMID: DOI: / j.gastro ] 98 Yasutake K, Bekki M, Ichinose M, Ikemoto M, Fujino T, Ryu 2886 March 21, 2014 Volume 20 Issue 11

168 Toshikuni N et al. Hepatitis C-related liver cirrhosis T, Wada Y, Takami Y, Saitsu H, Kohjima M, Fukuizumi K, Nakashima M, Nakamuta M, Enjoji M. Assessing current nutritional status of patients with HCV-related liver cirrhosis in the compensated stage. Asia Pac J Clin Nutr 2012; 21: [PMID: ] 99 Hui JM, Sud A, Farrell GC, Bandara P, Byth K, Kench JG, McCaughan GW, George J. Insulin resistance is associated with chronic hepatitis C virus infection and fibrosis progression [corrected]. Gastroenterology 2003; 125: [PMID: ] 100 Petta S, Cammà C, Di Marco V, Alessi N, Cabibi D, Caldarella R, Licata A, Massenti F, Tarantino G, Marchesini G, Craxì A. Insulin resistance and diabetes increase fibrosis in the liver of patients with genotype 1 HCV infection. Am J Gastroenterol 2008; 103: [PMID: DOI: / j x] 101 Cammà C, Petta S, Di Marco V, Bronte F, Ciminnisi S, Licata G, Peralta S, Simone F, Marchesini G, Craxì A. Insulin resistance is a risk factor for esophageal varices in hepatitis C virus cirrhosis. Hepatology 2009; 49: [PMID: DOI: /hep.22655] 102 Wang C, Wang X, Gong G, Ben Q, Qiu W, Chen Y, Li G, Wang L. Increased risk of hepatocellular carcinoma in patients with diabetes mellitus: a systematic review and metaanalysis of cohort studies. Int J Cancer 2012; 130: [PMID: DOI: /ijc.26165] 103 N'Kontchou G, Paries J, Htar MT, Ganne-Carrie N, Costentin L, Grando-Lemaire V, Trinchet JC, Beaugrand M. Risk factors for hepatocellular carcinoma in patients with alcoholic or viral C cirrhosis. Clin Gastroenterol Hepatol 2006; 4: [PMID: DOI: /j.cgh ] 104 Veldt BJ, Chen W, Heathcote EJ, Wedemeyer H, Reichen J, Hofmann WP, de Knegt RJ, Zeuzem S, Manns MP, Hansen BE, Schalm SW, Janssen HL. Increased risk of hepatocellular carcinoma among patients with hepatitis C cirrhosis and diabetes mellitus. Hepatology 2008; 47: [PMID: DOI: /hep.22251] 105 Donadon V, Balbi M, Mas MD, Casarin P, Zanette G. Metformin and reduced risk of hepatocellular carcinoma in diabetic patients with chronic liver disease. Liver Int 2010; 30: [PMID: DOI: /j x] 106 Nkontchou G, Cosson E, Aout M, Mahmoudi A, Bourcier V, Charif I, Ganne-Carrie N, Grando-Lemaire V, Vicaut E, Trinchet JC, Beaugrand M. Impact of metformin on the prognosis of cirrhosis induced by viral hepatitis C in diabetic patients. J Clin Endocrinol Metab 2011; 96: [PMID: DOI: /jc ] 107 López-Méndez E, Uribe M. Beta blockers in portal hypertension. Are they really a good option? Ann Hepatol 2006; 5: [PMID: ] 108 Zhang C, Thabut D, Kamath PS, Shah VH. Oesophageal varices in cirrhotic patients: from variceal screening to primary prophylaxis of the first oesophageal variceal bleeding. Liver Int 2011; 31: [PMID: DOI: / j x] 109 Groszmann RJ, Garcia-Tsao G, Bosch J, Grace ND, Burroughs AK, Planas R, Escorsell A, Garcia-Pagan JC, Patch D, Matloff DS, Gao H, Makuch R. Beta-blockers to prevent gastroesophageal varices in patients with cirrhosis. N Engl J Med 2005; 353: [PMID: DOI: / NEJMoa044456] 110 Reiberger T, Ulbrich G, Ferlitsch A, Payer BA, Schwabl P, Pinter M, Heinisch BB, Trauner M, Kramer L, Peck-Radosavljevic M. Carvedilol for primary prophylaxis of variceal bleeding in cirrhotic patients with haemodynamic non-response to propranolol. Gut 2013; 62: [PMID: DOI: /gutjnl ] 111 Hernández-Gea V, Aracil C, Colomo A, Garupera I, Poca M, Torras X, Miñana J, Guarner C, Villanueva C. Development of ascites in compensated cirrhosis with severe portal hypertension treated with β-blockers. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ] 112 Cole SW, Sood AK. Molecular pathways: beta-adrenergic signaling in cancer. Clin Cancer Res 2012; 18: [PMID: DOI: / CCR ] 113 Nkontchou G, Aout M, Mahmoudi A, Roulot D, Bourcier V, Grando-Lemaire V, Ganne-Carrie N, Trinchet JC, Vicaut E, Beaugrand M. Effect of long-term propranolol treatment on hepatocellular carcinoma incidence in patients with HCVassociated cirrhosis. Cancer Prev Res (Phila) 2012; 5: [PMID: DOI: / CAPR ] 114 Schmidt WN, Nelson DR, Pawlotsky JM, Sherman KE, Thomas DL, Chung RT. Direct-Acting Antiviral Agents and the Path to Interferon Independence. Clin Gastroenterol Hepatol 2013; pii: S (13) [PMID: DOI: /j.cgh ] P- Reviewers: Mekky MAS, Biecker E, Zapata RL S- Editor: Zhai HH L- Editor: A E- Editor: Liu XM 2887 March 21, 2014 Volume 20 Issue 11

169 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Interaction between hepatitis C virus and metabolic factors Yasunori Kawaguchi, Toshihiko Mizuta Yasunori Kawaguchi, Toshihiko Mizuta, Department of Internal Medicine, Saga Medical School, Saga , Japan Author contributions: Kawaguchi Y conceived the study and coordinated the literature search and data review; Kawaguchi Y and Mizuta T drafted the manuscript. Correspondence to: Yasunori Kawaguchi, MD, Department of Internal Medicine, Saga Medical School, Nabeshima, Saga , Japan. kawaguy@cc.saga-u.ac.jp Telephone: Fax: Received: September 27, 2013 Revised: November 15, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) infection disrupts the normal metabolism processes, but is also influenced by several of the host s metabolic factors. An obvious and significantly detrimental pathophysiological feature of HCV infection is insulin resistance in hepatic and peripheral tissues. Substantial research efforts have been put forth recently to elucidate the molecular mechanism of HCV-induced insulin resistance, and several cytokines, such as tumor necrosis factor-α, have been identified as important contributors to the development of insulin resistance in the distant peripheral tissues of HCV-infected patients and animal models. The demonstrated etiologies of HCV-induced whole-body insulin resistance include oxidative stress, lipid metabolism abnormalities, hepatic steatosis and iron overload. In addition, myriad effects of this condition have been characterized, including glucose intolerance, resistance to antiviral therapy, progression of hepatic fibrosis, development of hepatocellular carcinoma, and general decrease in quality of life. Metabolic-related conditions and disorders, such as visceral obesity and diabetes mellitus, have been shown to synergistically enhance HCV-induced metabolic disturbance, and are associated with worse prognosis. Yet, the molecular interactions between HCV-induced metabolic disturbance and hostassociated metabolic factors remain largely unknown. The diet and lifestyle recommendations for chronic hepatitis C are basically the same as those for obesity, diabetes, and metabolic syndrome. Specifically, patients are suggested to restrict their dietary iron intake, abstain from alcohol and tobacco, and increase their intake of green tea and coffee (to attain the beneficial effects of caffeine and polyphenols). While successful clinical management of HCV-infected patients with metabolic disorders has also been achieved with some antidiabetic (i.e., metformin) and anti-lipid (i.e., statins) medications, it is recommended that sulfonylurea and insulin be avoided Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Insulin resistance; Diabetes; Lipid metabolism abnormality; Hepatic steatosis; Iron overload; Oxidative stress; Visceral obesity Core tip: A specific pathophysiologic feature of hepatitis C virus (HCV) infection is whole-body insulin resistance, which is related to oxidative stress, lipid metabolism abnormalities, hepatic steatosis, and iron overload. Host metabolic factors synergistically enhance the HCV-induced metabolic disturbance, affectively deteriorating the clinical course in patients with chronic hepatitis C. Consequently, diet, lifestyle and medications appropriate for metabolic disorders are important for management of HCV-infected patients to improve their prognosis. Kawaguchi Y, Mizuta T. Interaction between hepatitis C virus and metabolic factors. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/2888.htm DOI: i INTRODUCTION Epidemiological and clinical studies have shown that pa March 21, 2014 Volume 20 Issue 11

170 Kawaguchi Y et al. HCV and metabolic factors tients with chronic liver disease, especially those infected with the hepatitis C virus (HCV), have a higher prevalence of glucose intolerance than the general population [1-8]. Insulin resistance appears to be a central feature of the pathogenesis of HCV-induced glucose intolerance. Eradication of HCV by antiviral therapy has been shown to ameliorate insulin resistance, both in hepatic tissues [4] and whole body [9] ; in addition, these patients with antiviral treatment response show significantly lower incidence rates of glucose metabolism abnormalities during the subsequent follow-up [10,11]. Insulin resistance has emerged as an important prognostic factor for the clinical course of HCV infection, due to its association with resistance to antiviral therapy [12-18], progression of hepatic fibrosis [13,19-24], development of hepatocellular carcinoma (HCC) [25], and poor quality of life [26]. In addition, insulin resistance, as well as oxidative stress, has been shown to contribute to the HCV-related disruptions in host metabolic factors, particularly lipids and iron [27-31]. Visceral obesity has been shown to enhance HCV-induced insulin resistance [32], and HCV infection in patients with both obesity and diabetes mellitus has been reported to strongly promote the development of HCC [33]. Thus, synergistic effects of viral and metabolic factors are hypothesized to contribute to hepatocarcinogenesis. Liver cirrhosis, regardless of etiology, leads to marked metabolic disturbances in protein-energy malnutrition [34], whole-body insulin resistance [35,36], and peripheral hyperinsulinemia [37-40]. Thus, the pathophysiology of liver cirrhosis is not included in the present discussion of interactive and synergistic relationships between HCV-specific metabolic disturbances. Instead, we provide overviews of the following: (1) insulin signaling factors and pathways that play important roles in glucose and lipid metabolism; (2) mechanism of HCV-induced insulin resistance in multiple organs; (3) mechanisms of altered lipid metabolism and hepatic steatosis under conditions of HCV infection; (4) interactions between the iron metabolism and oxidative stress pathways in HCV infection; (5) impact of host-related metabolic factors on HCV-induced metabolic disturbance; and (6) recommendations for diet, lifestyle and medications aimed at protecting against or resolving metabolic disorders in HCV-infected non-cirrhosis patients. OVERVIEW OF INSULIN ACTION IN THE REGULATION OF GLUCOSE AND LIPID METABOLISM Insulin controls postprandial blood glucose levels by increasing glucose uptake in muscle and fat, and reducing hepatic glucose production. Insulin stimulates cellular synthesis of glycogen, proteins and lipids, and inhibits glycogenolysis, protein breakdown and lipolysis, thereby facilitating storage of these substrates. The uptake of glucose by muscle and fat cells is promoted through insulin s stimulation of glucose transporter (GLUT) 4 translocation from the cytoplasm to the plasma membrane. Although insulin does not affect GLUT2 in hepatocytes, it blocks gluconeogenesis and glycogenolysis, and stimulates glycogen synthesis [41]. The biological action of insulin involves modulation of a cascade of intracellular signaling molecules in response to circulating insulin binding to its cognate cell surface receptor. The insulin receptor is a tetrameric complex, consisting of two extracellular insulin-binding α-subunits and two b-subunits transversing the cell membrane; these subunits function as allosteric enzymes, whereby the α-subunit inhibits the tyrosine kinase activity of the b-subunit [42]. Furthermore, insulin binding promotes its receptor s autophosphorylation, which leads to tyrosine phosphorylation of the intracellular insulin receptor substrate (IRS)-1 and IRS-2, initiating a cascade of multifaceted events [41]. Conversely, serine phosphorylation of the IRS proteins attenuates insulin signaling by decreasing insulin-stimulated tyrosine phosphorylation; this action acts as a negative feedback signal under normal physiologic conditions, providing a crosstalk mechanism between pathways that are not directly modulated by insulin but which can produce insulin resistance [43-46]. Additional factors that suppress activation of IRS proteins have also been implicated in development of insulin resistance; these include the protein tyrosine phosphatases (PTPs), especially PTP1B, which dephosphorylate tyrosine residues on the insulin receptor or IRS-1/2 [47], and the suppressor of cytokine signaling (SOCS) proteins, SOCS-1 and SOCS-3, which promote ubiquitin-mediated IRS-1 and IRS-2 degradation [48]. The phosphatidyl inositol 3-kinase (PI3K)-Akt pathway is a key transducer of the insulin-mediated metabolic signal [41,49]. PI3K itself consists of a p110 catalytic subunit and a p85 regulatory subunit. IRS proteins activate PI3K by phosphorylating two SH2 domains in the p85 component [50]. Subsequently, the p110 component of PI3K phosphorylates the membrane phospholipid phosphatidylinositol 4,5-bisphosphate at the 3 position. The resultant phosphatidylinositol 3,4,5-triphosphate (PIP3) regulates the phosphoinositide-dependent kinase 1, which phosphorylates and activates Akt [51]. Overexpression of the phosphatase and tensin homolog [52] and the SH2 domain-containing inositol-5-phosphatase [53] leads to decreased levels of PIP3, resulting in inhibition of the PI3K-Akt pathway. The following three pathways regulate glucose uptake: PI3K-Akt [54] ; PI3K-atypical protein kinase C (apkc, composed of PKC ζ/λ) [55] ; and lipid raft-expressed CAP- Cbl-TC10 [56,57]. For all, the PI3K-Akt pathway is critical for GLUT4 translocation. Upon activation, Akt inhibits glycogen synthase kinase-3 [58] and activates protein phosphatase 1 [59], thereby activating glycogen synthase by promoting its dephosphorylation. Insulin itself inhibits gluconeogenesis and glycogenolysis through its modulation of certain process-related transcription factors, such as hepatic nuclear factor-4, members of the forkhead protein family and peroxisome proliferator-activated re March 21, 2014 Volume 20 Issue 11

171 Kawaguchi Y et al. HCV and metabolic factors Insulin Glucose Lipid raft α α Insulin receptor αglut β β TC10 C3G P P P CrkII CAP Cbl PTB1B SOCS Shc P Grb2 SOS IRS-1/2 Ras P GLUT P SHP2 translocation p85 PI3K p110 PTEN αptenship2 Flotillin Flotillin Mek GLUT vesicle PDK1 mtor MAPK cascade apkc Akt PP1 GSK3 p70 rsk Fox SREBP-1 GS Cell proliferation Gluconeogenesis Lipid synthesis Glycogen synthesis Protein synthesis Figure 1 Overview of insulin signaling. Insulin binding promotes receptor autophosphorylation and subsequent tyrosine phosphorylation of insulin receptor substrates, which initiate a cascade of multifaceted metabolic actions. GLUT: Glucose transporter; IRS: Insulin receptor substrate; SOCS: Suppressor of cytokine signaling; apkc: Atypical protein kinase; SREBP: Sterol regulatory element binding protein; mtor: Mammalian target of rapamycin; MAPK: Mitogen-activated protein kinase; PTEN: Phosphatase and tensin homolog; GSK3: Gen synthase kinase-3; SHIP: SH2 domain-containing inositol phosphatases. ceptor (PPAR)γ co-activator 1, and increases lipogenesis by modulating the sterol regulatory element binding protein (SREBP)-1 [41]. Insulin-mediated PI3K pathway and mammalian target of rapamycin (mtor) signaling activate p70 ribosomal S6 kinase, which synthesizes proteins and modulates the mammalian translation machinery [60]. Insulin can also stimulate cellular proliferation and differentiation by perturbing Ras activation by Grb2-SOS, which modulates the downstream mitogen-activated protein kinase (MAPK) signaling cascade [61,62] (Figure 1). HCV-INDUCED METABOLIC DISTURBANCE Molecular mechanisms of insulin resistance in HCVinfected liver A study using liver biopsy specimens obtained from non-diabetic HCV-infected patients showed that HCV impaired the insulin-stimulated tyrosine phosphorylation of hepatic IRS-1, resulting in reduced PI3K-Akt activation without any alterations in the MAPK pathway [63]. Subsequent study of a transgenic mouse model expressing the HCV genotype 1 core protein indicated that the core protein was responsible for inducing hepatic insulin resistance via suppression of IRS-1 tyrosine phosphorylation, which was shown to ultimately lead to overt diabetes [64]. When human hepatoma cell lines were infected with HCV genotype 1, the core protein-mediated induction of SOCS-3 was shown to promote proteosomal degradation of IRS-1/2 through ubiquitination, resulting in inhibition of the PI3K-Akt pathway [65]. Although another study demonstrated that HCV genotype 2 did not mediate the same IRS-1/2 degradation via up-regulation of SOCS-3 [66], both of the core proteins derived from genotype 2 and genotype 1 have been shown to increase serine phosphorylation of IRS-1 through the c-jun N-terminal kinase (JNK) signaling pathway to decrease tyrosine phosphorylation of IRS-1 and impair the PI3K- Akt pathway [44]. In addition, the core protein of genotype 1 has been shown to promote IRS-1 degradation through mtor activation [67] and to suppress phosphorylation of tyrosine on IRS-1, as well as the production of IRS-2, through modulation of a proteasome activator (PA)28γdependent pathway [68]. The core protein of HCV genotype 3 can also promote IRS-1 degradation, and this effect is mediating by its effects on PPARγ that lead to up-regulation of SOCS-7 [67,69]. In general, HCV can also 2890 March 21, 2014 Volume 20 Issue 11

172 Kawaguchi Y et al. HCV and metabolic factors TNF-α Insulin Glucose GLUT2 TNF-R1 α α β β P P Insulin receptor HCV virion HCV core proteins PP2A SOCS mtor JNK PA28γ PTEN p85 p110 P PTB1B Shc P Grb2 IRS-1/2 P SHP2 PI3K SHIP2 SOS Ras Mek Assembly ER stress PDK1 mtor MAPK cascade Membranous web Endoplasmic reticulum Akt PP1 GSK3 p70 rsk Fox SREBP-1 GS Cell proliferation Gluconeogenesis Lipid synthesis Glycogen synthesis Protein synthesis Figure 2 Molecular mechanisms of insulin resistance in hepatitis C virus-infected hepatocytes. Hepatitis C virus (HCV) can inhibit insulin signaling directly or indirectly. GLUT: Glucose transporter; IRS: Insulin receptor substrate; SOCS: Suppressor of cytokine signaling; SREBP: Sterol regulatory element binding protein; mtor: Mammalian target of rapamycin; MAPK: Mitogen-activated protein kinase; PTEN: Phosphatase and tensin homolog; SHIP: SH2 domain-containing inositol phosphatases; GSK3: Gen synthase kinase-3; PI3K: Phosphatidyl inositol 3-kinase; TNF: Tumor necrosis factor; ER: Endoplasmic reticulum; PP2A: Protein phosphatase 2A; PA28γ: Proteasome activator 28γ. inhibit insulin signaling by dephosphorylation of Akt, and this mechanism has been shown to involve the endoplasmic reticulum (ER) stress signal inducing overexpression of protein phosphatase (PP)2A [70-72] (Figure 2). Mechanisms of insulin resistance in HCV-uninfected peripheral tissues (mainly skeletal muscle) Under normal physiologic conditions, skeletal muscle accounts for up to 75% of insulin-dependent glucose disposal, while adipose tissue accounts for only a small fraction [41]. However, obese and diabetic patients simultaneously develop insulin resistance in liver, skeletal muscle, and fat. HCV-infected patients also develop insulin resistance in peripheral tissues (mainly skeletal muscle) as well as the liver, although the molecular mechanism remains unclear. One clinical study using a euglycemic hyperinsulinemic clamp showed that HCV infection increased endogenous glucose production (reflecting hepatic insulin resistance) and decreased total glucose disposal (reflecting peripheral insulin resistance) [73]. Another clinical study showed that chronic hepatitis C was associated with peripheral, rather than hepatic, insulin resistance [74]. It is assumed that some humoral factors are necessary for the development of insulin resistance in peripheral tissues that are distant from the HCV-infected liver. A study using the Zucker (fa/fa) rat model of obesity and insulin resistance showed that tumor necrosis factor (TNF)-α impaired insulin signaling by inhibiting the function of insulin receptor or IRS-1 in the muscle and adipose tissues, but not in the liver [75]. Subsequent studies of the TNF-α induced insulin resistance indicated that the underlying mechanism involved up-regulation of SOCS-3 and consequent promotion of ubiquitin-mediated IRS-1/2 degradation [76], as well as activation of JNK and consequent phosphorylation of serine 307 on IRS-1 [45,46]. Furthermore, the levels of TNF-α in patients with chronic hepatitis C were found to be strongly associated with both hepatic and systemic insulin resistance [9,32,64,68,77] and the development of diabetes [9,64,78]. While other cytokines, such as interleukin (IL)-6 and IL-18, have also been implicated in the development of insulin resistance [73,78-81], TNF-α appears to play a central role in obesity-related and HCV-induced insulin resistance (Figure 3) March 21, 2014 Volume 20 Issue 11

173 Kawaguchi Y et al. HCV and metabolic factors Hepatic insulin resistance in HCV-infected liver Peripheral insulin resistance in skeletal muscle Proinflammatory cytokines such as TNF-α Whole-body insulin resistance Proinflammatory cytokines such as TNF-α FFA, adipokines FFA, adipokines Visceral adiposity Figure 3 Multi-organ interaction in hepatitis C virus infection. Visceral adiposity enhances hepatitis C virus (HCV)-induced whole-body insulin resistance. TNF: Tumor necrosis factor; FFA: Free fatty acid. HCV-related changes in pancreatic β-cells Whether the pathogenesis of HCV-induced diabetes is the same as that of type 2 diabetes remains controversial, despite extensive studies of HCV effects on the main diabetes-related features of decreased islet mass and β-cell dysfunction. In vitro studies have demonstrated that HCV infection of human β-cells leads to a reduction in the cells glucose-stimulated insulin release [82] and induces a novel apoptosis-like death through an ER stress-involved, caspase 3-dependent, specific pathway [83]. In contrast, however, an in vivo study of the HCV core protein transgenic mouse model suggested no substantial effects on pancreas-related insulin, due to a compensatory increase of islet mass that occurred without infiltration of inflammatory cells [64]. These in vivo results agree with the reported clinical observations of up-regulated insulin secretion in HCVinfected patients [3,4,9,12-14,18-20,22-24,65,84,85]. Nonetheless, further studies are needed to elucidate the effects of HCV on pancreatic β-cells and their production and release of insulin. HCV-related changes in gut hormones The gastrointestinal tract plays pivotal roles in regulating glucose metabolism and energy homeostasis through the digestion and absorption of nutrients and the secretion of multiple gut hormones. The incretin hormones, glucagon-like peptide (GLP)-1 and glucose-dependent insulinotropic polypeptide, are produced mainly in the small intestine and promote insulin biosynthesis, insulin secretion, and β-cell survival, and are enzymatically inactivated by dipeptidyl peptidase (DPP)-Ⅳ [86]. Furthermore, GLP-1 inhibits glucagon secretion and gastric emptying, induces satiety, and activates glycogen synthesis in hepatocytes [86,87]. In contrast, the ghrelin hormone, which is produced in the stomach, inhibits insulin secretion and stimulates food intake [88]. The cholecystokinin and gastrin hormones both act to stimulate the formation of new β-cells by stimulating islet neogenesis [86]. Only a few reports to date have addressed the relationship between gut hormones and HCV infection. One study demonstrated that HCV could decrease serum GLP-1 through up-regulation of DPP-Ⅳ expression and suggested that this mechanism may explain HCV-induced glucose intolerance [89]. Another recent study showed that circulating levels of active ghrelin were positively correlated with serum albumin levels in HCV-infected patients [90]. However, the effect of ghrelin on glucose metabolism in HCV infection remains unclear. HCV affects lipid metabolism and induces hepatic steatosis by genotype-specific mechanisms Host lipids are manipulated by HCV to support its life cycle. Viral replication and assembly require close interactions with lipid droplets and factors of lipoprotein metabolism [91,92] in the host cell. Moreover, when mature virus is released from hepatocytes it is complexed with host lipoproteins [93]. Unfortunately, modulation of the 2892 March 21, 2014 Volume 20 Issue 11

174 Kawaguchi Y et al. HCV and metabolic factors lipid metabolism process in host cells by HCV can induce hepatic steatosis [27]. This fact is reflected by the higher prevalence of hepatic steatosis in HCV-infected patients compared to the general population or even patients with chronic hepatitis B [94]. Using the HCV core protein transgenic mouse model, the core protein was implicated as a key inducer of HCVrelated hepatic steatosis [95] and the mechanism was determined to involve inhibition of both the microsomal triglyceride transfer protein activity and of very low density lipoprotein (VLDL) secretion [96]. HCV-induced oxidative stress via mitochondrial dysfunction has also been shown to cause lipid and protein peroxidation, resulting in impairment of VLDL export [27]. In addition, HCV core protein has been shown to impair the expression and function of PPARγ [97], thereby reducing mitochondrial long chain fatty acid β-oxidation [98], and induce hepatic gene expression and transcriptional activity of SREBP-1, thereby increasing fatty acid synthesis [99]. Activation of SREBP-1 is promoted via SOCS [100] or PA28γ [101] (Figure 2). Collectively, these results suggest that hepatic steatosis in HCV infection is induced by decreases in lipid export from the liver, reduction of fatty acid oxidation, and promotion of de novo fatty acid synthesis. An in vitro study has shown that significant triglyceride accumulation occurs in cells upon transfection with HCV genotypes 1 and 3, but not with genotypes 2, 4 or 5. Furthermore, the HCV genotype 3 core protein was estimated to be three times more potent at inducing this triglyceride accumulation than the genotype 1 core protein [102]. Compared with genotype 1, HCV genotype 3 also induced greater SREBP-1-dependent fatty acid synthase promoter activity [103], impairment of PPARγ expression [104], and generation of larger lipid droplets in hepatocytes [105]. Clinical studies of hepatic steatosis in patients with HCV genotype 3 showed direct associations with serum [20,106,107] and intrahepatic [108] titers of HCV RNA, which disappeared after HCV eradication by antiviral therapy [ ] and recurred in conjunction with HCV relapse [108]. These clinical phenomena have not been observed in studies of the other HCV genotypes, suggesting that only HCV genotype 3 possesses virus-specific cytopathic effects that may lead to steatosis. Iron overload and oxidative stress in HCV infection A study using liver biopsy specimens from chronic hepatitis patients indicated that hepatic iron overload was a characteristic of HCV infection, and demonstrated that serum ferritin levels can reflect the extent of hepatic iron storage in a clinical setting [111]. Recently, a large cohort study in the United States showed that HCV infection was significantly associated with increases in serum iron and ferritin levels, and that serum ferritin levels were directly correlated with results of liver function tests [112]. In both in vitro and in vivo studies, the HCV core protein has been shown to cause mitochondrial oxidative stress manifests as liver injury [113]. Transgenic expression of HCV polyprotein in mice led to hepatic iron accumulation through a process that involved HCV-induced increases in reactive oxygen species (ROS) and subsequent downregulation of hepcidin transcription leading to increased duodenal iron transport and macrophage iron release via ferroportin overexpression [31]. Patients with chronic hepatitis C have been shown to have up-regulated transferrin receptor 2, a type of hepatic iron transporter, as well as down-regulated hepcidin expression in liver [114,115]. Excess divalent iron is known to produce hydroxyl radicals, a type of ROS, through the Fenton reaction [116] ; therefore, hepatic iron overload may also contribute to hepatic oxidative stress [117]. The above-mentioned vicious cycle between hepatic iron overload and oxidative stress has been implicated as an etiology of elevated serum alanine aminotransferase (ALT) [30,112,118], insulin resistance [28-30], and hepatocarcinogenesis [119]. IMPACT OF HOST-RELATED METABOLIC FACTORS ON HCV INFECTION Synergistic effect of visceral obesity on HCV-induced systemic insulin resistance Free fatty acids (FFAs) produced and secreted by visceral adipocytes can induce insulin resistance in skeletal muscle and liver [120]. Recent studies have provided substantial insights into the mechanism of lipid-induced insulin resistance [121]. In particular, intracellular accumulation of fatty acid metabolites was shown to trigger activation of novel PKC (δ, ε, η and θ), resulting in impairment of insulin signaling. In muscle, activated PKCθ is necessary for diacylglycerol (DAG)-mediated inhibition of GLUT4 transportation, and in the liver, activated PKCε is necessary for the DAG-mediated decrease in glycogen synthesis and increase in gluconeogenesis. In addition, visceral adipocytes have also been shown to promote insulin resistance by negatively modulating several adipokines, including TNF-α, adiponectin, leptin, and resistin [41]. The hypothesis suggested by these cumulated findings, that visceral obesity may cause whole-body insulin resistance and glucose intolerance via FFAs and adipokines, is supported by the clinical studies of chronic hepatitis C patients showing that visceral adiposity synergistically enhances HCV-induced insulin resistance [32] (Figure 3). Links between metabolic factors and resistance to antiviral therapy in HCV infection Hepatic and peripheral insulin resistance is strongly associated with response to pegylated interferon (peg-ifn)-α plus ribavirin combination therapy in patients with chronic hepatitis C [12,13-18]. Non-response to antiviral therapy in HCV-infected patients has also been shown to be associated with increased hepatic expression of SOCS-3 [122], which is a physiological negative regulator of a key factor in the transduction of IFN-α signaling, the signal transducer and activator of transcription (STAT)-1 [123]. HCV is known to escape from the host immune system by interfering with IFN signaling via up-regulation of PP2A and hypomethylation of STAT-1, both of which result in reduced transcriptional activation of IFN-stimulated 2893 March 21, 2014 Volume 20 Issue 11

175 Kawaguchi Y et al. HCV and metabolic factors genes [124]. Thus, factors related to IFN signaling may represent the molecular link between resistance to antiviral therapy and insulin resistance in patients with chronic hepatitis C. This theory is further supported by studies showing that SOCS proteins also play an important role in insulin resistance related to metabolic syndrome [100] and that obesity-related up-regulation of hepatic SOCS-3 expression is associated with a reduced biological response to IFN-α in HCV-infected patients [122]. Metabolic factors are associated with hepatic inflammation, fibrosis, and hepatocarcinogenesis in HCV infection The presence of visceral obesity in HCV-infected patients has been associated with decreased high-density lipoprotein cholesterol, hepatic insulin resistance, and steatosis, all of which affect serum ALT levels [125]. In contrast to HCV genotype 3, which causes viral hepatic steatosis, HCV genotype 1 can cause metabolic hepatic steatosis through its interactions with factors related to visceral adiposity [94]. Both insulin resistance and hepatic steatosis are related to hepatic inflammation and fibrosis, and might enhance these conditions when present as comorbidities [13,21-23,106]. Studies addressing the underlying molecular mechanisms of this phenomenon have indicated that hyperglycemia and hyperinsulinemia may directly affect hepatic stellate cells and increase connective tissue growth factor, stimulating production of extracellular matrix [126]. Moreover, in HCV-infected patients, the risk of HCC increases in proportion to body mass index (BMI) [127], and increased BMI is associated with younger onset of HCC [128]. The clinical observations of postprandial hyperglycemia [129] and hyperinsulinemia [130] accelerating development and progression of hepatocarcinogenesis were also confirmed by a large cohort study of Taiwanese HCV carriers that identified obesity and diabetes as significant risk factors (representing a > 100-fold increase in risk) of HCC [33]. Thus, the interactions of hepatitis virus and host metabolic factors appear to synergistically promote hepatocarcinogenesis. DIET AND LIFESTYLE RECOMMENDATIONS FOR HCV- INFECTED NON-CIRRHOSIS PATIENTS The diet and lifestyle recommendations for managing chronic hepatitis C are basically the same as those for obesity, diabetes and metabolic syndrome, reflecting the potential negative effects of metabolic factors on the clinical course of HCV infection. A recent meta-analysis confirmed that diet and lifestyle modifications designed to address metabolic syndrome produced effective reductions in fasting blood glucose, waist circumference, blood pressure and triglycerides [131]. Exercise is a well-established behavioral modification that benefits metabolic disorders, and the molecular mechanism has been determined to involve exercise-stimulated glucose transport via activation of AMP-activated protein kinase (AMPK) in skeletal muscle [132]. Since the AMPK pathway is independent of insulin signaling, exercise is effective for improving hyperglycemia without influence from an insulin resistant milieu. Although the precise impact of diet and lifestyle modifications on outcomes of HCV infection remain to be fully elucidated, we have shown that appropriate diet and exercise intervention can increase insulin sensitivity in HCV-infected patients, as well as improve early viral response to antiviral therapy and decrease serum α-fetoprotein levels [84,85]. Considering the potential HCV-mediated effects on iron metabolism, it is recommended that HCV-infected patients reduce iron intake. Although the reported loads of HCV-induced iron accumulation in liver have not been extremely high [133,134], excessive iron intake may enhance the condition to a dangerous level [31,118,119]. Therefore, dietary iron restriction is important for HCV-infected patients. Intake of a low iron diet with appropriate nutrition has been shown to significantly decrease serum ALT and ferritin levels in patients with chronic hepatitis C [135] ; in addition, reduction of hepatic iron by phlebotomy was also shown to improve serum ALT levels [30, ] and insulin resistance [30]. Long-term therapy of low iron diet in combination with phlebotomy further improved hepatic inflammation and fibrosis [138], and reduced the risk of hepatocarcinogenesis [139]. The collected results from these clinical studies led to the estimation of an ideal iron intake being < 7 mg/d for patients with chronic hepatitis C. The advantage of phlebotomy use in combination with dietary iron restriction may be explained by the fact that dietary iron absorption is enhanced under conditions of iron deficiency [140]. The practice of drinking alcohol is another important factor for any disease associated with the liver, such as hepatitis. Temperance is recommended for patients with chronic hepatitis C because HCV and alcohol metabolism have been shown to synergistically accelerate disease progression via the oxidative stress pathway, promoting HCV replication and suppressing the antiviral action of IFN [141]. Furthermore, alcoholics with HCV infection have been shown to develop more severe fibrosis and to have higher rates of both cirrhosis and HCC than their counterparts who are non-drinkers [142]. Tobacco smoking is another behavioral practice that is detrimental to both metabolic disorders and chronic pathogenic infections, in general. A meta-analysis of smoking and cancer [143] demonstrated a causal relationship between tobacco smoking and cancer of the liver [relative risk (RR) = 1.56, 95%CI: ], as well as for lung (RR = 8.96, 95%CI: ), larynx (RR = 6.98, 95%CI: ), pharynx (RR = 6.76, 95%CI: ), upper digestive tract (RR = 3.57, 95%CI: ), oral cavity (RR = 3.43, 95%CI: ), lower urinary tract (RR = 2.77, 95%CI: ), esophagus (RR = 2.50, 95%CI: ), nasal sinuses and nasopharynx (RR = 1.95, 95%CI: ), pancreas (RR = 1.70, 95%CI: ), uterine cervix (RR 2894 March 21, 2014 Volume 20 Issue 11

176 Kawaguchi Y et al. HCV and metabolic factors = 1.83, 95%CI: ), stomach (RR = 1.65, 95%CI: ), and kidney (RR = 1.52, 95%CI: ). Although the effect of smoking on liver cancer was small compared to the other organs, smoking cessation is recommended for HCV-infected patients to avoid the synergistic effect on hepatocarcinogenesis. Caffeine and polyphenols may be another dietary factor related to outcome of metabolic disorders and pathogenic infections. Some studies have shown that green tea and coffee may be beneficial to patients with chronic hepatitis C, with intake being associated with an improved clinical course. Green tea catechins have antiinflammatory and antioxidant properties [ ] and have been shown to ameliorate glucose metabolism [149]. In addition, data from several studies have indicated that this plant-based extract may be effective in preventing hepatocarcinogenesis [ ]. The benefits of coffee consumption have been demonstrated by numerous studies, and include decreased risks of developing elevated ALT activity [153], hepatic fibrosis [154] and HCC [155], and improvements in glucose metabolism [156]. Furthermore, a recent metaanalysis showed that the RR of HCC was 0.80 (95%CI: ) for an increment of one cup of coffee per day, regardless of sex, alcohol intake, or history of hepatitis or liver disease [157]. IMPACT OF ANTI-DIABETIC AND ANTI- LIPID MEDICATIONS IN HCV-INFECTED PATIENTS Anti-diabetic agents Although insulin resistance is strongly associated with resistance to IFN-based therapy in HCV-infected patients [12-18], the effect of insulin sensitizers on antiviral therapy seems to be restrictive. In one study, administration of metformin was shown to improve the rate of sustained viral response (SVR) to peg-ifn plus ribavirin therapy in patients with HCV genotype 1 infection and insulin resistance [158] ; however, another study indicated that the metformin effect was limited to female patients [159]. Administration of pioglitazone was similarly reported to improve viral response to peg-ifn plus ribavirin therapy in patients with HCV genotype 4 and insulin resistance [160], but shown to provide no benefit to patients with HCV genotype 1 and insulin resistance [161]. In contrast, several studies have detected a harmful effect of sulfonylurea or insulin on HCC incidence in HCV-infected patients; however, the metformin appeared to provide a benefit in regard to this disease outcome [162,163]. A recent meta-analysis of observational studies confirmed an increased incidence of HCC in viral hepatitis patients with diabetes who were treated with sulfonylurea [odds ratio (OR) = 1.62; 95%CI: ] or insulin (OR = 2.61; 95%CI: ) and a reduced incidence for metformin treatment (OR = 0.50; 95%CI: ) [164]. Therefore, the therapeutic strategy to address glucose intolerance in patients with chronic hepatitis C should aim to improve glucose metabolism as well as reduce serum insulin levels. Anti-lipid agents A recent meta-analysis showed that addition of statins (also known as HMG-CoA reductase inhibitors) to the combination therapy of IFN-α and ribavirin improved SVR without additional adverse events [165]. Although statins might still provide beneficial effects in the era of direct acting antivirals (DAAs) [166], close attention must be paid to potential drug-drug interactions. Co-administration of simvastatin or lovastatin with DAAs metabolized through cytochrome P450 (CYP) 3A is contraindicated [167]. CYP3A-independent statins can also affect the concentration of DAAs through interaction with organic anion transporter polypeptide 1B1, although to a lesser extent [167]. Nonetheless, a population-based cohort study of HCV-infected patients in Taiwan showed that statin use reduced the risk of HCC in a cumulative, dosedependent manner [168] and a meta-analysis consisting of patients confirmed the association of statin use with reduced risk of HCC (although the effect was stronger in Asian than Western populations) [169]. Therefore, statin use is considered beneficial for high-risk groups of HCC, such as HCV-infected patients, but regular monitoring is strongly recommended to readily detect the occurrence of any statin-related adverse effects. CONCLUSION Interactive and synergistic relationships exist between HCV-specific metabolic disturbances and host-associated metabolic factors. HCV can induce both hepatic and peripheral insulin resistance, and the myriad mechanisms involve oxidative stress pathways, lipid metabolism abnormalities, hepatic steatosis, and iron overload. The virushost synergism ultimately promotes deterioration of the clinical course of HCV infection. Modifications to diet and lifestyle and application of the appropriate medications to address the metabolic disorder are important for the management of HCV-infected patients and help to improve response to antiviral therapy, inhibit progression of fibrosis, and prevent hepatocarcinogenesis. REFERENCES 1 Mehta SH, Brancati FL, Sulkowski MS, Strathdee SA, Szklo M, Thomas DL. Prevalence of type 2 diabetes mellitus among persons with hepatitis C virus infection in the United States. Ann Intern Med 2000; 133: [PMID: DOI: / ] 2 Mehta SH, Brancati FL, Strathdee SA, Pankow JS, Netski D, Coresh J, Szklo M, Thomas DL. Hepatitis C virus infection and incident type 2 diabetes. Hepatology 2003; 38: [PMID: DOI: /jhep ] 3 Moucari R, Asselah T, Cazals-Hatem D, Voitot H, Boyer N, Ripault MP, Sobesky R, Martinot-Peignoux M, Maylin S, Nicolas-Chanoine MH, Paradis V, Vidaud M, Valla D, Bedossa P, Marcellin P. Insulin resistance in chronic hepatitis C: association with genotypes 1 and 4, serum HCV RNA level, and liver fibrosis. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 4 Kawaguchi T, Ide T, Taniguchi E, Hirano E, Itou M, Sumie S, 2895 March 21, 2014 Volume 20 Issue 11

177 Kawaguchi Y et al. HCV and metabolic factors Nagao Y, Yanagimoto C, Hanada S, Koga H, Sata M. Clearance of HCV improves insulin resistance, beta-cell function, and hepatic expression of insulin receptor substrate 1 and 2. Am J Gastroenterol 2007; 102: [PMID: DOI: /j x] 5 Allison ME, Wreghitt T, Palmer CR, Alexander GJ. Evidence for a link between hepatitis C virus infection and diabetes mellitus in a cirrhotic population. J Hepatol 1994; 21: [PMID: ] 6 Mason AL, Lau JY, Hoang N, Qian K, Alexander GJ, Xu L, Guo L, Jacob S, Regenstein FG, Zimmerman R, Everhart JE, Wasserfall C, Maclaren NK, Perrillo RP. Association of diabetes mellitus and chronic hepatitis C virus infection. Hepatology 1999; 29: [PMID: ] 7 Caronia S, Taylor K, Pagliaro L, Carr C, Palazzo U, Petrik J, O Rahilly S, Shore S, Tom BD, Alexander GJ. Further evidence for an association between non-insulin-dependent diabetes mellitus and chronic hepatitis C virus infection. Hepatology 1999; 30: [PMID: ] 8 Wang CS, Wang ST, Yao WJ, Chang TT, Chou P. Community-based study of hepatitis C virus infection and type 2 diabetes: an association affected by age and hepatitis severity status. Am J Epidemiol 2003; 158: [PMID: DOI: /aje/kwg259] 9 Kawaguchi Y, Mizuta T, Oza N, Takahashi H, Ario K, Yoshimura T, Eguchi Y, Ozaki I, Hisatomi A, Fujimoto K. Eradication of hepatitis C virus by interferon improves wholebody insulin resistance and hyperinsulinaemia in patients with chronic hepatitis C. Liver Int 2009; 29: [PMID: DOI: /j x] 10 Romero-Gómez M, Fernández-Rodríguez CM, Andrade RJ, Diago M, Alonso S, Planas R, Solá R, Pons JA, Salmerón J, Barcena R, Perez R, Carmona I, Durán S. Effect of sustained virological response to treatment on the incidence of abnormal glucose values in chronic hepatitis C. J Hepatol 2008; 48: [PMID: DOI: /j.jhep ] 11 Arase Y, Suzuki F, Suzuki Y, Akuta N, Kobayashi M, Kawamura Y, Yatsuji H, Sezaki H, Hosaka T, Hirakawa M, Ikeda K, Kumada H. Sustained virological response reduces incidence of onset of type 2 diabetes in chronic hepatitis C. Hepatology 2009; 49: [PMID: DOI: / hep.22703] 12 Mizuta T, Kawaguchi Y, Eguchi Y, Takahashi H, Ario K, Akiyama T, Oza N, Otsuka T, Kuwashiro T, Yoshimura T, Hisatomi A, Ozaki I. Whole-body insulin sensitivity index is a highly specific predictive marker for virological response to peginterferon plus ribavirin therapy in chronic hepatitis C patients with genotype 1b and high viral load. Dig Dis Sci 2010; 55: [PMID: DOI: /s ] 13 D Souza R, Sabin CA, Foster GR. Insulin resistance plays a significant role in liver fibrosis in chronic hepatitis C and in the response to antiviral therapy. Am J Gastroenterol 2005; 100: [PMID: DOI: / j x] 14 Romero-Gómez M, Del Mar Viloria M, Andrade RJ, Salmerón J, Diago M, Fernández-Rodríguez CM, Corpas R, Cruz M, Grande L, Vázquez L, Muñoz-De-Rueda P, López- Serrano P, Gila A, Gutiérrez ML, Pérez C, Ruiz-Extremera A, Suárez E, Castillo J. Insulin resistance impairs sustained response rate to peginterferon plus ribavirin in chronic hepatitis C patients. Gastroenterology 2005; 128: [PMID: DOI: /j.gastro ] 15 Khattab M, Eslam M, Sharwae MA, Shatat M, Ali A, Hamdy L. Insulin resistance predicts rapid virologic response to peginterferon/ribavirin combination therapy in hepatitis C genotype 4 patients. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 16 Grasso A, Malfatti F, De Leo P, Martines H, Fabris P, Toscanini F, Anselmo M, Menardo G. Insulin resistance predicts rapid virological response in non-diabetic, non-cirrhotic genotype 1 HCV patients treated with peginterferon alpha- 2b plus ribavirin. J Hepatol 2009; 51: [PMID: DOI: /j.jhep ] 17 Dai CY, Huang JF, Hsieh MY, Hou NJ, Lin ZY, Chen SC, Hsieh MY, Wang LY, Chang WY, Chuang WL, Yu ML. Insulin resistance predicts response to peginterferon-alpha/ribavirin combination therapy in chronic hepatitis C patients. J Hepatol 2009; 50: [PMID: DOI: / j.jhep ] 18 Poustchi H, Negro F, Hui J, Cua IH, Brandt LR, Kench JG, George J. Insulin resistance and response to therapy in patients infected with chronic hepatitis C virus genotypes 2 and 3. J Hepatol 2008; 48: [PMID: DOI: /j.jhep ] 19 Hui JM, Sud A, Farrell GC, Bandara P, Byth K, Kench JG, McCaughan GW, George J. Insulin resistance is associated with chronic hepatitis C virus infection and fibrosis progression [corrected]. Gastroenterology 2003; 125: [PMID: DOI: /j.gastro ] 20 Fartoux L, Poujol-Robert A, Guéchot J, Wendum D, Poupon R, Serfaty L. Insulin resistance is a cause of steatosis and fibrosis progression in chronic hepatitis C. Gut 2005; 54: [PMID: DOI: /gut ] 21 Petta S, Cammà C, Di Marco V, Alessi N, Cabibi D, Caldarella R, Licata A, Massenti F, Tarantino G, Marchesini G, Craxì A. Insulin resistance and diabetes increase fibrosis in the liver of patients with genotype 1 HCV infection. Am J Gastroenterol 2008; 103: [PMID: DOI: / j x] 22 Petta S, Cammà C, Di Marco V, Macaluso FS, Maida M, Pizzolanti G, Belmonte B, Cabibi D, Di Stefano R, Ferraro D, Guarnotta C, Venezia G, Craxì A. Hepatic steatosis and insulin resistance are associated with severe fibrosis in patients with chronic hepatitis caused by HBV or HCV infection. Liver Int 2011; 31: [PMID: DOI: /j x] 23 Cua IH, Hui JM, Kench JG, George J. Genotype-specific interactions of insulin resistance, steatosis, and fibrosis in chronic hepatitis C. Hepatology 2008; 48: [PMID: DOI: /hep.22392] 24 Muzzi A, Leandro G, Rubbia-Brandt L, James R, Keiser O, Malinverni R, Dufour JF, Helbling B, Hadengue A, Gonvers JJ, Müllhaupt B, Cerny A, Mondelli MU, Negro F. Insulin resistance is associated with liver fibrosis in non-diabetic chronic hepatitis C patients. J Hepatol 2005; 42: [PMID: ] 25 El-Serag HB, Tran T, Everhart JE. Diabetes increases the risk of chronic liver disease and hepatocellular carcinoma. Gastroenterology 2004; 126: [PMID: DOI: /j.gastro ] 26 Kuwashiro T, Mizuta T, Kawaguchi Y, Iwane S, Takahashi H, Oza N, Oeda S, Isoda H, Eguchi Y, Ozaki I, Anzai K, Fujimoto K. Impairment of health-related quality of life in patients with chronic hepatitis C is associated with insulin resistance. J Gastroenterol 2014; 49: [PMID: DOI: /s ] 27 Syed GH, Amako Y, Siddiqui A. Hepatitis C virus hijacks host lipid metabolism. Trends Endocrinol Metab 2010; 21: [PMID: DOI: /j.tem ] 28 Garrido Serrano A, Guerrero Igea FJ, Lepe Jiménez JA, Palomo Gil S, Grilo Reina A. Hepatitis C virus infection, increased serum ferritin and hyperinsulinemia. Rev Esp Enferm Dig 2001; 93: [PMID: ] 29 Lecube A, Hernández C, Simó R. Glucose abnormalities in non-alcoholic fatty liver disease and chronic hepatitis C virus infection: the role of iron overload. Diabetes Metab Res Rev 2009; 25: [PMID: ] 30 Mitsuyoshi H, Itoh Y, Sumida Y, Minami M, Yasui K, Nakashima T, Okanoue T. Evidence of oxidative stress as a cofactor in the development of insulin resistance in patients with chronic hepatitis C. Hepatol Res 2008; 38: [PMID: 2896 March 21, 2014 Volume 20 Issue 11

178 Kawaguchi Y et al. HCV and metabolic factors DOI: /j X x] 31 Nishina S, Hino K, Korenaga M, Vecchi C, Pietrangelo A, Mizukami Y, Furutani T, Sakai A, Okuda M, Hidaka I, Okita K, Sakaida I. Hepatitis C virus-induced reactive oxygen species raise hepatic iron level in mice by reducing hepcidin transcription. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 32 Eguchi Y, Mizuta T, Ishibashi E, Kitajima Y, Oza N, Nakashita S, Hara M, Iwane S, Takahashi H, Akiyama T, Ario K, Kawaguchi Y, Yasutake T, Iwakiri R, Ozaki I, Hisatomi A, Eguchi T, Ono N, Fujimoto K. Hepatitis C virus infection enhances insulin resistance induced by visceral fat accumulation. Liver Int 2009; 29: [PMID: DOI: /j x] 33 Chen CL, Yang HI, Yang WS, Liu CJ, Chen PJ, You SL, Wang LY, Sun CA, Lu SN, Chen DS, Chen CJ. Metabolic factors and risk of hepatocellular carcinoma by chronic hepatitis B/C infection: a follow-up study in Taiwan. Gastroenterology 2008; 135: [PMID: DOI: / j.gastro ] 34 Caregaro L, Alberino F, Amodio P, Merkel C, Bolognesi M, Angeli P, Gatta A. Malnutrition in alcoholic and virusrelated cirrhosis. Am J Clin Nutr 1996; 63: [PMID: ] 35 Petrides AS, Vogt C, Schulze-Berge D, Matthews D, Strohmeyer G. Pathogenesis of glucose intolerance and diabetes mellitus in cirrhosis. Hepatology 1994; 19: [PMID: DOI: /hep ] 36 Jessen N, Buhl ES, Schmitz O, Lund S. Impaired insulin action despite upregulation of proximal insulin signaling: novel insights into skeletal muscle insulin resistance in liver cirrhosis. J Hepatol 2006; 45: [PMID: DOI: /j.jhep ] 37 Johnson DG, Alberti KG, Faber OK, Binder C. Hyperinsulinism of hepatic cirrhosis: Diminished degradation or hypersecretion? Lancet 1977; 1: [PMID: 63654] 38 Iwasaki Y, Ohkubo A, Kajinuma H, Akanuma Y, Kosaka K. Degradation and secretion of insulin in hepatic cirrhosis. J Clin Endocrinol Metab 1978; 47: [PMID: DOI: /jcem ] 39 Bosch J, Gomis R, Kravetz D, Casamitjana R, Terés J, Rivera F, Rodés J. Role of spontaneous portal-systemic shunting in hyperinsulinism of cirrhosis. Am J Physiol 1984; 247: G206-G212 [PMID: ] 40 Riggio O, Merli M, Cangiano C, Capocaccia R, Cascino A, Lala A, Leonetti F, Mauceri M, Pepe M, Rossi Fanelli F, Savioli M, Tamburrano G, Capocaccia L. Glucose intolerance in liver cirrhosis. Metabolism 1982; 31: [PMID: ] 41 Saltiel AR, Kahn CR. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001; 414: [PMID: DOI: /414799a] 42 Patti ME, Kahn CR. The insulin receptor--a critical link in glucose homeostasis and insulin action. J Basic Clin Physiol Pharmacol 1998; 9: [PMID: ] 43 Tanti JF, Jager J. Cellular mechanisms of insulin resistance: role of stress-regulated serine kinases and insulin receptor substrates (IRS) serine phosphorylation. Curr Opin Pharmacol 2009; 9: [PMID: DOI: / j.coph ] 44 Banerjee S, Saito K, Ait-Goughoulte M, Meyer K, Ray RB, Ray R. Hepatitis C virus core protein upregulates serine phosphorylation of insulin receptor substrate-1 and impairs the downstream akt/protein kinase B signaling pathway for insulin resistance. J Virol 2008; 82: [PMID: DOI: /JVI ] 45 Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM. IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesityinduced insulin resistance. Science 1996; 271: [PMID: DOI: /science ] 46 Aguirre V, Uchida T, Yenush L, Davis R, White MF. The c-jun NH(2)-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser(307). J Biol Chem 2000; 275: [PMID: DOI: /jbc ] 47 Koren S, Fantus IG. Inhibition of the protein tyrosine phosphatase PTP1B: potential therapy for obesity, insulin resistance and type-2 diabetes mellitus. Best Pract Res Clin Endocrinol Metab 2007; 21: [PMID: DOI: / j.beem ] 48 Rui L, Yuan M, Frantz D, Shoelson S, White MF. SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem 2002; 277: [PMID: DOI: /jbc.C ] 49 Virkamaki A, Ueki K, Kahn CR. Protein-protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J Clin Invest 1999; 103: Myers MG, Backer JM, Sun XJ, Shoelson S, Hu P, Schlessinger J, Yoakim M, Schaffhausen B, White MF. IRS-1 activates phosphatidylinositol 3 -kinase by associating with src homology 2 domains of p85. Proc Natl Acad Sci USA 1992; 89: [PMID: ] 51 Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 1997; 7: [PMID: DOI: /S (06) ] 52 Ogg S, Ruvkun G. The C. elegans PTEN homolog, DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol Cell 1998; 2: [PMID: DOI: / S (00) ] 53 Wada T, Sasaoka T, Ishiki M, Hori H, Haruta T, Ishihara H, Kobayashi M. Role of the Src homology 2 (SH2) domain and C-terminus tyrosine phosphorylation sites of SH2-containing inositol phosphatase (SHIP) in the regulation of insulin-induced mitogenesis. Endocrinology 1999; 140: [PMID: DOI: /en ] 54 Cho H, Mu J, Kim JK, Thorvaldsen JL, Chu Q, Crenshaw EB, Kaestner KH, Bartolomei MS, Shulman GI, Birnbaum MJ. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 2001; 292: [PMID: DOI: /science ] 55 Tsuru M, Katagiri H, Asano T, Yamada T, Ohno S, Ogihara T, Oka Y. Role of PKC isoforms in glucose transport in 3T3-L1 adipocytes: insignificance of atypical PKC. Am J Physiol Endocrinol Metab 2002; 283: E338-E345 [PMID: DOI: /ajpendo ] 56 Chiang SH, Hou JC, Hwang J, Pessin JE, Saltiel AR. Cloning and functional characterization of related TC10 isoforms, a subfamily of Rho proteins involved in insulin-stimulated glucose transport. J Biol Chem 2002; 277: [PMID: DOI: /jbc.M ] 57 Chang L, Adams RD, Saltiel AR. The TC10-interacting protein CIP4/2 is required for insulin-stimulated Glut4 translocation in 3T3L1 adipocytes. Proc Natl Acad Sci USA 2002; 99: [PMID: DOI: /pnas ] 58 Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 1995; 378: [PMID: DOI: /378785a0] 59 Brady MJ, Nairn AC, Saltiel AR. The regulation of glycogen synthase by protein phosphatase 1 in 3T3-L1 adipocytes. Evidence for a potential role for DARPP-32 in insulin action. J Biol Chem 1997; 272: [PMID: DOI: /jbc ] 60 Raught B, Gingras AC, Sonenberg N. The target of rapamycin (TOR) proteins. Proc Natl Acad Sci USA 2001; 98: [PMID: ] 61 Sasaoka T, Draznin B, Leitner JW, Langlois WJ, Olefsky 2897 March 21, 2014 Volume 20 Issue 11

179 Kawaguchi Y et al. HCV and metabolic factors JM. Shc is the predominant signaling molecule coupling insulin receptors to activation of guanine nucleotide releasing factor and p21ras-gtp formation. J Biol Chem 1994; 269: [PMID: ] 62 Chang L, Karin M. Mammalian MAP kinase signalling cascades. Nature 2001; 410: [PMID: DOI: / ] 63 Aytug S, Reich D, Sapiro LE, Bernstein D, Begum N. Impaired IRS-1/PI3-kinase signaling in patients with HCV: a mechanism for increased prevalence of type 2 diabetes. Hepatology 2003; 38: [PMID: DOI: / j.hep ] 64 Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Tsukamoto K, Kimura S, Moriya K, Koike K. Hepatitis C virus infection and diabetes: direct involvement of the virus in the development of insulin resistance. Gastroenterology 2004; 126: [PMID: DOI: /j.gastro ] 65 Kawaguchi T, Yoshida T, Harada M, Hisamoto T, Nagao Y, Ide T, Taniguchi E, Kumemura H, Hanada S, Maeyama M, Baba S, Koga H, Kumashiro R, Ueno T, Ogata H, Yoshimura A, Sata M. Hepatitis C virus down-regulates insulin receptor substrates 1 and 2 through up-regulation of suppressor of cytokine signaling 3. Am J Pathol 2004; 165: [PMID: DOI: /S (10) ] 66 Persico M, Russo R, Persico E, Svelto M, Spano D, Andolfo I, La Mura V, Capasso M, Tiribelli C, Torella R, Iolascon A. SOCS3 and IRS-1 gene expression differs between genotype 1 and genotype 2 hepatitis C virus-infected HepG2 cells. Clin Chem Lab Med 2009; 47: [PMID: DOI: /CCLM ] 67 Pazienza V, Clément S, Pugnale P, Conzelman S, Foti M, Mangia A, Negro F. The hepatitis C virus core protein of genotypes 3a and 1b downregulates insulin receptor substrate 1 through genotype-specific mechanisms. Hepatology 2007; 45: [PMID: DOI: /hep.21634] 68 Miyamoto H, Moriishi K, Moriya K, Murata S, Tanaka K, Suzuki T, Miyamura T, Koike K, Matsuura Y. Involvement of the PA28gamma-dependent pathway in insulin resistance induced by hepatitis C virus core protein. J Virol 2007; 81: [PMID: DOI: /JVI ] 69 Pazienza V, Vinciguerra M, Andriulli A, Mangia A. Hepatitis C virus core protein genotype 3a increases SOCS-7 expression through PPAR-{gamma} in Huh-7 cells. J Gen Virol 2010; 91: [PMID: DOI: /vir ] 70 Bernsmeier C, Duong FH, Christen V, Pugnale P, Negro F, Terracciano L, Heim MH. Virus-induced over-expression of protein phosphatase 2A inhibits insulin signalling in chronic hepatitis C. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 71 Christen V, Treves S, Duong FH, Heim MH. Activation of endoplasmic reticulum stress response by hepatitis viruses up-regulates protein phosphatase 2A. Hepatology 2007; 46: [PMID: DOI: /hep.21611] 72 Tardif KD, Waris G, Siddiqui A. Hepatitis C virus, ER stress, and oxidative stress. Trends Microbiol 2005; 13: [PMID: DOI: /j.tim ] 73 Vanni E, Abate ML, Gentilcore E, Hickman I, Gambino R, Cassader M, Smedile A, Ferrannini E, Rizzetto M, Marchesini G, Gastaldelli A, Bugianesi E. Sites and mechanisms of insulin resistance in nonobese, nondiabetic patients with chronic hepatitis C. Hepatology 2009; 50: [PMID: DOI: /hep.23031] 74 Milner KL, van der Poorten D, Trenell M, Jenkins AB, Xu A, Smythe G, Dore GJ, Zekry A, Weltman M, Fragomeli V, George J, Chisholm DJ. Chronic hepatitis C is associated with peripheral rather than hepatic insulin resistance. Gastroenterology 2010; 138: e1-3 [PMID: DOI: /j.gastro ] 75 Hotamisligil GS, Budavari A, Murray D, Spiegelman BM. Reduced tyrosine kinase activity of the insulin receptor in obesity-diabetes. Central role of tumor necrosis factoralpha. J Clin Invest 1994; 94: [PMID: DOI: /JCI117495] 76 Emanuelli B, Peraldi P, Filloux C, Chavey C, Freidinger K, Hilton DJ, Hotamisligil GS, Van Obberghen E. SOCS-3 inhibits insulin signaling and is up-regulated in response to tumor necrosis factor-alpha in the adipose tissue of obese mice. J Biol Chem 2001; 276: [PMID: DOI: /jbc.M ] 77 Lecube A, Hernández C, Genescà J, Simó R. Proinflammatory cytokines, insulin resistance, and insulin secretion in chronic hepatitis C patients: A case-control study. Diabetes Care 2006; 29: [PMID: DOI: / dc ] 78 Knobler H, Zhornicky T, Sandler A, Haran N, Ashur Y, Schattner A. Tumor necrosis factor-alpha-induced insulin resistance may mediate the hepatitis C virus-diabetes association. Am J Gastroenterol 2003; 98: [PMID: DOI: /j x] 79 Fernandez-Real JM, Vayreda M, Richart C, Gutierrez C, Broch M, Vendrell J, Ricart W. Circulating interleukin 6 levels, blood pressure, and insulin sensitivity in apparently healthy men and women. J Clin Endocrinol Metab 2001; 86: [PMID: DOI: /jc ] 80 Straczkowski M, Kowalska I, Nikolajuk A, Otziomek E, Adamska A, Karolczuk-Zarachowicz M, Gorska M. Increased serum interleukin-18 concentration is associated with hypoadiponectinemia in obesity, independently of insulin resistance. Int J Obes (Lond) 2007; 31: [PMID: DOI: /sj.ijo ] 81 Chandrasekar B, Boylston WH, Venkatachalam K, Webster NJ, Prabhu SD, Valente AJ. Adiponectin blocks interleukin- 18-mediated endothelial cell death via APPL1-dependent AMP-activated protein kinase (AMPK) activation and IKK/NF-kappaB/PTEN suppression. J Biol Chem 2008; 283: [PMID: DOI: /jbc.M ] 82 Masini M, Campani D, Boggi U, Menicagli M, Funel N, Pollera M, Lupi R, Del Guerra S, Bugliani M, Torri S, Del Prato S, Mosca F, Filipponi F, Marchetti P. Hepatitis C virus infection and human pancreatic beta-cell dysfunction. Diabetes Care 2005; 28: [PMID: DOI: /diacare ] 83 Wang Q, Chen J, Wang Y, Han X, Chen X. Hepatitis C virus induced a novel apoptosis-like death of pancreatic beta cells through a caspase 3-dependent pathway. PLoS One 2012; 7: e38522 [PMID: DOI: /journal.pone ] 84 Kawaguchi Y, Mizuta T, Eguchi Y, Sakurai E, Motomura Y, Isoda H, Kuwashiro T, Oeda S, Iwane S, Takahashi H, Anzai K, Ozaki I. Whole-body insulin resistance is associated with elevated serum α-fetoprotein levels in patients with chronic hepatitis C. Intern Med 2013; 52: [PMID: DOI: /internalmedicine ] 85 Kawaguchi Y, Mizuta T, Fukuyama M, Matsuda N, Kuwashiro T, Oeda S, Oza N, Takahashi H, Eguchi Y, Ushirokawa M, Horie H, Ishibashi E, Kitajima Y, Ozaki I, Fujimoto K. Impact of diet and exercise intervention on insulin resistance and early virological response to pegylated interferon plus ribavirin in patients with chronic hepatitis C. Gastroenterology 2009; 136 Suppl 1: A791 [DOI: /S (09) ] 86 Drucker DJ. The role of gut hormones in glucose homeostasis. J Clin Invest 2007; 117: [PMID: DOI: /JCI30076] 87 Redondo A, Trigo MV, Acitores A, Valverde I, Villanueva- Peñacarrillo ML. Cell signalling of the GLP-1 action in rat liver. Mol Cell Endocrinol 2003; 204: [PMID: DOI: /S (03) ] 88 Verhulst PJ, Depoortere I. Ghrelin s second life: from appetite stimulator to glucose regulator. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18. i ] 2898 March 21, 2014 Volume 20 Issue 11

180 Kawaguchi Y et al. HCV and metabolic factors 89 Itou M, Kawaguchi T, Taniguchi E, Sumie S, Oriishi T, Mitsuyama K, Tsuruta O, Ueno T, Sata M. Altered expression of glucagon-like peptide-1 and dipeptidyl peptidase IV in patients with HCV-related glucose intolerance. J Gastroenterol Hepatol 2008; 23: [PMID: DOI: / j x] 90 Kawaguchi T, Nagao Y, Sata M. Independent factors associated with altered plasma active ghrelin levels in HCV-infected patients. Liver Int 2013; 33: [PMID: DOI: /liv.12235] 91 Miyanari Y, Atsuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 2007; 9: [PMID: DOI: /ncb1631] 92 Alvisi G, Madan V, Bartenschlager R. Hepatitis C virus and host cell lipids: an intimate connection. RNA Biol 2011; 8: [PMID: DOI: /rna ] 93 André P, Komurian-Pradel F, Deforges S, Perret M, Berland JL, Sodoyer M, Pol S, Bréchot C, Paranhos-Baccalà G, Lotteau V. Characterization of low- and very-low-density hepatitis C virus RNA-containing particles. J Virol 2002; 76: [PMID: DOI: /JVI ] 94 Hwang SJ, Lee SD. Hepatic steatosis and hepatitis C: Still unhappy bedfellows? J Gastroenterol Hepatol 2011; 26 Suppl 1: [PMID: DOI: /j x.] 95 Moriya K, Yotsuyanagi H, Shintani Y, Fujie H, Ishibashi K, Matsuura Y, Miyamura T, Koike K. Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. J Gen Virol 1997; 78 (Pt 7): [PMID: ] 96 Perlemuter G, Sabile A, Letteron P, Vona G, Topilco A, Chrétien Y, Koike K, Pessayre D, Chapman J, Barba G, Bréchot C. Hepatitis C virus core protein inhibits microsomal triglyceride transfer protein activity and very low density lipoprotein secretion: a model of viral-related steatosis. FASEB J 2002; 16: [PMID: DOI: /fj com] 97 Dharancy S, Malapel M, Perlemuter G, Roskams T, Cheng Y, Dubuquoy L, Podevin P, Conti F, Canva V, Philippe D, Gambiez L, Mathurin P, Paris JC, Schoonjans K, Calmus Y, Pol S, Auwerx J, Desreumaux P. Impaired expression of the peroxisome proliferator-activated receptor alpha during hepatitis C virus infection. Gastroenterology 2005; 128: [PMID: DOI: /j.gastro ] 98 Ferré P. The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 2004; 53 Suppl 1: S43-S50 [PMID: DOI: /diabetes S43] 99 Kim KH, Hong SP, Kim K, Park MJ, Kim KJ, Cheong J. HCV core protein induces hepatic lipid accumulation by activating SREBP1 and PPARgamma. Biochem Biophys Res Commun 2007; 355: [PMID: DOI: / j.bbrc ] 100 Ueki K, Kondo T, Tseng YH, Kahn CR. Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad Sci USA 2004; 101: [PMID: DOI: /pnas ] 101 Moriishi K, Mochizuki R, Moriya K, Miyamoto H, Mori Y, Abe T, Murata S, Tanaka K, Miyamura T, Suzuki T, Koike K, Matsuura Y. Critical role of PA28gamma in hepatitis C virusassociated steatogenesis and hepatocarcinogenesis. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 102 Abid K, Pazienza V, de Gottardi A, Rubbia-Brandt L, Conne B, Pugnale P, Rossi C, Mangia A, Negro F. An in vitro model of hepatitis C virus genotype 3a-associated triglycerides accumulation. J Hepatol 2005; 42: [PMID: DOI: /j.jhep ] 103 Jackel-Cram C, Babiuk LA, Liu Q. Up-regulation of fatty acid synthase promoter by hepatitis C virus core protein: genotype-3a core has a stronger effect than genotype-1b core. J Hepatol 2007; 46: [PMID: DOI: / j.jhep ] 104 de Gottardi A, Pazienza V, Pugnale P, Bruttin F, Rubbia- Brandt L, Juge-Aubry CE, Meier CA, Hadengue A, Negro F. Peroxisome proliferator-activated receptor-alpha and -gamma mrna levels are reduced in chronic hepatitis C with steatosis and genotype 3 infection. Aliment Pharmacol Ther 2006; 23: [PMID: DOI: / j x] 105 Piodi A, Chouteau P, Lerat H, Hézode C, Pawlotsky JM. Morphological changes in intracellular lipid droplets induced by different hepatitis C virus genotype core sequences and relationship with steatosis. Hepatology 2008; 48: [PMID: DOI: /hep ] 106 Adinolfi LE, Gambardella M, Andreana A, Tripodi MF, Utili R, Ruggiero G. Steatosis accelerates the progression of liver damage of chronic hepatitis C patients and correlates with specific HCV genotype and visceral obesity. Hepatology 2001; 33: [PMID: DOI: / jhep ] 107 Patton HM, Patel K, Behling C, Bylund D, Blatt LM, Vallée M, Heaton S, Conrad A, Pockros PJ, McHutchison JG. The impact of steatosis on disease progression and early and sustained treatment response in chronic hepatitis C patients. J Hepatol 2004; 40: [PMID: DOI: / j.jhep ] 108 Rubbia-Brandt L, Quadri R, Abid K, Giostra E, Malé PJ, Mentha G, Spahr L, Zarski JP, Borisch B, Hadengue A, Negro F. Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. J Hepatol 2000; 33: [PMID: DOI: /S (00)80166-X] 109 Kumar D, Farrell GC, Fung C, George J. Hepatitis C virus genotype 3 is cytopathic to hepatocytes: Reversal of hepatic steatosis after sustained therapeutic response. Hepatology 2002; 36: [PMID: DOI: / jhep ] 110 Poynard T, Ratziu V, McHutchison J, Manns M, Goodman Z, Zeuzem S, Younossi Z, Albrecht J. Effect of treatment with peginterferon or interferon alfa-2b and ribavirin on steatosis in patients infected with hepatitis C. Hepatology 2003; 38: [PMID: DOI: /jhep ] 111 Farinati F, Cardin R, De Maria N, Della Libera G, Marafin C, Lecis E, Burra P, Floreani A, Cecchetto A, Naccarato R. Iron storage, lipid peroxidation and glutathione turnover in chronic anti-hcv positive hepatitis. J Hepatol 1995; 22: [PMID: ] 112 Shan Y, Lambrecht RW, Bonkovsky HL. Association of hepatitis C virus infection with serum iron status: analysis of data from the third National Health and Nutrition Examination Survey. Clin Infect Dis 2005; 40: [PMID: ] 113 Okuda M, Li K, Beard MR, Showalter LA, Scholle F, Lemon SM, Weinman SA. Mitochondrial injury, oxidative stress, and antioxidant gene expression are induced by hepatitis C virus core protein. Gastroenterology 2002; 122: [PMID: DOI: /gast ] 114 Takeo M, Kobayashi Y, Fujita N, Urawa N, Iwasa M, Horiike S, Tanaka H, Kaito M, Adachi Y. Upregulation of transferrin receptor 2 and ferroportin 1 mrna in the liver of patients with chronic hepatitis C. J Gastroenterol Hepatol 2005; 20: [PMID: DOI: /j x] 115 Fujita N, Sugimoto R, Takeo M, Urawa N, Mifuji R, Tanaka H, Kobayashi Y, Iwasa M, Watanabe S, Adachi Y, Kaito M. Hepcidin expression in the liver: relatively low level in patients with chronic hepatitis C. Mol Med 2007; 13: [PMID: DOI: / Fujita] 116 Fenton HJH. Oxidation of tartaric acid in presence of iron. J Chem Soc 1894; 65: [DOI: /CT ] 2899 March 21, 2014 Volume 20 Issue 11

181 Kawaguchi Y et al. HCV and metabolic factors 117 Fujita N, Miyachi H, Tanaka H, Takeo M, Nakagawa N, Kobayashi Y, Iwasa M, Watanabe S, Takei Y. Iron overload is associated with hepatic oxidative damage to DNA in nonalcoholic steatohepatitis. Cancer Epidemiol Biomarkers Prev 2009; 18: [PMID: DOI: / EPI ] 118 Bassett SE, Di Bisceglie AM, Bacon BR, Sharp RM, Govindarajan S, Hubbard GB, Brasky KM, Lanford RE. Effects of iron loading on pathogenicity in hepatitis C virus-infected chimpanzees. Hepatology 1999; 29: [PMID: DOI: /hep ] 119 Furutani T, Hino K, Okuda M, Gondo T, Nishina S, Kitase A, Korenaga M, Xiao SY, Weinman SA, Lemon SM, Sakaida I, Okita K. Hepatic iron overload induces hepatocellular carcinoma in transgenic mice expressing the hepatitis C virus polyprotein. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 120 Bergman RN, Ader M. Free fatty acids and pathogenesis of type 2 diabetes mellitus. Trends Endocrinol Metab 2000; 11: [PMID: ] 121 Samuel VT, Petersen KF, Shulman GI. Lipid-induced insulin resistance: unravelling the mechanism. Lancet 2010; 375: [PMID: DOI: /S (10) ] 122 Walsh MJ, Jonsson JR, Richardson MM, Lipka GM, Purdie DM, Clouston AD, Powell EE. Non-response to antiviral therapy is associated with obesity and increased hepatic expression of suppressor of cytokine signalling 3 (SOCS-3) in patients with chronic hepatitis C, viral genotype 1. Gut 2006; 55: [PMID: DOI: /gut ] 123 Gadina M, Hilton D, Johnston JA, Morinobu A, Lighvani A, Zhou YJ, Visconti R, O Shea JJ. Signaling by type I and II cytokine receptors: ten years after. Curr Opin Immunol 2001; 13: [PMID: DOI: /S (00) ] 124 Duong FH, Filipowicz M, Tripodi M, La Monica N, Heim MH. Hepatitis C virus inhibits interferon signaling through up-regulation of protein phosphatase 2A. Gastroenterology 2004; 126: [PMID: DOI: / j.gastro ] 125 Kobayashi Y, Kawaguchi Y, Mizuta T, Kuwashiro T, Oeda S, Oza N, Takahashi H, Iwane S, Eguchi Y, Anzai K, Ozaki I, Fujimoto K. Metabolic factors are associated with serum alanine aminotransferase levels in patients with chronic hepatitis C. J Gastroenterol 2011; 46: [PMID: DOI: /s x] 126 Paradis V, Perlemuter G, Bonvoust F, Dargere D, Parfait B, Vidaud M, Conti M, Huet S, Ba N, Buffet C, Bedossa P. High glucose and hyperinsulinemia stimulate connective tissue growth factor expression: a potential mechanism involved in progression to fibrosis in nonalcoholic steatohepatitis. Hepatology 2001; 34: [PMID: DOI: / jhep ] 127 Ohki T, Tateishi R, Sato T, Masuzaki R, Imamura J, Goto T, Yamashiki N, Yoshida H, Kanai F, Kato N, Shiina S, Yoshida H, Kawabe T, Omata M. Obesity is an independent risk factor for hepatocellular carcinoma development in chronic hepatitis C patients. Clin Gastroenterol Hepatol 2008; 6: [PMID: DOI: /j.cgh ] 128 Akiyama T, Mizuta T, Kawazoe S, Eguchi Y, Kawaguchi Y, Takahashi H, Ozaki I, Fujimoto K. Body mass index is associated with age-at-onset of HCV-infected hepatocellular carcinoma patients. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i7.914] 129 Takahashi H, Mizuta T, Eguchi Y, Kawaguchi Y, Kuwashiro T, Oeda S, Isoda H, Oza N, Iwane S, Izumi K, Anzai K, Ozaki I, Fujimoto K. Post-challenge hyperglycemia is a significant risk factor for the development of hepatocellular carcinoma in patients with chronic hepatitis C. J Gastroenterol 2011; 46: [PMID: DOI: /s ] 130 Saito K, Inoue S, Saito T, Kiso S, Ito N, Tamura S, Watanabe H, Takeda H, Misawa H, Togashi H, Matsuzawa Y, Kawata S. Augmentation effect of postprandial hyperinsulinaemia on growth of human hepatocellular carcinoma. Gut 2002; 51: [PMID: ] 131 Yamaoka K, Tango T. Effects of lifestyle modification on metabolic syndrome: a systematic review and meta-analysis. BMC Med 2012; 10: 138 [PMID: DOI: / ] 132 Fujii N, Jessen N, Goodyear LJ. AMP-activated protein kinase and the regulation of glucose transport. Am J Physiol Endocrinol Metab 2006; 291: E867-E877 [PMID: DOI: /ajpendo ] 133 Di Bisceglie AM, Axiotis CA, Hoofnagle JH, Bacon BR. Measurements of iron status in patients with chronic hepatitis. Gastroenterology 1992; 102: [PMID: ] 134 Haque S, Chandra B, Gerber MA, Lok AS. Iron overload in patients with chronic hepatitis C: a clinicopathologic study. Hum Pathol 1996; 27: [PMID: DOI: /S (96) ] 135 Iwasa M, Iwata K, Kaito M, Ikoma J, Yamamoto M, Takeo M, Kuroda M, Fujita N, Kobayashi Y, Adachi Y. Efficacy of longterm dietary restriction of total calories, fat, iron, and protein in patients with chronic hepatitis C virus. Nutrition 2004; 20: [PMID: DOI: /j.nut ] 136 Hayashi H, Takikawa T, Nishimura N, Yano M, Isomura T, Sakamoto N. Improvement of serum aminotransferase levels after phlebotomy in patients with chronic active hepatitis C and excess hepatic iron. Am J Gastroenterol 1994; 89: [PMID: ] 137 Yano M, Hayashi H, Yoshioka K, Kohgo Y, Saito H, Niitsu Y, Kato J, Iino S, Yotsuyanagi H, Kobayashi Y, Kawamura K, Kakumu S, Kaito M, Ikoma J, Wakusawa S, Okanoue T, Sumida Y, Kimura F, Kajiwara E, Sata M, Ogata K. A significant reduction in serum alanine aminotransferase levels after 3-month iron reduction therapy for chronic hepatitis C: a multicenter, prospective, randomized, controlled trial in Japan. J Gastroenterol 2004; 39: [PMID: DOI: /s z] 138 Kato J, Kobune M, Nakamura T, Kuroiwa G, Takada K, Takimoto R, Sato Y, Fujikawa K, Takahashi M, Takayama T, Ikeda T, Niitsu Y. Normalization of elevated hepatic 8-hydroxy-2 -deoxyguanosine levels in chronic hepatitis C patients by phlebotomy and low iron diet. Cancer Res 2001; 61: [PMID: ] 139 Kato J, Miyanishi K, Kobune M, Nakamura T, Takada K, Takimoto R, Kawano Y, Takahashi S, Takahashi M, Sato Y, Takayama T, Niitsu Y. Long-term phlebotomy with low-iron diet therapy lowers risk of development of hepatocellular carcinoma from chronic hepatitis C. J Gastroenterol 2007; 42: [PMID: DOI: /s z] 140 Nathanson MH, Muir A, McLaren GD. Iron absorption in normal and iron-deficient beagle dogs: mucosal iron kinetics. Am J Physiol 1985; 249: G439-G448 [PMID: ] 141 McCartney EM, Beard MR. Impact of alcohol on hepatitis C virus replication and interferon signaling. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg. v16.i ] 142 Singal AK, Anand BS. Mechanisms of synergy between alcohol and hepatitis C virus. J Clin Gastroenterol 2007; 41: [PMID: ] 143 Gandini S, Botteri E, Iodice S, Boniol M, Lowenfels AB, Maisonneuve P, Boyle P. Tobacco smoking and cancer: a metaanalysis. Int J Cancer 2008; 122: [PMID: DOI: /ijc.23033] 144 Tipoe GL, Leung TM, Hung MW, Fung ML. Green tea polyphenols as an anti-oxidant and anti-inflammatory agent for cardiovascular protection. Cardiovasc Hematol Disord Drug Targets 2007; 7: [PMID: DOI: / ] 145 Wheeler DS, Catravas JD, Odoms K, Denenberg A, Malhotra V, Wong HR. Epigallocatechin-3-gallate, a green tea-derived 2900 March 21, 2014 Volume 20 Issue 11

182 Kawaguchi Y et al. HCV and metabolic factors polyphenol, inhibits IL-1 beta-dependent proinflammatory signal transduction in cultured respiratory epithelial cells. J Nutr 2004; 134: [PMID: ] 146 Yang F, de Villiers WJ, McClain CJ, Varilek GW. Green tea polyphenols block endotoxin-induced tumor necrosis factorproduction and lethality in a murine model. J Nutr 1998; 128: [PMID: ] 147 Lin YT, Wu YH, Tseng CK, Lin CK, Chen WC, Hsu YC, Lee JC. Green tea phenolic epicatechins inhibit hepatitis C virus replication via cycloxygenase-2 and attenuate virus-induced inflammation. PLoS One 2013; 8: e54466 [PMID: DOI: /journal.pone ] 148 Baba Y, Sonoda JI, Hayashi S, Tosuji N, Sonoda S, Makisumi K, Nakajo M. Reduction of oxidative stress in liver cancer patients by oral green tea polyphenol tablets during hepatic arterial infusion chemotherapy. Exp Ther Med 2012; 4: [PMID: DOI: /etm ] 149 Liu K, Zhou R, Wang B, Chen K, Shi LY, Zhu JD, Mi MT. Effect of green tea on glucose control and insulin sensitivity: a meta-analysis of 17 randomized controlled trials. Am J Clin Nutr 2013; 98: [PMID: DOI: / ajcn ] 150 Shimizu M, Kubota M, Tanaka T, Moriwaki H. Nutraceutical approach for preventing obesity-related colorectal and liver carcinogenesis. Int J Mol Sci 2012; 13: [PMID: DOI: /ijms ] 151 Darvesh AS, Bishayee A. Chemopreventive and therapeutic potential of tea polyphenols in hepatocellular cancer. Nutr Cancer 2013; 65: [PMID: DOI: / ] 152 Li Y, Chang SC, Goldstein BY, Scheider WL, Cai L, You NC, Tarleton HP, Ding B, Zhao J, Wu M, Jiang Q, Yu S, Rao J, Lu QY, Zhang ZF, Mu L. Green tea consumption, inflammation and the risk of primary hepatocellular carcinoma in a Chinese population. Cancer Epidemiol 2011; 35: [PMID: DOI: /j.canep ] 153 Ruhl CE, Everhart JE. Coffee and caffeine consumption reduce the risk of elevated serum alanine aminotransferase activity in the United States. Gastroenterology 2005; 128: [PMID: DOI: /j.gastro ] 154 Modi AA, Feld JJ, Park Y, Kleiner DE, Everhart JE, Liang TJ, Hoofnagle JH. Increased caffeine consumption is associated with reduced hepatic fibrosis. Hepatology 2010; 51: [PMID: DOI: /hep.23279] 155 Gelatti U, Covolo L, Franceschini M, Pirali F, Tagger A, Ribero ML, Trevisi P, Martelli C, Nardi G, Donato F. Coffee consumption reduces the risk of hepatocellular carcinoma independently of its aetiology: a case-control study. J Hepatol 2005; 42: [PMID: ] 156 Tunnicliffe JM, Shearer J. Coffee, glucose homeostasis, and insulin resistance: physiological mechanisms and mediators. Appl Physiol Nutr Metab 2008; 33: [PMID: DOI: /H08-123] 157 Bravi F, Bosetti C, Tavani A, Gallus S, La Vecchia C. Coffee reduces risk for hepatocellular carcinoma: an updated metaanalysis. Clin Gastroenterol Hepatol 2013; 11: e1 [PMID: DOI: /j.cgh ] 158 Yu JW, Sun LJ, Zhao YH, Kang P, Yan BZ. The effect of metformin on the efficacy of antiviral therapy in patients with genotype 1 chronic hepatitis C and insulin resistance. Int J Infect Dis 2012; 16: e436-e441 [PMID: DOI: / j.ijid ] 159 Romero-Gómez M, Diago M, Andrade RJ, Calleja JL, Salmerón J, Fernández-Rodríguez CM, Solà R, García-Samaniego J, Herrerías JM, De la Mata M, Moreno-Otero R, Nuñez O, Olveira A, Durán S, Planas R. Treatment of insulin resistance with metformin in naïve genotype 1 chronic hepatitis C patients receiving peginterferon alfa-2a plus ribavirin. Hepatology 2009; 50: [PMID: DOI: / hep.23206] 160 Khattab M, Emad M, Abdelaleem A, Eslam M, Atef R, Shaker Y, Hamdy L. Pioglitazone improves virological response to peginterferon alpha-2b/ribavirin combination therapy in hepatitis C genotype 4 patients with insulin resistance. Liver Int 2010; 30: [PMID: DOI: / j x] 161 Harrison SA, Hamzeh FM, Han J, Pandya PK, Sheikh MY, Vierling JM. Chronic hepatitis C genotype 1 patients with insulin resistance treated with pioglitazone and peginterferon alpha-2a plus ribavirin. Hepatology 2012; 56: [PMID: DOI: /hep.25661] 162 Kawaguchi T, Taniguchi E, Morita Y, Shirachi M, Tateishi I, Nagata E, Sata M. Association of exogenous insulin or sulphonylurea treatment with an increased incidence of hepatoma in patients with hepatitis C virus infection. Liver Int 2010; 30: [PMID: DOI: /j x] 163 Nkontchou G, Cosson E, Aout M, Mahmoudi A, Bourcier V, Charif I, Ganne-Carrie N, Grando-Lemaire V, Vicaut E, Trinchet JC, Beaugrand M. Impact of metformin on the prognosis of cirrhosis induced by viral hepatitis C in diabetic patients. J Clin Endocrinol Metab 2011; 96: [PMID: DOI: /jc ] 164 Singh S, Singh PP, Singh AG, Murad MH, Sanchez W. Antidiabetic medications and the risk of hepatocellular cancer: a systematic review and meta-analysis. Am J Gastroenterol 2013; 108: ; quiz 892 [PMID: DOI: / ajg ] 165 Zhu Q, Li N, Han Q, Zhang P, Yang C, Zeng X, Chen Y, Lv Y, Liu X, Liu Z. Statin therapy improves response to interferon alfa and ribavirin in chronic hepatitis C: a systematic review and meta-analysis. Antiviral Res 2013; 98: [PMID: DOI: /j.antiviral ] 166 Sheridan DA, Neely RD, Bassendine MF. Hepatitis C virus and lipids in the era of direct acting antivirals (DAAs). Clin Res Hepatol Gastroenterol 2013; 37: [PMID: DOI: /j.clinre ] 167 Chauvin B, Drouot S, Barrail-Tran A, Taburet AM. Drug-drug interactions between HMG-CoA reductase inhibitors (statins) and antiviral protease inhibitors. Clin Pharmacokinet 2013; 52: [PMID: DOI: /s ] 168 Tsan YT, Lee CH, Ho WC, Lin MH, Wang JD, Chen PC. Statins and the risk of hepatocellular carcinoma in patients with hepatitis C virus infection. J Clin Oncol 2013; 31: [PMID: DOI: /JCO ] 169 Singh S, Singh PP, Singh AG, Murad MH, Sanchez W. Statins are associated with a reduced risk of hepatocellular cancer: a systematic review and meta-analysis. Gastroenterology 2013; 144: [PMID: DOI: / j.gastro ] P- Reviewers: Anand BS, Kawaguchi T S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2901 March 21, 2014 Volume 20 Issue 11

183 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Hepatitis C virus NS5A inhibitors and drug resistance mutations TOPIC HIGHLIGHT Shingo Nakamoto, Tatsuo Kanda, Shuang Wu, Hiroshi Shirasawa, Osamu Yokosuka Shingo Nakamoto, Hiroshi Shirasawa, Department of Molecular Virology, Graduate School of Medicine, Chiba University, Chiba , Japan Shingo Nakamoto, Tatsuo Kanda, Shuang Wu, Osamu Yokosuka, Department of Gastroenterology and Nephrology, Graduate School of Medicine, Chiba University, Chiba , Japan Author contributions: Nakamoto S, Kanda T, Wu S, Shirasawa H and Yokosuka O contributed to this paper. Supported by Grants for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to Nakamoto S, Kanda T); and grants from the Ministry of Health, Labour, and Welfare of Japan (to Yokosuka O) Correspondence to: Tatsuo Kanda, MD, PhD, Associate Professor, Department of Gastroenterology and Nephrology, Graduate School of Medicine, Chiba University, Inohana, Chuo-ku, Chiba , Japan. kandat-cib@umin.ac.jp Telephone: Fax: Received: September 24, 2013 Revised: October 23, 2013 Accepted: January 14, 2014 Published online: March 21, 2014 Abstract Some direct-acting antiviral agents for hepatitis C virus (HCV), such as telaprevir and boceprevir have been available since It was reported that HCV NS5A is associated with interferon signaling related to HCV replication and hepatocarcinogenesis. HCV NS5A inhibitors efficiently inhibited HCV replication in vitro. Human studies showed that dual, triple and quad regimens with HCV NS5A inhibitors, such as daclatasvir and ledipasvir, in combination with other direct-acting antiviral agents against other regions of HCV with or without peginterferon/ribavirin, could efficiently inhibit HCV replication according to HCV genotypes. These combinations might be a powerful tool for difficult-to-treat HCV-infected patients. First generation HCV NS5A inhibitors such as daclatasvir, ledipasvir and ABT-267, which are now in phase Ⅲ clinical trials, could result in resistance mutations. Second generation NS5A inhibitors such as GS-5816, ACH-3102, and MK-8742, have displayed improvements in the genetic barrier while maintaining potency. HCV NS5A inhibitors are safe at low concentrations, which make them attractive for use despite low genetic barriers, although, in fact, HCV NS5A inhibitors should be used with HCV NS3/4A inhibitors, HCV NS5B inhibitors or peginterferon plus ribavirin. This review article describes HCV NS5A inhibitor resistance mutations and recommends that HCV NS5A inhibitors be used in combination regimens potent enough to prevent the emergence of resistant variants Baishideng Publishing Group Co., Limited. All rights reserved. Key words: ACH-3102; Direct-acting antiviral agents; Daclatasvir; Hepatitis C virus; Ledipasvir Core tip: Hepatitis C virus (HCV) NS5A inhibitors such as daclatasvir and ledipasvir in combination with other direct-acting antiviral agents against other regions of HCV with or without peginterferon/ribavirin are becoming available for daily clinical practice. These inhibitors can induce resistance mutations more easily in HCV genotype 1a patients than in HCV genotype 1b patients. HCV NS5A inhibitors should be used in combination regimens potent enough to prevent the emergence of resistant mutants and attention should be paid to these mutants potential emergence. Nakamoto S, Kanda T, Wu S, Shirasawa H, Yokosuka O. Hepatitis C virus NS5A inhibitors and drug resistance mutations. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Hepatitis C virus (HCV) infection is a leading cause of 2902 March 21, 2014 Volume 20 Issue 11

184 Nakamoto S et al. HCV NS5A inhibitors and mutations hepatocellular carcinoma (HCC) in Japan [1-3] and is one of the major causes of end-stage liver disease, HCC and liver transplantation in the United States and Europe [4,5]. A sustained virological response, defined as undetectable HCV RNA at week 24 (SVR24) after stopping combination therapy with peginterferon plus ribavirin for 48 wk in HCV genotype 1 and for 24 wk in HCV genotype 2, is achieved in approximately 50% and 80% of patients, respectively [6-9]. HCV genomes are translated into a single open reading frame of approximately 3011 amino acids after HCV infects hepatocytes. This protein is made into structural (core, E1, E2 and p7) and nonstructural proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B) by HCV-encoding and cellular proteases [9,10]. HCV NS5A is a multifunctional phosphoprotein required for HCV RNA replication and virus assembly [11,12]. HCV NS5A has no known enzymatic activities and its precise role in the HCV life cycle is not yet fully understood; however, there have been several reports concerning the association between HCV NS5A, interferon signaling and hepatocarcinogenesis [13-21]. HCV NS5A is an approximately 447-amino acid protein with an N-terminal amphipathic alpha helix (amino acids 5-25) and 3 structural Domains (Ⅰ, Ⅱ and Ⅲ; Figure 1) [22]. Domain Ⅰ (amino acids ) contains Zn 2+ -binding and RNA-binding motifs and has been crystallized as a dimer, which is essential for HCV replication [22-24]. Domains Ⅱ (amino acids ) and Ⅲ (amino acids ) appear unfolded [25]. Domain Ⅱ has been linked to RNA replication, while Domain Ⅲ is important for virus assembly. Both an interferon sensitivitydetermining region and an interferon/ribavirin resistancedetermining region exist in Domains Ⅱ-Ⅲ (Figure 1) [26-35]. Daclatasvir (DCV, formerly called BMS ) is a first-in-class HCV NS5A inhibitor with pmol/l potency and broad genotype coverage in vitro; DCV is currently the most studied among this class of inhibitors. The inhibitor was discovered through a screening hit with BMS-858, iminothiazolidinone, using a high-throughput cell-based HCV replicon assay. BMS-858 is a weak but specific inhibitor of HCV RNA replication for which resistance was mapped to the N-terminal of the HCV NS5A protein, indicating HCV NS5A protein as its target [36]. After chemical refinements to improve potency and HCV genotype coverage and the identification of symmetry as an important antiviral activity factor, DCV was identified as a candidate for clinical trials [36,37]. Its precise mode of action remains unclear, but DCV seems to bind with HCV NS5A at NS5A s dimer interface based on current models of the HCV NS5A structure and analysis of drug resistant mutants [23,24]. DCV induces an alteration in the subcellular localization of HCV NS5A, which inhibits the formation and activation of HCV replication complexes [38], and DCV blocks intracellular HCV RNA synthesis, virus assembly and secretion [39]. HCV NS5A inhibitors are safe at low concentrations, which make them attractive for use despite low genetic barriers, although, in fact, HCV NS5A inhibitors should be used with HCV NS3/4A, NS5B inhibitors or peginterferon plus ribavirin. It seems to be relatively weak in HCV genotypes other than genotype 1b [40,41]. Many trials using direct acting antiviral agents (DAAs) including HCV NS5A inhibitors are currently underway, and the exact resistance profile is becoming apparent [42-49]. In this review, resistance-associated variants (RAVs) against HCV NS5A inhibitors and their correlations to clinical studies, as well as the difference in efficacy among HCV genotypes, are discussed. EFFICACY OF DCV AND ITS RESISTANCE MUTATIONS IN VITRO Gao et al [36] reported that a chemical genetic approach identified an HCV NS5A inhibitor with a potent clinical effect. However, the in vitro resistance profile of DCV has been reported in detail, using the HCV replicon system, the HCV cell culture-adaptive virus system and human hepatocyte chimeric mice (Table 1) [36,40,50-53]. Resistance mutations have been mapped to the N-terminal region of HCV NS5A (the first 100 amino acids within Domain I). The primary mutation sites are M28T, Q30E/H/R, L31M/V, P32L, and Y93C/H/N for HCV genotype 1a, and L31F/V, P32L, and Y93H/N for HCV genotype 1b. L23F, R30Q, and P58S in HCV genotype 1b acted as secondary resistance mutations. The genetic barrier to resistance is lower for HCV genotype 1a than for HCV genotype 1b (Table 1). As single mutations, Q30E and Y93N in HCV genotype 1a conferred the highest levels of resistance, while for HCV genotype 1b, DCV retained sub-nanomolar potency against all variants with single amino acid substitutions. However, a linked resistance mutation remarkably decreased inhibitor susceptibility for both HCV genotypes 1a and 1b. These substitutions also confer cross-resistance to other HCV NS5A inhibitors. DCV-resistant variants remained fully sensitive to interferon-alpha and other classes of DAAs such as HCV NS3/4A and HCV NS5B inhibitors. Pelosi et al [54] reported that combinations of double and triple inhibitors could generate resistance pathways that differ from those developed during HCV NS5A inhibitor monotherapy. In HCV genotype 2a, HCV NS5A F28S, L31M, C92R, and Y93H were the major resistance mutations [55]. Residue 30 acted as a compensatory mutation, enhancing viral replication and modulating inhibitor sensitivity. The majority of HCV genotype 2a sequences stored in the European HCV database contain methionine at HCV NS5A residue 31 [56], which showed 140-fold resistance [50% effective concentrations (EC50) 6.9 nmol/l] compared to the HCV genotype 2a strain JFH1 wild-type replicon. In HCV genotype 3a, DCV showed sub-nanomolar potency, with EC50 ranging from 120 to 870 pmol/l [57]. HCV NS5A residues 31 and 93 were also detected as sites for DCV-selected resistance in HCV genotype 3a. DCV retained pmol/l potency against the HCV genotype 4 replicon (EC pmol/l). HCV NS5A residue 30 was 2903 March 21, 2014 Volume 20 Issue 11

185 Nakamoto S et al. HCV NS5A inhibitors and mutations ISDR ( ) PKR binding site ( ) IRRDR ( ) Domain I (1-213) LCSI LCSⅠ LCSII LCSⅡ Domain Ⅰ (1-213) Domain Ⅱ ( ) Domain Ⅲ ( ) AAH (5-25) NS5A 5 NTR Core E1 E2 p7 NS2 NS3 4A 4B NS5A NS5B Hepatitis C virus 3 NTR Figure 1 Structure of hepatitis C virus NS5A and hepatitis C virus (upper part and lower part, respectively) [22-35]. AAH: Amphipathic alpha helix; ISDR: Interferon sensitivity-determining region; IRRDR: Interferon/ribavirin resistance-determining region; LCS: Low-complexity sequence; NTR: Non-translated region. an important site for DCV-selected resistance; R30G and L30H conferred an EC50 of > 10 nmol/l. L30I-Y93R showed an EC50 of > 100 nmol/l [58]. HCV NS5A INHIBITORS OTHER THAN DCV In addition to DCV, ledipasvir (LDV, formerly GS-5885) and ABT-267 are entering phase Ⅲ clinical study [59], and GSK is currently in a phase Ⅱ trial [60]. LDV has a similar potency and resistance profile to that of DCV. Y93N conferred the highest resistance (EC50 > 500 nmol/l) as a single mutation [61]. ABT-267 also exhibited pmol/l potency and broad HCV genotype coverage with a low barrier to resistance [59,62]. Second generation HCV NS5A inhibitors such as GS-5816, ACH-3102, and MK-8742, displayed improved potency against the resistant variants selected by the first generation HCV NS5A inhibitors, including HCV genotype 1a-Q30E and L31V [63-65]. ACH-3102 has sub-nanomolar potency to HCV genotype 1b-combined variants such as 31V-93H as well as many HCV genotype 1a single variants, while the HCV genotype 1a-Y93 variant confers high-level resistance (Table 1). HCV NS5A INHIBITOR MONOTHERAPY STUDY IN VIVO Analyses of the sequence variants in a 14-d DCV monotherapy study revealed a correlation between resistant variants emerging in vivo with DCV treatment and those observed in the in vitro HCV replicon system (major substitutions at residues 28, 30, 31, and 93 for HCV genotype 1a, and residues 31 and 93 for HCV genotype 1b) [41,66]. Generally, HCV genotype 1b responded better to DCV than HCV genotype 1a. The primary difference in the resistance patterns observed in vitro and in vivo was the increased complexity of linked variant combinations observed in clinical samples [67]. The influence of natural baseline polymorphisms at positions involved in drug resistance within the HCV genome has been reported (Table 2). In an HCV genotype 1a patient with Q30R, 14-d DCV treatment at 60 mg exhibited the maximal response with a 2.9 log decrease in HCV RNA, while the mean HCV decrease in this study group was 3.8 logiu/ml [66]. The natural prevalence of Q30R in HCV genotype 1a is reported to be 1% (Figure 2) [40,55-58,68-72]. Patients with high baseline HCV genotype 1a resistant variants Q30E or L31M responded poorly to LDV. In HCV genotype 1b, the natural prevalence of L31M or Y93H is 4%-8% according to the HCV database, and these variants are observed at a higher frequency than HCV genotype 1a variants. However, the resistance levels of HCV genotype 1b single variants are relatively low compared to those of HCV genotype 1a variants (Table 1). Low-level resistant variants such as R30Q and Q54H- Y93H in HCV genotype 1b responded well to DCV treatment, while the combined variants R30Q-L31I- Y93H responded poorly to PPI-668 (Table 2) [73]. Few studies have examined HCV genotype 2 patients. IDX-719 exhibited a mean maximal viral load reduction of 2 logiu/ml, while patients with a pre-existing resistance substitution (L31M in HCV NS5A at baseline) responded poorly (Table 2). Indeed, the HCV genotype 2904 March 21, 2014 Volume 20 Issue 11

186 Nakamoto S et al. HCV NS5A inhibitors and mutations Table 1 In vitro resistance profiles according to hepatitis C virus genotypes [36,40,50-54,64] EC50 < 10 pmol/l < 100 pmol/l < 1 nmol/l < 10 nmol/l < 100 nmol/l < 1 μmol/l > 1 μmol/l DCV HCV GT 1b Wild (2.6 pmol/l) R30E, H 23F/93H 31F, M, V/93H Δ30/32L L28M L31F, V 30Q/31F 30Q/31M/93H L31M P32L 31V/58S R30Q Y93H, N 30H/31M 37L or 54H/93H 23F/31F 1a Wild (6 pmol/l) M28T L31V Q30E, K 31V/93H Q30H, R Y93C, H Y93N (> 500 nmol/l) L31M 28T/30H P32L 30H/93H H58D 30R/93C 30R/62D 2-6 GT2a (JFH1) GT3a GT2a (L31M) GT2a (Y93H) GT2a (F28S) GT4a, 5a, 6a GT2a (C92R) GT2b (31M) GT3a (Y93H) GT3a (A30K) GT4a (L30I/Y93R) GT3a (L31F) GT4a (R30G) GT4a (L30H) ACH-3102 HCV GT 1b Wild (7 pmol/l) Y93H P58S/Y93H L31V 31V/93H P58S/T64A/Y93H 1a wild (20 pmol/l) Q30R, E, K Y93C Y93H, N 1 Q30H M28T 28T/30H/93C 1 L31M, V P32L H58D 2-6 GT2a (JFH1) GT2a (L31M) GT2b (31M) GT3a, 4a, 5a, 6a 1 Analysis of hepatitis C virus (HCV) NS5A from patient samples [75]. EC50: Half maximal (50%) effective concentration; DCV: Daclatasvir; GT: Genotype. 2a M31 variant was less sensitive to IDX-719 (EC nmol/l) compared to the HCV wild-type L31 replicon (EC nmol/l) [74]. In the HCV database, the most prevalent amino acid at residue 31 is methionine, indicating that HCV genotype 2a may respond poorly to DCV. In HCV genotype 3a patients, A30K or Y93H conferred high-level resistance to PPI-668 (Table 2). These data indicate that the in vitro resistance profile correlates with the in vivo HCV NS5A inhibitor monotherapy efficacy. As for the second generation HCV NS5A inhibitor ACH-3102, potency was not attenuated at least in patients having a minor prevalence of M28V, L31M or Y93 variants (approximately 30%) [75]. Long-term persistence of HCV NS5A resistance polymorphisms was observed following 14-d DCV monotherapy and preserved for up to 6 mo. Viral fitness, rather than DCV resistance, may determine which viral variants emerge as dominant in populations [67]. In 3-d monotherapy treatment of patients with LDV [61,76], HCV NS5A resistance polymorphisms, present at baseline or selected during LDV treatment, persisted in 100% and 50% of HCV genotype 1a- and 1b-infected patients, respectively, at 48 wk following treatment cessation. These data indicated that in contrast to HCV NS3 resistant vari- ants to HCV NS3/4A inhibitors, those of HCV NS5A can fit well instead of HCV wild-type. The data also highlighted the need to use HCV NS5A inhibitor in combination with other DAAs or interferon to avoid producing drug-resistant virus. A baseline polymorphism with a minimal effect on DCV s anti-hcv effect can affect the emergence of resistance. E62D at baseline did not contribute to DCV resistance; however, the linked variant, Q30R-E62D, conferred high-level resistance in vitro and is likely responsible for a viral breakthrough in vivo [77]. The pattern of resistant variants and the level of resistance observed varied depending on the selective pressure; 14-d treatment with low-dose DCV (1 mg) selected relatively low-level resistant variants, such as Q30R/H and M28T, while treatment with high-dose DCV (60 mg) selected high-level resistant variants, such as Q30E and Y93N, and linked variants, such as 28T-30H [66]. COMBINATION THERAPY WITH DCV In vitro studies showed that DCV-resistant variants remained fully sensitive to other classes of DAAs, such as protease inhibitor and interferon. The COMMAND-1 study combining DCV with peginterferon-alpha and 2905 March 21, 2014 Volume 20 Issue 11

187 Nakamoto S et al. HCV NS5A inhibitors and mutations Table 2 Resistance profiles of hepatitis C virus NS5A inhibitors in hepatitis C virus genotype 1- and 2-infected patients [61,66,73-75] HCV NS5A inhibitor Mean maximal viral decline (log IU/mL) Maximal viral decline in patients with RAVs at baseline (log IU/mL) HCV genotype 1a-infected DCV 3.8 (60 mg, 14 d) Q30R (10%) 2.9 LDV (10-90 mg, 3 d) Q30E/Q 0.88 L31M 0.16 Y93C (12%) 1.6 PPI ( mg, 3 d) M28V (50%) 3.7 M28T (7%) 2.8 M28T (10%)/L31M (11%) 3.6 H58D (69%)/N (31%) 2.2 IDX ( mg, 3 d) M28M/V 3.6 ACH ( mg, single dose) M28V, T (2%-24%) 3.4 to 4 L31M (28%) 3.4 Y93C, D, H (2%-3%) 4 to 4.6 HCV genotype 1b-infected DCV 4.3 (10 mg, 14 d) Q54H, N > 4 Q54H/Y93H > 4 LDV 3.3 (10 mg, 3 d) L31M 2.09 PPI (40 mg, 3 d; only 1 patient) R30Q ( mg, 3 d) L31M 4 P58S 3.8 L28M (7%), R30Q (76%), L31M (20%) 3.5 R30Q/L31I/Y93H 0.33 IDX (25-50 mg, 3 d) R30Q/Y93H 2.8 HCV genotype 2a-infected PPI (160 mg, 3 d; only 1 patient) F28L/A30K/L31M 0.33 IDX ( mg, 3 d) L31M 0.45 L31L/M 0.85 HCV genotype 2b-infected PPI (160 mg, 3 d) A30K 0.48 Y93H (7%) 0.45 Y93H 0.25 DCV: Daclatasvir; LDV: Ledipasvir; RAVs: Resistance-associated variants; HCV: Hepatitis C virus. ribavirin revealed that SVR24 rates are lower in patients infected with HCV genotype 1a than in patients infected with HCV genotype 1b [78], which is consistent with the in vitro data. In a 24-wk dual-oral therapy with DCV and asunaprevir (ASV) in HCV genotype 1b-infected Japanese patients, 90.5% of null responders and 63.6% of patients ineligible for or intolerant of peginterferonalpha and ribavirin achieved SVR24 [79]. Of interest, many patients in this study with pre-existing resistanceassociated HCV NS5A polymorphisms were cured of their chronic HCV infection [80]. The presence of DCV or ASV RAVs at baseline was no longer a strong predictor of treatment failure in HCV genotype 1b patients receiving dual therapy [44]. In line with these results, the AAI US/ French study demonstrated that a dual regimen in HCV genotype 1b null responders resulted in SVR12, defined as undetectable HCV RNA at week 12 after treatment cessation, in 78% with ASV 200 mg bid regimens and 65% with qid regimens. Among 8 patients with viral breakthrough, 5 had baseline HCV NS5A resistant variants [81]. At viral breakthrough, 7 patients had RAVs in both the HCV NS5A and HCV NS3 regions. In 1 relapsed patient, no baseline variants were detected. At relapse, both HCV NS5A and HCV NS3 RAVs were observed. On the other hand, in an AAI sentinel cohort, 6 of 9 HCV genotype 1a patients receiving dual therapy had viral breakthrough [82]. No baseline variants were detected and resistance mutations to both antiviral agents were found in all cases at the time of viral breakthrough. In these cases, the following high-level HCV NS5A-resistant variants were detected (3400- to > fold resistance) Y93N, C, L31V, Q30R-L31M [83]. In prior null responders receiving triple therapy (DCV, ASV, and ribavirin), 10/18 (56%) HCV genotype 1a patients experienced viral breakthrough, while 4/4 HCV genotype 1b patients achieved SVR4, defined as undetectable HCV RNA at week 4 after treatment cessation [81]. In difficult-to-cure subgroups, such as HCV genotype 1a or interferon-ineligible patients, a combination of only 2 DAAs with a low genetic barrier to resistance with or without ribavirin could be sub-optimal in terms of SVR rates and lead to selection of HCV NS5A RAVs [84,85]. A quad regimen of DCV, ASV, and peginterferonalpha plus ribavirin has also been reported, resulting in 90%-95% SVR24 in HCV genotype 1a and 1b prior null responders. No viral breakthrough occurred. Two patients relapsed with no baseline variants being detected. At relapse, both NS3 and NS5A variants were observed. In 1 HCV genotype 1a patient, HCV NS3 (Q80Q/L) and HCV NS5A (L31M/L) variants were detected 8 h after treatment initiation. The quad regimen seems to be sufficient to suppress the emergence of high-level HCV 2906 March 21, 2014 Volume 20 Issue 11

188 Nakamoto S et al. HCV NS5A inhibitors and mutations GT1a n = 548 n = 538 M (98) Q (98) L (99) P (100) Y (99) T (< 1) R (1) M (< 1) H (< 1) H (1) C (< 1) N (< 1) GT1b n = 1796 n = 239 L (99) R (90-93) L (94) P (100) Y (92-98) Q (3) M (4-6) H (4-8) H (< 1) V (0-2) C (< 1) GT2a n = 43 F (98) K (98) M (74) P (100) C (100) Y (100) I (2) R (2) L (26) GT2b n = 101 L (92) K (100) M (85) P (100) L (98) L (100) F (8) L (15) C (2) GT3a n = 454 M (99) A (91) L (100) P (100) E (100) Y (98) V (< 1) T (6) H (1) I (< 1) K (3) L (< 1) GT4 n = 40 L (83) R (50) M (93) P (100) P (90) Y (88) M (13) L (30) L (7.5) T (10) H (5) I (2.5) S (10) S (5) V (2.5) Q (5) T (2.5) A (2.5) T (2.5) Figure 2 Prevalence of naturally occurring resistance variants against hepatitis C virus NS5A in previous reports. Each bar represents an NS5A terminal protein with amino acid numbers. Letters within the bars represent the dominant amino acid at the indicated positions (prevalence %). Letters below the bars represent minor amino acids, and amino acids prevalence (%) is shown in parentheses. Genotype (GT) 1a, based on Ref [40] (n = 548) and Ref [68] (n = 538); GT1b, based on Ref [40] (n = 1796) and Ref [68] (n = 239); GT2, based on Los Alamos HCV data-base (n = 43 and n = 101 for GT2a and GT2b, respectively); GT3a, based on Ref [57] (n = 454); GT4, based on Ref [58] (n = 40). NS5A resistance [82,83]. Karino et al [80] reported the long-term virologic characterization of patients failing to respond to ASV/ DCV. In line with the results of monotherapy studies, DCV-resistant variants persisted through 48 wk posttreatment, whereas ASV-resistant substitutions were no longer detectable after 48 wk. The selection of durable resistant variant strains with high-level resistance might be problematic. These results indicated that, in difficultto-treat patients, the optimal interferon-free regimen should combine a drug with potent antiviral activity (HCV NS3/4A inhibitor or HCV NS5A inhibitor) with a drug with a high genetic barrier to resistance (HCV NS5B polymerase inhibitor) [84]. PROMISING INTERFERON-FREE REGIMEN WITH DCV While the ASV and DCV dual regimen only seems effective in limited patients such as HCV genotype 1b patients, high SVR has been achieved with broad genotype coverage by regimens combining 3 or more DAAs, or DAAs with a high barrier to resistance. A quad therapy regimen consisting of 12 wk of a ritonavir-boosted HCV NS3/ 4A inhibitor (ABT-450/r) plus an HCV NS5B polymerase inhibitor (ABT-333) and an HCV NS5A inhibitor (ABT-267) obtained 96% of SVR12 in untreated HCV genotype 1a patients and 89% of SVR12 in HCV genotype 1a null responders [86,87]. An interferon-free and ribavirin-free triple combination of DAAs (ASV, DCV, and the non-nucleoside polymerase inhibitor BMS ) resulted in more than 90% of SVR12 in untreated HCV genotype 1a and 1b patients [88]. A combination of DCV and a nucleotide analogue inhibitor of HCV RNAdependent RNA polymerase, sofosbuvir, with or without ribavirin for 24 wk achieved SVR in 100% of untreated HCV genotype 1a and 1b patients (n = 44) as well as in HCV genotype 1a and 1b patients (n = 41) who failed to respond to prior treatment with telaprevir or boceprevir, peginterferon and ribavirin. SVR was achieved in 93% of patients infected with HCV genotypes 2 and 3 (n = 44) [89,90]. CONCLUSION Currently, DCV is the most studied HCV NS5A inhibitor 2907 March 21, 2014 Volume 20 Issue 11

189 Nakamoto S et al. HCV NS5A inhibitors and mutations A IL28B SNP rs TT IFN + RBV + DAA or IFN-free Yes IFN-tolerate patients TG/GG IFN-free No IFN-free B Yes IFN + RBV or IFN-free IFN-tolerate patients No IFN-free C NI + NS5A inhibitor ± RBV PI + NS5A inhibitor ± RBV HCV G1 NI + PI ± RBV IFN-free NI + PI + NS5A inhibitor ± RBV HCV G2 NI + RBV Figure 3 Algorithm of current hepatitis C virus treatment options. A: Hepatitis C virus (HCV) genotype 1 patients; B: HCV genotype 2 patients; C: Interferon (IFN)-free regimens. G1: Genotype 1; G2: Genotype 2; RBV: Ribavirin; NI: Nucleoside inhibitor; PI: Protease inhibitor. with pmol/l potency and HCV pan-genotype coverage. HCV NS5A-resistant variants exist naturally and emerge frequently after virologic response failure with suboptimal treatment including HCV NS5A inhibitors. Cross-resistance is observed to all HCV NS5A inhibitors currently entering the clinical trial stage, although promising second generation HCV NS5A inhibitors with improved potency are reported. Long-term clinical consequences of previously selected resistant variants are still unknown at this time. At present, patients should be treated according to the recommendations [91], which do not mention any HCV NS5A inhibitors. HCV NS5A inhibitors should be used in combination regimens potent enough to prevent the emergence of resistant variants. An algorithm of the current treatment options for HCV genotypes 1 and 2 is shown in Figure 3. In the near future, HCV NS5A inhibitors will play a critical role in interferon-free regimens in HCV genotype 1 patients. REFERENCES 1 Okuda K. Hepatocellular carcinoma. J Hepatol 2000; 32: [PMID: ] 2 Nakamoto S, Imazeki F, Fukai K, Fujiwara K, Arai M, Kanda T, Yonemitsu Y, Yokosuka O. Association between muta March 21, 2014 Volume 20 Issue 11

190 Nakamoto S et al. HCV NS5A inhibitors and mutations tions in the core region of hepatitis C virus genotype 1 and hepatocellular carcinoma development. J Hepatol 2010; 52: [PMID: DOI: /j.jhep ] 3 Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci USA 1990; 87: [PMID: ] 4 Di Bisceglie AM. Hepatitis C and hepatocellular carcinoma. Hepatology 1997; 26: 34S-38S [PMID: ] 5 Pacholczyk M, Łągiewska B, Lisik W, Tronina O, Wasiak D, Cieciura T, Chmura A. Liver transplantation for HCV cirrhosis; cautious optimism after 10 years of experience. Ann Transplant 2012; 17: 5-10 [PMID: DOI: / AOT ] 6 Nakamoto S, Kanda T, Yonemitsu Y, Arai M, Fujiwara K, Fukai K, Kanai F, Imazeki F, Yokosuka O. Quantification of hepatitis C amino acid substitutions 70 and 91 in the core coding region by real-time amplification refractory mutation system reverse transcription-polymerase chain reaction. Scand J Gastroenterol 2009; 44: [PMID: DOI: / ] 7 Kanda T, Imazeki F, Yonemitsu Y, Mikami S, Takada N, Nishino T, Takashi M, Tsubota A, Kato K, Sugiura N, Tawada A, Wu S, Tanaka T, Nakamoto S, Mikata R, Tada M, Chiba T, Kurihara T, Arai M, Fujiwara K, Kanai F, Yokosuka O. Quantification of hepatitis C virus in patients treated with peginterferon-alfa 2a plus ribavirin treatment by COBAS TaqMan HCV test. J Viral Hepat 2011; 18: e292-e297 [PMID: DOI: /j x] 8 Kanda T, Imazeki F, Azemoto R, Yonemitsu Y, Mikami S, Kita K, Takashi M, Sunaga M, Wu S, Nakamoto S, Tawada A, Arai M, Kato K, Yoshida Y, Koma Y, Fujiwara K, Fukai K, Suzuki N, Yokosuka O. Response to peginterferon-alfa 2b and ribavirin in Japanese patients with chronic hepatitis C genotype 2. Dig Dis Sci 2011; 56: [PMID: DOI: /s ] 9 Kanda T, Imazeki F, Yokosuka O. New antiviral therapies for chronic hepatitis C. Hepatol Int 2010; 4: [PMID: DOI: /s ] 10 Watashi K, Shimotohno K. Chemical genetics approach to hepatitis C virus replication: cyclophilin as a target for antihepatitis C virus strategy. Rev Med Virol 2007; 17: [PMID: ] 11 Tanji Y, Kaneko T, Satoh S, Shimotohno K. Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A. J Virol 1995; 69: [PMID: ] 12 Macdonald A, Harris M. Hepatitis C virus NS5A: tales of a promiscuous protein. J Gen Virol 2004; 85: [PMID: ] 13 Gale MJ, Korth MJ, Tang NM, Tan SL, Hopkins DA, Dever TE, Polyak SJ, Gretch DR, Katze MG. Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 1997; 230: [PMID: ] 14 Gale M, Blakely CM, Kwieciszewski B, Tan SL, Dossett M, Tang NM, Korth MJ, Polyak SJ, Gretch DR, Katze MG. Control of PKR protein kinase by hepatitis C virus nonstructural 5A protein: molecular mechanisms of kinase regulation. Mol Cell Biol 1998; 18: [PMID: ] 15 Polyak SJ, Paschal DM, McArdle S, Gale MJ, Moradpour D, Gretch DR. Characterization of the effects of hepatitis C virus nonstructural 5A protein expression in human cell lines and on interferon-sensitive virus replication. Hepatology 1999; 29: [PMID: ] 16 Gale M, Kwieciszewski B, Dossett M, Nakao H, Katze MG. Antiapoptotic and oncogenic potentials of hepatitis C virus are linked to interferon resistance by viral repression of the PKR protein kinase. J Virol 1999; 73: [PMID: ] 17 Ghosh AK, Majumder M, Steele R, Meyer K, Ray R, Ray RB. Hepatitis C virus NS5A protein protects against TNF-alpha mediated apoptotic cell death. Virus Res 2000; 67: [PMID: ] 18 Majumder M, Ghosh AK, Steele R, Ray R, Ray RB. Hepatitis C virus NS5A physically associates with p53 and regulates p21/waf1 gene expression in a p53-dependent manner. J Virol 2001; 75: [PMID: ] 19 Pflugheber J, Fredericksen B, Sumpter R, Wang C, Ware F, Sodora DL, Gale M. Regulation of PKR and IRF-1 during hepatitis C virus RNA replication. Proc Natl Acad Sci USA 2002; 99: [PMID: ] 20 Kanda T, Steele R, Ray R, Ray RB. Inhibition of intrahepatic gamma interferon production by hepatitis C virus nonstructural protein 5A in transgenic mice. J Virol 2009; 83: [PMID: DOI: /JVI ] 21 Tamura R, Kanda T, Imazeki F, Wu S, Nakamoto S, Tanaka T, Arai M, Fujiwara K, Saito K, Roger T, Wakita T, Shirasawa H, Yokosuka O. Hepatitis C Virus nonstructural 5A protein inhibits lipopolysaccharide-mediated apoptosis of hepatocytes by decreasing expression of Toll-like receptor 4. J Infect Dis 2011; 204: [PMID: DOI: /infdis/ jir381] 22 Tellinghuisen TL, Marcotrigiano J, Gorbalenya AE, Rice CM. The NS5A protein of hepatitis C virus is a zinc metalloprotein. J Biol Chem 2004; 279: [PMID: ] 23 Tellinghuisen TL, Marcotrigiano J, Rice CM. Structure of the zinc-binding domain of an essential component of the hepatitis C virus replicase. Nature 2005; 435: [PMID: ] 24 Love RA, Brodsky O, Hickey MJ, Wells PA, Cronin CN. Crystal structure of a novel dimeric form of NS5A domain I protein from hepatitis C virus. J Virol 2009; 83: [PMID: DOI: /JVI ] 25 Bartenschlager R, Lohmann V, Penin F. The molecular and structural basis of advanced antiviral therapy for hepatitis C virus infection. Nat Rev Microbiol 2013; 11: [PMID: DOI: /nrmicro3046] 26 Enomoto N, Sakuma I, Asahina Y, Kurosaki M, Murakami T, Yamamoto C, Izumi N, Marumo F, Sato C. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J Clin Invest 1995; 96: [PMID: ] 27 Enomoto N, Sakuma I, Asahina Y, Kurosaki M, Murakami T, Yamamoto C, Ogura Y, Izumi N, Marumo F, Sato C. Mutations in the nonstructural protein 5A gene and response to interferon in patients with chronic hepatitis C virus 1b infection. N Engl J Med 1996; 334: [PMID: ] 28 Kurosaki M, Enomoto N, Murakami T, Sakuma I, Asahina Y, Yamamoto C, Ikeda T, Tozuka S, Izumi N, Marumo F, Sato C. Analysis of genotypes and amino acid residues 2209 to 2248 of the NS5A region of hepatitis C virus in relation to the response to interferon-beta therapy. Hepatology 1997; 25: [PMID: ] 29 Penin F, Brass V, Appel N, Ramboarina S, Montserret R, Ficheux D, Blum HE, Bartenschlager R, Moradpour D. Structure and function of the membrane anchor domain of hepatitis C virus nonstructural protein 5A. J Biol Chem 2004; 279: [PMID: ] 30 Kanda T, Yokosuka O, Imazeki F, Tanaka M, Shino Y, Shimada H, Tomonaga T, Nomura F, Nagao K, Ochiai T, Saisho H. Inhibition of subgenomic hepatitis C virus RNA in Huh-7 cells: ribavirin induces mutagenesis in HCV RNA. J Viral Hepat 2004; 11: [PMID: ] 31 El-Shamy A, Nagano-Fujii M, Sasase N, Imoto S, Kim SR, Hotta H. Sequence variation in hepatitis C virus nonstructural protein 5A predicts clinical outcome of pegylated interferon/ribavirin combination therapy. Hepatology 2008; 48: [PMID: DOI: /hep.22339] 2909 March 21, 2014 Volume 20 Issue 11

191 Nakamoto S et al. HCV NS5A inhibitors and mutations 32 Verdegem D, Badillo A, Wieruszeski JM, Landrieu I, Leroy A, Bartenschlager R, Penin F, Lippens G, Hanoulle X. Domain 3 of NS5A protein from the hepatitis C virus has intrinsic alpha-helical propensity and is a substrate of cyclophilin A. J Biol Chem 2011; 286: [PMID: DOI: /jbc.M ] 33 El-Shamy A, Shoji I, Kim SR, Ide Y, Imoto S, Deng L, Yoon S, Fujisawa T, Tani S, Yano Y, Seo Y, Azuma T, Hotta H. Sequence heterogeneity in NS5A of hepatitis C virus genotypes 2a and 2b and clinical outcome of pegylated-interferon/ribavirin therapy. PLoS One 2012; 7: e30513 [PMID: DOI: /journal.pone ] 34 El-Shamy A, Shoji I, El-Akel W, Bilasy SE, Deng L, El-Raziky M, Jiang DP, Esmat G, Hotta H. NS5A sequence heterogeneity of hepatitis C virus genotype 4a predicts clinical outcome of pegylated-interferon-ribavirin therapy in Egyptian patients. J Clin Microbiol 2012; 50: [PMID: DOI: /JCM ] 35 Scheel TK, Prentoe J, Carlsen TH, Mikkelsen LS, Gottwein JM, Bukh J. Analysis of functional differences between hepatitis C virus NS5A of genotypes 1-7 in infectious cell culture systems. PLoS Pathog 2012; 8: e [PMID: DOI: /journal.ppat ] 36 Gao M, Nettles RE, Belema M, Snyder LB, Nguyen VN, Fridell RA, Serrano-Wu MH, Langley DR, Sun JH, O Boyle DR, Lemm JA, Wang C, Knipe JO, Chien C, Colonno RJ, Grasela DM, Meanwell NA, Hamann LG. Chemical genetics strategy identifies an HCV NS5A inhibitor with a potent clinical effect. Nature 2010; 465: [PMID: DOI: /nature08960] 37 Lemm JA, Leet JE, O Boyle DR, Romine JL, Huang XS, Schroeder DR, Alberts J, Cantone JL, Sun JH, Nower PT, Martin SW, Serrano-Wu MH, Meanwell NA, Snyder LB, Gao M. Discovery of potent hepatitis C virus NS5A inhibitors with dimeric structures. Antimicrob Agents Chemother 2011; 55: [PMID: DOI: /AAC ] 38 Lee C, Ma H, Hang JQ, Leveque V, Sklan EH, Elazar M, Klumpp K, Glenn JS. The hepatitis C virus NS5A inhibitor (BMS ) alters the subcellular localization of the NS5A non-structural viral protein. Virology 2011; 414: [PMID: DOI: /j.virol ] 39 Guedj J, Dahari H, Rong L, Sansone ND, Nettles RE, Cotler SJ, Layden TJ, Uprichard SL, Perelson AS. Modeling shows that the NS5A inhibitor daclatasvir has two modes of action and yields a shorter estimate of the hepatitis C virus half-life. Proc Natl Acad Sci USA 2013; 110: [PMID: DOI: /pnas ] 40 Fridell RA, Qiu D, Wang C, Valera L, Gao M. Resistance analysis of the hepatitis C virus NS5A inhibitor BMS in an in vitro replicon system. Antimicrob Agents Chemother 2010; 54: [PMID: DOI: / AAC ] 41 Nettles RE, Gao M, Bifano M, Chung E, Persson A, Marbury TC, Goldwater R, DeMicco MP, Rodriguez-Torres M, Vutikullird A, Fuentes E, Lawitz E, Lopez-Talavera JC, Grasela DM. Multiple ascending dose study of BMS , a nonstructural protein 5A replication complex inhibitor, in patients infected with hepatitis C virus genotype 1. Hepatology 2011; 54: [PMID: DOI: /hep.24609] 42 Pol S, Ghalib RH, Rustgi VK, Martorell C, Everson GT, Tatum HA, Hézode C, Lim JK, Bronowicki JP, Abrams GA, Bräu N, Morris DW, Thuluvath PJ, Reindollar RW, Yin PD, Diva U, Hindes R, McPhee F, Hernandez D, Wind-Rotolo M, Hughes EA, Schnittman S. Daclatasvir for previously untreated chronic hepatitis C genotype-1 infection: a randomised, parallel-group, double-blind, placebo-controlled, dose-finding, phase 2a trial. Lancet Infect Dis 2012; 12: [PMID: DOI: /S (12)70138-X] 43 Suk-Fong Lok A. HCV NS5A inhibitors in development. Clin Liver Dis 2013; 17: [PMID: DOI: /j.cld ] 44 Pawlotsky JM. NS5A inhibitors in the treatment of hepatitis C. J Hepatol 2013; 59: [PMID: DOI: / j.jhep ] 45 Wyles DL. Antiviral resistance and the future landscape of hepatitis C virus infection therapy. J Infect Dis 2013; 207 Suppl 1: S33-S39 [PMID: DOI: /infdis/jis761] 46 Vermehren J, Sarrazin C. The role of resistance in HCV treatment. Best Pract Res Clin Gastroenterol 2012; 26: [PMID: DOI: /j.bpg ] 47 Yang PL, Gao M, Lin K, Liu Q, Villareal VA. Anti-HCV drugs in the pipeline. Curr Opin Virol 2011; 1: [PMID: DOI: /j.coviro ] 48 Londoño MC, Lens S, Forns X. Interferon free regimens for the difficult-to-treat : are we there? J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 49 Herbst DA, Reddy KR. NS5A inhibitor, daclatasvir, for the treatment of chronic hepatitis C virus infection. Expert Opin Investig Drugs 2013; 22: [PMID: DOI: / ] 50 Scheel TK, Gottwein JM, Mikkelsen LS, Jensen TB, Bukh J. Recombinant HCV variants with NS5A from genotypes 1-7 have different sensitivities to an NS5A inhibitor but not interferon-α. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 51 Ramirez S, Li YP, Jensen SB, Pedersen J, Gottwein JM, Bukh J. Highly efficient infectious cell culture of three hepatitis C virus genotype 2b strains and sensitivity to lead protease, nonstructural protein 5A, and polymerase inhibitors. Hepatology 2014; 59: [PMID: DOI: /hep.26660] 52 Abe H, Hayes CN, Hiraga N, Imamura M, Tsuge M, Miki D, Takahashi S, Ochi H, Chayama K. A translational study of resistance emergence using sequential direct-acting antiviral agents for hepatitis C using ultra-deep sequencing. Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ] 53 Shi N, Hiraga N, Imamura M, Hayes CN, Zhang Y, Kosaka K, Okazaki A, Murakami E, Tsuge M, Abe H, Aikata H, Takahashi S, Ochi H, Tateno-Mukaidani C, Yoshizato K, Matsui H, Kanai A, Inaba T, McPhee F, Gao M, Chayama K. Combination therapies with NS5A, NS3 and NS5B inhibitors on different genotypes of hepatitis C virus in human hepatocyte chimeric mice. Gut 2013; 62: [PMID: DOI: /gutjnl ] 54 Pelosi LA, Voss S, Liu M, Gao M, Lemm JA. Effect on hepatitis C virus replication of combinations of direct-acting antivirals, including NS5A inhibitor daclatasvir. Antimicrob Agents Chemother 2012; 56: [PMID: DOI: /AAC ] 55 Fridell RA, Qiu D, Valera L, Wang C, Rose RE, Gao M. Distinct functions of NS5A in hepatitis C virus RNA replication uncovered by studies with the NS5A inhibitor BMS J Virol 2011; 85: [PMID: DOI: / JVI ] 56 Combet C, Garnier N, Charavay C, Grando D, Crisan D, Lopez J, Dehne-Garcia A, Geourjon C, Bettler E, Hulo C, Le Mercier P, Bartenschlager R, Diepolder H, Moradpour D, Pawlotsky JM, Rice CM, Trépo C, Penin F, Deléage G. euhcvdb: the European hepatitis C virus database. Nucleic Acids Res 2007; 35: D363-D366 [PMID: ] 57 Wang C, Valera L, Jia L, Kirk MJ, Gao M, Fridell RA. In vitro activity of daclatasvir on hepatitis C virus genotype 3 NS5A. Antimicrob Agents Chemother 2013; 57: [PMID: DOI: /AAC ] 58 Wang C, Jia L, Huang H, Qiu D, Valera L, Huang X, Sun JH, Nower PT, O Boyle DR, Gao M, Fridell RA. In vitro activity of BMS on hepatitis C virus genotype 4 NS5A. Antimicrob Agents Chemother 2012; 56: [PMID: DOI: /AAC ] 59 Lawitz E, Marbury T, Cambell A, Dumas E, Kapoor M, Pilot March 21, 2014 Volume 20 Issue 11

192 Nakamoto S et al. HCV NS5A inhibitors and mutations Matias T, Krishnan P, Setze C, Xie W, Podsadecki T, Bernstein B, Williams L. Safety and antiviral acyivity of ABT-267, a novel NS5A inhibitor, during 3-day monotherapy: first study in HCV genotype-1 (GT-1)-infected treatment-naive subject. J Hepatol 2012; 56 suppl 2: S469-S470 [47th annual meeting EASL abstract] 60 Wilfret DA, Walker J, Adkison KK, Jones LA, Lou Y, Gan J, Castellino S, Moseley CL, Horton J, de Serres M, Culp A, Goljer I, Spreen W. Safety, tolerability, pharmacokinetics, and antiviral activity of GSK , an inhibitor of hepatitis C virus (HCV) NS5A, in healthy subjects and subjects chronically infected with HCV genotype 1. Antimicrob Agents Chemother 2013; 57: [PMID: DOI: /AAC ] 61 Lawitz EJ, Gruener D, Hill JM, Marbury T, Moorehead L, Mathias A, Cheng G, Link JO, Wong KA, Mo H, McHutchison JG, Brainard DM. A phase 1, randomized, placebo-controlled, 3-day, dose-ranging study of GS-5885, an NS5A inhibitor, in patients with genotype 1 hepatitis C. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 62 Gao M. Antiviral activity and resistance of HCV NS5A replication complex inhibitors. Curr Opin Virol 2013; 3: [PMID: DOI: /j.coviro ] 63 Cheng G, Yu M, Peng B, Lee YJ, Trejo-Martin A, Gong R, Bush C, Worth A, Nash M, Chan K, Yang H, Beran R, Tian Y, Perry J, Taylor J, Yang C, Paulson M, Delaney W, Link JO. GS-5816, a second generation HCV NS5A inhibitor with potent antiviral activity, broad genotypic coverage and a high resistance barrier. J Hepatol 2013; 58 suppl 1: S484-S485 [48th annual meeting EASL abstract] 64 Yang G, Wiles J, Patel D, Zhao Y, Fabrycki J, Weinheimer S, Marlor C, Rivera J, Wang Q, Gadhachanda V, Hashimoto A, Chen D, Pais G, Wang X, Deshpande M, Stauber K, Huang M, Phadke A. Preclinical characteristics of ACH-3102: a novel HCV NS5A inhibitor with improved potency against genotype-1a virus and variants resistant to 1st generation of NS5A inhibitors. J Hepatol 2012; 56 suppl 2: S330 [DOI: / S (12) ] 65 Liu R, Kong R, Mann P, Ingravallo P, Zhai Y, Xia E, Ludmerer S, Kozlowski J, Coburn C. In vitro resistance analysis of HCV NS5A inhibitor: MK-8742 demonstrates increased potency against clinical resistance variants and higher resisitance barrier. J Hepatol 2012; 56 suppl 2: S334-S335 [DOI: / S (12) ] 66 Fridell RA, Wang C, Sun JH, O Boyle DR, Nower P, Valera L, Qiu D, Roberts S, Huang X, Kienzle B, Bifano M, Nettles RE, Gao M. Genotypic and phenotypic analysis of variants resistant to hepatitis C virus nonstructural protein 5A replication complex inhibitor BMS in humans: in vitro and in vivo correlations. Hepatology 2011; 54: [PMID: DOI: /hep.24594] 67 Wang C, Sun JH, O Boyle DR, Nower P, Valera L, Roberts S, Fridell RA, Gao M. Persistence of resistant variants in hepatitis C virus-infected patients treated with the NS5A replication complex inhibitor daclatasvir. Antimicrob Agents Chemother 2013; 57: [PMID: DOI: / AAC ] 68 Bartels DJ, Sullivan JC, Zhang EZ, Tigges AM, Dorrian JL, De Meyer S, Takemoto D, Dondero E, Kwong AD, Picchio G, Kieffer TL. Hepatitis C virus variants with decreased sensitivity to direct-acting antivirals (DAAs) were rarely observed in DAA-naive patients prior to treatment. J Virol 2013; 87: [PMID: DOI: /JVI ] 69 Kuiken C, Hraber P, Thurmond J, Yusim K. The hepatitis C sequence database in Los Alamos. Nucleic Acids Res 2008; 36: D512-D516 [PMID: ] 70 Hernandez D, Zhou N, Ueland J, Monikowski A, McPhee F. Natural prevalence of NS5A polymorphisms in subjects infected with hepatitis C virus genotype 3 and their effects on the antiviral activity of NS5A inhibitors. J Clin Virol 2013; 57: [PMID: DOI: /j.jcv ] 71 Plaza Z, Soriano V, Vispo E, del Mar Gonzalez M, Barreiro P, Seclén E, Poveda E. Prevalence of natural polymorphisms at the HCV NS5A gene associated with resistance to daclatasvir, an NS5A inhibitor. Antivir Ther 2012; 17: [PMID: DOI: /IMP2091] 72 Suzuki F, Sezaki H, Akuta N, Suzuki Y, Seko Y, Kawamura Y, Hosaka T, Kobayashi M, Saito S, Arase Y, Ikeda K, Kobayashi M, Mineta R, Watahiki S, Miyakawa Y, Kumada H. Prevalence of hepatitis C virus variants resistant to NS3 protease inhibitors or the NS5A inhibitor (BMS ) in hepatitis patients with genotype 1b. J Clin Virol 2012; 54: [PMID: DOI: /j.jcv ] 73 Lalezari JP, Farrell GC, Shah PS, Schwab C, Walsh D, Vig P, Brown NA, Ruby E, Halfon S, Colonno R, Li L, Johnston B, Wargin W, Gane EJ. PPI-668, a potent new pan-genotypic HCV NS5A inhibitor: phase 1 efficacy and safety. Hepatology 2012; 56 Suppl: 1065A 74 McCarville JF, Seifer M, Standring DN, Mayers DL. IDX- 06A-001 Investigator Team. Treatment-emergent variants following 3 days of monotherapy with IDX719, a potent, pan-genotypic NS5A inhibitor, in subjects infected with HCV genotypes 1-4. J Hepatol 2013; 58 suppl 1: S491-S492 [48th annual meeting EASL abstract] 75 Yang G, Patel D, Zhao Y, Fabrycki J, Yang W, Podos S, Robison H, Robarge L, Kocinsky H, Deshpande M, Huang M. Findings from clinical virology studies on ACH-3102 are consistent with preclinical observations on its improved potency against genotype-1a HCV and resistant variants. J Hepatol 2013; 58 suppl 1: S487-S488 [DOI: / S (13) ] 76 Wong KA, Worth A, Martin R, Svarovskaia E, Brainard DM, Lawitz E, Miller MD, Mo H. Characterization of Hepatitis C virus resistance from a multiple-dose clinical trial of the novel NS5A inhibitor GS Antimicrob Agents Chemother 2013; 57: [PMID: ] 77 Sun JH, O Boyle Ii DR, Zhang Y, Wang C, Nower P, Valera L, Roberts S, Nettles RE, Fridell RA, Gao M. Impact of a baseline polymorphism on the emergence of resistance to the hepatitis C virus nonstructural protein 5A replication complex inhibitor, BMS Hepatology 2012; 55: [PMID: DOI: /hep.25581] 78 Hezode C, Hirschfield GM, Ghesquiere W, Sievert W, Rodriguez-Torres M, Shafran SD, Thuluvath PJ, Tatum HA, Waked I, Esmat GE, Lawitz E, Rustgi VK, Pol S, Weis n, Pockros P, Bourliere M, Serfaty L, Vierling JM, Fried MW, Weiland O, Brunetto MR, Everson GT, Zeuzem S, Kwo PY, Liu Z, Hughes EA, Schnittman SM, Yin PD. Daclatasvir, an NS5A replication complex inhibitor, combined with peginterferon alfa-2a and ribavirin in treatment-naive hcv-genotype 1 or 4 patients: phase 2b COMMAND-1 SVR12 results. Hepatology 2012; 56 suppl: 553A 79 Suzuki Y, Ikeda K, Suzuki F, Toyota J, Karino Y, Chayama K, Kawakami Y, Ishikawa H, Watanabe H, Hu W, Eley T, McPhee F, Hughes E, Kumada H. Dual oral therapy with daclatasvir and asunaprevir for patients with HCV genotype 1b infection and limited treatment options. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 80 Karino Y, Toyota J, Ikeda K, Suzuki F, Chayama K, Kawakami Y, Ishikawa H, Watanabe H, Hernandez D, Yu F, McPhee F, Kumada H. Characterization of virologic escape in hepatitis C virus genotype 1b patients treated with the directacting antivirals daclatasvir and asunaprevir. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 81 Lok AS, Gardiner DF, Hezode C, Lawitz E, Bourliere M, Everson GT, Marcellin P, Rodriguez-Torres M, Pol S, Serfaty L, Eley T, Huang SP, Wind-Rotolo M, McPhee F, Grasela DM, Pasquinelli C. Sustained virologic response in chronic HCV genotype (GT) 1-infected null responders with combination of daclatasvir (DCV; NS5A inhibitor) and asunaprevir 2911 March 21, 2014 Volume 20 Issue 11

193 Nakamoto S et al. HCV NS5A inhibitors and mutations (ASV; NS3 inhibitor) with or without peginterferon alfa-2a/ ribavirin (PEG/RBV). Hepatology 2012; 56 suppl: 230A 82 Lok AS, Gardiner DF, Lawitz E, Martorell C, Everson GT, Ghalib R, Reindollar R, Rustgi V, McPhee F, Wind-Rotolo M, Persson A, Zhu K, Dimitrova DI, Eley T, Guo T, Grasela DM, Pasquinelli C. Preliminary study of two antiviral agents for hepatitis C genotype 1. N Engl J Med 2012; 366: [PMID: DOI: /NEJMoa ] 83 Hernandez D, Yu F, Ueland J, Wang C, Huang H, Gardiner D, Fridell R, Gao M. Characterization of virologic escape in hcv genotype 1 null responders receiving a combination of the NS3 protease inhibitor BMS and NS5A inhibitor BMS J Hepatol 2011; 54 suppl 1: S28-S29 [DOI: /S (11) ] 84 Aghemo A, De Francesco R. New horizons in hepatitis C antiviral therapy with direct-acting antivirals. Hepatology 2013; 58: [PMID: DOI: /hep.26371] 85 Aghemo A, Colombo M. Selection of resistant-associated variants to the NS5A inhibitor daclatasvir: revenge of the hepatitis C virus. Gastroenterology 2013; 145: [PMID: DOI: /j.gastro ] 86 Lange CM, Zeuzem S. Perspectives and challenges of interferon-free therapy for chronic hepatitis C. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 87 Kowdley K, Lawitz E, Poordad F, Cohen DE, Nelson DR, Zeuzem S, Everson GT, Kwo PY, Foster GR, Sulkowski MS, Xie W, Pilot-Matias T, Liossis G, Larsen LM, Khatri A, Podsadecki TJ, Bernstein B. A 12-week Interferon-free Treatment Regimen With ABT-450/r, ABT 267, ABT-333, and Ribavirin Achieves SVR12 Rates (Observed Data) of 99% in Treatmentnaive Patients and 93% in Prior Null Responders With HCV Genotype 1 Infection. Hepatology 2012; 56: 1515A-1516A 88 Everson GT, Sims KD, Rodriguez-Torres, Hezode C, Lawitz E, Bourliere M, Loustaud-Ratti V, Rustgi VK, Schwartz H, Tatum HA, Marcellin P, Pol S, Thuluvath PJ, Eley T, Wang X, Huang SP, McPhee F, Wind-Rotolo M, Chung E, Pasquinelli C, Grasela DM, Gardiner DF. An Interferon-Free, Ribavirin- Free 12-Week Regimen of Daclatasvir (DCV), Asunaprevir (ASV), and BMS Yielded SVR4 of 94% in Treatment- Naive Patients with Genotype (GT) 1 Chronic Hepatitis C Virus (HCV) Infection. Hepatology 2012; 56: 1517A-1518A 89 Sulkowski M, Gardiner D, Rodriguez-Torres M, Reddy KR, Hassanein T, Jacobson IM, Lawitz E, Lok AS, Hinestrosa F, Thuluvath PJ, Schwartz H, Nelson DR, Eley T, Wind-Rotolo M, Huang SP, Gao M, McPhee F, Sherman D, Hindes R, Symonds WT, Pasquinelli C, Grasela DM. High Rate of Sustained Virologic Response With the All-Oral Combination of Daclatasvir (NS5A Inhibitor) Plus Sofosbuvir (Nucleotide NS5B Inhibitor), With or Without Ribavirin, in Treatment- Naive Patients Chronically Infected With HCV GT 1, 2, or 3. Hepatology 2012; 56: 1516A-1517A 90 Sulkowski MS, Gardiner DF, Rodriguez-Torres M, Reddy KR, Hassanein T, Jacobson IM, Lawitz E, Lok AS, Hinestrosa F, Thuluvath PJ, Schwartz H, Nelson DR, Eley T, Wind- Rotolo M, Huang SP, Gao M, McPhee F, Sherman D, Hindes R, Symonds WT, Pasquinelli C, Grasela DM, AI Study Group. Sustained Virologic Response With Daclatasvir Plus Sofosbuvir Ribavirin (RBV) in Chronic HCV Genotype (GT) 1-Infected Patients Who Previously Failed Telaprevir (TVR) or Boceprevir (BOC). J Hepatol 2013; 58: S Omata M, Kanda T, Yu ML, Yokosuka O, Lim SG, Jafri W, Tateishi R, S. Hamid S, Chuang WL, Chutaputti A, Wei L, Sollano J, Sarin SK, Kao JH, W. McCaughan G. APASL consensus statements and management algorithms for hepatitis C virus infection. Hepatol Int 2012; 6: [DOI: / s y] P- Reviewers: Bock T, Enjoji M, Kapoor S, Liu XY, Wirth S S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2912 March 21, 2014 Volume 20 Issue 11

194 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Understanding the interaction of hepatitis C virus with host DEAD-box RNA helicases Megha Haridas Upadya, Jude Juventus Aweya, Yee-Joo Tan Megha Haridas Upadya, Jude Juventus Aweya, Yee-Joo Tan, Department of Microbiology, Yong Loo Lin School of Medicine, National University Health System (NUHS), National University of Singapore, Singapore , Singapore Yee-Joo Tan, Institute of Molecular and Cell Biology, Agency for Science, Technology and Research (A*STAR), Singapore , Singapore Author contributions: Tan YJ designed the research; Upadya MH performed the research; Upadya MH, Aweya JJ and Tan YJ co-wrote the manuscript; all authors read and approved the final version of the manuscript. Supported by Grants from the Ministry of Education of Singapore, Academic Research Fund Tier 1 Grant R Correspondence to: Yee-Joo Tan, Associate Professor, Department of Microbiology, Yong Loo Lin School of Medicine, National University Health System (NUHS), National University of Singapore, MD4A, 5 Science Drive 2, Singapore , Singapore. yee_joo_tan@nuhs.edu.sg Telephone: Fax: Received: September 27, 2013 Revised: December 6, 2013 Accepted: January 19, 2014 Published online: March 21, 2014 Abstract The current therapeutic regimen to combat chronic hepatitis C is not optimal due to substantial side effects and the failure of a significant proportion of patients to achieve a sustained virological response. Recently developed direct-acting antivirals targeting hepatitis C virus (HCV) enzymes reportedly increase the virologic response to therapy but may lead to a selection of drug-resistant variants. Besides directacting antivirals, another promising class of HCV drugs in development include host targeting agents that are responsible for interfering with the host factors crucial for the viral life cycle. A family of host proteins known as DEAD-box RNA helicases, characterized by nine conserved motifs, is known to play an important role in RNA metabolism. Several members of this family such as DDX3, DDX5 and DDX6 have been shown to play a role in HCV replication and this review will summarize our current knowledge on their interaction with HCV. As chronic hepatitis C is one of the leading causes of hepatocellular carcinoma, the involvement of DEADbox RNA helicases in the development of HCC will also be highlighted. Continuing research on the interaction of host DEAD-box proteins with HCV and the contribution to viral replication and pathogenesis could be the panacea for the development of novel therapeutics against HCV Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Chronic hepatitis C; Hepatitis C virus therapy; DEAD-box helicases; Host factors; Hepatocellular carcinoma Core tip: Alternative treatments to combat chronic hepatitis C include direct-acting antivirals targeting hepatitis C virus (HCV) enzymes and host targeting agents that interfere with host factors essential for the viral life cycle. Several members of a family of host proteins known as DEAD-box RNA helicases have been shown to modulate HCV replication. This review highlights their interaction with HCV and their role in viral replication. Since hepatocellular carcinoma (HCC) is a major cause of death among patients with chronic hepatitis C, the involvement of these DEAD-box RNA helicases in the development of HCC will also be discussed. Upadya MH, Aweya JJ, Tan YJ. Understanding the interaction of hepatitis C virus with host DEAD-box RNA helicases. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: March 21, 2014 Volume 20 Issue 11

195 Upadya MH et al. Interaction of HCV with DEAD-box helicases INTRODUCTION Hepatitis C is a contagious liver disease that results from infection with hepatitis C virus (HCV), a positivestranded RNA virus of the family Flaviviridae. HCV was discovered in 1988 during the course of investigating the cause of non-a, non-b, transfusion-associated hepatitis. Chronic hepatitis C can lead to liver damage which includes fibrosis, cirrhosis and eventually hepatocellular carcinoma (HCC). Consequently, these complications are a common indication for liver transplantations around the world, especially in developed countries. Chronic hepatitis C affects about 170 million people (or 3% of the world s population) and approximately deaths are reported from hepatitis C-related diseases every year [1]. Unfortunately, as of today, there is no protective vaccine for hepatitis C and the most practical way of preventing the occurrence and transmission of this disease is by raising public awareness, adopting universal precautions in medical settings and conducting thorough screening of blood and blood products. As obligate cellular parasites, viruses can only replicate by entering a host cell with the subsequent manipulation of cellular functions. Processes such as viral entry, translation, processing and modification of viral proteins, maturation and release of viral particles from host cells involve intimate interactions between viral and host proteins. Contrary to humans with a large genome size of approximately genes, the HCV genome is very small. Hence, HCV interacts extensively with the cellular machineries in the human host and uses them to its advantage [2]. This review summarizes the literature on the interaction of HCV with a family of host proteins, namely the DEAD-box RNA helicases. Several members of this family have been shown to interact with HCV proteins and/or regulate HCV replication. Recently, some DEAD-box RNA helicases have been shown to be involved in the progression of several types of tumours including HCC. Thus, their roles in the development of HCC will be highlighted and the potential link to HCV pathogenesis will be explored. HCV GENOME AND VIRAL PROTEINS HCV has a single stranded RNA genome containing a single, large open reading frame that encodes a large polyprotein precursor of approximately 3000 amino acid residues. This polyprotein is cleaved by a combination of host and viral proteases into at least 10 viral proteins. The N-terminus encodes three structural proteins namely core, envelope glycoprotein 1 and 2 (E1 and E2) while the C-terminal two-thirds of the polyprotein comprises of six non-structural proteins namely non-structural protein 2 (NS2), NS3, NS4A, NS4B, NS5A and NS5B [3]. These proteins encode enzymes or accessory factors that catalyze and regulate the replication of the HCV genome [4]. Another protein called p7 lies at the junction between the structural and non-structural regions of the virus polyprotein. Cleavages from the N-terminus through p7 are mediated by host-encoded proteases, cleavage between NS2 and NS3 is mediated by the autoprotease NS2/NS3, and the remaining cleavages in the C-terminal part of the polyprotein are mediated by the NS3/NS4A serine protease. HCV is characterized by substantial genome heterogeneity with at least 6 major genotypes and > 100 subtypes defined on the basis of nucleotide and amino acid sequences of conserved and non-conserved genome regions [5]. The HCV genotypes exhibit different geographic and regional distributions with genotypes 1 and 3 being the most prevalent worldwide [5]. CURRENT THERAPY FOR HEPATITIS C HCV replication occurs in hepatocytes and mononuclear cells. Both viral replication and host immune responses are believed to contribute to liver pathology. Despite that, hepatitis C infection does not always require treatment. In acute HCV infected patients, the virus is cleared spontaneously in about 30% of the cases [6]. However, in the majority of cases, the infection becomes chronic and necessitates treatment. The primary end point of therapy, the sustained virological response (SVR) defined as the absence of detectable serum HCV RNA, 24 wk after therapy may be considered equivalent to a clinical cure of HCV infection [7]. Combination antiviral therapy with pegylated interferon (Peg-IFN) and ribavirin (RBV) has been the mainstay of hepatitis C treatment across all genotypes so far. Regrettably, this mode of treatment is not optimal because a significant proportion of patients fail to achieve SVR. It has been reported that the failure rate is almost 50% for patients with genotype 1 HCV and approximately 20% for those with genotype 2 or 3 HCV [8-10]. Thus, there is evidence to show that this treatment regimen is effective only for a subset of patients with chronic HCV. Moreover, interferon is not widely available globally and not always well tolerated owing to the substantial side effects. Consequently, the development of new classes of antiviral compounds to combat this global health burden has been receiving widespread attention in recent years [11]. Scientific advances have led to the development of new direct-acting antiviral (DAA) agents for hepatitis C, which potentially could be more effective and well tolerated than the current treatment regimens. In 2011, the FDA approved the first two DAAs, Boceprevir (Victrelis) and Teleprevir (Incivek), which target the HCV protease [12]. A combination of these DAAs with Peg-IFN and RBV in triple combination therapy substantially increased the SVR rate in difficult to treat, treatment-naïve and treatment-experienced patients [13-18]. It has been reported that SVR rates for patients with genotype 1 HCV infection have increased to 70%-80%, and about twothirds of patients are eligible for a shortened duration of therapy [16,17,19]. However, the efficacy of these new drugs is not genotype-wide and some infected individuals respond poorly. Moreover, these drugs do not appear to be suitable for monotherapy because the selective pressure 2914 March 21, 2014 Volume 20 Issue 11

196 Upadya MH et al. Interaction of HCV with DEAD-box helicases imposed by the drugs can lead to the rapid emergence of DAA-resistant viral mutants [20-22]. Another major target for anti-hcv drugs is NS5B, the inhibitors of which can be grouped into two categories, namely the nucleoside/nucleotide inhibitors which target the catalytic site of the enzyme and non-nucleoside inhibitors which target the allosteric sites of the RNAdependent RNA polymerase [23]. Other drugs targeting the NS5A RNA-binding protein are also in the final stages of clinical development [24]. The mechanism of action of these compounds is however poorly understood due to the lack of a comprehensive insight into the specific function of NS5A. There are also studies to evaluate inhibitors of NS4B, another HCV-encoded RNA binding protein [25]. To minimize drug resistance and be effective across all genotypes, it is desirable to devise combination therapies with drugs acting through diverse modes of action [26]. However, it is still not clear as to how many classes of these aforementioned new drugs will need to be combined in order to replace the Peg-IFN/RBV treatment. VIRAL-HOST INTERACTIONS AS POTENTIAL DRUG TARGETS As discussed in the previous section, the prevailing therapeutic arsenal against HCV is directed towards the viral components, specifically the viral enzymes. Targeting viral components that are required for the replication cycle could reduce the likelihood of inducing undesirable side effects such as toxicity. However, a major limitation here is the small HCV genome which will limit the number of viral targets. In addition, HCV mutates rapidly and churns out many viral variants or quasispecies [27]. Alternatively, there are a class of new compounds termed as host-targeting agents (HTAs) and these target the host factors that are essential for HCV replication. Recent studies have suggested that these HTAs could potentially serve as a promising strategy to broaden the therapeutic repository against HCV. The mode of action of HTAs is conceptualized in two strategies. The first strategy involves interfering with the host factors that play an integral role in the various stages of the viral life cycle such as viral entry, replication, assembly and release. The second involves boosting the innate immunity of the host through the administration of agents such as IFN-λ [28], or agonists of Toll-like receptors [29,30]. HTAs have several advantages over DAAs including: (1) A wide-ranging pan-genotypic activity with reported inhibition of HCV infection caused by all major genotypes, coupled with highly variable quasispecies isolates and resistant escape variants [31-33] ; (2) A higher genetic barrier to resistance development due to the fact that the genetic variability of the host is lower than that of the virus [31-33] ; and (3) Complementary mechanisms of action to DAAs, paving the way for a potential synergistic therapeutic effect [32,34]. However, the side effects of HTAs are a prime concern in therapeutics when host factors instead of viral components are targets [35]. Nevertheless, targeted strategies against host factors such as CD81 and SR-BI that are involved in viral entry are currently under investigation [36], while mir-122 and inhibitors of cyclophilin A (alisporivir) targeting viral replication, with possible action on virion assembly and release are currently at various stages of clinical development [37]. Efforts are also underway to develop and evaluate several other HTAs with different host targets in order to improve and broaden the therapeutic net. Targeting host factors is an attractive option in the search for more potent HCV therapies with an additional advantage of minimizing the development of resistant mutant virus and ensuring an adept treatment of HCV across all genotypes. In the past, the lack of a cell culture model for the study of HCV had severely hampered research on the role of host proteins in the replication cycle of HCV and the significance of virus-host interactions. However, with the development of the replicon system, as well as infectious cell culture system, studying viral replication and pathogenesis has been made much less cumbersome. In particular, the development of the HCV infectious clone and the chimeric forms which produce HCV robustly in cell culture, termed the HCVcc system [38,39]. The most widely used HCVcc system is based on the JFH-1 strain or the intragenotypic chimeric J6/JFH-1 strain (both are of genotype 2a) and allows the entire virus life cycle, including entry, replication, assembly and release, to be studied in hepatoma cell lines. As described further, this has allowed much progress in the characterization of the interaction of several DEAD-box RNA helicases with HCV proteins and has helped to define their roles in different steps of the virus life cycle. DEAD-BOX RNA HELICASES The DEAD-box RNA helicases represent the largest family of RNA helicases, comprising of 38 members in humans. DEAD-box helicases have been implicated in various cellular processes involving RNA such as splicing, mrna export, transcriptional and translational regulation, RNA decay and ribosome biogenesis [40]. They contain a central region comprised of 2 conserved domains, termed as domain Ⅰ and Ⅱ, flanked by highly variable N and C-terminal sequences. A comparison of the known structures of domain Ⅰand Ⅱ reveal that they have a fold belonging to the RecA super family, where 5 β-strands are surrounded by 5 α-helices [41-43]. The DEAD-box helicases are divided into several subgroups based on the DEAD-box motif such as DEAD, DEAH and DEXH subfamilies. These DEAD-box proteins are highly conserved in nine motifs but exhibit substantial sequence divergence outside these nine conserved motifs. The nine conserved motifs are the Q-motif, motif 1, motif 1a, motif 1b, motif Ⅱ, motif Ⅲ, motif Ⅳ, motif Ⅴ, and motif Ⅵ (Figure 1A). Motif Ⅱ is also known as the Walker B motif and contains the amino acid sequence D-E-A-D (asp-glu-ala-asp), which gave this family of proteins the 2915 March 21, 2014 Volume 20 Issue 11

197 Upadya MH et al. Interaction of HCV with DEAD-box helicases A Motif Ⅱ II N-terminus Q motif Motif 1 1 Motif Ⅰa Ia Motif Ⅰb Ib Motif Ⅲ III Motif Ⅳ IV Motif Ⅴ V Motif Ⅵ VI C-terminus D.E.A.D B DDX1 DDX3 DDX5 DDX6 DDX1 DDX3 DDX5 DDX6 Motif Ⅰ Q Motif Motif Ⅰa DDX1 DDX3 DDX5 DDX6 DDX1 DDX3 DDX5 DDX6 Motif Ⅱ Motif Ⅰb Motif Ⅲ DDX1 DDX3 DDX5 DDX6 DDX1 DDX3 DDX5 DDX6 DDX1 DDX3 DDX5 DDX6 Motif Ⅳ Motif Ⅴ DDX1 DDX3 DDX5 DDX6 Motif Ⅵ Figure 1 Schematic diagram of DEAD-box proteins and sequence alignment of selected members. A: Conserved motifs within the DEAD-box family; B: Sequences of the conserved motifs-q motif, Ⅰ, Ⅰa, Ⅰb, Ⅱ, Ⅲ, Ⅳ, Ⅴ, Ⅵ from DDX1, DDX3, DDX5 and DDX6. name DEAD box. Motif 1, motif Ⅱ, the Q motif, and motif Ⅵ are all needed for ATP binding and hydrolysis, while motifs, 1a, 1b, Ⅲ, Ⅳ, and V may be involved in intramolecular rearrangements and RNA interaction. A sequence alignment of 4 members of the DEAD-box group of proteins known to be involved in HCV replication shows that there is a high degree of conservation in these motifs (Figure 1B). Current knowledge of the interaction of these 4 DEAD-box proteins with HCV has been summarized below. In addition, several DEADbox helicases, namely the retinoic acid inducible gene-i (RIG-I), melanoma associated differentiation factor-5 and laboratory of genetics and physiology, have been shown to be important factors in the RIG-I pathway, which is one of the major antiviral pathways activated during viral infection [44,45]. However, the intrinsic interaction between the RIG-I pathway and HCV is beyond the scope of this review and has been extensively covered in several recent publications [46,47]. DDX1 AND HCV A study had previously identified an ATP-dependent helicase DDX1 (DBP-RB/UKVH5d) which can bind to HCV 3 (+) UTR as well as its reverse complementary 5 (-) UTR [48]. It was reported that sirna-mediated knockdown of DDX1 caused a reduction in the replication of subgenomic replicon RNA. This suggested a possible 2916 March 21, 2014 Volume 20 Issue 11

198 Upadya MH et al. Interaction of HCV with DEAD-box helicases role of DDX1 in the initiation of HCV RNA replication. DDX1 has also been reported to be important for the human immunodeficiency virus type 1 (HIV-1) replication as it binds to and serves as a cofactor of the HIV-1 Rev protein, which induces nuclear export of viral RNA and the transition from the early to the late phase of viral gene expression [49,50]. In recent years, there has been a startling increase in the number of cases of HIV-1 and HCV co-infection, with about one-third of HIV-1 infected patients and about 90% of HIV-1 infected drug abusers in the United States and Europe being co-infected with HCV [51,52]. The large proportion of co-infection with HIV-1 and HCV suggests that these two viruses may use similar host machineries for their replication. DDX3 AND HCV DDX3 plays an important role in several cellular processes but the precise mechanism of action as well as the extent of involvement in these processes is poorly understood [53]. There is evidence to show that DDX3 contributes to antiviral innate immunity [54,55]. With regard to HCV, the host cells sense viral RNA particularly via the mitochondrial antiviral signalling (MAVS) pathway [56]. It is believed that MAVS signals TANK-binding kinase 1 and IkB kinase epsilon, to phosphorylate IFN regulatory factors IRF-3 and IFR-7, thereby inducing type 1 IFN [57]. It has been shown that DDX3 serves as a positive regulator for MAVS-mediated type 1 IFN induction [47,58]. A dichotomy exists in the role of DDX3 where viruses like HCV are able to manipulate DDX3 to support replication yet at the same time, DDX3 could suppress the antiviral activity of HCV by inducing IFN. An in-depth understanding of the functions of DDX3 is important because two viruses that pose a major global health threat, namely HIV and HCV exploit DDX3 and use it to their advantage [59-61]. There is a plethora of literature on DDX3 and its role as a target for viral manipulation has been summarized in other review articles [53,62]. Based on the evidence that DDX3 is required for viral replication, its suppression may serve as a novel strategy and means to widen the repertoire of treatment against these two viruses. Similarly, since HIV/HCV co-infection increases the likelihood of developing other life-threatening complications, it could potentially contribute towards a killing two birds with one stone approach to therapy. However, a detailed understanding of the interaction between DDX3 and the virus is required so as to determine if this interaction can serve as a therapeutic target without adversely affecting normal cellular function. The first HCV protein that was reported to interact with DDX3 was the HCV core protein and this interaction was described by three independent publications [63-65]. However, these early studies were limited by the lack of a robust cell culture model for HCV infection at that time. Two of the above-mentioned publications [64,65] provided evidence to show that the HCV core binds to the C-terminus of DDX3 (amino acids ) and the interaction is mediated by the N-terminus of HCV core (amino acids 1-59). Owsianka et al [64], demonstrated the direct interaction of HCV core with the RS-like domain of DDX3. RS domains are stretches of protein sequence very rich in alternate arginine and serine residues. By analyzing deletion mutants, they demonstrated that the N-terminal 59 amino acid residues of core and a C-terminal RS-like domain of DDX3 were the regions associated with this interaction. The presence of an RS-like domain near the C-terminus of DDX3 and the observed localization of DDX3 predominantly in nuclear speckles which was similar to splicing factors, suggest the possible involvement of DDX3 in RNA splicing. Interestingly, it was observed that in the presence of HCV core, the DDX3 protein was redistributed in distinct spots in the perinuclear region of the cytoplasm where it co-localized with HCV core. This change in the pattern of localization of DDX3 in the presence of core was suggested to be a result of the core protein targeting the cytoplasmic function of DDX3. You et al [65], designated a cellular RNA helicase that is a homologue of DDX3 as CAP-Rf and demonstrated the direct interaction between CAP-Rf and HCV core. This group reported that the N-terminal 40 amino acid residues of core and a C-terminal tail of CAP-Rf were the regions associated with this interaction. Furthermore, HCV core protein was found to enhance the nucleotide triphosphatase-deoxynucleoside triphosphatase activity of CAP-Rf as well as potentiate its trans-activation effects. Mamiya et al [63], showed that HCV core protein prevented DDX3 from rescuing ded1-deletion yeast and that it inhibited the translation of capped but not uncapped RNA in experimental assays which suggests that it may inhibit cellular mrna translation in infected human cells. Thus, these three studies highlighted the multifunctional role of DDX3 with regard to exploitation by HCV with the interaction between HCV core and DDX3 proposed to manipulate splicing [64], transcriptional regulation [65] and translational regulation [63]. With the establishment of the HCVcc system, numerous studies have shown that DDX3 is essential for HCV RNA replication. A study in 2007 reported for the first time that DDX3 is required for HCV RNA replication [59]. When DDX3 was knocked-down in Huh7 derived cells, there was a decrease in the accumulation of both genome-length HCV RNA (HCV-O, genotype 1b) and its replicon RNA [59]. Subsequently, another study identified 26 human genes that modulate HCV replication and implicated the RNA interference (RNAi) pathway itself as a key regulator of HCV replication. It was reported that among the host proteins that played a role in HCV replication, DDX3 was one of them [60]. Although there have been studies detailing the interaction between DDX3 and HCV core, it is still unclear if the effect of DDX3 on HCV replication is dependent on this interaction. There is contradictory evidence to show the relationship between the interaction of DDX3 with core protein and its contribution towards HCV replica March 21, 2014 Volume 20 Issue 11

199 Upadya MH et al. Interaction of HCV with DEAD-box helicases A Mock 2 d.p.i. 4 d.p.i. B Mock 2 d.p.i. 4 d.p.i. C Mock 2 d.p.i. 4 d.p.i. kda 70 Control DDX5 Control DDX5 Control DDX5 DDX5 kda 70 Control DDX3 Control DDX3 Control DDX3 DDX3 kda 55 Control DDX6 Control DDX6 Control DDX6 DDX6 70 NS5B 70 NS5B 70 NS5B 40 b-actin 40 b-actin 40 b-actin Figure 2 Analysis of protein expression following knockdown of endogenous DDX5, DDX3 and DDX6 in Huh7.5 cells. A: Cells transfected with 40 nmol/l of DDX5 short interfering RNA (sirna) or a control sirna; B: Cells transfected with 40 nmol/l of DDX3 sirna or control sirna; C: Cells transfected with 40 nmol/l of DDX6 sirna or control sirna. At 48 h, cells were infected with J6/JFH-1 (p47) hepatitis C virus (HCV) at multiplicity of infection of 2 as previously described [72]. Cell lysates were prepared 0, 2, 4 d post-infection (d.p.i.) and subjected to immunoblotting with the respective primary antibodies. Expression of NS5B was used to confirm HCV infection and β-actin served as a loading control. Three independent experiments were performed and one representative set of data is shown. Table 1 Target sequences of short interfering RNA of a selected group of DEAD-box proteins used in this study sirna Sequence Ref. Control AAA ACG UUC UGA UGC CUU AAG From SARS genome DDX3 CGC UUG GAA CAG GAA CUC UUU Chang et al [100] DDX5 AAG UGG AAU CUU GAU GAG CUG Goh et al [68] DDX6 GCA GAA ACC CUA UGA GAU UUU Chu and Rana [89] sirna: Short interfering RNA. tion. One study demonstrated that HCV (of genotype 2a) having a core protein mutation can recruit DDX3 for its replication process despite the fact that the alanine substitution in core disrupted the interaction with DDX3 [66]. On the other hand, it was reported that in a HCV genotype 1b replication system, the inhibitory effect of corederived peptides was reversed by overexpressing DDX3, suggesting that the mechanism of action was by targeting DDX3 [67]. Therefore, the relevance of DDX3-core interaction in HCV replication has not been thoroughly elucidated and warrants further investigation. DDX5 AND HCV DDX5 was first identified as an interacting partner of HCV NS5B through a yeast-two-hybrid screen [68]. Interestingly, the overexpression of NS5B caused the endogenous DDX5 in Hela cells to redistribute from the nucleus to the cytoplasm and the C-terminal of NS5B was found to be important for this interaction [68]. Consistently, another study reported that DDX5 underwent a similar translocation when Huh7 cells were infected with cell culture derived and JFH-1-based infectious HCV particles [69]. Further experiments revealed that there are two independent NS5B-binding sites in DDX5, one located at the N-terminus and another at the C-terminus [70]. The N-terminal regions (NTRs) of DEAD-box helicases are highly variable and a crystal structure of the N-terminal fragment of DDX5 reveals the first 51 residues are highly flexible while the remaining part of the NTR (residues 52-78) forms an extensive loop and an alpha-helix [70]. Binding studies revealed that the highly flexible first 51 residues of DDX5 could fold back to block one of the NS5B binding sites located between residues in DDX5, suggesting that the interaction between DDX5 and NS5B in infected cells is likely to be highly dynamic. Previously, we showed that the knockdown of endogenous DDX5 by RNAi reduced the synthesis of negative-strand HCV RNA in 293 cells transiently transfected with a genotype 1b full-length HCV expression construct (HCV-S1, Genebank accession number AF356827) developed in our laboratory [68]. As opposed to the HCVcc system which produces HCV robustly in cell culture [38], introducing the HCV-S1 genome into liver-derived cell lines produced a very low level of virus [71]. Hence, we repeated the knockdown of DDX5 in Huh7.5 cells and determined if the knockdown of DDX5 affects HCV replication in the HCVcc system. As shown in Figure 2A, the endogenous level of DDX5 was significantly reduced in the DDX5 sirna treated cells at different days post infection (d.p.i.) when compared to cells treated with an irrelevant control sirna. To achieve a better comparison, the experimentation was performed in parallel with sir- NAs targeting DDX6 and DDX3 because these DEADbox proteins have been shown to contribute to HCV replication (as described herein). The target sequences of the sirnas used in this study have been listed in Table 1. As seen in the case of DDX5, the endogenous levels of DDX3 and DDX6 were reduced in the corresponding samples (Figure 2B, C, respectively). Upon infection with the J6/JFH-1 virus at multiplicity of infection (MOI) of 2, expression of the NS5B protein was detected at 2 and 4 d.p.i. However, no clear difference in NS5B expression was observed for the samples with reduced DDX3, DDX5 or DDX6 probably because western blot analysis does not provide a quantitative measure of HCV infection. Hence, reverse transcription followed by real-time PCR was performed to determine the level of intracellu March 21, 2014 Volume 20 Issue 11

200 Upadya MH et al. Interaction of HCV with DEAD-box helicases A HCV/GAPDH expression levels Control DDX5 DDX3 DDX6 b b b B Virus infectivity (log10 ffu/ml) b b b b 0 2 d.p.i 4 d.p.i 0 2 d.p.i 4 d.p.i Figure 3 Analysis of viral replication and viral infectivity following knockdown of endogenous DDX5, DDX3 and DDX6 in Huh7.5 cells. Cells transfected with DDX5 short interfering RNA (sirna) in parallel with a control sirna, DDX3 sirna and DDX6 sirna. At 48 h, cells were infected with J6/JFH-1(p47) hepatitis C virus (HCV) at an multiplicity of infection of 2. A: At 2 and 4 d.p.i., the total RNA was isolated from the cells, reverse transcribed, and the resulting cdna was subjected to quantitative polymerase chain reaction for detection of genomic HCV RNA and glyceraldehyde-3-phosphate dehydrogenase mrna as previously described [73] ; B: Virus supernatants collected 2 and 4 d.p.i. were titrated on naive Huh7.5 cells by using indirect immunofluorescence as previously described [74] and expressed as focus forming units per millilitre (ml). Statistical analysis was performed using the two-tailed Student s t test to determine if the differences between the gene specific sirnatreated and control sirna-treated cells were statistically significant. b P < 0.01 vs control sirna-treated cells. Data were obtained from three independent experiments and one representative set of data is shown. Each measurement was performed in triplicate, and the average (± SD) is presented. lar HCV RNA as a quantitative measure of viral replication. As shown in Figure 3A, the level of HCV RNA in the DDX5 sirna treated cells was higher than the cells treated with control sirna at both 2 and 4 d.p.i., suggesting that DDX5 has the ability to inhibit HCV RNA replication. However, the change in the level of HCV RNA was statistically significant only at 2 d.p.i. Consistent with previous publications (as described herein), the levels of intracellular HCV RNA in both the DDX3 and DDX6 sirna treated cells were significantly reduced at both time points (Figure 3A). Next, the production of cell-free infectious virus particles was compared (Figure 3B). Surprisingly, the DDX5 sirna treated cells did not produce higher level of cell-free infectious virus particles than the control sirna treated cells despite the higher level of intracellular HCV RNA. As would be expected, the production of cell-free infectious virus particles was significantly reduced in both the DDX3 and DDX6 sirna treated cells. In summary, DDX5 interacts with the HCV NS5B protein and the expression of NS5B in transfected or infected cells causes the redistribution of DDX5 from the nucleus to the cytoplasm. The interaction between DDX5 and NS5B in the cytoplasm seems to inhibit viral RNA multiplication because the knockdown of endogenous DDX5 resulted in a slight increase in the level of intracellular HCV RNA in J6/JFH-1 virus infected Huh7.5 cells. Curiously, the increase in HCV RNA in the DDX5 sirna treated cells did not cause an increase in the production of cell-free infectious virus particles. This may indicate that DDX5 has another positive regulatory role at a later stage of the virus life cycle. In a recent study by Kuroki et al [75], it was reported that the knockdown of DDX5 reduces JFH-1 virus production in OR6c JRN/3-5B cells, which harbour the subgenomic HCV-JFH1 RNA with luciferase [76], infected at an MOI of Despite the use of different cell lines and MOIs, both studies suggest that DDX5 may be important for a late stage of the HCV life cycle. Hence, the precise role of DDX5 in HCV replication needs to be further investigated and it should be determined if DDX5 can interact with other HCV proteins. Interestingly, single nucleotide polymorphisms in the DDX5 gene have been shown to be significantly associated with increased risk of advanced fibrosis in HCV patients [77] and future studies can be directed to determine if these polymorphisms affect the interaction of DDX5 with one or more HCV proteins. DDX6 AND HCV DDX6 is normally found as a component of the large messenger ribonucleoprotein (mrnp) complex. It has been demonstrated that RNAi-mediated silencing of DDX6 and a few other related proteins impaired the replication of HCV which was thought to be due to impairment in HCV translation in the absence of expression [78]. Shortly afterwards, another study also demonstrated the role of DDX6 in HCV replication in which the knockdown of DDX6 was found to reduce the expression of HCV proteins, accumulation of intracellular viral RNA and infectious virus yields [79]. Overexpression studies showed that an abundance of DDX6 did not significantly affect the expression of viral proteins but increased the infectious virus yields. Furthermore, this study showed that DDX6 knockdown did not affect the abundance of mir-122 which is an amply expressed liver-specific mirna. In addition, the supplementation of mir-122 reversed the defect in HCV replication observed after DDX6 knockdown, suggesting that these two host fac March 21, 2014 Volume 20 Issue 11

201 Upadya MH et al. Interaction of HCV with DEAD-box helicases Table 2 Summary of selected members of the DEAD-box family that are involved in hepatitis C virus replication and/or have been implicated in the development of hepatocellular carcinoma Dead-box family Alternate names Interaction with HCV Effect on HCV replication Ref. Effect on HCC Ref. DDX1 DBP-RB UKVH5d HCV 3 (+) UTR and 5 (-) UTR Unknown NA Unknown NA DDX3 DDX3X DBX DDX14 HCV core Required for HCV replication Ariumi et al [59] Randall et al [60] Angus et al [66] Overexpressed in HCC Huang et al [97] Li et al [98] Liu et al [99] HLP2 Downregulated in HCC Chang et al [100] Chao et al [101] DDX5 DDX6 DDX17 DDX20 p68 G17P1 HLR1 HUMP68 Rck P54 HLR2 P72 RP3-434P1.1 RH70 Gemin3 DP103 HCV NS5B HCV core Inhibit an early step and promote a late step in viral replication Required for HCV replication Data presented herein Kuroki et al [75] Scheller et al [78] Jangra et al [79] Downregulated in HCC Kitagawa et al [86] Overexpressed in HCC Miyaji et al [88] Pager et al [80] Huys et al [81] Unknown Unknown NA Downregulated in HCC Kitagawa et al [86] Unknown Unknown NA Downregulated in HCC Takata et al [94] HCV: Hepatitis C virus; HCC: Hepatocellular carcinoma; NA: Not applicable. tors promote HCV replication by independent mechanisms. By conducting co-immunoprecipitation experiments, it was found that DDX6 forms an intracellular complex that involves the HCV core protein and that the C-terminal domain Ⅱ of DDX6 was essential for this. However, the significance of this interaction is uncertain because the facilitation of HCV replication by DDX6 seems to occur independently of core expression. The findings of this study [79] demonstrated that DDX6 expression is required for HCV replication but in contrast to the findings by Scheller et al [78], that it is not required for translation. While the overexpression of wild-type DDX6 enhanced HCV replication, a helicase-defective mutant suppressed it instead, thus suggesting that the helicase activity of DDX6 is required for HCV replication. The reduction in HCV replication following knockdown of DDX6 has also been described by two other recent publications [80,81]. DEAD-BOX PROTEINS AND LIVER CANCER Approximately 70% of HCV infected individuals become chronic carriers and 50% of them will develop chronic liver diseases. Some of them will subsequently progress to cirrhosis, which is a major risk factor for the development of HCC [82]. Similar to other types of cancer, the development of HCC involves many steps including genetic and epigenetic alterations, activation of oncogenes and inactivation of tumor suppressor genes in the infected hepatocytes. Indeed, several HCV proteins have been implicated in disrupting cellular functions and contributing to malignant transformation [69,83,84]. Consequently, the dysregulation of multiple cellular pathways contributes to tumour progression and several members of the DEADbox family have been shown to be involved in this process [85]. Here, we will highlight those studies involving HCC (Table 2) and discuss the potential contribution of the interactions between DEAD-box helicases and HCV. The expression of two closely related members, namely DDX5 and DDX17, was found to be significantly downregulated in primary HCC when compared to noncancerous liver tissue [86]. Notably, DDX5 and DDX17 are components of the mirna biogenesis pathway and the same study reported that another 5 important genes in this pathway were also downregulated. Thus, it appears that the dysregulation of the mirna biogenesis pathway is associated with the development of HCC, which is consistent with the results of studies performed in mice [87]. However, it seems that the downregulation of DDX5 in HCC may not be related to its ability to interact with HCV proteins because DDX5 was found to be downregulated in HBV-positive and non-hbv, non-hcv HCC but not in HCV-positive HCC. Immunohistochemistry and Western blot analysis showed that DDX6 was over-expressed in 26 out of 29 HCV-positive liver tissues taken from patients with chronic hepatitis [88]. In addition, another 8 HCC samples all showed overexpression of DDX6. In contrast, DDX6 was not overexpressed in 3 control samples taken from the nontumor portion of the liver of 3 patients who had non- HCV, non-hbv liver tumor. Interestingly, the level of DDX6 was found to be lower after treatment with interferon-α in 2 out of 3 patients whose levels of HCV RNA decreased after treatment. Hence, the replication of HCV may be responsible for upregulating DDX6 expression. Given that DDX6 is required for efficient HCV replication in Huh7.5 cells [78,79], it is probable that a positive feedback loop contributes to the development of HCC because HCV upregulates DDX6 expression 2920 March 21, 2014 Volume 20 Issue 11

202 Upadya MH et al. Interaction of HCV with DEAD-box helicases and the higher level of DDX6 further enhances HCV production. Coincidentally, DDX6, like DDX5, is also involved in the mirna biogenesis pathway as it is part of the mirna-induced silencing complex [89]. Similarly, DDX20 is also a component of the mir- NA-containing ribonucleoprotein complexes [90,91]. It was first linked to cancer when an oncogenomic-based in vivo RNAi screen identified it as a novel tumor suppressor in murine liver cancers [92]. Subsequent studies suggested that DDX20 functions to suppress NF-κB activity by preferentially regulating the function of the NF-κB-suppressing mirna-140 [93]. Consistent with its role as a tumor suppressor, the knockdown of DDX20 resulted in NF-κB activation in hepatoma cell lines [93,94] and it is known that such activation is frequently observed in hepatitis-related HCC [95,96]. Indeed, up to 67% (47/70) of HCC samples were found to have reduced levels of DDX20 when compared to paired samples taken from the surrounding noncancerous liver, suggesting that the downregulation of DDX20 may contribute to the development of HCC [94]. Up until now, it has not been determined if DDX20 is involved in HCV replication or if it interacts with HCV proteins. By comparing liver cancer cell lines with high and low transformation capabilities, DDX3 was identified as a potential oncogene and the overexpression of DDX3 increased the transformation capability of Tong cells in an anchorage-independent growth assay [97]. Quantitative RT-PCR further showed that the mrna level of DDX3 was higher in 29 out of 45 (64%) HCC samples when compared to the surrounding normal tissues [97]. Consistent with this, two independent studies reported that the levels of auto-antibodies against DDX3 were significantly higher in serum taken from patients with HCC when compared to patients with chronic hepatitis or healthy volunteers [98,99]. While the above studies suggest that DDX3 is overexpressed in HCC, another study reported that DDX3 was significantly downregulated in HCCs from HBV + but not HCV + patients [100]. The reason for these contradictory observations is not clear but some possibilities could be the use of different types of assays, the demographic or clinicopathologic characteristics of the study populations. Curiously, a higher prevalence of DDX3 downregulation was observed in HCC from male patients compared to female patients [100]. Similarly, another study reported that the mrna level of DDX3 was lower in 26 out of 45 HCC samples when compared to surrounding normal tissues [101]. Moreover, most of these 26 samples also showed lower mrna levels of p21 waf1/cip1 and there was significant correlation between the expression of DDX3 and p21 waf1/cip1. Consistently, in vitro studies showed the overexpression of DDX3 in the liver cancer cell line Huh7 inhibited colony formation and upregulated the p21 waf1/cip1 by transactivating its promoter [101]. Conversely, knockdown of DDX3 by sirna led to the downregulation of p21 waf1/cip1 and upregulation of cyclin D1, resulting in deregulation of cell cycle control in NIH-3T3 cells [100]. In summary, several members of the DEAD-box family have been found to be deregulated in HCC and they may contribute to the development of HCC. As the deregulation of mirna expression is now recognized as being important in many cancers [102,103], it is intriguing to note that the DEAD-box proteins found to be up or downregulated in HCC are all involved in some aspects of the mirna biogenesis pathway. Unfortunately, most of these studies have grouped together HCC samples from HCV +, HBV + and non-hcv, non-hbv patients rather than analyzed each of the groups separately. Hence, further studies are needed to address whether the involvement of DEAD-box proteins in HCV replication is linked to the development of HCC in HCV patients. There is also a gap in the knowledge on the role of DEAD-box proteins in other forms of HCV-induced pathogenesis like fibrosis and cirrhosis. CONCLUSION The standard of care for anti-hcv therapy with Peg-IFN plus RBV is not optimal because a significant proportion of patients fail to achieve SVR and many patients are unable to tolerate the substantial side effects of treatment. Moreover, the treatment options for immunocompromised patients, patients with advanced liver disease and co-infection cases with HIV or HBV remain unsatisfactory. Limitations of the existing HCV treatment have led to extensive interest in the development of DAAs that target specific HCV proteins. Such anti-hcv agents are currently being evaluated in clinical trials and a couple of them have already been approved for clinical use in conjugation with Peg-IFN/RBV. To minimize the drug resistance, properly tailored combination therapies with drugs acting by different mechanisms are the need of the hour. It has become increasingly important to identify novel drug targets and widen the repertoire of anti-hcv agents. Since viral-host interactions are essential for HCV replication, they can potentially serve as important drug targets. HTAs have shown to possess certain merits over DAAs including a broader pan-genotypic activity, a higher genetic barrier to resistance development and a potential synergistic therapeutic effect when combined with DAAs. As highlighted in this review, several members of the DEAD-box family are involved in HCV replication (Table 2). As these DEAD-box proteins share nine conserved motifs (Figure 1), it is intriguing that multiple DEAD-box RNA helicases are involved in the regulation of HCV replication and further studies are warranted to determine if they are involved in the same step(s) of the viral life cycle. It will also be important to determine if they act independently of each other or in parallel. For instance, Choi and Lee [104], revealed a novel protein-protein interaction between two DEAD-box RNA helicases, DDX3 and DDX5, which is affected by the phosphorylation states of both proteins and the cell cycle. Such interaction between members of the DEAD-box proteins may result in co-operativity or redundancy of their roles in relation to HCV replication. It is also possible that these host proteins are involved in more than one viral-host 2921 March 21, 2014 Volume 20 Issue 11

203 Upadya MH et al. Interaction of HCV with DEAD-box helicases interaction, for example, DDX3 not only binds to the HCV core protein, but is probably also associated with a HCV non-structural protein or HCV RNA itself [59,64,75]. A comprehensive understanding of the relative importance and specificity of the interaction between HCV and DEAD-box proteins may raise the possibility of targeting such a viral-host interaction for the development of therapeutics. However a detailed understanding of each viral-host interaction is required to evaluate if the interaction can be targeted without affecting the normal cellular homoeostasis. While several DEAD-box helicases have been implicated in the development of HCC (Table 2), there is currently insufficient data to determine if their deregulation in HCC is related to their interaction with HCV. Furthermore, the dearth of small animal models that can mimic the HCV infection and liver pathogenesis that is observed in humans has significantly hampered studies to define the role of viral-host interactions in HCV-induced pathogenesis. However, with the recent advancement in the development of fully immunocompetent mouse models for the study of HCV [105,106], we hope to employ this model so as to further characterize the roles of DEAD-box proteins in HCV infection. For instance, we can leverage on the novel humanized mouse model developed by Washburn et al [107], which consists of a humanized mouse engineered by engraftment of both human hepatocytes and human immune cells. These humanized mice were shown to harbour both human hepatocytes and T cells, hence, they could support HCV infection and induce HCV-specific human immune response, liver inflammation, hepatitis, and fibrosis [107]. Similarly, we could use the recently developed genetically humanized inbred mouse model with blunted antiviral immunity, which allows the entire HCV life cycle to be completed [108]. This inbred mouse model is reported to overcome most of the inherent challenges of previous models, and thus can be manipulated and used in various stages of HCV research. With these humanized mice, we should be able to study in vivo the interaction of DEAD-box proteins with HCV and how this interaction could affect viral replication as well as contribute to disease pathogenesis. Moreover, investigations can be performed to determine if certain DEAD-box proteins play important roles in acute HCV infection while others are more involved in chronic HCV infection. It will also be crucial to delineate the contribution of individual DEAD-box protein to different steps in the virus life cycle or different viral-induced liver diseases like fibrosis and HCC. Knowledge gained from such studies would enhance our basic understanding of HCV replication and probably aid future work towards the development of more efficacious drugs and vaccine. ACKNOWLEDGMENTS We thank Hotta H for the J6/JFH-1 (p47) virus and Rice CM for the Huh7.5 cells. REFERENCES 1 Schaefer EA, Chung RT. Anti-hepatitis C virus drugs in development. Gastroenterology 2012; 142: e1 [PMID: DOI: /j.gastro ] 2 Joyce MA, Tyrrell DL. The cell biology of hepatitis C virus. Microbes Infect 2010; 12: [PMID: DOI: /j.micinf ] 3 Macdonald A, Harris M. Hepatitis C virus NS5A: tales of a promiscuous protein. J Gen Virol 2004; 85: [PMID: DOI: /vir ] 4 Tan SL, Pause A, Shi Y, Sonenberg N. Hepatitis C therapeutics: current status and emerging strategies. Nat Rev Drug Discov 2002; 1: [PMID: DOI: / nrd937] 5 Simmonds P, Bukh J, Combet C, Deléage G, Enomoto N, Feinstone S, Halfon P, Inchauspé G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 2005; 42: [PMID: DOI: / hep.20819] 6 Santantonio T, Sinisi E, Guastadisegni A, Casalino C, Mazzola M, Gentile A, Leandro G, Pastore G. Natural course of acute hepatitis C: a long-term prospective study. Dig Liver Dis 2003; 35: [PMID: ] 7 Swain MG, Lai MY, Shiffman ML, Cooksley WG, Zeuzem S, Dieterich DT, Abergel A, Pessôa MG, Lin A, Tietz A, Connell EV, Diago M. A sustained virologic response is durable in patients with chronic hepatitis C treated with peginterferon alfa-2a and ribavirin. Gastroenterology 2010; 139: [PMID: DOI: /j.gastro ] 8 Hadziyannis SJ, Sette H, Morgan TR, Balan V, Diago M, Marcellin P, Ramadori G, Bodenheimer H, Bernstein D, Rizzetto M, Zeuzem S, Pockros PJ, Lin A, Ackrill AM. Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 2004; 140: [PMID: ] 9 Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL, Häussinger D, Diago M, Carosi G, Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: / NEJMoa020047] 10 Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001; 358: [PMID: ] 11 Scheel TK, Rice CM. Understanding the hepatitis C virus life cycle paves the way for highly effective therapies. Nat Med 2013; 19: [PMID: DOI: / nm.3248] 12 Shah N, Pierce T, Kowdley KV. Review of direct-acting antiviral agents for the treatment of chronic hepatitis C. Expert Opin Investig Drugs 2013; 22: [PMID: DOI: / ] 13 Bacon BR, Gordon SC, Lawitz E, Marcellin P, Vierling JM, Zeuzem S, Poordad F, Goodman ZD, Sings HL, Boparai N, Burroughs M, Brass CA, Albrecht JK, Esteban R. Boceprevir for previously treated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 14 European Association for the Study of the Liver. EASL Clinical Practice Guidelines: management of hepatitis C virus infection. J Hepatol 2011; 55: [PMID: March 21, 2014 Volume 20 Issue 11

204 Upadya MH et al. Interaction of HCV with DEAD-box helicases DOI: /j.jhep ] 15 Hézode C. Oral combination therapy: future hepatitis C virus treatment? J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 16 Jacobson IM, McHutchison JG, Dusheiko G, Di Bisceglie AM, Reddy KR, Bzowej NH, Marcellin P, Muir AJ, Ferenci P, Flisiak R, George J, Rizzetto M, Shouval D, Sola R, Terg RA, Yoshida EM, Adda N, Bengtsson L, Sankoh AJ, Kieffer TL, George S, Kauffman RS, Zeuzem S. Telaprevir for previously untreated chronic hepatitis C virus infection. N Engl J Med 2011; 364: [PMID: DOI: / NEJMoa ] 17 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 18 Zeuzem S, Andreone P, Pol S, Lawitz E, Diago M, Roberts S, Focaccia R, Younossi Z, Foster GR, Horban A, Ferenci P, Nevens F, Müllhaupt B, Pockros P, Terg R, Shouval D, van Hoek B, Weiland O, Van Heeswijk R, De Meyer S, Luo D, Boogaerts G, Polo R, Picchio G, Beumont M. Telaprevir for retreatment of HCV infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 19 Welsch C, Jesudian A, Zeuzem S, Jacobson I. New directacting antiviral agents for the treatment of hepatitis C virus infection and perspectives. Gut 2012; 61 Suppl 1: i36-i46 [PMID: DOI: /gutjnl ] 20 Chatel-Chaix L, Germain MA, Götte M, Lamarre D. Directacting and host-targeting HCV inhibitors: current and future directions. Curr Opin Virol 2012; 2: [PMID: DOI: /j.coviro ] 21 Pawlotsky JM. Treatment failure and resistance with directacting antiviral drugs against hepatitis C virus. Hepatology 2011; 53: [PMID: DOI: / hep.24262] 22 Aloia AL, Locarnini S, Beard MR. Antiviral resistance and direct-acting antiviral agents for HCV. Antivir Ther 2012; 17: [PMID: DOI: /imp2426] 23 Huang Z, Murray MG, Secrist JA. Recent development of therapeutics for chronic HCV infection. Antiviral Res 2006; 71: [PMID: DOI: /j.antiviral ] 24 Koev G, Kati W. The emerging field of HCV drug resistance. Expert Opin Investig Drugs 2008; 17: [PMID: DOI: / ] 25 Einav S, Gerber D, Bryson PD, Sklan EH, Elazar M, Maerkl SJ, Glenn JS, Quake SR. Discovery of a hepatitis C target and its pharmacological inhibitors by microfluidic affinity analysis. Nat Biotechnol 2008; 26: [PMID: DOI: /nbt.1490] 26 Pan Q, van der Laan LJ. New targets for treatment against HCV infection. Best Pract Res Clin Gastroenterol 2012; 26: [PMID: DOI: /j.bpg ] 27 Bartenschlager R, Lohmann V. Replication of hepatitis C virus. J Gen Virol 2000; 81: [PMID: ] 28 Zeuzem S, Arora S, Bacon B, Box T, Charlton M, Diago M, Dieterich D, Esteban Mur R, Everson G, Fallon M, Ferenci P, Flisiak R, George J, Ghalib R, Gitlin N, Gladysz A, Gordon S, Greenbloom S, Hassanein T, Jacobson I, Jeffers L, Kowdley K, Lawitz E, Lee S, Leggett B, Lueth S, Nelson D, Pockros P, Rodriguez-Torres M, Rustgi V, Serfaty L, Sherman M, Shiffman M, Sola R, Sulkowski M, Vargas H, Vierling J, Yoffe B, Ishak L, Fontana D, Xu D, Lester J, Gray T, Horga A, Hillson J, Ramos E, Lopez-Talavera JC, Muir A. Pegylated interferon-lambda (PEGIFN-λ) shows superior viral response with improved safety and tolerability versus PEGIFNα-2A in HCV patients (Gl/2/3/4): EMERGE Phase IIB through week 12. J Hepatol 2011; 54: S538-S539 (abstract 1362) 29 Boonstra A, Liu BS, Groothuismink ZM, Bergmann JF, de Bruijne J, Hotho DM, Hansen BE, van Vliet AA, van de Wetering de Rooij J, Fletcher SP, Bauman LA, Rahimy M, Appleman JR, Freddo JL, Reesink HW, de Knegt RJ, Janssen HL. Potent immune activation in chronic hepatitis C patients upon administration of an oral inducer of endogenous interferons that acts via Toll-like receptor 7. Antivir Ther 2012; 17: [PMID: DOI: /imp2023] 30 Zhang X, Kraft A, Broering R, Schlaak JF, Dittmer U, Lu M. Preclinical development of TLR ligands as drugs for the treatment of chronic viral infections. Expert Opin Drug Discov 2012; 7: [PMID: DOI: / ] 31 Fafi-Kremer S, Fofana I, Soulier E, Carolla P, Meuleman P, Leroux-Roels G, Patel AH, Cosset FL, Pessaux P, Doffoël M, Wolf P, Stoll-Keller F, Baumert TF. Viral entry and escape from antibody-mediated neutralization influence hepatitis C virus reinfection in liver transplantation. J Exp Med 2010; 207: [PMID: DOI: /jem ] 32 Zeisel MB, Lupberger J, Fofana I, Baumert TF. Host-targeting agents for prevention and treatment of chronic hepatitis C - perspectives and challenges. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 33 Lupberger J, Zeisel MB, Xiao F, Thumann C, Fofana I, Zona L, Davis C, Mee CJ, Turek M, Gorke S, Royer C, Fischer B, Zahid MN, Lavillette D, Fresquet J, Cosset FL, Rothenberg SM, Pietschmann T, Patel AH, Pessaux P, Doffoël M, Raffelsberger W, Poch O, McKeating JA, Brino L, Baumert TF. EGFR and EphA2 are host factors for hepatitis C virus entry and possible targets for antiviral therapy. Nat Med 2011; 17: [PMID: DOI: /nm.2341] 34 Zhu H, Wong-Staal F, Lee H, Syder A, McKelvy J, Schooley RT, Wyles DL. Evaluation of ITX 5061, a scavenger receptor B1 antagonist: resistance selection and activity in combination with other hepatitis C virus antivirals. J Infect Dis 2012; 205: [PMID: DOI: /infdis/jir802] 35 von Hahn T, Ciesek S, Manns MP. Arrest all accessories- -inhibition of hepatitis C virus by compounds that target host factors. Discov Med 2011; 12: [PMID: ] 36 Samreen B, Khaliq S, Ashfaq UA, Khan M, Afzal N, Shahzad MA, Riaz S, Jahan S. Hepatitis C virus entry: role of host and viral factors. Infect Genet Evol 2012; 12: [PMID: DOI: /j.meegid ] 37 Pawlotsky JM. The science of direct-acting antiviral and host-targeted agent therapy. Antivir Ther 2012; 17: [PMID: DOI: /imp2423] 38 Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K, Habermann A, Kräusslich HG, Mizokami M, Bartenschlager R, Liang TJ. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 2005; 11: [PMID: DOI: /nm1268] 39 Lindenbach BD, Evans MJ, Syder AJ, Wölk B, Tellinghuisen TL, Liu CC, Maruyama T, Hynes RO, Burton DR, McKeating JA, Rice CM. Complete replication of hepatitis C virus in cell culture. Science 2005; 309: [PMID: DOI: /science ] 40 Rocak S, Linder P. DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 2004; 5: [PMID: DOI: /nrm1335] 41 Story RM, Steitz TA. Structure of the reca protein-adp complex. Nature 1992; 355: [PMID: DOI: /355374a0] 42 Caruthers JM, Johnson ER, McKay DB. Crystal structure of yeast initiation factor 4A, a DEAD-box RNA helicase. Proc Natl Acad Sci USA 2000; 97: [PMID: DOI: /pnas ] 43 Carmel AB, Matthews BW. Crystal structure of the Bst- DEAD N-terminal domain: a novel DEAD protein from 2923 March 21, 2014 Volume 20 Issue 11

205 Upadya MH et al. Interaction of HCV with DEAD-box helicases Bacillus stearothermophilus. RNA 2004; 10: [PMID: ] 44 Seth RB, Sun L, Chen ZJ. Antiviral innate immunity pathways. Cell Res 2006; 16: [PMID: DOI: /sj.cr ] 45 Gerlier D, Lyles DS. Interplay between innate immunity and negative-strand RNA viruses: towards a rational model. Microbiol Mol Biol Rev 2011; 75: , second page of table of contents [PMID: DOI: /mmbr ] 46 Horner SM. Activation and Evasion of Antiviral Innate Immunity by Hepatitis C Virus. J Mol Biol 2014; 426: [PMID: DOI: /j.jmb ] 47 Oshiumi H, Funami K, Aly HH, Matsumoto M, Seya T. Multi-step regulation of interferon induction by hepatitis C virus. Arch Immunol Ther Exp (Warsz) 2013; 61: [PMID: DOI: /s x] 48 Tingting P, Caiyun F, Zhigang Y, Pengyuan Y, Zhenghong Y. Subproteomic analysis of the cellular proteins associated with the 3 untranslated region of the hepatitis C virus genome in human liver cells. Biochem Biophys Res Commun 2006; 347: [PMID: DOI: /j.bbrc ] 49 Godbout R, Packer M, Bie W. Overexpression of a DEAD box protein (DDX1) in neuroblastoma and retinoblastoma cell lines. J Biol Chem 1998; 273: [PMID: ] 50 Fang J, Kubota S, Yang B, Zhou N, Zhang H, Godbout R, Pomerantz RJ. A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev. Virology 2004; 330: [PMID: DOI: /j.virol ] 51 Borgia G, Reynaud L, Gentile I, Piazza M. HIV and hepatitis C virus: facts and controversies. Infection 2003; 31: [PMID: ] 52 Tan YJ, Lim SG, Hong W. Understanding human immunodeficiency virus type 1 and hepatitis C virus coinfection. Curr HIV Res 2006; 4: [PMID: ] 53 Schröder M. Human DEAD-box protein 3 has multiple functions in gene regulation and cell cycle control and is a prime target for viral manipulation. Biochem Pharmacol 2010; 79: [PMID: DOI: /j.bcp ] 54 Schröder M, Baran M, Bowie AG. Viral targeting of DEAD box protein 3 reveals its role in TBK1/IKKepsilon-mediated IRF activation. EMBO J 2008; 27: [PMID: DOI: /emboj ] 55 Soulat D, Bürckstümmer T, Westermayer S, Goncalves A, Bauch A, Stefanovic A, Hantschel O, Bennett KL, Decker T, Superti-Furga G. The DEAD-box helicase DDX3X is a critical component of the TANK-binding kinase 1-dependent innate immune response. EMBO J 2008; 27: [PMID: DOI: /emboj ] 56 Cheng G, Zhong J, Chisari FV. Inhibition of dsrnainduced signaling in hepatitis C virus-infected cells by NS3 protease-dependent and -independent mechanisms. Proc Natl Acad Sci USA 2006; 103: [PMID: DOI: /pnas ] 57 Kawai T, Akira S. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 2009; 21: [PMID: DOI: /intimm/dxp017] 58 Oshiumi H, Sakai K, Matsumoto M, Seya T. DEAD/H BOX 3 (DDX3) helicase binds the RIG-I adaptor IPS-1 to upregulate IFN-beta-inducing potential. Eur J Immunol 2010; 40: [PMID: DOI: /eji ] 59 Ariumi Y, Kuroki M, Abe K, Dansako H, Ikeda M, Wakita T, Kato N. DDX3 DEAD-box RNA helicase is required for hepatitis C virus RNA replication. J Virol 2007; 81: [PMID: DOI: /jvi ] 60 Randall G, Panis M, Cooper JD, Tellinghuisen TL, Sukhodolets KE, Pfeffer S, Landthaler M, Landgraf P, Kan S, Lindenbach BD, Chien M, Weir DB, Russo JJ, Ju J, Brownstein MJ, Sheridan R, Sander C, Zavolan M, Tuschl T, Rice CM. Cellular cofactors affecting hepatitis C virus infection and replication. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 61 Yedavalli VS, Neuveut C, Chi YH, Kleiman L, Jeang KT. Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function. Cell 2004; 119: [PMID: DOI: /j.cell ] 62 Schröder M. Viruses and the human DEAD-box helicase DDX3: inhibition or exploitation? Biochem Soc Trans 2011; 39: [PMID: DOI: /bst ] 63 Mamiya N, Worman HJ. Hepatitis C virus core protein binds to a DEAD box RNA helicase. J Biol Chem 1999; 274: [PMID: ] 64 Owsianka AM, Patel AH. Hepatitis C virus core protein interacts with a human DEAD box protein DDX3. Virology 1999; 257: [PMID: DOI: / viro ] 65 You LR, Chen CM, Yeh TS, Tsai TY, Mai RT, Lin CH, Lee YH. Hepatitis C virus core protein interacts with cellular putative RNA helicase. J Virol 1999; 73: [PMID: ] 66 Angus AG, Dalrymple D, Boulant S, McGivern DR, Clayton RF, Scott MJ, Adair R, Graham S, Owsianka AM, Targett- Adams P, Li K, Wakita T, McLauchlan J, Lemon SM, Patel AH. Requirement of cellular DDX3 for hepatitis C virus replication is unrelated to its interaction with the viral core protein. J Gen Virol 2010; 91: [PMID: DOI: /vir ] 67 Sun C, Pager CT, Luo G, Sarnow P, Cate JH. Hepatitis C virus core-derived peptides inhibit genotype 1b viral genome replication via interaction with DDX3X. PLoS One 2010; 5: [PMID: DOI: /journal.pone ] 68 Goh PY, Tan YJ, Lim SP, Tan YH, Lim SG, Fuller-Pace F, Hong W. Cellular RNA helicase p68 relocalization and interaction with the hepatitis C virus (HCV) NS5B protein and the potential role of p68 in HCV RNA replication. J Virol 2004; 78: [PMID: ] 69 McGivern DR, Lemon SM. Virus-specific mechanisms of carcinogenesis in hepatitis C virus associated liver cancer. Oncogene 2011; 30: [PMID: DOI: /onc ] 70 Dutta S, Gupta G, Choi YW, Kotaka M, Fielding BC, Song J, Tan YJ. The variable N-terminal region of DDX5 contains structural elements and auto-inhibits its interaction with NS5B of hepatitis C virus. Biochem J 2012; 446: [PMID: DOI: /bj ] 71 Lim SP, Soo HM, Tan YH, Brenner S, Horstmann H, MacKenzie JM, Ng ML, Lim SG, Hong Wj. Inducible system in human hepatoma cell lines for hepatitis C virus production. Virology 2002; 303: [PMID: ] 72 Bungyoku Y, Shoji I, Makine T, Adachi T, Hayashida K, Nagano-Fujii M, Ide YH, Deng L, Hotta H. Efficient production of infectious hepatitis C virus with adaptive mutations in cultured hepatoma cells. J Gen Virol 2009; 90: [PMID: DOI: /vir ] 73 Mohd-Ismail NK, Deng L, Sukumaran SK, Yu VC, Hotta H, Tan YJ. The hepatitis C virus core protein contains a BH3 domain that regulates apoptosis through specific interaction with human Mcl-1. J Virol 2009; 83: [PMID: DOI: /jvi ] 74 Deng L, Adachi T, Kitayama K, Bungyoku Y, Kitazawa S, Ishido S, Shoji I, Hotta H. Hepatitis C virus infection induces apoptosis through a Bax-triggered, mitochondrionmediated, caspase 3-dependent pathway. J Virol 2008; 82: [PMID: DOI: /jvi ] 75 Kuroki M, Ariumi Y, Hijikata M, Ikeda M, Dansako H, Wakita T, Shimotohno K, Kato N. PML tumor suppressor protein is required for HCV production. Biochem Biophys Res Commun 2013; 430: [PMID: DOI: / j.bbrc ] 2924 March 21, 2014 Volume 20 Issue 11

206 Upadya MH et al. Interaction of HCV with DEAD-box helicases 76 Ariumi Y, Kuroki M, Maki M, Ikeda M, Dansako H, Wakita T, Kato N. The ESCRT system is required for hepatitis C virus production. PLoS One 2011; 6: e14517 [PMID: DOI: /journal.pone ] 77 Huang H, Shiffman ML, Cheung RC, Layden TJ, Friedman S, Abar OT, Yee L, Chokkalingam AP, Schrodi SJ, Chan J, Catanese JJ, Leong DU, Ross D, Hu X, Monto A, McAllister LB, Broder S, White T, Sninsky JJ, Wright TL. Identification of two gene variants associated with risk of advanced fibrosis in patients with chronic hepatitis C. Gastroenterology 2006; 130: [PMID: DOI: / j.gastro ] 78 Scheller N, Mina LB, Galão RP, Chari A, Giménez-Barcons M, Noueiry A, Fischer U, Meyerhans A, Díez J. Translation and replication of hepatitis C virus genomic RNA depends on ancient cellular proteins that control mrna fates. Proc Natl Acad Sci USA 2009; 106: [PMID: DOI: /pnas ] 79 Jangra RK, Yi M, Lemon SM. DDX6 (Rck/p54) is required for efficient hepatitis C virus replication but not for internal ribosome entry site-directed translation. J Virol 2010; 84: [PMID: DOI: /jvi ] 80 Pager CT, Schütz S, Abraham TM, Luo G, Sarnow P. Modulation of hepatitis C virus RNA abundance and virus release by dispersion of processing bodies and enrichment of stress granules. Virology 2013; 435: [PMID: DOI: /j.virol ] 81 Huys A, Thibault PA, Wilson JA. Modulation of hepatitis C virus RNA accumulation and translation by DDX6 and mir-122 are mediated by separate mechanisms. PLoS One 2013; 8: e67437 [PMID: DOI: /journal. pone ] 82 Jin DY. Molecular pathogenesis of hepatitis C virus-associated hepatocellular carcinoma. Front Biosci 2007; 12: [PMID: ] 83 Jeong SW, Jang JY, Chung RT. Hepatitis C virus and hepatocarcinogenesis. Clin Mol Hepatol 2012; 18: [PMID: DOI: /cmh ] 84 Arzumanyan A, Reis HM, Feitelson MA. Pathogenic mechanisms in HBV- and HCV-associated hepatocellular carcinoma. Nat Rev Cancer 2013; 13: [PMID: DOI: /nrc3449] 85 Fuller-Pace FV, Moore HC. RNA helicases p68 and p72: multifunctional proteins with important implications for cancer development. Future Oncol 2011; 7: [PMID: DOI: /fon.11.1] 86 Kitagawa N, Ojima H, Shirakihara T, Shimizu H, Kokubu A, Urushidate T, Totoki Y, Kosuge T, Miyagawa S, Shibata T. Downregulation of the microrna biogenesis components and its association with poor prognosis in hepatocellular carcinoma. Cancer Sci 2013; 104: [PMID: DOI: /cas.12126] 87 Sekine S, Ogawa R, Ito R, Hiraoka N, McManus MT, Kanai Y, Hebrok M. Disruption of Dicer1 induces dysregulated fetal gene expression and promotes hepatocarcinogenesis. Gastroenterology 2009; 136: e1-4 [PMID: DOI: /j.gastro ] 88 Miyaji K, Nakagawa Y, Matsumoto K, Yoshida H, Morikawa H, Hongou Y, Arisaka Y, Kojima H, Inoue T, Hirata I, Katsu K, Akao Y. Overexpression of a DEAD box/rna helicase protein, rck/p54, in human hepatocytes from patients with hepatitis C virus-related chronic hepatitis and its implication in hepatocellular carcinogenesis. J Viral Hepat 2003; 10: [PMID: ] 89 Chu CY, Rana TM. Translation repression in human cells by microrna-induced gene silencing requires RCK/p54. PLoS Biol 2006; 4: e210 [PMID: DOI: /journal. pbio ] 90 Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G. mirnps: a novel class of ribonucleoproteins containing numerous micror- NAs. Genes Dev 2002; 16: [PMID: DOI: /gad ] 91 Hutvágner G, Zamore PD. A microrna in a multiple-turnover RNAi enzyme complex. Science 2002; 297: [PMID: DOI: /science ] 92 Zender L, Xue W, Zuber J, Semighini CP, Krasnitz A, Ma B, Zender P, Kubicka S, Luk JM, Schirmacher P, McCombie WR, Wigler M, Hicks J, Hannon GJ, Powers S, Lowe SW. An oncogenomics-based in vivo RNAi screen identifies tumor suppressors in liver cancer. Cell 2008; 135: [PMID: DOI: /j.cell ] 93 Takata A, Otsuka M, Yoshikawa T, Kishikawa T, Kudo Y, Goto T, Yoshida H, Koike K. A mirna machinery component DDX20 controls NF-κB via microrna-140 function. Biochem Biophys Res Commun 2012; 420: [PMID: DOI: /j.bbrc ] 94 Takata A, Otsuka M, Yoshikawa T, Kishikawa T, Hikiba Y, Obi S, Goto T, Kang YJ, Maeda S, Yoshida H, Omata M, Asahara H, Koike K. MicroRNA-140 acts as a liver tumor suppressor by controlling NF-κB activity by directly targeting DNA methyltransferase 1 (Dnmt1) expression. Hepatology 2013; 57: [PMID: DOI: / hep.26011] 95 Karin M. Nuclear factor-kappab in cancer development and progression. Nature 2006; 441: [PMID: DOI: /nature04870] 96 Luedde T, Schwabe RF. NF-κB in the liver--linking injury, fibrosis and hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol 2011; 8: [PMID: DOI: / nrgastro ] 97 Huang JS, Chao CC, Su TL, Yeh SH, Chen DS, Chen CT, Chen PJ, Jou YS. Diverse cellular transformation capability of overexpressed genes in human hepatocellular carcinoma. Biochem Biophys Res Commun 2004; 315: [PMID: DOI: /j.bbrc ] 98 Li L, Chen SH, Yu CH, Li YM, Wang SQ. Identification of hepatocellular-carcinoma-associated antigens and autoantibodies by serological proteome analysis combined with protein microarray. J Proteome Res 2008; 7: [PMID: DOI: /pr070525r] 99 Liu H, Zhang J, Wang S, Pang Z, Wang Z, Zhou W, Wu M. Screening of autoantibodies as potential biomarkers for hepatocellular carcinoma by using T7 phase display system. Cancer Epidemiol 2012; 36: [PMID: DOI: /j.canep ] 100 Chang PC, Chi CW, Chau GY, Li FY, Tsai YH, Wu JC, Wu Lee YH. DDX3, a DEAD box RNA helicase, is deregulated in hepatitis virus-associated hepatocellular carcinoma and is involved in cell growth control. Oncogene 2006; 25: [PMID: DOI: /sj.onc ] 101 Chao CH, Chen CM, Cheng PL, Shih JW, Tsou AP, Lee YH. DDX3, a DEAD box RNA helicase with tumor growth-suppressive property and transcriptional regulation activity of the p21waf1/cip1 promoter, is a candidate tumor suppressor. Cancer Res 2006; 66: [PMID: DOI: / can ] 102 Jansson MD, Lund AH. MicroRNA and cancer. Mol Oncol 2012; 6: [PMID: DOI: /j.molonc ] 103 Farazi TA, Hoell JI, Morozov P, Tuschl T. MicroRNAs in human cancer. Adv Exp Med Biol 2013; 774: 1-20 [PMID: DOI: / _1] 104 Choi YJ, Lee SG. The DEAD-box RNA helicase DDX3 interacts with DDX5, co-localizes with it in the cytoplasm during the G2/M phase of the cycle, and affects its shuttling during mrnp export. J Cell Biochem 2012; 113: [PMID: DOI: /jcb.23428] 2925 March 21, 2014 Volume 20 Issue 11

207 Upadya MH et al. Interaction of HCV with DEAD-box helicases 105 Mailly L, Robinet E, Meuleman P, Baumert TF, Zeisel MB. Hepatitis C virus infection and related liver disease: the quest for the best animal model. Front Microbiol 2013; 4: 213 [PMID: DOI: /fmicb ] 106 Billerbeck E, de Jong Y, Dorner M, de la Fuente C, Ploss A. Animal models for hepatitis C. Curr Top Microbiol Immunol 2013; 369: [PMID: DOI: / _3] 107 Washburn ML, Bility MT, Zhang L, Kovalev GI, Buntzman A, Frelinger JA, Barry W, Ploss A, Rice CM, Su L. A humanized mouse model to study hepatitis C virus infection, immune response, and liver disease. Gastroenterology 2011; 140: [PMID: DOI: /j.gastro ] 108 Dorner M, Horwitz JA, Donovan BM, Labitt RN, Budell WC, Friling T, Vogt A, Catanese MT, Satoh T, Kawai T, Akira S, Law M, Rice CM, Ploss A. Completion of the entire hepatitis C virus life cycle in genetically humanized mice. Nature 2013; 501: [PMID: DOI: /nature12427] P- Reviewers: Hou WH, Jin DY, Jin B, Tetsuya T S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2926 March 21, 2014 Volume 20 Issue 11

208 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Hepatitis C virus genotype 6: Virology, epidemiology, genetic variation and clinical implication TOPIC HIGHLIGHT Vo Duy Thong, Srunthron Akkarathamrongsin, Kittiyod Poovorawan, Pisit Tangkijvanich, Yong Poovorawan Vo Duy Thong, Srunthron Akkarathamrongsin, Yong Poovorawan, Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand Kittiyod Poovorawan, Department of Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand Pisit Tangkijvanich, Department of Biochemistry, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand Author contributions: Thong VD, Tangkijvanich P and Poovorawan Y designed research, reviewed all references and documents; Akkarathamrongsin S, Poovorawan K analyzed data; Thong VD, Tangkijvanich P and Poovorawan Y wrote paper. All authors reviewed and approved the final version. Supported by Research Unit of Hepatitis and Liver Cancer, Chulalongkorn University; The Scholarship Program for Neighboring Countries, Chulalongkorn University; The Higher Education Research Promotion and National Research University Project of Thailand, HR1155A-55; Thailand Research Fund, DPG , BRG ; Office of the Commission on Higher Education; Center of Excellence in Clinical Virology, Chulalongkorn University; Integrated Innovation Academic Center IIAC Chulalongkorn University Centenary Academic Development Project, CU56-HR01); the Ratchadaphiseksomphot Endowment Fund of Chulalongkorn University, RES ; and King Chulalongkorn Memorial Hospital Correspondence to: Yong Poovorawan, MD, Professor, Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. yong.p@chula.ac.th Telephone: Fax: Received: September 24, 2013 Revised: January 6, 2014 Accepted: January 19, 2014 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) is a serious public health problem affecting 170 million carriers worldwide. It is a leading cause of chronic hepatitis, cirrhosis, and liver cancer and is the primary cause for liver transplantation worldwide. HCV genotype 6 (HCV-6) is restricted to South China, South-East Asia, and it is also occasionally found in migrant patients from endemic countries. HCV-6 has considerable genetic diversity with 23 subtypes (a to w). Although direct sequencing followed by phylogenetic analysis is the gold standard for HCV-6 genotyping and subtyping, there are also now rapid genotyping tests available such as the reverse hybridization line probe assay (INNO-LiPA Ⅱ; Innogenetics, Zwijnaarde, Belgium). HCV-6 patients present with similar clinical manifestations as patients infected with other genotypes. Based on current evidence, the optimal treatment duration of HCV-6 with pegylated interferon/ribavirin should be 48 wk, although a shortened treatment duration of 24 wk could be sufficient in patients with low pretreatment viral load who achieve rapid virological response. In addition, the development of direct-acting antiviral agents is ongoing, and they give high response rate when combined with standard therapy. Herein, we review the epidemiology, classification, diagnosis and treatment as it pertain to HCV Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Genotype 6; Epidemiology; Clinical; Treatment Core tip: Hepatitis C virus (HCV) genotype 6 is restricted to South China, South-East Asia, and it is occasionally found in migrant patients from endemic countries. Treatment response rates are lower than those of genotype 3 but higher than those of genotype 1. Based on current evidence, the optimal treatment duration of HCV-6 should be 48 wk. Shortened treatment duration of 24 wk could be sufficient in patients with low pretreatment viral load who achieve rapid virological response. The development of direct-acting antiviral agents is ongoing, and they give high response rate when combined with standard therapy. We review the epidemiology, classification, diagnosis and treatment. Thong VD, Akkarathamrongsin S, Poovorawan K, Tangkijvanich 2927 March 21, 2014 Volume 20 Issue 11

209 Thong VD et al. Hepatitis C virus genotype 6 P, Poovorawan Y. Hepatitis C virus genotype 6: Virology, epidemiology, genetic variation and clinical implication. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Hepatitis C virus (HCV) infection is an important worldwide public health problem. Most HCV cases become chronic hepatitis C (CHC), which may advance to liver fibrosis, cirrhosis, and hepatocellular carcinoma. The global prevalence of HCV infection is estimated at more than 170 million people [1-3], and some studies estimate that mortality related to HCV infection (death from liver failure or hepatocellular carcinoma) will continue to increases over the next two decades [4]. Hepatitis C virus is a member of the Flaviviridae family and belongs to the genus Hepacivirus. HCV is classified into six major genotypes (1-6) and subdivided into various subtypes named in alphabetical order from a to z. Currently, sequencing of HCV isolates has identified more than 83 subtypes from the six genotypes [5]. The genomes among HCV genotypes differ from each other by approximately 30%-35% while the genomes among the subtypes differ by 15%-20%. The prevalence of HCV genotypes varies geographically: HCV-1 is found worldwide including developed regions such as North America and Europe. HCV-2 has high prevalence in Central and West Africa as well as some western countries, while HCV-3 is predominantly found in the Far Eastern countries and the Indian subcontinent [6]. Meanwhile, HCV genotypes 4, 5 and 6 are endemic to specific geographical areas: HCV-4 is mainly found in Egypt and Sub-Saharan Africa, HCV-5 in South Africa [7], and HCV-6 in South China and South-East Asian countries [8-10] (Figure 1) [10-34]. HCV-6 is highly diverse with 23 subtypes currently known [8,9,30]. This genetic diversity may be the result of a long period of viral circulation [14]. In addition, repeated viral exposure through activities such as intravenous drug use leads to more than one viral strain circulating in the host, which in turn increases the chance of viral recombination events among circulating HCV genotypes and strains. The high variation and accumulation of HCV-6 in Southeast Asia also supports the idea that this area may be the origin and worldwide distribution center of this genotype. Various factors determine treatment response. In the case of host factors, age, sex, race, fibrosis and steatosis level all have important influences on treatment outcome [35-37], while the most important viral factors for predicting response to IFN-based therapy are genotype and viral load at baseline. In the past 10 years, the standard treatment of HCV patients has been a combination of pegylated interferon (PEG-IFN) and ribavirin (RBV) with a 24 to 48 wk regimen depending on the viral genotype of each infected individual. Thus, HCV genotype is considered one of the most robust independent predictors for sustained virological response (SVR). Most clinical studies on PEG-IFN/RBV efficacy have been based on common genotypes such as genotype 1, 2 and 3, while scant clinical data has been generated concerning genotype 6. However, due to this genotype s extreme genetic diversity, it may be important to study it in a controlled, clinical setting in order to gauge the standard therapy s efficacy [5]. Currently, the few available studies suggest that treatment with the longer 48-wk regimen may lead to a higher rate of SVR. On the other hand though, treatment with the 24-wk regimen may also lead to a similar SVR rate in subgroups of patients, as in the case of patients with genotypes 2 and 3 [38]. In 2011, newer agents known as direct-acting antivirals (DAA) were approved for use in conjunction with PEG-IFN and RBV for the treatment of HCV-1. However, the efficacy and safety of DAA in the treatment of the HCV-6 patients still needs to be assessed. This study aimed to review the virology, epidemiology, genetic variation and clinical implication of HCV genotype 6. All data were retrieved and selected from related HCV-6 topics from PubMed database. EPIDEMEDIOLOGY Within endemic countries, HCV-6 shows variability in subtype prevalence. Vietnam has reported HCV-6 prevalence of 51%-54.4% in Ho Chi Minh City and 47.1% elsewhere with the most common subtypes being 6a followed by 6e and 6l. In total, 12 subtypes have thus far been identified in Vietnam (6a, 6c, 6e, 6f, 6h, 6k, 6l, 6n, 6o, 6p, 6r and 6t) [39-41]. Although there is limited information regarding HCV epidemiology in Laos and Cambodia, a few studies have reported a high proportion of HCV-6 in these countries also. Among Laos blood donors, 95.6% of the HCV RNA positive samples were classified as HCV-6 with various subtypes being found including 6b, 6h, 6k, 6l, 6n, 6o, 6q and unclassified subtypes [42,43]. A study of Cambodian migrants in Thailand reported that HCV seroprevalence in this group is similar to their guest country (2.3%). It was also found that HCV-6 is the most dominate genotype in Cambodian migrants with 52% of the HCV-RNA carriers testing positive for this genotype with the subtype breakdown as the following; 6e (20%), 6r (20%), 6f (8%) and 6p (4%) [42]. Similar to its neighboring countries, Thailand also has several endemic HCV-6 subtypes (6b, 6c, 6e, 6f, 6i, 6m and 6n) along with novel subtypes (6u and 6v), which are found in the North and Northeast [43]. However, unlike the Cambodian migrant population in Thailand, this genotype contributes a lower proportion (20.1%) of overall infection in comparison with HCV-3 and HCV-1 [32]. In Myanmar, HCV-6 prevalence has gone from being the third most prevalent HCV genotype in 2004 to the first after analysis of a large number of blood samples from HCV-6 is especially prevalent in the Northern part of Myanmar 2928 March 21, 2014 Volume 20 Issue 11

210 Thong VD et al. Hepatitis C virus genotype 6 Canada n = 3565 United Kingdom n = Germany 3 1 United States n = n = Mexico France n = 9801 Genotypes Genotype 1 Genotype 2 Genotype 3 Genotype 4 Genotype 5 Genotype 6 Egypt n = Colombia n = n = 958 Brazil 1 Argentina South Africa 1 n = n = n = 315 Figure 1 The prevalence of the various hepatitis C virus genotypes varies considerably between countries and regions [10-34]. Sweden n = 470 Iran 3 1 n = 853 India n = 607 Russia n = 655 n = 4651 Myanmar n = 190 Thailand n = 1653 China Indonesia n = 675 Japan 2 1 n = 3768 Vietnam 2 3 n = Australia 3 1 n = 830 South Korea 2 1 n = 264 Hong Kong n = 344 Taiwan n = March 21, 2014 Volume 20 Issue 11

211 Thong VD et al. Hepatitis C virus genotype 6 with subtypes 6f, 6n and 6m predominating [44-47]. Despite is ubiquitous presence in the above-mentioned countries, however, HCV-6 is only rarely reported in other proximal countries. For example, only three samples of subtype 6g (previously designated as genotype 1a) have been reported in Indonesia since 1996 [48], while only a single recent report of subtype 6n has been found in Kuala Lumpur, Malaysia, and notably, this patient was co-infected with HIV-1 and had a history of IVDU [49]. HCV-6 can also be found outside of the immediate South East Asian region in countries such as South China, Hong Kong and Taiwan (Figure 2) [28,40,43,46-48,50-55]. Intravenous drug abuse is the transmission route suspected of being most responsible for the high frequency of this genotype in certain parts of Asia and the factor driving a continuous discovery of new subtypes. In China, HCV is frequently found in the South in patients with HIV-1 co-infection and IDU history [56]. For example, prevalence of HCV-6 in chronic hepatitis cases is 12.9% to 14.2% while being 28.2% to 51.5% in IDUs. In addition, similar to Vietnam, 6a is the major subtype in IDUs from all study groups [17,57,58]. A similar trend of HCV-6 infection can also be observed in Hong Kong. More than half of infected IVDU have this genotype (53.2% to 58.5%), which is much higher than the prevalence in the general population (23.6%), and subtype 6a is the most common subtype [52,59]. In Taiwan, there has been no report of HCV-6 until 2010, but since then there is a growing prevalence of HCV-6 and subtype 6a along with novel subtypes being reported in prisoners and IDUs [53]. EVOLUTION OF HEPATITIS C VIRUS GENOTYPE 6 There is now considerable evidence to support the hypothesis that HCV-6 originated in Southeast Asia. First, this genotype is mainly observed in countries such as Vietnam, Cambodia, Laos, Myanmar and Thailand with the prevalence of HCV-6 in these countries ranging from approximately 20% to more than 50% of all genotypes. Second, there are a great number of known and novel subtypes circulating within these populations [41]. Third, when HCV-6 is found outside of its endemic area, such as in countries like US, Canada and Australia, the virus is almost exclusively isolated from Asian immigrants [7,60]. Fourth, a study in Laos showed that HCV-6 is highly divergent from other genotypes, and that it has distinct genetic differences from other strains, which suggests that there may yet be unclassified subtypes existing in this area. Thus, the accumulation of such genetic heterogeneity suggests that this genotype has circulated, adapted and evolved in this area for a long period of time (Table 1) [39,46,61-64]. Evolutionary analysis of HCV-6 subtypes hypothesizes that these subtypes evolved from a common ancestor more than 1000 years ago, and that some subtypes may have maintained their endemicity via local epidemics during the 20 th century initiated and propagated by modern medicine, blood transfusion and IVDU [42]. However, each of the subtypes seems generally restricted to different locations such as subtype 6d in Vietnam, 6f in Thailand, 6g in Indonesia and 6r in Cambodia. In addition, strains isolated from the same country tend to cluster together in a HCV-6 phylogenetic tree (Figure 3) [42,47]. HCV-6 has spread through other East Asian countries by multiple transmission routes with one of the most effective routes being IDU. In the general population, HCV-1 is still the predominant genotype across Asia. However, HCV-6 - and especially subtype 6a - is the dominant genotype among IVDUs [53,58,59]. An example of this is the phylogeographic and coalescent analysis of HCV-6 s spread through China. Analysis shows that subtype 6a and some other Chinese strains may have originated in Vietnam and spread to neighboring Guangxi and Yunnan provinces [65,66]. Finally, since Guangdong is a major gateway to China, this province may have been the origin of subtype 6a dispersion throughout other regions of the country [58]. Similar to other RNA viruses, HCV has a high tendency for genetic heterogeneity due to a lack of proof reading activity by its viral RNA polymerase. This genetic drift results in an accumulation of viral mutations, which will then be selected forby forces of environmental pressure. Thus, only the fittest strains survive and become the major circulating viral population. Of course, however, this process of fixation requires a relatively long period of time. Meanwhile, viral recombination can result in novel strains overnight, although the drastic nature of recombination can be a danger to viral survival. So far, the evidence suggests that novel HCV strains mainly accumulate through genetic drift by collecting viral mutation instead of recombination, as there have only been two reported cases of HCV-6-specific recombination occurring [67,68] ; recombinants RF_2i/6p and RF_2b/6w from a Vietnamese blood donor and an IDU in Taiwan, respectively [53,69]. METHODS USED FOR GENOTYPING Since HCV genotype is such an important consideration for predicting an effective treatment regimen, several different genotyping methods have been developed. These methods include direct nucleic acid sequencing [70], a reverse hybridization line probe assay (LiPA) [71], subtypespecific reverse transcription (RT)-PCR [72], DNA restriction fragment length polymorphism [73], heteroduplex mobility analysis [74], primer-specific and mispair extension analysis [75], melting curve analysis with fluorescence resonance energy transfer probes [76] and serologic genotyping (Figure 4) [5,77,78]. However, not every method is equal. The Asian Pacific Association for the Study of the Liver states that genotype discrimination based on primers from the 5 untranslated region (5 UTR) do not distinguish some of the HCV-6 subtypes prevalent in Southeast Asia, and that these subtypes should instead be classified as genotype 1 or 1b [79], available methods generally use distinct motifs 2930 March 21, 2014 Volume 20 Issue 11

212 Thong VD et al. Hepatitis C virus genotype 6 6q 6a France Canada 6o 6a 6 6p 6 6h 6e n = 5 6r n = 273 United States 6l 6d 6e 6o n = l 6a 6 India 6h 6n n = 14 Figure 2 Distribution of the prevalence of subtype of hepatitis C virus-6 in the world [28,40,43,46-48,50-55]. Thailand 6 6f 6j 6i 6m Myanmar 6n 6m n = b 6f 6n n = 141 Laos 6q Cambodia 6q 6u 6p 6e 6f 6r n = 15 6k 6h 6d 6l 6 Vietnam 6e 6a n = 604 Indonesia 6b 6g n = 7 6e 6u South China 6k 6n 6a n = Taiwan 6n 6w 6a n = 22 Hong Kong 6 n = 205 6a Singapore 6a 2931 March 21, 2014 Volume 20 Issue 11

213 Thong VD et al. Hepatitis C virus genotype 6 Table 1 Prevalence of hepatitis C virus-6 in Asians n (%) Country Ref. Genotype 6 prevalence Myanmar Lwin et al [46] 1333 (49) Vietnam (Hanoi, Vietnam) Pham et al [39] 238 (47.1) Thailand (blood donors throughout country) Kanistanon et al [61] NR (18) (blood donors in northern Thailand provinces) Jutavigittum et al [62] 326 (31) (blood donors from central Thailand) Akkarathamrongsin et al [63] 375 (30) Hong Kong, China (Blood donors) Leung et al [64] 910 (27) NR: Not reported. 6t.VT21.EF Vietnam 100 6t.TV249.EF Vietnam 6t.D49.EU Vietnam 6t.TV241.EF Vietnam 6q.QC99.EF Cambodia 6e.GX004.DQ China 6o.QC227.EF Canada p.QC216.EF Vietnam 6c.Th846.EF Thailand 6d.VN235.D84263.Vietnam 6r.QC245.EU Cambodia f.TH52.EU Thailand 6f.c-0004.DQ Thailand 6f.C-0046.DQ Thailand 6s QC66 EU Cambodia 100 6g.HK6554.DQ Hongkong 6g.JK046.D63822.Indonesia 6w.GZ52557.DQ China 100 6w.D140.EU Taiwan 6W.D370.EU Taiwan 6i.C-0159.DQ Thailand i.Th602.DQ Thailand j.Th553.DQ Thailand 6j.C-0667.DQ Thailand 6d.VN004.D84265.Vietnam h.VN004.D84265.Vietnam 6l EF Asian 6l.TV494.JX Vietnam 6k.VN405.D84264.Vietnam 6n.KM42.DQ China n Th31 EU Thailand 6m.C-0208.DQ Thailand 6m.B4/92.DQ Thailand 100 6m.C-0185.DQ Thailand 100 6m.C-0192.DQ Thailand 6b.TH580.D84262.Thailand a.euhk2.Y12083.Hongkong 6a D9 EU Vietnam 6u.DH012.EU China 6u.DH014.EU China 6u.DH028.EU China 6v.KM046.EU China v.KM181.FJ China 6v.KMN02.EU China 1a.M Figure 3 Phylogenetic relationships among subtypes hepatitis C virus-6. Phylogenetic tree constructed from whole genome sequence of all hepatitis C virus-6 subtypes (subtype 6a to 6w) which was analyzed by K2P model and MEGA version.5. Bootstrap value of 1000 replicates was indicated at each node March 21, 2014 Volume 20 Issue 11

214 Thong VD et al. Hepatitis C virus genotype 6 INNO-LIPA Ⅰ 5 UTR C E1 E2 NS1 NS2 NS3 NS4A NS4B NS5A NS5B 3 3 UTR INNO-LIPA Ⅱ Figure 4 Methods used for genotyping. The 5'-untranslated region (5'-UTR) and Core regions targeted by INNO-LiPA (the 5 -UTR only for INNO-LiPA Ⅰ or both the 5 -UTR and core regions for INNO-LiPA Ⅱ), sequencing of NS5B are used the standard methods for classifying hepatitis C virus genotype and subtype [5,78]. found within the HCV genome for HCV genotype [5]. In addition, previous studies reported the mistyping of HCV-6 as genotype 1 by the INNO-LiPA Ⅰ assay (Innogenetics, Zwijnaarde, Belgium) [80,81]. However, the INNO-LiPA HCV Ⅱ (Innogenetics, Zwijnaarde, Belgium) genotyping assay seems to overcome the deficiencies demonstrated by the INNO-LiPA Ⅰ assay, as it has shown remarkable improvement in genotyping accuracy and differentiation between HCV-1 and HCV-6 variants by using core sequencing data as well as 5 UTR data [82,83]. CLINICAL CHARACTERISTICS Acute HCV infection is infrequently diagnosed and leads to chronic infection in about 80% of cases [84]. Clinical manifestations can occur, usually within 7 to 8 wk (range: 2-26 wk) after exposure to HCV, but the majority of persons have either no symptoms or only mild symptoms, and fulminant hepatic failure due to acute HCV infection is very rare. Although clinical features will be present in less than 25% of infected patients, symptoms of acute hepatitis include jaundice, malaise, nausea and right upper quadrant pain [85]. While the infection becomes chronic in most cases, chronic infection is either asymptomatic or has only mild nonspecific symptoms such as fatigue as long as cirrhosis and hepatocellular carcinoma are not present. Other clinical manifestations are possible, however, such as nausea, weakness, myalgia, arthralgia and weight loss [86]. Although there have been many papers describing HCV-6 s epidemiology, the clinical characteristics have not been well described in those studies. Nguyen et al [87] reported that patients with HCV-6 presented similar clinical manifestations as those with genotype 1 or 2/3. They also found that people with HCV genotype 1 and 6 had a somewhat higher baseline viral load than those with others genotypes. However, when comparing HCV-6 patients with patients infected with other genotypes, these differences were not statistically significant with regard to host factors (e.g., age, history of smoking, alcohol use, family history of CHC, hepatitis B, hepatocellular carcinoma and liver-related death), baseline laboratory values (e.g., ALT, total bilirubin, albumin, white blood cell count, platelet count), and liver histology [55,88]. However, steatosis is a chief modulator of clinical course of HCV infection [89]. TREATMENT The current standard-of-care for treatment of HCV-infected patients is a combination of PEG-IFN and RBV. Among the various viral and host factors, HCV genotype is one of the most important predictors of response to treatment and is used to guide the duration of treatment. Patients with HCV genotype 1 are typically treated for 48 wk, whereas patients with genotype 2 and 3 are treated for 24 wk [35,36,90]. Limited studies have suggested that the response rate of HCV-6 may be at an intermediate level between those of genotypes 3 and 1 [87,91-93]. Virological response kinetics during therapy has emerged as an important prognostic factor of treatment outcome in patients with chronic HCV infection [94,95]. Absence of an early virological response (EVR) at week 12 during therapy is the best negative predictor for nonresponse to treatment. In contrast, rapid virological response (RVR; defined as undetectable HCV RNA at week 4) is regarded as the most important predictor for SVR (defined as undetectable HCV RNA at week 24 after the end of therapy) and has emerged as an important milestone to guide the appropriate duration of therapy. For example, in patients with genotype 1, an individualized approach to therapy designed according to early viral kinetics has been adopted to optimize therapeutic outcome in patients. Recent clinical trials have used RVR to identify those patients with low baseline viral load that may benefit from shortened treatment duration of 24 wk [96-98]. TREATMENT OUTCOMES OF HCV-6 VS OTHER GENOTYPES Currently, although the treatment outcome of patients with HCV-6 has so far not been exhaustively studied, a few studies exit which give hints as to what the standard course of care should be. Most previous studies have reported that genotype 6 behaves more similar to genotypes 2 and 3 (SVR rates of 76%-80%) [87,99,100] and thus responds better to therapy than genotype 1 (SVR rates of 46%-52%) [101]. For example, Nguyen et al [87] demonstrated that patients with HCV-6 had significantly better SVRs to PEG-IFN and RBV combination therapy than patients with genotype 1 (74% vs 49%). Furthermore, Tangkijvanich et al [102] 2933 March 21, 2014 Volume 20 Issue 11

215 Thong VD et al. Hepatitis C virus genotype 6 SVR (%) Cheng et al [86], 2006 reported that the SVR of HCV-6 is higher than that of genotype 1 but lower than that of genotype 3 (Figure 5). OPTIMAL TREATMENT DURATION OF HCV-6 Genotype 1 Genotype 6 Fung et al [105], 2008 Nguyen et al [87], 2010 Seto et al [93], 2010 Tsang et al [91], 2010 Tangkijvanich et al [102], 2012 Figure 5 Sustained virological response in genotype 6 vs genotype 1. SVR: Sustained virological response. Most prior studies of HCV-6 included patients treated for wk [ ]. A small study of Asian-American patients comparing a 48-wk to a shortened 24-wk regimen showed a significantly higher SVR rate in those treated by the 48-wk course (74% vs 49%) [38]. However, the limitation of the study was its retrospective design and the results were not analyzed with regard to an intention-totreat method. A retrospective study conducted in China showed that the rate of SVR in 22 patients with HCV-6 treated for 24 wk was comparable to that of genotypes 2/3 (82% and 83%, respectively) [92]. In that study, the positive predictive values of RVR and EVR for HCV-6 were comparable with those for genotypes 2/3 (87% vs 91% and 86% vs 87%, respectively). A randomized controlled trial of 60 patients with HCV-6 demonstrated that there was no significant difference in SVR rates in patients treated with 48-wk and 24-wk regimens (79% and 70%, respectively) [101]. In that study, RVR was a significant predictor of SVR in the 48-wk group and tending towards significance in the 24-wk group, although a sizeable number of patients did not have RVR measurement performed. Recently, Thu Thuy et al [106] conducted an open-label randomized trial in Vietnam, which aimed at assessing the rate of SVR in HCV-6 chronic HCV following 48 and 24 wk of PEG- IFN and RBV combination therapy. They demonstrated that RVR was achieved in the majority of HCV-6 patients and similar and high rates of SVR were noted following 48- and 24-wk therapy (71% vs 60%, respectively, P = 0.24). The feasibility of a response-guided therapy by individualizing the duration of treatment according to viral kinetics in patients with genotype 6 was first investigated by Fired et al [107]. In that pilot study, more than 70% of patients with HCV-6 achieved RVR and received an abbreviated 24-wk regimen. Among them, the rate of relapse was approximately 10%, and nearly 90% of them eradicated the virus. These data were consistent with observations regarding treatment of HCV genotypes 1, 2, 3 and 4, which suggest that monitoring RVR might be useful to guide treatment duration for patients with HCV-6. In particular, therapy might be shortened to 24 wk in patients with low pretreatment viral load who achieve RVR, whereas a 48-wk course was appropriate for those who cleared the virus after week 4. The abbreviated regimen could offer advantages by reducing unnecessary medication exposure, which may make the treatment of HCV-6 more affordable and maximize the cost effectiveness of therapy. However, further prospective randomized trials are required to evaluate the response-guided strategy in a larger number of patients with HCV-6. OPTIMAL DOSE OF RBV IN TREATING HCV-6 Although PEG-IFN represents the backbone of treatment, combination with RBV has been shown to help prevent relapse. Current guidelines recommend a weightadjusted dose of RBV in combination with PEG-IFN for treating patients with genotype 1, while a flat, low dose of RBV (800 mg/d) is recommended for treating patients with genotype 3 [95]. However, a weight-adjusted dose of RBV might be useful to enhance the response rate in patients with genotype 3 who do not achieve RVR and in those with RVR undergoing abbreviated therapy [108,109]. Currently, the optimal dose of RBV for treatment of patients with HCV-6 is unknown. In previous studies, daily weight-based or fixed doses of RBV had been used, rendering comparisons rather complicated. Nonetheless, recent prospective trials adopted a weight-based dosage of RBV ( mg/d) for abbreviated treatment (24 wk), which might result in achieving SVR equivalent to that obtained with longer treatment duration (48 wk) [101]. These data might reflect the need of a weight-based dosage of RBV in patients with HCV-6 undergoing abbreviated therapy. SAFETY AND SIDE EFFECT PROFILE OF TREATMENT Treatment with PEG-IFN and RBV has been shown to be safe in patients with HCV-6, but treatment discontinuation or dose reduction due to side-effects is typical. Although HCV genotypes play a role in achieving SVR, there is no significant difference in the frequency or types of side effects experienced among patients of genotypes 1, 2, 3 or 6 [87,104,105] taking PEG-IFN and RBV, although side effect profiles do appear to differ among patients of 2934 March 21, 2014 Volume 20 Issue 11

216 Thong VD et al. Hepatitis C virus genotype 6 different ethnicities. For example, compared with Caucasians, Asian patients are more likely to decrease their RBV dose or discontinue the therapy due to anemia. In addition, Asian patients reported symptoms of depression, more commonly than Caucasian patients [110,111]. Other common side effects include flu-like symptoms (fever, fatigue, headache, malign, and loss of appetite), dyspepsia and some cases with rash, weight loss, arthralgia and alopecia [110]. However, these symptoms are often mild and tolerable and without the requirement for PEG- IFN and/or RBV dose modification. PREDICTORS OF SVR As in studies of patients with other HCV genotypes, pretreatment predictors of response are useful for advising patients on their likelihood of SVR. Pretreatment host and viral characteristics affect early viral kinetics. Once treatment has been initiated, outcome depends on how fast HCV RNA becomes undetectable. Multivariate analyses have identified various predictors of response in HCV-6 such as youth (< years) [100,105], low BMI, treatment adherence and RVR [35,100,105]. Among these predictors - and concordant with observations in other HCV genotypes - the importance of RVR (undetectable HCV RNA after 4 wk of treatment) in the prediction of SVR has been further substantiated in HCV-6, wherein the positive predictive value to achieve SVR in patients with RVR has been 83%-87% [87,105]. ROLE OF INTERLEUKIN IL28-B Recent studies have reported that one of the strongest baseline predictors of SVR in HCV genotype 1 are single-nucleotide polymorphisms (SNPs) on chromosome 19 in or near the interleukin-28b gene (IL28B, encoding interferon lambda-3). Following antiviral treatment, patients carrying the CC genotype of one of these predictive SNPs (rs ) have a twofold (95%CI: ) greater rate of SVR than patients who carry the TT alleles (78% for the CC genotype, 38% for the TC genotype, and 26% for the TT genotype). Interestingly, the C allele frequency is much higher in white and Asian populations than in black populations [112]. More recently, a variant upstream of IFNL3 creating a novel gene, designated as IFNL4, has been discovered [113]. This region harbors a dinucleotide variant (ss ) that is found in two alternative forms (ΔG or TT alleles). The ss indel is more strongly associated with treatment response of HCV-1 infection in African-American individuals compared to rs [113]. Data regarding the association of the SNPs with antiviral response in HCV-6 infected patients are still very limited. A recent study from Hong Kong showed that rs , another IL28B polymorphism, was associated with response to PEG-IFN/RBV therapy in HCV-6 infected patients [114]. In that report, the favorable TT genotype of rs , when compared to the unfavorable TG genotype, was significantly associated with an increased SVR rate (96.2% and 62.5%, respectively) and was the only clinical parameter that predicted SVR. DAA In 2011, direct-acting antivirals (telaprevir and boceprevir) were approved by the US. Food and Drug Administration for treatment of HCV genotype 1. They are first generation NS3-4A protease inhibitors (PI), targeting the protease enzyme that cleaves the HCV polyprotein thus inhibiting the replication process. The addition of a DAA to PEG-IFN/RBV has reduced treatment duration and side effects, and improve efficacy and cost [115]. Thus, the development of DAA represents a significant milestone in improving the efficacy of HCV treatment, especially in patients with HCV genotype 1. Currently, clinical results of the use of DAAs for patients with HCV-6 are limited [116]. For example, monotherapy with TMC 435, a second-generation NS3/4A PI with pan-genotype antiviral activity, could induce a significant mean viremia decrease of log10 UI/mL after 8 days in patients with HCV-6. In addition, five patients with HCV-6 were included in the ATOMIC study and treated with sofosbuvir (GS 7977), a NS5B polymerase inhibitor, plus PEG-IFN/RBV for 24 wk. The RVR rate at week 4 and the SVR rate 12 wk after the end of the treatment were both 100%. CONCLUSION Three percent of the world s population is infected with HCV. Of that 3%, HCV-6 accounts for a disproportionately high burden high of prevalence in Southeast Asia and the surrounding areas as well as in infection drug users and people with thalassemia major. Previous literature suggest older tests may have misclassified HCV-6 as genotype 1, but newer line probe assays have shown impressive improvement in genotyping accuracy and differentiation between HCV genotype 1 and HCV-6 variants. Clinical characteristics and predictors of poor response are similar for patients with HCV-6 and other HCV genotypes. Current data suggests that the response rate of HCV-6 may be at an intermediate level between those of genotypes 3 and 1. Thus, the optimal treatment duration of HCV-6 should be 48 wk, although shortened treatment duration of 24 wk could be sufficient in patients with low pretreatment viral load who achieve RVR. In addition, there are currently conflicting data on the role of IL28B testing in predicting treatment response in patients with HCV-6. Further studies will be required to arrive at a sensitively diagnostic method for HCV-6/subtypes, optimal treatment duration, and early predictors for treatment response and drugs (DAA) to achieve higher SVR rates in patients with HCV-6. ACKNOWLEDGMENTS We would like to express our gratitude to the entire staff 2935 March 21, 2014 Volume 20 Issue 11

217 Thong VD et al. Hepatitis C virus genotype 6 of the Gastroenterology unit department of Medicine, Center of Excellence in Clinical Virology, Department of Biochemistry, Faculty of Medicine, Chulalongkorn University and Hospital, Thai Red Cross Society. Finally, we would like to thank Brian Muchmore for reviewing our manuscript. REFERENCES 1 Leary TP, Gutierrez RA, Muerhoff AS, Birkenmeyer LG, Desai SM, Dawson GJ. A chemiluminescent, magnetic particlebased immunoassay for the detection of hepatitis C virus core antigen in human serum or plasma. J Med Virol 2006; 78: [PMID: DOI: /jmv.20716] 2 Moreno M, Pérez-Alvarez R, Rodrigo L, Pérez-López R, Suárez-Leiva P. Long-term evolution of serum and liver viral markers in patients treated for chronic hepatitis C and sustained response. J Viral Hepat 2006; 13: [PMID: DOI: /j x] 3 Ramia S, Eid-Fares J. Distribution of hepatitis C virus genotypes in the Middle East. Int J Infect Dis 2006; 10: [PMID: DOI: /j.ijid ] 4 Kim WR. The burden of hepatitis C in the United States. Hepatology 2002; 36: S30-S34 [PMID: DOI: / jhep ] 5 Chao DT, Abe K, Nguyen MH. Systematic review: epidemiology of hepatitis C genotype 6 and its management. Aliment Pharmacol Ther 2011; 34: [PMID: DOI: /j x] 6 Simmonds P. Genetic diversity and evolution of hepatitis C virus--15 years on. J Gen Virol 2004; 85: [PMID: DOI: /vir ] 7 Antaki N, Craxi A, Kamal S, Moucari R, Van der Merwe S, Haffar S, Gadano A, Zein N, Lai CL, Pawlotsky JM, Heathcote EJ, Dusheiko G, Marcellin P. The neglected hepatitis C virus genotypes 4, 5 and 6: an international consensus report. Liver Int 2010; 30: [PMID: DOI: / j x] 8 Mellor J, Holmes EC, Jarvis LM, Yap PL, Simmonds P. Investigation of the pattern of hepatitis C virus sequence diversity in different geographical regions: implications for virus classification. The International HCV Collaborative Study Group. J Gen Virol 1995; 76 (Pt 10): [PMID: ] 9 Simmonds P, Bukh J, Combet C, Deléage G, Enomoto N, Feinstone S, Halfon P, Inchauspé G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 2005; 42: [PMID: DOI: / hep.20819] 10 Alter MJ. Epidemiology of hepatitis C virus infection. World J Gastroenterol 2007; 13: [PMID: ] 11 Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through Ann Intern Med 2006; 144: [PMID: ] 12 Wiessing L, Guarita B, Giraudon I, Brummer-Korvenkontio H, Salminen M, Cowan SA. European monitoring of notifications of hepatitis C virus infection in the general population and among injecting drug users (IDUs) - the need to improve quality and comparability. Euro Surveill 2008; 13: pii: [PMID: ] 13 Amon JJ, Garfein RS, Ahdieh-Grant L, Armstrong GL, Ouellet LJ, Latka MH, Vlahov D, Strathdee SA, Hudson SM, Kerndt P, Des Jarlais D, Williams IT. Prevalence of hepatitis C virus infection among injection drug users in the United States, Clin Infect Dis 2008; 46: [PMID: DOI: /588297] 14 Touzet S, Kraemer L, Colin C, Pradat P, Lanoir D, Bailly F, Coppola RC, Sauleda S, Thursz MR, Tillmann H, Alberti A, Braconier JH, Esteban JI, Hadziyannis SJ, Manns MP, Saracco G, Thomas HC, Trépo C. Epidemiology of hepatitis C virus infection in seven European Union countries: a critical analysis of the literature. HENCORE Group. (Hepatitis C European Network for Co-operative Research. Eur J Gastroenterol Hepatol 2000; 12: [PMID: ] 15 Burguete-García AI, Conde-González CJ, Jiménez-Méndez R, Juárez-Díaz Y, Meda-Monzón E, Torres-Poveda K, Madrid-Marina V. Hepatitis C seroprevalence and correlation between viral load and viral genotype among primary care clients in Mexico. Salud Publica Mex 2011; 53 Suppl 1: S7-12 [PMID: ] 16 Viazov S, Kuzin S, Paladi N, Tchernovetsky M, Isaeva E, Mazhul L, Vasychova F, Widell A, Roggendorf M. Hepatitis C virus genotypes in different regions of the former Soviet Union (Russia, Belarus, Moldova, and Uzbekistan). J Med Virol 1997; 53: [PMID: ] 17 Zhou Y, Wang X, Mao Q, Fan Y, Zhu Y, Zhang X, Lan L, Jiang L, Tan W. Changes in modes of hepatitis C infection acquisition and genotypes in southwest China. J Clin Virol 2009; 46: [PMID: DOI: / j.jcv ] 18 Utama A, Budiarto BR, Monasari D, Octavia TI, Chandra IS, Gani RA, Hasan I, Sanityoso A, Miskad UA, Yusuf I, Lesmana LA, Sulaiman A, Tai S. Hepatitis C virus genotype in blood donors and associated liver disease in Indonesia. Intervirology 2008; 51: [PMID: DOI: / ] 19 Samimi-Rad K, Nasiri Toosi M, Masoudi-Nejad A, Najafi A, Rahimnia R, Asgari F, Shabestari AN, Hassanpour G, Alavian SM, Asgari F. Molecular epidemiology of hepatitis C virus among injection drug users in Iran: a slight change in prevalence of HCV genotypes over time. Arch Virol 2012; 157: [PMID: DOI: /s ] 20 Berg T, Hopf U, Stark K, Baumgarten R, Lobeck H, Schreier E. Distribution of hepatitis C virus genotypes in German patients with chronic hepatitis C: correlation with clinical and virological parameters. J Hepatol 1997; 26: [PMID: ] 21 Campiotto S, Pinho JR, Carrilho FJ, Da Silva LC, Souto FJ, Spinelli V, Pereira LM, Coelho HS, Silva AO, Fonseca JC, Rosa H, Lacet CM, Bernardini AP. Geographic distribution of hepatitis C virus genotypes in Brazil. Braz J Med Biol Res 2005; 38: [PMID: DOI: /S X ] 22 Kamal SM. Hepatitis C genotype 4 therapy: increasing options and improving outcomes. Liver Int 2009; 29 Suppl 1: [PMID: DOI: /j x] 23 Mangia A, Mottola L. What s new in HCV genotype 2 treatment. Liver Int 2012; 32 Suppl 1: [PMID: DOI: /j x] 24 Oh DJ, Park YM, Seo YI, Lee JS, Lee JY. Prevalence of hepatitis C virus infections and distribution of hepatitis C virus genotypes among Korean blood donors. Ann Lab Med 2012; 32: [PMID: DOI: /alm ] 25 Das BR, Kundu B, Khandapkar R, Sahni S. Geographical distribution of hepatitis C virus genotypes in India. Indian J Pathol Microbiol 2002; 45: [PMID: ] 26 Zarife MA, Silva LK, Silva MB, Lopes GB, Barreto ML, Teixeira Mda G, Dourado I, Reis MG. Prevalence of hepatitis C virus infection in north-eastern Brazil: a population-based study. Trans R Soc Trop Med Hyg 2006; 100: [PMID: DOI: /j.trstmh ] 27 Akkarathamrongsin S, Hacharoen P, Tangkijvanich P, Theamboonlers A, Tanaka Y, Mizokami M, Poovorawan Y March 21, 2014 Volume 20 Issue 11

218 Thong VD et al. Hepatitis C virus genotype 6 Molecular epidemiology and genetic history of hepatitis C virus subtype 3a infection in Thailand. Intervirology 2013; 56: [PMID: DOI: / ] 28 Narahari S, Juwle A, Basak S, Saranath D. Prevalence and geographic distribution of Hepatitis C Virus genotypes in Indian patient cohort. Infect Genet Evol 2009; 9: [PMID: DOI: /j.meegid ] 29 Zali MR, Mayumi M, Raoufi M, Nowroozi A. Hepatitis C virus genotypes in the Islamic Republic of Iran: a preliminary study. East Mediterr Health J 2000; 6: [PMID: ] 30 Gededzha MP, Selabe SG, Kyaw T, Rakgole JN, Blackard JT, Mphahlele MJ. Introduction of new subtypes and variants of hepatitis C virus genotype 4 in South Africa. J Med Virol 2012; 84: [PMID: DOI: /jmv.23215] 31 Chamberlain RW, Adams NJ, Taylor LA, Simmonds P, Elliott RM. The complete coding sequence of hepatitis C virus genotype 5a, the predominant genotype in South Africa. Biochem Biophys Res Commun 1997; 236: [PMID: DOI: /bbrc ] 32 Waheed Y, Shafi T, Safi SZ, Qadri I. Hepatitis C virus in Pakistan: a systematic review of prevalence, genotypes and risk factors. World J Gastroenterol 2009; 15: [PMID: ] 33 Manos MM, Shvachko VA, Murphy RC, Arduino JM, Shire NJ. Distribution of hepatitis C virus genotypes in a diverse US integrated health care population. J Med Virol 2012; 84: [PMID: DOI: /jmv.23399] 34 Nguyen LH, Nguyen MH. Systematic review: Asian patients with chronic hepatitis C infection. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12300] 35 Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL, Häussinger D, Diago M, Carosi G, Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: /NEJ- Moa020047] 36 Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001; 358: [PMID: ] 37 Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J, Mueller T, Bochud M, Battegay M, Bernasconi E, Borovicka J, Colombo S, Cerny A, Dufour JF, Furrer H, Günthard HF, Heim M, Hirschel B, Malinverni R, Moradpour D, Müllhaupt B, Witteck A, Beckmann JS, Berg T, Bergmann S, Negro F, Telenti A, Bochud PY. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology 2010; 138: , e1-7 [PMID: DOI: /j.gastro ] 38 Nguyen MH, Trinh HN, Garcia R, Nguyen G, Lam KD, Keeffe EB. Higher rate of sustained virologic response in chronic hepatitis C genotype 6 treated with 48 weeks versus 24 weeks of peginterferon plus ribavirin. Am J Gastroenterol 2008; 103: [PMID: DOI: / j x] 39 Pham DA, Leuangwutiwong P, Jittmittraphap A, Luplertlop N, Bach HK, Akkarathamrongsin S, Theamboonlers A, Poovorawan Y. High prevalence of Hepatitis C virus genotype 6 in Vietnam. Asian Pac J Allergy Immunol 2009; 27: [PMID: ] 40 Noppornpanth S, Lien TX, Poovorawan Y, Smits SL, Osterhaus AD, Haagmans BL. Identification of a naturally occurring recombinant genotype 2/6 hepatitis C virus. J Virol 2006; 80: [PMID: DOI: / JVI ] 41 Pham VH, Nguyen HD, Ho PT, Banh DV, Pham HL, Pham PH, Lu L, Abe K. Very high prevalence of hepatitis C virus genotype 6 variants in southern Vietnam: large-scale survey based on sequence determination. Jpn J Infect Dis 2011; 64: [PMID: ] 42 Pybus OG, Barnes E, Taggart R, Lemey P, Markov PV, Rasachak B, Syhavong B, Phetsouvanah R, Sheridan I, Humphreys IS, Lu L, Newton PN, Klenerman P. Genetic history of hepatitis C virus in East Asia. J Virol 2009; 83: [PMID: DOI: /JVI ] 43 Hübschen JM, Jutavijittum P, Thammavong T, Samountry B, Yousukh A, Toriyama K, Sausy A, Muller CP. High genetic diversity including potential new subtypes of hepatitis C virus genotype 6 in Lao People s Democratic Republic. Clin Microbiol Infect 2011; 17: E30-E34 [PMID: DOI: /j x] 44 Shinji T, Lwin AA, Gokan K, Obika M, Ryuko H, Khin M, Okada S, Koide N. Three type 6 hepatitis C virus subgroups among blood donors in the Yangon area of Myanmar are identified as subtypes 6m and 6n, and a novel subtype by sequence analysis of the core region. Acta Med Okayama 2006; 60: [PMID: ] 45 Shinji T, Kyaw YY, Gokan K, Tanaka Y, Ochi K, Kusano N, Mizushima T, Fujioka S, Shiraha H, Lwin AA, Shiratori Y, Mizokami M, Khin M, Miyahara M, Okada S, Koide N. Analysis of HCV genotypes from blood donors shows three new HCV type 6 subgroups exist in Myanmar. Acta Med Okayama 2004; 58: [PMID: ] 46 Lwin AA, Shinji T, Khin M, Win N, Obika M, Okada S, Koide N. Hepatitis C virus genotype distribution in Myanmar: Predominance of genotype 6 and existence of new genotype 6 subtype. Hepatol Res 2007; 37: [PMID: DOI: /j X x] 47 Akkarathamrongsin S, Praianantathavorn K, Hacharoen N, Theamboonlers A, Tangkijvanich P, Poovorawan Y. Seroprevalence and genotype of hepatitis C virus among immigrant workers from Cambodia and Myanmar in Thailand. Intervirology 2011; 54: [PMID: DOI: / ] 48 Tokita H, Okamoto H, Iizuka H, Kishimoto J, Tsuda F, Lesmana LA, Miyakawa Y, Mayumi M. Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups. J Gen Virol 1996; 77 (Pt 2): [PMID: ] 49 Ng KT, Lee YM, Al-Darraji HA, Xia X, Takebe Y, Chan KG, Lu L, Mahadeva S, Kamarulzaman A, Tee KK. Genome sequence of the hepatitis C virus subtype 6n isolated from malaysia. Genome Announc 2013; 1: pii: e [PMID: DOI: /genomeA ] 50 Yan Z, Fan K, Wang Y, Fan Y, Tan Z, Deng G. Changing pattern of clinical epidemiology on hepatitis C virus infection in southwest china. Hepat Mon 2012; 12: [PMID: DOI: /hepatmon.857] 51 Apichartpiyakul C, Apichartpiyakul N, Urwijitaroon Y, Gray J, Natpratan C, Katayama Y, Fujii M, Hotta H. Seroprevalence and subtype distribution of hepatitis C virus among blood donors and intravenous drug users in northern/northeastern Thailand. Jpn J Infect Dis 1999; 52: [PMID: ] 52 Chan DP, Lee SS, Lee KC. The effects of widespread methadone treatment on the molecular epidemiology of hepatitis C virus infection among injection drug users in Hong Kong. J Med Virol 2011; 83: [PMID: DOI: /jmv.22099] 53 Lee YM, Lin HJ, Chen YJ, Lee CM, Wang SF, Chang KY, Chen TL, Liu HF, Chen YM. Molecular epidemiology of HCV genotypes among injection drug users in Taiwan: Full-length sequences of two new subtype 6w strains and a recombinant form_2b6w. J Med Virol 2010; 82: [PMID: DOI: /jmv.21658] 54 Chowdhury A, Santra A, Chaudhuri S, Dhali GK, Chaud March 21, 2014 Volume 20 Issue 11

219 Thong VD et al. Hepatitis C virus genotype 6 huri S, Maity SG, Naik TN, Bhattacharya SK, Mazumder DN. Hepatitis C virus infection in the general population: a community-based study in West Bengal, India. Hepatology 2003; 37: [PMID: DOI: /jhep ] 55 Nguyen NH, Vutien P, Trinh HN, Garcia RT, Nguyen LH, Nguyen HA, Nguyen KK, Nguyen MH. Risk factors, genotype 6 prevalence, and clinical characteristics of chronic hepatitis C in Southeast Asian Americans. Hepatol Int 2010; 4: [PMID: DOI: /s ] 56 Garten RJ, Lai S, Zhang J, Liu W, Chen J, Vlahov D, Yu XF. Rapid transmission of hepatitis C virus among young injecting heroin users in Southern China. Int J Epidemiol 2004; 33: [PMID: DOI: /ije/dyh019] 57 Garten RJ, Zhang J, Lai S, Liu W, Chen J, Yu XF. Coinfection with HIV and hepatitis C virus among injection drug users in southern China. Clin Infect Dis 2005; 41 Suppl 1: S18-S24 [PMID: DOI: /429491] 58 Fu Y, Qin W, Cao H, Xu R, Tan Y, Lu T, Wang H, Tong W, Rong X, Li G, Yuan M, Li C, Abe K, Lu L, Chen G. HCV 6a prevalence in Guangdong province had the origin from Vietnam and recent dissemination to other regions of China: phylogeographic analyses. PLoS One 2012; 7: e28006 [PMID: DOI: /journal.pone ] 59 Zhou DX, Tang JW, Chu IM, Cheung JL, Tang NL, Tam JS, Chan PK. Hepatitis C virus genotype distribution among intravenous drug user and the general population in Hong Kong. J Med Virol 2006; 78: [PMID: DOI: /jmv.20578] 60 Murphy DG, Willems B, Deschênes M, Hilzenrat N, Mousseau R, Sabbah S. Use of sequence analysis of the NS5B region for routine genotyping of hepatitis C virus with reference to C/E1 and 5 untranslated region sequences. J Clin Microbiol 2007; 45: [PMID: DOI: / JCM ] 61 Kanistanon D, Neelamek M, Dharakul T, Songsivilai S. Genotypic distribution of hepatitis C virus in different regions of Thailand. J Clin Microbiol 1997; 35: [PMID: ] 62 Jutavijittum P, Jiviriyawat Y, Yousukh A, Pantip C, Maneekarn N, Toriyama K. Genotypic distribution of hepatitis C virus in voluntary blood donors of northern Thailand. Southeast Asian J Trop Med Public Health 2009; 40: [PMID: ] 63 Akkarathamrongsin S, Praianantathavorn K, Hacharoen N, Theamboonlers A, Tangkijvanich P, Tanaka Y, Mizokami M, Poovorawan Y. Geographic distribution of hepatitis C virus genotype 6 subtypes in Thailand. J Med Virol 2010; 82: [PMID: DOI: /jmv.21680] 64 Leung N, Chu C, Tam JS. Viral hepatitis C in Hong Kong. Intervirology 2006; 49: [PMID: DOI: / ] 65 Xia X, Luo J, Bai J, Yu R. Epidemiology of hepatitis C virus infection among injection drug users in China: systematic review and meta-analysis. Public Health 2008; 122: [PMID: DOI: /j.puhe ] 66 Rong X, Lu L, Wang J, Xiong H, Huang J, Chen J, Huang K, Xu R, Wang M, Zhang X, Guo T, Liu Y, Gao G, Fu Y, Nelson KE. Correlation of viral loads with HCV genotypes: higher levels of virus were revealed among blood donors infected with 6a strains. PLoS One 2012; 7: e52467 [PMID: DOI: /journal.pone ] 67 Kalinina O, Norder H, Mukomolov S, Magnius LO. A natural intergenotypic recombinant of hepatitis C virus identified in St. Petersburg. J Virol 2002; 76: [PMID: ] 68 Kurbanov F, Tanaka Y, Avazova D, Khan A, Sugauchi F, Kan N, Kurbanova-Khudayberganova D, Khikmatullaeva A, Musabaev E, Mizokami M. Detection of hepatitis C virus natural recombinant RF1_2k/1b strain among intravenous drug users in Uzbekistan. Hepatol Res 2008; 38: [PMID: DOI: /j X x] 69 Noppornpanth S, Sablon E, De Nys K, Truong XL, Brouwer J, Van Brussel M, Smits SL, Poovorawan Y, Osterhaus AD, Haagmans BL. Genotyping hepatitis C viruses from Southeast Asia by a novel line probe assay that simultaneously detects core and 5 untranslated regions. J Clin Microbiol 2006; 44: [PMID: DOI: /JCM ] 70 Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993; 74 ( Pt 11): [PMID: ] 71 Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G. Second-generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 1996; 34: [PMID: ] 72 Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, Sato K, Tsuda F, Miyakawa Y. Typing hepatitis C virus by polymerase chain reaction with typespecific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992; 73 (Pt 3): [PMID: ] 73 Nakao T, Enomoto N, Takada N, Takada A, Date T. Typing of hepatitis C virus genomes by restriction fragment length polymorphism. J Gen Virol 1991; 72 (Pt 9): [PMID: ] 74 White PA, Zhai X, Carter I, Zhao Y, Rawlinson WD. Simplified hepatitis C virus genotyping by heteroduplex mobility analysis. J Clin Microbiol 2000; 38: [PMID: ] 75 Hu YW, Balaskas E, Furione M, Yen PH, Kessler G, Scalia V, Chui L, Sher G. Comparison and application of a novel genotyping method, semiautomated primer-specific and mispair extension analysis, and four other genotyping assays for detection of hepatitis C virus mixed-genotype infections. J Clin Microbiol 2000; 38: [PMID: ] 76 Schröter M, Zöllner B, Schäfer P, Landt O, Lass U, Laufs R, Feucht HH. Genotyping of hepatitis C virus types 1, 2, 3, and 4 by a one-step LightCycler method using three different pairs of hybridization probes. J Clin Microbiol 2002; 40: [PMID: ] 77 Dixit V, Quan S, Martin P, Larson D, Brezina M, DiNello R, Sra K, Lau JY, Chien D, Kolberg J. Evaluation of a novel serotyping system for hepatitis C virus: strong correlation with standard genotyping methodologies. J Clin Microbiol 1995; 33: [PMID: ] 78 Cai Q, Zhao Z, Liu Y, Shao X, Gao Z. Comparison of three different HCV genotyping methods: core, NS5B sequence analysis and line probe assay. Int J Mol Med 2013; 31: [PMID: DOI: /ijmm ] 79 McCaughan GW, Omata M, Amarapurkar D, Bowden S, Chow WC, Chutaputti A, Dore G, Gane E, Guan R, Hamid SS, Hardikar W, Hui CK, Jafri W, Jia JD, Lai MY, Wei L, Leung N, Piratvisuth T, Sarin S, Sollano J, Tateishi R. Asian Pacific Association for the Study of the Liver consensus statements on the diagnosis, management and treatment of hepatitis C virus infection. J Gastroenterol Hepatol 2007; 22: [PMID: DOI: /j x] 80 Chinchai T, Noppornpanth S, Bedi K, Theamboonlers A, Poovorawan Y. 222 base pairs in NS5B region and the determination of hepatitis C virus genotype 6. Intervirology 2006; 49: [PMID: DOI: / ] 81 Bukh J, Purcell RH, Miller RH. Sequence analysis of the core gene of 14 hepatitis C virus genotypes. Proc Natl Acad Sci USA 1994; 91: [PMID: ] 82 Chinchai T, Labout J, Noppornpanth S, Theamboonlers A, Haagmans BL, Osterhaus AD, Poovorawan Y. Comparative study of different methods to genotype hepatitis C virus type 6 variants. J Virol Methods 2003; 109: [PMID: ] 83 Bouchardeau F, Cantaloube JF, Chevaliez S, Portal C, Razer A, Lefrère JJ, Pawlotsky JM, De Micco P, Laperche S. Improvement of hepatitis C virus (HCV) genotype determina March 21, 2014 Volume 20 Issue 11

220 Thong VD et al. Hepatitis C virus genotype 6 tion with the new version of the INNO-LiPA HCV assay. J Clin Microbiol 2007; 45: [PMID: DOI: /JCM ] 84 Farci P, Alter HJ, Shimoda A, Govindarajan S, Cheung LC, Melpolder JC, Sacher RA, Shih JW, Purcell RH. Hepatitis C virus-associated fulminant hepatic failure. N Engl J Med 1996; 335: [PMID: DOI: / NEJM ] 85 National Institutes of Health Consensus Development Conference Panel statement: management of hepatitis C. Hepatology 1997; 26: 2S-10S [PMID: DOI: /hep ] 86 Cheng JT, Hsien C, Sun HE, Tong MJ. The emerging importance of chronic hepatitis C infection in Asian Americans. Am J Gastroenterol 2006; 101: [PMID: ] 87 Nguyen NH, VuTien P, Garcia RT, Trinh H, Nguyen H, Nguyen K, Levitt B, Nguyen MH. Response to pegylated interferon and ribavirin in Asian American patients with chronic hepatitis C genotypes 1 vs 2/3 vs 6. J Viral Hepat 2010; 17: [PMID: DOI: /j x] 88 Seong MH, Kil H, Kim JY, Lee SS, Jang ES, Kim JW, Jeong SH, Kim YS, Bae SH, Lee YJ, Lee HC, Yun H, Kang BH, Kim K. Clinical and epidemiological characteristics of Korean patients with hepatitis C virus genotype 6. Clin Mol Hepatol 2013; 19: [PMID: DOI: /cmh ] 89 Adinolfi LE, Restivo L, Zampino R, Lonardo A, Loria P. Metabolic alterations and chronic hepatitis C: treatment strategies. Expert Opin Pharmacother 2011; 12: [PMID: DOI: / ] 90 Chevaliez S, Pawlotsky JM. Hepatitis C virus: virology, diagnosis and management of antiviral therapy. World J Gastroenterol 2007; 13: [PMID: ] 91 Tsang OT, Zee JS, Chan JM, Li RS, Kan YM, Li FT, Lo FH, Chow DA, Cheung KW, Chan KH, Yeung YW, Ng FH, Li MK, Kwan WK, Lai TS. Chronic hepatitis C genotype 6 responds better to pegylated interferon and ribavirin combination therapy than genotype 1. J Gastroenterol Hepatol 2010; 25: [PMID: ] 92 Zhou YQ, Wang XH, Hong GH, Zhu Y, Zhang XQ, Hu YJ, Mao Q. Twenty-four weeks of pegylated interferon plus ribavirin effectively treat patients with HCV genotype 6a. J Viral Hepat 2011; 18: [PMID: DOI: / j x] 93 Seto WK, Lai CL, Fung J, Hung I, Yuen J, Young J, Wong DK, Yuen MF. Natural history of chronic hepatitis C: genotype 1 versus genotype 6. J Hepatol 2010; 53: [PMID: ] 94 de Leuw P, Sarrazin C, Zeuzem S. How to use virological tools for the optimal management of chronic hepatitis C. Liver Int 2011; 31 Suppl 1: 3-12 [PMID: ] 95 Ghany MG, Strader DB, Thomas DL, Seeff LB. Diagnosis, management, and treatment of hepatitis C: an update. Hepatology 2009; 49: [PMID: ] 96 Ferenci P, Laferl H, Scherzer TM, Gschwantler M, Maieron A, Brunner H, Stauber R, Bischof M, Bauer B, Datz C, Löschenberger K, Formann E, Staufer K, Steindl-Munda P. Peginterferon alfa-2a and ribavirin for 24 weeks in hepatitis C type 1 and 4 patients with rapid virological response. Gastroenterology 2008; 135: [PMID: ] 97 Jensen DM, Morgan TR, Marcellin P, Pockros PJ, Reddy KR, Hadziyannis SJ, Ferenci P, Ackrill AM, Willems B. Early identification of HCV genotype 1 patients responding to 24 weeks peginterferon alpha-2a (40 kd)/ribavirin therapy. Hepatology 2006; 43: [PMID: ] 98 Zeuzem S, Buti M, Ferenci P, Sperl J, Horsmans Y, Cianciara J, Ibranyi E, Weiland O, Noviello S, Brass C, Albrecht J. Efficacy of 24 weeks treatment with peginterferon alfa-2b plus ribavirin in patients with chronic hepatitis C infected with genotype 1 and low pretreatment viremia. J Hepatol 2006; 44: [PMID: ] 99 Nguyen MH, Keeffe EB. Prevalence and treatment of hepatitis C virus genotypes 4, 5, and 6. Clin Gastroenterol Hepatol 2005; 3: S97-S101 [PMID: ] 100 Yuen MF, Lai CL. Response to combined interferon and ribavirin is better in patients infected with hepatitis C virus genotype 6 than genotype 1 in Hong Kong. Intervirology 2006; 49: [PMID: DOI: / ] 101 Lam KD, Trinh HN, Do ST, Nguyen TT, Garcia RT, Nguyen T, Phan QQ, Nguyen HA, Nguyen KK, Nguyen LH, Nguyen MH. Randomized controlled trial of pegylated interferon-alfa 2a and ribavirin in treatment-naive chronic hepatitis C genotype 6. Hepatology 2010; 52: [PMID: DOI: /hep.23889] 102 Tangkijvanich P, Komolmit P, Mahachai V, Poovorawan K, Akkarathamrongsin S, Poovorawan Y. Response-guided therapy for patients with hepatitis C virus genotype 6 infection: a pilot study. J Viral Hepat 2012; 19: [PMID: DOI: /j x] 103 Hui CK, Yuen MF, Sablon E, Chan AO, Wong BC, Lai CL. Interferon and ribavirin therapy for chronic hepatitis C virus genotype 6: a comparison with genotype 1. J Infect Dis 2003; 187: [PMID: DOI: /368217] 104 Dev AT, McCaw R, Sundararajan V, Bowden S, Sievert W. Southeast Asian patients with chronic hepatitis C: the impact of novel genotypes and race on treatment outcome. Hepatology 2002; 36: [PMID: DOI: / jhep ] 105 Fung J, Lai CL, Hung I, Young J, Cheng C, Wong D, Yuen MF. Chronic hepatitis C virus genotype 6 infection: response to pegylated interferon and ribavirin. J Infect Dis 2008; 198: [PMID: DOI: /591252] 106 Thu Thuy PT, Bunchorntavakul C, Tan Dat H, Rajender Reddy K. A randomized trial of 48 versus 24 weeks of combination pegylated interferon and ribavirin therapy in genotype 6 chronic hepatitis C. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 107 Fried MW, Hadziyannis SJ, Shiffman ML, Messinger D, Zeuzem S. Rapid virological response is the most important predictor of sustained virological response across genotypes in patients with chronic hepatitis C virus infection. J Hepatol 2011; 55: [PMID: ] 108 Mangia A. Individualizing treatment duration in hepatitis C virus genotype 2/3-infected patients. Liver Int 2011; 31: [PMID: DOI: /j x] 109 Martin P, Jensen DM. Ribavirin in the treatment of chronic hepatitis C. J Gastroenterol Hepatol 2008; 23: [PMID: DOI: /j x] 110 Vutien P, Nguyen NH, Trinh HN, Li J, Garcia RT, Garcia G, Nguyen KK, Nguyen HA, Levitt BS, Keeffe EB, Nguyen MH. Similar treatment response to peginterferon and ribavirin in Asian and Caucasian patients with chronic hepatitis C. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 111 Fancher TL, Ton H, Le Meyer O, Ho T, Paterniti DA. Discussing depression with Vietnamese American patients. J Immigr Minor Health 2010; 12: [PMID: DOI: /s y] 112 Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ, Sulkowski M, McHutchison JG, Goldstein DB. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 461: [PMID: DOI: /nature08309] 113 Prokunina-Olsson L, Muchmore B, Tang W, Pfeiffer RM, Park H, Dickensheets H, Hergott D, Porter-Gill P, Mumy A, Kohaar I, Chen S, Brand N, Tarway M, Liu L, Sheikh F, Astemborski J, Bonkovsky HL, Edlin BR, Howell CD, Morgan TR, Thomas DL, Rehermann B, Donnelly RP, O Brien TR. A variant upstream of IFNL3 (IL28B) creating a new interferon 2939 March 21, 2014 Volume 20 Issue 11

221 Thong VD et al. Hepatitis C virus genotype 6 gene IFNL4 is associated with impaired clearance of hepatitis C virus. Nat Genet 2013; 45: [PMID: DOI: /ng.2521] 114 Seto WK, Tsang OT, Liu K, Chan JM, Wong DK, Fung J, Lai CL, Yuen MF. Role of IL28B and inosine triphosphatase polymorphisms in the treatment of chronic hepatitis C virus genotype 6 infection. J Viral Hepat 2013; 20: [PMID: DOI: /jvh.12047] 115 Kiser JJ, Flexner C. Direct-acting antiviral agents for hepatitis C virus infection. Annu Rev Pharmacol Toxicol 2013; 53: [PMID: DOI: /annurev-pharmtox ] 116 Wartelle-Bladou C, Le Folgoc G, Bourlière M, Lecomte L. Hepatitis C therapy in non-genotype 1 patients: the near future. J Viral Hepat 2012; 19: [PMID: DOI: /j x] P- Reviewers: Castiella A, Chiu KW, Dang SS, Lonardo A S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2940 March 21, 2014 Volume 20 Issue 11

222 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. TOPIC HIGHLIGHT WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Medicinal plants against hepatitis C virus Usman A Ashfaq, Sobia Idrees Usman A Ashfaq, Sobia Idrees, Department of Bioinformatics and Biotechnology, Government College University, Faisalabad 38000, Pakistan Author contributions: Ashfaq UA designed the study, and wrote the manuscript; Idrees S helped in writing the manuscript. Correspondence to: Usman A Ashfaq, PhD, Group Leader, Department of Bioinformatics and Biotechnology, Government College University, Allama Iqbal Road, Faisalabad 38000, Pakistan. usmancemb@gmail.com Telephone: Fax: Received: October 2, 2013 Revised: November 1, 2013 Accepted: November 18, 2013 Published online: March 21, 2014 Abstract Hepatitis C virus (HCV) is a global health concern which is responsible for most of the liver diseases. Currently, there is no vaccine available for prevention of HCV infection due to the high degree of strain variation. The current standard of care is a combination of pegylated interferon α with ribavirin and boceprevir/telaprevir. This treatment was partially effective and had significant side effects. Hence, there is a need to develop new antiviral agents that interfere with different stages of the HCV life cycle. Recent advances in the understanding of both the cellular and molecular mechanisms of HCV replication have provided the basis for novel therapeutic strategies. Several hundred plant species and their phyto-constituents have been isolated for screening against HCV, and some have been shown to have great medicinal value in preventing and/or ameliorating viral diseases in pre-clinical and clinical trials. This review summarizes medicinal plants and their phytochemicals which inhibit different stages of HCV life cycle and discuss their potential use in HCV therapy Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Medicinal plants; Anti-hepa- titis C virus drugs Core tip: Medicinal plants have always caught the attention of researchers to develop antiviral drugs against dreadful viral diseases. Many plant species are being tested against hepatitis C virus (HCV) to find a possible cure for it and, hopefully, in the future these medicinal plants can serve as an important source for developing anti-hcv drugs. Ashfaq UA, Idrees S. Medicinal plants against hepatitis C virus. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Hepatitis C virus (HCV) is a dreadful viral disease and has always been a global health issue. According to estimation, about 170 million people are affected, with the highest infection rates in Africa and Asia [1]. Each year approximately 3-4 million people are affected and > individuals die due to liver disease. HCV causes an acute infection which can eventually progress to chronic infection and can cause permanent liver damage, hepatocellular carcinoma (HCC), cirrhosis and death [2-5]. Acute to chronic progression is rapid in people who are older, human immunodeficiency virus (HIV) co-infected, consume more than 50 g of alcohol daily, or immunosuppressed and patients undergoing organ transplantation [6]. HCV belongs to the Flaviviridae family and has a positive single stranded RNA genome of 9.6 Kb. The genome of HCV has 5 untranslated region (UTR) which works as an internal ribosomal entry site (IRES). The 5 UTR is in length and the IRES is considered important for Cap-independent translation of viral RNA [7,8]. This entry site (IRES) leads to the translation of an open reading frame (ORF) that encodes a 3010 amino acid poly protein precursor which 2941 March 21, 2014 Volume 20 Issue 11

223 Ashfaq UA et al. Medicinal plants against hepatitis C virus HCV RNA Region encoding polyprotein precursor 5'NTR 3'NTR Structural proteins Nonstructural proteins p22 C gp35 E1 gp70 E2 p23 p70 p8 p7 NS1 NS2 NS3 NS4A p27 p56/58 NS4B NS5A p68 NS5B Nucleocapsid Envelop proteins Transmembrance proteins NS3 protease/helicase complex Cofactors IFN-resistance protein RNA polymerase Figure 1 Hepatitis C virus genome organization. HCV: Hepatitis C virus; IFN: Interferon. Attachment Hepatocyte HCV Entra Receptors CXXR3 Replication Release Uncoating Translation Lipid droplet Assembly Nucleus Figure 2 Hepatitis C virus life cycle. is ultimately cleaved by host and viral proteases into 10 viral proteins in the order of NH (2) -Core-E1-E2-p7- NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH (Figure 1) [9]. According to past research, the structural proteins (Core, E and E2) and the nonstructural proteins (NS3 protease and NS5B RNA dependent RNA polymerase) have been considered the best targets to develop novel molecular inhibitors. Among these proteins, NS3 in association with NS4A has been hugely investigated due to its protease and helicase domains that are important in viral replication [1,10-12]. The life cycle of HCV is illustrated in Figure 2. HCV has six major genotypes with a series of subtypes [13]. In 2012, a new sequence has been found that is being named as subtype 7a [14]. The prevalence of genotype 3a is related to steatosis that leads to liver fibrosis [15,16]. To date, many medicinal plants have been tested against HCV and have proved beneficial as antiviral mediators. The reasons to prefer medicinal plants over traditional 2942 March 21, 2014 Volume 20 Issue 11

224 Ashfaq UA et al. Medicinal plants against hepatitis C virus medicines are their fewer side effects, low cost and multiple target activities [17]. The phytochemicals of the medicinal plants, such as limonoids, alkaloids, lignana, organosulfur, furyl, thiophenes, polylines, terpenoids, flavonoids, polyphenolics, sulphides, saponins, coumarins, chlorophyllins, are considered important due to their efficiency at hampering viral entry, blocking/limiting the RNA/DNA genome replication and their anti-oxidant activity [18]. Currently, there are few antiviral drugs that can efficiently work against HCV as most of the antiviral drugs show side effects and many of the viruses acquire resistance against them; thus, there is a strong need to develop antiviral compounds that can suppress HCV without side effects. Therefore, medicinal plants due to their magical powers are being investigated to discover antiviral agents that can efficiently target the entry or replication of HCV virus and are believed to be our future inhibitors for this dreadful disease. CURRENT TREATMENT HCV is a major concern worldwide and clearing it in its early phase to avoid liver cirrhosis and HCC has always been the target for researchers. To date, there is no authenticated vaccine available in the market and current approved treatment (standard of care) is a combination therapy having pegylated interferon alpha (PegIFN-α) injections and antiviral nucleoside analogue ribavirin (RBV) used for wk depending upon the type of genotype. All the genotypes of HCV show different sustained virological response (SVR) and genotype 1 which is regarded as most problematic genotype shows the clearance of HCV in 50% of the cases. Similarly, genotype 2 infection shows clearance in only 80% of the cases [19-22]. This combination therapy has several considerable side effects such as fever, anemia, flu and depression [23]. Several combinations of IFN are in clinical trials, such as taribavirin which is a prodrug of ribavirin and albinterferon which is the combination of IFN-α and human albumin [24,25]. The side effects caused by current treatment raised the need to develop antiviral compounds that can suppress or eliminate the infection without toxicity and side effects. This directed the investigation to test antiviral agents against HCV viral proteins. HCV NS3 protease has been investigated as a drug target [26,27]. The inhibition of NS3/4A protease interferes with the replication of HCV genome and also restores the pathways of the innate immunity [28]. To date, several NS3/4A protease inhibitors have been investigated and recently, two NS3 protease inhibitors, boceprevir and telaprevir, have been approved by the Food and Drug Administration (FDA) as combination therapy along with PegIFN-α and RBV for HCV genotype 1 patients [29]. Despite the availability of current treatment, there is a dire need to screen antiviral agents that can target all four genotypes with the same efficiency and without any side effects. This increases the significance of the medicinal plants as antiviral agents as they are less toxic, less costly and are easily accessed. MEDICINAL PLANTS AGAINST HCV Viral infections with high mortality and morbidity rate are the leading cause of human deaths worldwide. All viruses start their life cycle through attachment and entry into the host cell and then increase their progeny by transcription and replication of the genome. The RNA viruses such as influenza, HIV and HCV have become a matter of concern as these are highly variable and lack an RNA dependent RNA polymerase proofreading mechanism [30]. Development of vaccines against viral diseases such as polio, mumps and smallpox have controlled these diseases but infections like HIV and HCV have been hard to target because of variation in genotypes. Infectious diseases have widely been treated using the medicinal plants and about 25% of current medicines have compounds from medicinal plants. There are plenty of plants that are known for their magical medicinal properties and these plants can serve as an important reservoir for drug discovery against infectious diseases. Current separation techniques have enabled researchers to find active compounds of plants as antiviral agents and to overcome the challenge of emerging infectious disease in human population. There is a wide range of medicinal plants which are being used to extract natural compounds that are being used for their antiviral activity. Liver diseases have been treated around the world using numerous medicinal plants and their formulations and this has given confidence to researchers to investigate the effect of these medicinal plants against HCV in more depth [31]. HCV infection is a leading cause of deaths among patients. To date, many drugs have been tested against HCV and many of them have successfully completed clinical trials but the problem of viral resistance against these drugs and side effects caused by these drugs have marked a question of developing better therapeutics against HCV [32]. At the present, drug discovery is being focused on medicinal herbs for HCV due to the lack of appropriate standard therapy. Acetonic and methanolic extracts of Acacia nilotica (AN) have shown novel inhibition of HCV titer invitro confirmed by real-time PCR [33]. Preclinical evaluation of the lyophilized juice of ginger and aqueous extracts of Milk thistle (MSE) has demonstrated anti HCV effects in the HepG2 cell line. Both of these plants have shown effective antiviral activity at concentrations of 300 μg/ml and 100 μg/ml respectively [34]. Recently, medicinal plants from Indonesia have been tested for their antiviral activity against HCV. Ethanolic extracts of Indonesian plants were analyzed in the Huh 7.5 cell line and HCV strains of 9 different genotypes namely 1a-71, 1b and 2b. Among the tested plants, Toona sureni leaves (TSL) showed IC50 value of 13.9, Melicope latifolia leaves (MLL) showed IC50 of 3.5, Melanolepis multiglandulosa stem (MMS) exhibited IC50 of 17.1 and Ficus fistulosa leaves (FFL) showed IC50 of Among all of these, MLL, TSL, FFL and MMS exhibited antiviral activity against all genotypes of HCV and thus, it is suggested that these plants may prove good candidates to develop novel inhibitory drugs against 2943 March 21, 2014 Volume 20 Issue 11

225 Ashfaq UA et al. Medicinal plants against hepatitis C virus Table 1 Medicinal plant phytochemicals as anti- hepatitis C virus agents Phytochemicals Viral step Effect Diosgenin [43] Replication Inhibition of transcription factor 3 and signal transducer Silymarin/silibinin [37,44,45] Viral entry (viral attachment) Inhibition of core protein and NS5 RNA-dependent RNA polymerase Replication Iridoids [46,47] Viral entry Blockage of E2 and CD81 contact Naringenin [48,49] Viral assembly Suppression of core protein activity EGCG [50,51] Viral entry Disturbance in glycoprotein activity and Inhibition of cell-cell transmission Quercetin [52,53] Replication Inhibition of IRES activity and NS3 polymerase Ladanein [54] Post attachment entry step Inhibition of receptor interactions, virus endocytosis, or membrane fusion Luteolin and apigenin [55] Replication Inhibition of NS5B polymerase activity IRES: Internal ribosomal entry site. EGCG: Epigallocatechin gallate. HCV though, there is a need to further investigate these plants to develop drugs for the effective inhibition of HCV [35]. MEDICINAL PLANTS AGAINST HCV CORE To date, many plants have been tested against HCV core protein and some of these plants have been found as a source of novel inhibitory drugs to suppress HCV infection. Some of these plants have been discussed in this review. In recent years, Pakistan has tested various medicinal plants in vitro and found significant inhibitory effects on HCV titer. Among these plants are glycyrrhizin (GL) which inhibited HCV titer in dose dependent mode and also exhibited synergistic effects when administered with interferon. GL inhibited the core protein of genotype 3a at the mrna and protein level and thus has been suggested as a future drug that can help to decrease the viral titer of HCV [36]. Another plant Silybum marianum (SM) was tested by the same research group and two pure fractions of SM exhibited inhibition of HCV core protein of genotype 3a which was confirmed through western blotting. The research group suggested that the combination of SM with interferon shows promising results in treating HCV [37]. MEDICINAL PLANTS AGAINST NS3 PROTEASE During the recent decades, advancements in drug discovery have revealed NS3/4A protease as an important drug target in overcoming HCV infection. Many inhibitors against NS3 have successfully entered clinical trials but there is still need to improve their functionality and efficiency. Various medicinal plants are also being investigated to develop anti HCV drugs that are not only efficient but are also easily available to developing countries due to their low cost [38]. Methanolic and water extracts of medicinal plants used in Sudanese traditional medicine such as Boswellia carterii, Acacia nilotica, Quercus infectoria, Embelia schimperi, Trachyspermum ammi, Q. infectoria, Piper cubeba and Syzygium aromaticum have been tested against HCV protease and showed more than 90% at 100 µg/ml [39]. An in-silico approach has been used to test Accacia nilotica phytochemicals against NS3/4A protease and found that they may serve as a potential drug candidate with relatively simple structural changes against HCV NS3/4A protease [40]. Solanum nigrum (SN) has also been tested against HCV and its methanolic and chloroform extracts exhibited significant inhibition against HCV protease in liver infected cells [41]. Recently, Viola yedoensis has been investigated to find an anti HCV compound targeting protease. Using the various chromatographic procedures, 3 coumarins have been isolated and characterized from Viola yedoensis. Among the isolated compounds, a dimeric coumarin 5, 5 -bi (6,7-dihydroxycoumarin) has significantly inhibited NS3/4A protease with IC50 value of 0.5 μg/ml. Thus, this dicoumarin can serve as an important molecular template to design novel anti HCV drugs [42]. MEDICINAL PLANT PHYTOCHEMICALS AS HCV INHIBITORS Medicinal plants have shown potential against viral infections and investigation of their active compounds has taken antiviral research to a new horizon. Currently, there are many plant derivatives being tested against HCV and some of them have shown significant inhibition in entry, replication and assembly steps of the viral life cycle, described in Table 1. Diosgenin (3β-hydroxy-5-spirostene), which is a plant-derived sapogenin, has effectively blocked the replication of the HCV subgenomic replicon system at both the mrna and the protein level. A decrease in activator of transcription factor 3 and signal transducer has been observed. The EC50 value of diosgenin was 3.8 μmol with no cellular toxicity. In another antiviral system, it showed inhibition of viral replication at 20 μmol concentration [43]. Silymarin, which is isolated from Silybum marianum has been tested against HCV and is found to be effective in inhibiting the viral activity of HCV. Silymarin has been tested against the HCV core protein of genotype 3a and was found to be effective in inhibiting the core expression [37]. Silibinin, which is a combination of two diastereoisomers, is the major component of silymarin 2944 March 21, 2014 Volume 20 Issue 11

226 Ashfaq UA et al. Medicinal plants against hepatitis C virus responsible for anti HCV activity [44]. The antiviral effect of silibinin has been tested against NS5 RNA-dependent RNA polymerase with IC50 values of μmol [45]. HCV entry has been blocked using different iridoids from Lamium album using HCVpp. The aqueous extract of Lamium album containing lamiridosins A/B (1/2) and iridoids aglycone epimers have reduced HCVpp entry by disturbing the contact of HCV envelope 2 proteins (E2) with the CD81 receptor [46]. The 4-[(1,2-dihydro- 2-oxo-3H-indol-3-ylidene) amino]-n (4,6-dimethyl- 2-pyrimidiny) benzene sulphonamide and its derivatives have also been evaluated for anti-hcv activity and have shown inhibitory effects. The replication of HCV RNA has been blocked by 5-fluoro derivative of Isatin in Huh 5-2 cells [47]. Naringenin is a predominant flavanone found in the grapefruit and has been tested on the HCV particles [48]. Naringenin has suppressed the activity of core protein in Huh 7 cells and has also effectively blocked the assembly of HCV particles. It showed maximum inhibition at 200 μmol concentration with IC50 value of 109 μmol [49]. Epigallocatechin-3-gallate (EGCG) is found in green tea extract and recently this compound has been found significant in inhibiting HCV entry. EGCG had no effect on HCV assembly, replication and release but it efficiently inhibited cell-culture-derived HCV (HCVcc) entry into hepatocellular cell lines and this effect was independent of the HCV genotypes [50]. The effect of EGCG on HCV entry blockage has also been confirmed by another research group using a new anti HCV molecule screening assay [51]. Thus, EGCG may serve as an important anti HCV drug by blocking the entry of virus into host cells. Quercetin, present in vegetables, fruits, grains and leaves has been investigated as an anti HCV agent. Quercetin not only reduced IRES activity but also its augmentation by NS5A. Thus quercetin reduced viral production without any toxic effects [52]. Similarly, in another study quercetin suppressed RNA replication in a subgenomic RNA replicon and also inhibited replication in a model containing NS3 substrates suggesting that it may be related to NS3 protein of HCV and blocks replication by targeting the NS3 protease. The effects of quercetin were nontoxic and were significant [53]. Ladanein (BJ486K) is a flavone isolated from the Marrubium peregrinum L. (Lamiaceae). Ladanein has shown effective inhibition of the post attachment entry step of HCV with an IC50 value of 2.5 μmol. In combination with cyclosporine, it showed interesting synergetic results against all the genotypes of HCV. This provides clues to further investigate ladanein for its anti HCV potential in patients [54]. Luteolin and apigenin have also been identified as anti HCV agents with IC50 values of 4.3 μmol and 7.9 μmol respectively. Among both compounds, luteolin showed persuasive inhibition of NS5B polymerase activity with an IC50 of 1.12 μmol [55]. REFERENCES 1 Romański B, Bokowski W. [Evaluation of the therapeutic effect of sodium cromoglycate in patients with gastric and duodenal ulcers, sensitive to exogenous allergens]. Pol Tyg Lek 1986; 41: [PMID: DOI: / X-8-161] 2 World Health Organization. Hepatitis C. Fact sheet: No.164, O'Sullivan A, Brody M. Discharge planning for the mentally disabled. QRB Qual Rev Bull 1986; 12: [PMID: DOI: / ] 4 Jahan S, Ashfaq UA, Khaliq S, Samreen B, Afzal N. Dual behavior of HCV Core gene in regulation of apoptosis is important in progression of HCC. Infect Genet Evol 2012; 12: [PMID: DOI: /j.meegid ] 5 Aaronson NK, Calais da Silva F, de Voogt HJ. Subjective response criteria and quality of life. Prog Clin Biol Res 1988; 269: [PMID: DOI: / ] 6 Naggie S. Management of hepatitis C virus infection: the basics. Top Antivir Med 2012; 20: [PMID: ] 7 Tsukiyama-Kohara K, Iizuka N, Kohara M, Nomoto A. Internal ribosome entry site within hepatitis C virus RNA. J Virol 1992; 66: Tanaka T, Lau JY, Mizokami M, Orito E, Tanaka E, Kiyosawa K, Yasui K, Ohta Y, Hasegawa A, Tanaka S. Simple fluorescent enzyme immunoassay for detection and quantification of hepatitis C viremia. J Hepatol 1995; 23: [PMID: ] 9 Gonzalez-Cerezo H, Dalziel K. L-alpha-glycerophosphate dehydrogenase from beef liver. Methods Enzymol 1975; 41: [PMID: ] 10 Foy E, Li K, Wang C, Sumpter R, Ikeda M, Lemon SM, Gale M. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 2003; 300: [PMID: DOI: /science ] 11 Thomas ED. A review of the results of human marrow transplantation in Seattle. Nihon Ketsueki Gakkai Zasshi 1977; 40: [PMID: 24973] 12 Kato N. Molecular virology of hepatitis C virus. Acta Med Okayama 2001; 55: [PMID: ] 13 Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993; 74 (Pt 11): [PMID: ] 14 Nakano T, Lau GM, Lau GM, Sugiyama M, Mizokami M. An updated analysis of hepatitis C virus genotypes and subtypes based on the complete coding region. Liver Int 2012; 32: [PMID: DOI: /j x] 15 Strocchi R, De Pasquale V, Guizzardi S, Govoni P, Facchini A, Raspanti M, Girolami M, Giannini S. Human Achilles tendon: morphological and morphometric variations as a function of age. Foot Ankle 1991; 12: [PMID: ] 16 Westin J, Nordlinder H, Lagging M, Norkrans G, Wejstål R. Steatosis accelerates fibrosis development over time in hepatitis C virus genotype 3 infected patients. J Hepatol 2002; 37: [PMID: ] 17 Jassim SA, Naji MA. Novel antiviral agents: a medicinal plant perspective. J Appl Microbiol 2003; 95: [PMID: ] 18 Naithani R, Huma LC, Holland LE, Shukla D, McCormick DL, Mehta RG, Moriarty RM. Antiviral activity of phytochemicals: a comprehensive review. Mini Rev Med Chem 2008; 8: [PMID: ] 19 Zeuzem S, Feinman SV, Rasenack J, Heathcote EJ, Lai MY, Gane E, O Grady J, Reichen J, Diago M, Lin A, Hoffman J, Brunda MJ. Peginterferon alfa-2a in patients with chronic hepatitis C. N Engl J Med 2000; 343: [PMID: DOI: /NEJM ] 20 Feld JJ, Hoofnagle JH. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature 2005; 436: [PMID: ] 21 Vasil'eva VI, Sumarokov AA, Kozhevnikova LK, Asratian 2945 March 21, 2014 Volume 20 Issue 11

227 Ashfaq UA et al. Medicinal plants against hepatitis C virus AA, Gorbunov MA. [Frequency of finding hepatitis B viral markers in young children born of mothers carrying the HBs-antigen]. Zh Mikrobiol Epidemiol Immunobiol 1987; (2): [PMID: DOI: /JVI ] 22 Dienstag JL, McHutchison JG. American Gastroenterological Association technical review on the management of hepatitis C. Gastroenterology 2006; 130: ; quiz [PMID: ] 23 Shah PJ, Greenberg WM. Tolbutamide and fatal water intoxication. Br J Psychiatry 1991; 158: [PMID: ] 24 Rustgi VK. Albinterferon alfa-2b, a novel fusion protein of human albumin and human interferon alfa-2b, for chronic hepatitis C. Curr Med Res Opin 2009; 25: [PMID: DOI: / ] 25 Benhamou Y, Afdhal NH, Nelson DR, Shiffman ML, Halliman DG, Heise J, Chun E, Pockros PJ. A phase III study of the safety and efficacy of viramidine versus ribavirin in treatment-naïve patients with chronic hepatitis C: ViSER1 results. Hepatology 2009; 50: [PMID: DOI: /hep.23073] 26 Gluckman PD, Ballard PL, Kaplan SL, Liggins GC, Grumbach MM. Prolactin in umbilical cord blood and the respiratory distress syndrome. J Pediatr 1978; 93: [PMID: ] 27 López-Labrador FX. Hepatitis C Virus NS3/4A Protease Inhibitors. Recent Pat Antiinfect Drug Discov 2008; 3: [PMID: ] 28 Bagliani A, Moia R. [Effects of a new anti-inflammatory agent in some phlebopathies of the lower extremities]. Minerva Cardioangiol 1979; 27: [PMID: ] 29 Coupland RM, Howell PR. An experience of war surgery and wounds presenting after 3 days on the border of Afghanistan. Injury 1988; 19: [PMID: DOI: /hep.24641] 30 Coen DM. Antiviral drug resistance. Ann N Y Acad Sci 1990; 616: [PMID: ] 31 Tilak JC, Adhikari S, Devasagayam TP. Antioxidant properties of Plumbago zeylanica, an Indian medicinal plant and its active ingredient, plumbagin. Redox Rep 2004; 9: [PMID: DOI: / ] 32 Kitazato K, Wang Y, Kobayashi N. Viral infectious disease and natural products with antiviral activity. Drug Discov Ther 2007; 1: [PMID: ] 33 Evers MP, Zelle B, Peeper DS, Mager WH, Planta RJ, Eriksson AW, Frants RR. Molecular cloning of a pair of human pepsinogen A genes which differ by a Glu----Lys mutation in the activation peptide. Hum Genet 1987; 77: [PMID: DOI: / X-8-220] 34 Jacob JR, Korba BE, You JE, Tennant BC, Kim YH. Korean medicinal plant extracts exhibit antiviral potency against viral hepatitis. J Altern Complement Med 2004; 10: [PMID: ] 35 Wahyuni TS, Tumewu L, Permanasari AA, Apriani E, Adianti M, Rahman A, Widyawaruyanti A, Lusida MI, Fuad A, Soetjipto D, Nasronudin D, Fuchino H, Kawahara N, Shoji I, Deng L, Aoki C, Hotta H. Antiviral activities of Indonesian medicinal plants in the East Java region against hepatitis C virus. Virol J 2013; 10: 259 [PMID: ] 36 Raisaro A, Caizzi V, Roda G, Minzioni G, Bargiggia G, Bertucci C, Recusani F, Tronconi L. [Doppler evaluation of the Sorin and Medtronic-Hall prostheses in the aortic position]. G Ital Cardiol 1988; 18: [PMID: DOI: / ].] 37 da Silva Filho CE, Muench A. [Hardness of a low gold (46%) content alloy]. Rev Odontol Univ Sao Paulo 1988; 2: [PMID: DOI: / X-8-153] 38 Idrees S, Ashfaq UA. HCV infection and NS-3 serine protease inhibitors. Virol Mycol 2013; 2: 112 [DOI: / ] 39 Hussein G, Miyashiro H, Nakamura N, Hattori M, Kakiuchi N, Shimotohno K. Inhibitory effects of sudanese medicinal plant extracts on hepatitis C virus (HCV) protease. Phytother Res 2000; 14: [PMID: ] 40 Murakami K, Kuwabara H, Miura S, Mochizuki H, Nagamine T, Tomioka S, Yamada S, Kobayashi S, Ogawa A. [A case of glomerulonephritis complicated by idiopathic retroperitoneal fibrosis-like disease]. Nihon Naika Gakkai Zasshi 1986; 75: [PMID: DOI: / ] 41 Leitz T, Müller WA. Evidence for the involvement of PIsignaling and diacylglycerol second messengers in the initiation of metamorphosis in the hydroid Hydractinia echinata Fleming. Dev Biol 1987; 121: [PMID: DOI: / X-8-26] 42 Zhang L, Li MY, Wang LW, Gao J, Ma CM. Isolation, Identification, Quantification and Inhibitory Activity on HCV Protease of Coumarins from Viola yedoensis. Can. Chem. Trans. 2013; 1: Wang YJ, Pan KL, Hsieh TC, Chang TY, Lin WH, Hsu JT. Diosgenin, a plant-derived sapogenin, exhibits antiviral activity in vitro against hepatitis C virus. J Nat Prod 2011; 74: [PMID: DOI: /np100578u] 44 Polyak SJ, Morishima C, Shuhart MC, Wang CC, Liu Y, Lee DY. Inhibition of T-cell inflammatory cytokines, hepatocyte NF-kappaB signaling, and HCV infection by standardized Silymarin. Gastroenterology 2007; 132: [PMID: ] 45 Glass P, Miller M, Short B. Morbidity for survivors of extracorporeal membrane oxygenation: neurodevelopmental outcome at 1 year of age. Pediatrics 1989; 83: [PMID: DOI: /hep.23587] 46 Zhang H, Rothwangl K, Mesecar AD, Sabahi A, Rong L, Fong HH. Lamiridosins, hepatitis C virus entry inhibitors from Lamium album. J Nat Prod 2009; 72: [PMID: DOI: /np900549e] 47 McGarvey P, Helling RB, Lee JY, Engelke DR, el-gewely MR. Initiation of rrn transcription in chloroplasts of Euglena gracilis bacillaris. Curr Genet 1988; 14: [PMID: DOI: / X.40339] 48 Nahmias Y, Goldwasser J, Casali M, van Poll D, Wakita T, Chung RT, Yarmush ML. Apolipoprotein B-dependent hepatitis C virus secretion is inhibited by the grapefruit flavonoid naringenin. Hepatology 2008; 47: [PMID: DOI: /hep.22197] 49 Cheung R, Dickins J, Nicholson PW, Thomas AS, Smith HH, Larson HE, Deshmukh AA, Dobbs RJ, Dobbs SM. Compliance with anti-tuberculous therapy: a field trial of a pillbox with a concealed electronic recording device. Eur J Clin Pharmacol 1988; 35: [PMID: DOI: / j.jhep ] 50 Ciesek S, von Hahn T, Colpitts CC, Schang LM, Friesland M, Steinmann J, Manns MP, Ott M, Wedemeyer H, Meuleman P, Pietschmann T, Steinmann E. The green tea polyphenol, epigallocatechin-3-gallate, inhibits hepatitis C virus entry. Hepatology 2011; 54: [PMID: DOI: /hep.24610] 51 Fukazawa H, Suzuki T, Wakita T, Murakami Y. A cell-based, microplate colorimetric screen identifies 7,8-benzoflavone and green tea gallate catechins as inhibitors of the hepatitis C virus. Biol Pharm Bull 2012; 35: [PMID: ] 52 Gonzalez O, Fontanes V, Raychaudhuri S, Loo R, Loo J, Arumugaswami V, Sun R, Dasgupta A, French SW. The heat shock protein inhibitor Quercetin attenuates hepatitis C virus production. Hepatology 2009; 50: [PMID: ] 53 Bachmetov L, Gal-Tanamy M, Shapira A, Vorobeychik M, Giterman-Galam T, Sathiyamoorthy P, Golan-Goldhirsh A, Benhar I, Tur-Kaspa R, Zemel R. Suppression of hepatitis C virus by the flavonoid quercetin is mediated by inhibition of NS3 protease activity. J Viral Hepat 2012; 19: e81-e88 [PMID: DOI: /j x] 2946 March 21, 2014 Volume 20 Issue 11

228 Ashfaq UA et al. Medicinal plants against hepatitis C virus 54 Haid S, Novodomská A, Gentzsch J, Grethe C, Geuenich S, Bankwitz D, Chhatwal P, Jannack B, Hennebelle T, Bailleul F, Keppler OT, Poenisch M, Bartenschlager R, Hernandez C, Lemasson M, Rosenberg AR, Wong-Staal F, Davioud- Charvet E, Pietschmann T. A plant-derived flavonoid inhibits entry of all HCV genotypes into human hepatocytes. Gastroenterology 2012; 143: e5 [PMID: DOI: /j.gastro ] 55 Antunes JL, Carmel PW, Zimmerman EA, Ferin M. Regeneration of the magnocellular system of the rhesus monkey following hypothalamic lesions. Ann Neurol 1979; 5: [PMID: ] P- Reviewers: Cong WM, Kato T, Liu ZH, Ma Q, Zhu X S- Editor: Qi Y L- Editor: O Neill M E- Editor: Ma S 2947 March 21, 2014 Volume 20 Issue 11

229 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Current testing strategies for hepatitis C virus infection in blood donors and the way forward Neelam Marwaha, Suchet Sachdev Neelam Marwaha, Suchet Sachdev, Department of Transfusion Medicine, Post Graduate Institute of Medical Education and Research, Chandigarh , India Author contributions: Marwaha N planned the review article, wrote the article; Sachdev S crosschecked and took out all the references and proofed the article; Marwaha N and Sachdev S both approved the article before final submission. Correspondence to: Neelam Marwaha, Professor, Department of Transfusion Medicine, Post Graduate Institute of Medical Education and Research, Sector 12, Chandigarh , India. neelam2918@yahoo.com Telephone: Fax: Received: September 27, 2013 Revised: December 23, 2013 Accepted: February 20, 2014 Published online: March 21, 2014 constrained countries HCV screening is highly variable, depending upon infrastructure, trained manpower and financial resource. Rapid tests which do not require instrumentation and are simple to perform are used in many small and remotely located blood centres. The sensitivity as compared to EIAs is less and wherever feasible HCV antibody EIAs are most frequently used screening assays. Efforts have been made to implement combined antigen-antibody assays and even NAT in some of these countries Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Screening tests; Blood donors; Immunoassays; Nucleic acid testing Abstract Screening tests for blood donations are based upon sensitivity, cost-effectiveness and their suitability for high-throughput testing. Enzyme immunoassay (EIAs) for hepatitis C virus (HCV) antibodies were the initial screening tests introduced. The first generation antibody EIAs detected seroconversion after unduly long infectious window period. Improved HCV antibody assays still had an infectious window period around 66 d. HCV core antigen EIAs shortened the window period considerably, but high costs did not lead to widespread acceptance. A fourth-generation HCV antigen and antibody assay (combination EIA) is more convenient as two infectious markers of HCV are detected in the same assay. Molecular testing for HCV-RNA utilizing nucleic acid amplification technology (NAT) is the most sensitive assay and shortens the window period to only 4 d. Implementation of NAT in many developed countries around the world has resulted in dramatic reductions in transfusion transmissible HCV and relative risk is now < 1 per million donations. However, HCV serology still continues to be retained as some donations are serology positive but NAT negative. In resource Core tip: This is a review article on development and current status of screening tests for hepatitis C virus (HCV) infection in blood donors. The sensitivity of HCV antibody assays, HCV core antigen assays and combination assays are discussed. Effect of nucleic acid amplification technology implementation of blood safety is highlighted. Future prospects for developed countries and resource constrained countries are presented. Marwaha N, Sachdev S. Current testing strategies for hepatitis C virus infection in blood donors and the way forward. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Transfusion therapy is an important component of modern health care and is dependant primarily on safe and adequate blood supply. The real challenge of blood 2948 March 21, 2014 Volume 20 Issue 11

230 Marwaha N et al. Testing strategies for HCV transfusion lies in minimising risks and optimising clinical benefits. The first cases of transfusion associated jaundice were reported in 1943 [1,2]. It was only in the 1960 s that the causative agent - hepatitis B virus was identified and screening of donor blood for hepatitis B surface antigen (HBsAg) was initiated in the United States (US) in 1971 and became a US federal regulation in July 1972 [3]. During the same period a retrospective study was conducted by Grady and Chalmers in 1964 where it was shown that the incidence of transfusion associated hepatitis (TAH) in recipients of blood transfusion from volunteer donors was 0.6 cases/1000 units compared with 2.8 cases/1000 units where blood was collected from a mixture of volunteer and commercial blood donors [4]. This report was followed by a prospective study on recipients of blood transfusion to determine the incidence of TAH when blood was transfused from volunteer or commercial donors and reconfirmed the increased association between commercial blood donors and TAH [5]. The blood banks began switching over to blood collection from voluntary non-paid donors. By the end of 1975 the US Food and Drug Administration made it mandatory to collect blood from only voluntary non-remunerated blood donors [6]. Adoption of these two measures namely voluntary blood donation and screening donor blood for HBsAg led to 70% reduction of TAH and 85% reduction in transfusion associated hepatitis B [7]. Despite HBsAg screening, cases of TAH continued to occur, though majority of these (75%) were not due to hepatitis B virus (HBV). Hepatitis A virus (HAV) was identified in 1973 [8] and serological assays for antibody detection became available. It was presumed then, that HAV might be the agent of non-b TAH, but serological screening of recipient and donor samples for anti-hav showed non-reactivity [9]. Thus began the search for non A non B (NANB) hepatitis agent. During the period of non-discovery of the NANB hepatitis agents, surrogate tests i.e., alanine aminotransferase and anti-hbc were performed for routine blood donation screening [3]. Extensive experimental studies were conducted in chimpanzees [10,11] by inoculating the animals with serum from patients with acute or chronic NANB hepatitis and asymptomatic carriers, and finally in 1989 the virus was cloned and characterized. It was designated as hepatitis C virus (HCV) [12]. World over about 170 million people are chronically infected with HCV (3% of world population) [13]. However the prevalence varies in general population from high (> 10%) in Egypt, Cameroon, Rwanda, Bolivia, Gabon and Burundi, intermediate (2.5%-10%) in Mediterranean countries, South America, Africa and Middle East to low (< 2.5%) in North America, Europe, Australia [14]. Seroprevalence amongst blood donors as reported from different countries varies from 0.4% to 13.3% [15-20]. SCREENING BLOOD DONATIONS FOR HCV The natural course of HCV infection is characterised by the appearance of the following markers in chronological sequence; HCV RNA, HCV antigens and subsequently HCV antibodies. The tests however were introduced in the reverse order for donor screening since the technologies had to be optimised to achieve maximum sensitivity and specificity for blood transfusion safety. SEROLOGICAL ASSAYS Serology based assays may detect presence of anti-hcv antibodies, HCV antigen or both simultaneously. The testing platforms could be enzyme immunoassays (EIAs), chemiluminescence (CLIA) or rapid tests. The test principle in EIAs and CLIAs is the same, but end point detection in EIAs is measured as colour change and in CLIAs as luminescence. The CLIA end point detection signal has been reported to have better sensitivity than enzyme based assays. The improvements in assay performance, particularly of the EIAs have been termed as generations of the assays. The first generation anti- HCV EIA detected antibodies 12 to 26 wk after exposure, creating a long window period of infectivity and some patients never seroconverted with this assay. The false positivity rate in low risk populations was reported to be as high as 60%. The limited sensitivity of the first generation assay was attributed to the use of the antigen c100-3 (NS4) alone which represents only 12% of the viral genome [21,22]. The second generation anti-hcv EIA incorporated two more epitopes, one each from the core antigen and a non-structural antigen (NS3). The range of window period of infectivity reduced to 10 to 24 wk. The third generation EIAs incorporated additional antigen from the non-structural HCV antigen (NS5) and showed a further reduction in the window period by one week. Despite increase in sensitivity with each successive generation of the assay, the prolonged serology negative but infectious window period remained a cause for concern, with second generation assays, the average window period remains around 82 d [23] and with third generation assays it reduces to but still remains around 66 d [24,25]. Window period can be shortened by either detection of viral antigen or the genome. ELISA assays for the detection of HCV core antigen were developed and tested on both blood donors and patients at high risk of acquiring infections i.e., patients on chronic haemodialysis [26-28]. In a study on HCV antibody negative blood donors core antigen assays detected HCV antigen in 11 out of 18 (61%) of the donor samples initially positive for HCV RNA by real-time polymerase chain reaction (RT-PCR). In the 7 cases (39%) where the antigen assay was negative, the HCV core antigen became detectable between 2 and 21 d after the initial testing [27]. In another study [28] HCV core antigen was tested on 6 HCV antibody negative and HCV RNA positive blood donors and 135 serial samples from 28 antibody negative patients on haemodialysis. Five of the six donors (83%) were positive for HCV antigen, while in haemodialysis patients 81 samples tested positive out of 92 HCV RNA 2949 March 21, 2014 Volume 20 Issue 11

231 Marwaha N et al. Testing strategies for HCV positive samples (88%). A correlation was observed between viral load and the detection of HCV antigen. The positive results were obtained in 96% of the study population when the number of HCV RNA copies per ml was greater than 10 5 and only 53% when the number of HCV RNA copies was lower. Average time from RNA to antigen positivity was estimated at 2 d in contrast to a study in which compared with amplified HCV RNA testing the core antigen only testing increased the window period by 8 d [27]. Thus HCV antigen appears at the earliest within 2-8 d of HCV-RNA positivity. The average window period reduction can be achieved by 49 d. In a recently published meta-analysis the pooled sensitivity of the HCV core antigen assay was 0.84% (95%CI: ) and the pooled specificity was 0.98% (95%CI: ) [29]. The HCV core antigen only assay did not find widespread applicability in blood donor screening since two serology based assays had to be performed on the same donor unit. Additional high cost of the assay also precluded its use as a screening test. A sandwich ELISA for the detection of HCV NS3 antigen has been developed indigenously in a resource constrained country [30]. The authors used a high sensitivity and specificity anti-hcv-ns3 antigen monoclonal antibody and a highly efficient, purified anti-hcv polyclone antibody from a chronic HCV patient with high titre anti-hcv (titre-1 in 10000). The HCV NS3 antigen positivity rate in the 173 anti-hcv positive samples and the 3708 HCV-negative samples was 24.3% and 1.3% respectively. Innovations like these may help to make technological advancements affordable to large parts of the developing world. ELI- SA assays are the most widely used serological screening tests for HCV antibody detection in blood centres. The assays can be run in batches and can be fully automated for testing large numbers of donor samples. About 70%-80% of HCV antibody positive samples are also HCV RNA positive, hence there is high probability of HCV transmission from seropositive donors [16,31]. Combination antigen-antibody assays were introduced, where two markers of the same infection could be detected simultaneously. These assays came to be known as fourth generation or antigen-antibody combo tests and appeared more suitable in a blood bank setting where large numbers of donor samples need to be screened in the shortest possible time. The combined antigen-antibody assays are usually sandwich ELISAs where the solid phase and second phase comprise both HCV derived antigens and antibodies against HCV. The performance of these combined assays was evaluated on three panels of antibody negative plasma samples from HCV RNA only positive donors [32]. Assay kits from two manufacturers were compared, there was variability in antigen detection which also seemed genotype dependent and influenced to some extent by the viral load. The detection of HCV infection by these two fourth generation assays was 29% and 50% respectively in HCV RNA positive samples. Combined assays resulted in suboptimal detection of HCV antigen when compared to antigen only assays. Despite this, combination assays are a definite improvement over antibody only assays, as they detect the infection earlier and are capable of detecting immunosilent carriers who are viremic without detectable antibodies in their plasma [33]. In another study, 70.5% of HCV RNA positive and anti- HCV negative samples collected in pre-seroconversion phase were detected by antigen-antibody assays [34]. This study was conducted on 107 sequential samples from 10 HCV seroconversion commercial panels. The specificity was further analysed in 2503 consecutive blood donations and was estimated at 99.8%. The average window period reduction with combined assays was estimated at 26.8 d and this would translate to a reduction of the HCV transfusion transmissible risk by 41%. The authors observed that the assay failed to detect HCV antigen in few samples where the HCV-RNA load was greater than 10 6 /ml. They postulated that this might be explained by inaccessibility of the core antigen to monoclonal antibodies included in the assay. Nevertheless these assays provide a viable alternate to molecular methods where cost constraint is a limiting factor. RAPID TESTS In many blood centres located within resource-constrained countries the laboratory facilities are limited as regards instrumentation, electricity supply and trained manpower. In such situations rapid tests provide an alternate screening methodology to EIAs. These tests can be performed within few minutes and the results can be read visually and are not dependant on any instruments or electrical supply. They are based upon any one of the following principles; agglutination [35], immunofiltration [36] or immuno-chromatography [37]. The antigens used in the test are usually same as those incorporated in third generation EIAs. Each test strip or cassette has an inbuilt control band for validation. The reported sensitivities with these tests ranged from 98%-100% [35-37], however in the presence of associated human immunodeficiency virus (HIV) coinfection, the test sensitivity was detected to be only 77.5% [38]. An added advantage of rapid tests is to perform a quick risk assessment of source person in case of needle stick injury to health care workers. In a multinational assessment of blood-borne virus testing at 51 blood centres in 17 African countries, the sensitivity of rapid anti-hcv tests varied from 47% to 100%. Samples with the lowest HCV antibody levels were more frequently negative, especially with the rapid tests, thus compromising blood safety. Four samples with high antibody levels which were detected by all EIAs, tested negative with rapid tests [39]. MOLECULAR TESTING OF HCV In the late 1990s and early 2000s, several developed countries introduced direct viral nucleic acid detection for HCV and HIV-Ⅰ, following later by HBV. The ear March 21, 2014 Volume 20 Issue 11

232 Marwaha N et al. Testing strategies for HCV lier tests were based largely on in-house PCR and testing was voluntary. As technology advanced and the potential of blood donor screening by viral nucleic acid detection was realised, semi-automated and fully automated high throughput commercial platforms become available. Amplification of the small amounts of viral nucleic acid RNA/DNA present in donor plasma was an integral part of the technology, these tests came to be referred to as nucleic acid amplification technology. Viral nucleic acids are detected by one of the two technologies in blood centres [40] (1) PCR; and (2) transfusion mediated amplification (TMA). PCR is ideal for DNA amplification. For RNA amplification as required for HCV a reversetranscription step is needed to generate cdna. Both the steps, that is reverse transcription and DNA amplification can be incorporated into a single step by incorporating reverse transcriptase and DNA polymerase in the same reaction. TMA technology uses two enzymes- RNA polymerase and reverse transcriptase (RT). The RT enzyme creates cdna which serves as a template to generate RNA by the activity of the enzyme RNA polymerase. In this way about a billion RNA amplicons are produced in less than an hour. NAT testing for HCV was the first viral nucleic acid detection screening test introduced in blood centres. Testing was performed on minipools (MP-NAT), with pool size varying from 96 to 6 blood donations [41]. The first country to introduce NAT screening of whole blood and apheresis donations in 1997 was Germany. Initially this technology was started on voluntary basis, but in 1999 HCV NAT was made mandatory, prior to release of blood components [42]. Subsequently HCV NAT became mandated in at least 23 countries across the world [43], although NAT has been implemented in blood centres in over 40 countries. Testing in minipools has been reported to reduce sensitivity and this has led to decrease in pool size, varying from 24 to 6 donations. Many blood centres have progressed to individual donation (ID-NAT) testing. In a comparative study between MP-NAT and ID-NAT testing, the latter was observed to be significantly more sensitive in detecting HCV and HIV RNAs but the difference in sensitivity was limited for HBV DNA [44]. To enhance the sensitivity of MP- NAT, fully automated nucleic acid extraction systems are available. In Germany where MP-NAT is performed on pool size of 96, ultracentrifugation prior to viral extraction has yielded analytical sensitivity of NAT, equivalent to smaller pool size [45]. Many blood centres have progressed to individual donation (ID-NAT) testing. Regardless of minipool or individual donation testing, blood centres are using the multiplex commercial NAT platforms where simultaneous detection of HCV, HBV, HIV-1 and recently even HIV-2 is available. This helps in conserving reagents, reducing sample volume required and gives results for 3 viral agents within the same time frame. The initial NAT reactive results are then confirmed using discriminatory assays for each of the specific virus. NAT has a high analytical sensitivity for HCV RNA and ID-NAT can detect as low as 2.0 to 9.4 IU/mL [46]. NAT testing for HCV reduced the infectious pre-seroconversion period dramatically to 4 to 6 d. It also helped to detect immunosilent carriers. The residual risk of transfusion-transmitted HCV infection has declined significantly in countries where universal NAT screening has been implemented. In a study from the US, during a 10 year period 66 million donations were screened with HCV antibody and NAT, 244 HCV (1:270000) NAT yield donations were identified and the prevalence of HCV in first time donors decreased by 53% [47]. Enhanced blood safety is also evident from studies published from other countries. In Germany between 1990 and 1998, approximately seven transfusion-transmitted cases occurred annually, but after implementation of NAT, no additional case has been reported, except one where NAT was false negative due to very low viral load [42]. The marked improvement in blood safety is due to the high analytical sensitivity of NAT assays and addition of NAT to serological testing has been instrumental in reducing residual risk of transfusion-transmitted HCV to less than 1 per million donations [48]. NAT is an additional though highly sensitive and significant advance in blood safety. There are situations where NAT is negative but HCV serology is positive. In a recent international survey on NAT testing of blood donations 29.4% of HCV antibody positive donations tested HCV NAT negative [43]. Hence serology and NAT testing are complimentary tests. NAT must be viewed as an additional though highly significant advancement in blood safety. TESTING IN DEVELOPED COUNTRIES Developed countries have successfully implemented stringent donor screening, voluntary blood donation and advanced and sensitive technologies for blood donation screening to reach acceptable levels of blood safety. Second/third generation HCV antibody screening EIAs or CLIAs coupled with HCV RNA detection by NAT has resulted in marked reduction in transfusion transmitted risk. The NAT yield rate (HCV RNA positive, antibody negation donations) is lowest (< 1 per million donations screened) in UK, France, Germany, Canada and South Africa. The residual risk (risk of HCV infectious donations entering the blood supply) in these countries varies from 1 in 7.7 million in France to 1 in million in United Kingdom [31]. The residual risk though minute remains due to viral load below limit of detection of NAT assays or specific genotype prevalence or mutant variants of the virus. Implementation of NAT has been expensive both in terms of technology and human resource training and despite its low cost effectiveness as evidenced by low NAT yields it continues to be progressively implemented in the interest of the public. TESTING IN RESOURCE-CONSTRAINED COUNTRIES The testing scenario is highly variable and depends upon 2951 March 21, 2014 Volume 20 Issue 11

233 Marwaha N et al. Testing strategies for HCV availability of laboratory infrastructure, instrumentation as well as trained staff and financial resources. These countries are mostly located in Africa, Asia and Latin America and as per WHO database on blood safety, blood donations are still not routinely tested for infectious marker screening including HCV in 39 countries. Forty seven per cent donations are tested in laboratories without quality assurance [49]. The testing technologies vary from rapid tests to EIAs, CLIAs or even NAT as in Egypt or few blood centres within countries as in India. The HCV NAT yield as reported from Egypt was 15 in donation (1 per 1043) which carries a residual risk of 1 per donations [50]. In the first multicentre evaluation of NAT in Indian blood donors HCV RNA yield was 1 per donors [51]. Subsequent studies showed higher HCV NAT yields (3 in donors) [52]. In a study from China where HCV testing with MP-NAT was employed, the residual risk estimate from NAT yield was 1 in as compared to HCV antigen-antibody EIA (1 in ) and with third generation EIA (1 in 59588) [53]. There is an urgent need for the resourceconstrained countries to implement testing where none exists and to replace rapid tests wherever feasible with either sensitive antibody assays or combined antigenantibody assays to shorten the antibody pre-seroconversion window period. Quality control is essential for both precision and accuracy of test results. NAT testing where affordable and feasible should be introduced since the prevalence of HCV, HBV and HIV-1/2 is higher in these countries and NAT might detect more window period donations than low-prevalence countries. FUTURE DEVELOPMENTS Serological and NAT testing has contributed dramatically to improving blood safety. However, a minimal residual risk still remains. In addition, emerging and reemerging pathogens and bacterial contamination continue to pose further risks to blood safety. Recognition of any new infectious threat necessitates development of appropriate assays systems, regulatory approvals and staff training. One approach is to inactivate pathogens in donated blood. Pathogen reduction technologies (PRT) are available for platelets and plasma and lead to 4-6 log reduction of transfusion transmissible HCV, HIV, HBV, CMV as well as syphilis organisms [54,55]. Issues of concern with PRT are high costs, neo-antigen formation in the product and post PRT yields and function of platelets or plasma coagulation factors. PRT for red cells is not yet licensed. Attempts are on-going to develop pathogen inactivation process for whole blood [56,57]. This step may obviate the need for multiple PRT platforms for blood components. Second approach is to consider microarray platforms for all potential transfusion transmissible infections or combination technologies [42] (antibody, antigen and NAT) as one platform. Zero risk blood supply still remains an elusive goal. The blood transfusion services continue to be challenged by mutations in known viruses, immunosilent carriers and emerging infectious agents. CONCLUSION In conclusion the best strategy for HCV screening should ideally include a sensitive antibody assay coupled with a direct viral detection method, either HCV antigen or HCV RNA. Fourth generation combined antigenantibody assays can provide a single serological platform in resource-constrained settings. REFERENCES 1 Beeson PB. Jaundice occurring one to four months after transfusion of blood or plasma. Report of seven cases. JAMA 1943; 121: [DOI: /jama ] 2 Morgan HV, Williamson DA. Jaundice following Administration of Human Blood Products. Br Med J 1943; 1: [PMID: DOI: /bmj ] 3 Tobler LH, Busch MP. History of posttransfusion hepatitis. Clin Chem 1997; 43: [PMID: ] 4 GRADY GF, CHALMERS TC. RISK OF POST-TRANSFU- SION VIRAL HEPATITIS. N Engl J Med 1964; 271: [PMID: DOI: /NEJM ] 5 Walsh JH, Purcell RH, Morrow AG, Chanock RM, Schmidt PJ. Posttransfusion hepatitis after open-heart operations. Incidence after the administration of blood from commercial and volunteer donor populations. JAMA 1970; 211: [PMID: DOI: /jama ] 6 Domen RE. Paid-versus-volunteer blood donation in the United States: a historical review. Transfus Med Rev 1995; 9: [PMID: DOI: /S (05) ] 7 Alter HJ, Holland PV, Purcell RH, Lander JJ, Feinstone SM, Morrow AG, Schmidt PJ. Posttransfusion hepatitis after exclusion of commercial and hepatitis-b antigen-positive donors. Ann Intern Med 1972; 77: [PMID: DOI: / ] 8 Genêt F, Poiraudeau S, Revel M. [Effectiveness and compliance to a center-based short rehabilitation program with a home-based program for chronic low back pain]. Ann Readapt Med Phys 2002; 45: [PMID: DOI: /science ] 9 Dienstag JL, Purcell HR, Alter HJ, Feinstone SM, Wong DC, Holland PV. Non-A, non-b post-transfusion hepatitis. Lancet 1977; 1: [PMID: DOI: / S (77) ] 10 Tabor E, Gerety RJ, Drucker JA, Seeff LB, Hoofnagle JH, Jackson DR, April M, Barker LF, Pineda-Tamondong G. Transmission of non-a, non-b hepatitis from man to chimpanzee. Lancet 1978; 1: [PMID: DOI: / S (78) ] 11 Bradley DW, McCaustland KA, Cook EH, Schable CA, Ebert JW, Maynard JE. Posttransfusion non-a, non-b hepatitis in chimpanzees. Physicochemical evidence that the tubuleforming agent is a small, enveloped virus. Gastroenterology 1985; 88: [PMID: ] 12 Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cdna clone derived from a bloodborne non-a, non-b viral hepatitis genome. Science 1989; 244: [PMID: DOI: /science ] 13 Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 2006; 45: [PMID: DOI: / j.jhep ] 2952 March 21, 2014 Volume 20 Issue 11

234 Marwaha N et al. Testing strategies for HCV 14 Zaltron S, Spinetti A, Biasi L, Baiguera C, Castelli F. Chronic HCV infection: epidemiological and clinical relevance. BMC Infect Dis 2012; 12 Suppl 2: S2 [PMID: DOI: / S2-S2] 15 Sharma RR, Cheema R, Vajpayee M, Rao U, Kumar S, Marwaha N, Agnihotri SK. Prevalence of markers of transfusion transmissible diseases in voluntary and replacement blood donors. Natl Med J India 2004; 17: [PMID: ] 16 Thakral B, Marwaha N, Chawla YK, Saluja K, Sharma A, Sharma RR, Minz RW, Agnihotri SK. Prevalence & significance of hepatitis C virus (HCV) seropositivity in blood donors. Indian J Med Res 2006; 124: [PMID: ] 17 Makroo RN, Walia RS, Chowdhry M, Bhatia A, Hegde V, Rosamma NL. Seroprevalence of anti-hcv antibodies among blood donors of north India. Indian J Med Res 2013; 138: [PMID: ] 18 Khattak MF, Salamat N, Bhatti FA, Qureshi TZ. Seroprevalence of hepatitis B, C and HIV in blood donors in northern Pakistan. J Pak Med Assoc 2002; 52: [PMID: ] 19 Nagalo BM, Bisseye C, Sanou M, Kienou K, Nebié YK, Kiba A, Dahourou H, Ouattara S, Nikiema JB, Moret R, Zongo JD, Simpore J. Seroprevalence and incidence of transfusiontransmitted infectious diseases among blood donors from regional blood transfusion centres in Burkina Faso, West Africa. Trop Med Int Health 2012; 17: [PMID: DOI: /j x] 20 Dessie A, Abera B, Wale F. Seroprevalence of major bloodborne infections among blood donors of Felege Hiwot referral hospital, Northwest Ethiopia. Ethiop J Health Dev 2007; 21: [DOI: /ejhd.v21i ] 21 Kobayashi S, Koike T, Yoshiki K, Shirai S. [Problems in determination of T and B cells in SLE]. Nihon Rinsho 1978; 36: [PMID: DOI: /hep ] 22 Klein HG, Anstee DJ. Mollison's Blood Transfusion in Clinical Medicine. 11th ed. Oxford: Blackwell Publishing Ltd, 2005: Busch MP, Korelitz JJ, Kleinman SH, Lee SR, AuBuchon JP, Schreiber GB. Declining value of alanine aminotransferase in screening of blood donors to prevent posttransfusion hepatitis B and C virus infection. The Retrovirus Epidemiology Donor Study. Transfusion 1995; 35: [PMID: DOI: /j x] 24 Barrera JM, Francis B, Ercilla G, Nelles M, Achord D, Darner J, Lee SR. Improved detection of anti-hcv in post-transfusion hepatitis by a third-generation ELISA. Vox Sang 1995; 68: [PMID: DOI: /j tb02538.x] 25 Couroucé AM, Pillonel J. Transfusion-transmitted viral infections. Retrovirus and Viral Hepatitis Working Groups of the French Society of Blood Transfusion. N Engl J Med 1996; 335: [PMID: ] 26 Peterson J, Green G, Iida K, Caldwell B, Kerrison P, Bernich S, Aoyagi K, Lee SR. Detection of hepatitis C core antigen in the antibody negative window phase of hepatitis C infection. Vox Sang 2000; 78: [PMID: DOI: /j x] 27 Grant PR, Sims CM, Tedder RS. Quantification of HCV RNA levels and detection of core antigen in donations before seroconversion. Transfusion 2002; 42: [PMID: DOI: /j x] 28 Couroucé AM, Le Marrec N, Bouchardeau F, Razer A, Maniez M, Laperche S, Simon N. Efficacy of HCV core antigen detection during the preseroconversion period. Transfusion 2000; 40: [PMID: DOI: /j x] 29 Gu S, Liu J, Zhang H, Gu B, Lai H, Zhou H, He C, Chen Y. Core antigen tests for hepatitis C virus: a meta-analysis. Mol Biol Rep 2012; 39: [PMID: DOI: / s z] 30 Xie L, Wu XD, Huang DZ, Chen HL, He LX, Wang J, Han DK. Clinical application and analysis of hepatitis C virus NS3 antigen detection by ELISA in human serum. Chin Med J (Engl) 2007; 120: [PMID: ] 31 Busch MP, Kleinman SH. Hepatitis C infection: recent insights relevant to transfusion safety. ISBT Sci Ser 2009; 4: [DOI: /j x] 32 Lagardère B. [Future vaccines in parasitology]. Bull Soc Pathol Exot 1991; 84: [PMID: ] 33 Laperche S, Le Marrec N, Girault A, Bouchardeau F, Servant- Delmas A, Maniez-Montreuil M, Gallian P, Levayer T, Morel P, Simon N. Simultaneous detection of hepatitis C virus (HCV) core antigen and anti-hcv antibodies improves the early detection of HCV infection. J Clin Microbiol 2005; 43: [PMID: DOI: /JCM ] 34 Laperche S, Elghouzzi MH, Morel P, Asso-Bonnet M, Le Marrec N, Girault A, Servant-Delmas A, Bouchardeau F, Deschaseaux M, Piquet Y. Is an assay for simultaneous detection of hepatitis C virus core antigen and antibody a valuable alternative to nucleic acid testing? Transfusion 2005; 45: [PMID: DOI: /j x] 35 Jourbert JJ, Dewar JB, Weinberg J, De Beer M, Parker JS, Steele AD. A cost-effective particle agglutination assay to detect viral antibodies in dried blood spots--a simple solution to HIV and HCV screening. Cent Afr J Med 2003; 49: [PMID: ] 36 Daniel HD, Abraham P, Raghuraman S, Vivekanandan P, Subramaniam T, Sridharan G. Evaluation of a rapid assay as an alternative to conventional enzyme immunoassays for detection of hepatitis C virus-specific antibodies. J Clin Microbiol 2005; 43: [PMID: DOI: / JCM ] 37 Montebugnoli L, Borea G, Miniero R, Sprovieri G. A rapid test for the visual detection of anti-hepatitis C virus antibodies in whole blood. Clin Chim Acta 1999; 288: [PMID: DOI: /S (99) ] 38 Desbois D, Vaghefi P, Savary J, Dussaix E, Roque-Afonso AM. Sensitivity of a rapid immuno-chromatographic test for hepatitis C antibodies detection. J Clin Virol 2008; 41: [PMID: DOI: /j.jcv ] 39 Laperche S. Multinational assessment of blood-borne virus testing and transfusion safety on the African continent. Transfusion 2013; 53: [PMID: DOI: / j x] 40 Levi JE. Current concepts in molecular testing. ISBT Sci Ser 2011; 6: [DOI: /j x] 41 Roth WK, Seifried E. The German experience with NAT. Transfus Med 2002; 12: [PMID: DOI: / j x] 42 Schmidt M, Seifried E. Current concepts in serological testing - TTID. ISBT Sci Ser 2011; 6: [DOI: /j x] 43 Roth WK, Busch MP, Schuller A, Ismay S, Cheng A, Seed CR, Jungbauer C, Minsk PM, Sondag-Thull D, Wendel S, Levi JE, Fearon M, Delage G, Xie Y, Jukic I, Turek P, Ullum H, Tefanova V, Tilk M, Reimal R, Castren J, Naukkarinen M, Assal A, Jork C, Hourfar MK, Michel P, Offergeld R, Pichl L, Schmidt M, Schottstedt V, Seifried E, Wagner F, Weber-Schehl M, Politis C, Lin CK, Tsoi WC, O Riordan J, Gottreich A, Shinar E, Yahalom V, Velati C, Satake M, Sanad N, Sisene I, Bon AH, Koppelmann M, Flanagan P, Flesland O, Brojer E, Lętowska M, Nascimento F, Zhiburt E, Chua SS, Teo D, Stezinar SL, Vermeulen M, Reddy R, Park Q, Castro E, Eiras A, Gonzales Fraile I, Torres P, Ekermo B, Niederhauser C, Chen H, Oota S, Brant LJ, Eglin R, Jarvis L, Mohabir L, Brodsky J, Foster G, Jennings C, Notari E, Stramer S, Kessler D, Hillyer C, Kamel H, Katz L, Taylor C, Panzer S, Reesink HW. International survey on NAT testing of blood donations: expanding implementation and yield from 1999 to Vox Sang 2012; 102: [PMID: DOI: /j x] 44 Assal A, Barlet V, Deschaseaux M, Dupont I, Gallian P, Guit March 21, 2014 Volume 20 Issue 11

235 Marwaha N et al. Testing strategies for HCV ton C, Morel P, David B, De Micco P. Comparison of the analytical and operational performance of two viral nucleic acid test blood screening systems: Procleix Tigris and cobas s 201. Transfusion 2009; 49: [PMID: DOI: /j x] 45 Roth WK, Weber M, Buhr S, Drosten C, Weichert W, Sireis W, Hedges D, Seifried E. Yield of HCV and HIV-1 NAT after screening of 3.6 million blood donations in central Europe. Transfusion 2002; 42: [PMID: DOI: / j x] 46 Busch MP, Glynn SA, Stramer SL, Strong DM, Caglioti S, Wright DJ, Pappalardo B, Kleinman SH. A new strategy for estimating risks of transfusion-transmitted viral infections based on rates of detection of recently infected donors. Transfusion 2005; 45: [PMID: DOI: / j x] 47 Zou S, Dorsey KA, Notari EP, Foster GA, Krysztof DE, Musavi F, Dodd RY, Stramer SL. Prevalence, incidence, and residual risk of human immunodeficiency virus and hepatitis C virus infections among United States blood donors since the introduction of nucleic acid testing. Transfusion 2010; 50: [PMID: DOI: /j x] 48 Candotti D, Allain JP. Molecular virology in transfusion medicine laboratory. Blood Transfus 2013; 11: [PMID: ] 49 World Health Organisation - Blood safety. Key global fact and figures in Last accessed 26 September Available from: URL: index.html 50 El Ekiaby M, Laperhe S, Moftah M, Burnouf T, Lelie N. The impact of different HCV blood screening technologies on the reduction of transfusion transmitted HCV infection in Egypt. Vox Sang 2009; 96 Suppl 1: Makroo RN, Choudhury N, Jagannathan L, Parihar-Malhotra M, Raina V, Chaudhary RK, Marwaha N, Bhatia NK, Ganguly AK. Multicenter evaluation of individual donor nucleic acid testing (NAT) for simultaneous detection of human immunodeficiency virus -1 & amp; hepatitis B & amp; C viruses in Indian blood donors. Indian J Med Res 2008; 127: [PMID: ] 52 Chatterjee K, Coshic P, Borgohain M, Premchand RM, Chakroborty S, Sunder S. Individual donor nucleic acid testing for blood safety against HIV-1 and hepatitis B and C viruses in a tertiary care hospital. Natl Med J India 2012; 25: [PMID: ] 53 Shang G, Seed CR, Wang F, Nie D, Farrugia A. Residual risk of transfusion-transmitted viral infections in Shenzhen, China, 2001 through Transfusion 2007; 47: [PMID: DOI: /j x] 54 Stramer SL, Hollinger FB, Katz LM, Kleinman S, Metzel PS, Gregory KR, Dodd RY. Emerging infectious disease agents and their potential threat to transfusion safety. Transfusion 2009; 49 Suppl 2: 1S-29S [PMID: DOI: / j x] 55 Teo D, Lam S. Pathogen inactivation. ISBT Sci Ser 2011; 6: [DOI: /j x] 56 Mufti NA, Erickson AC, North AK, Hanson D, Sawyer L, Corash LM, Lin L. Treatment of whole blood (WB) and red blood cells (RBC) with S-303 inactivates pathogens and retains in vitro quality of stored RBC. Biologicals 2010; 38: [PMID: DOI: /j.biologicals ] 57 Goodrich RP, Doane S, Reddy HL. Design and development of a method for the reduction of infectious pathogen load and inactivation of white blood cells in whole blood products. Biologicals 2010; 38: [PMID: DOI: /j.biologicals ] P- Reviewers: Kelesidis T, Rajeshwari K, Snyder N S- Editor: Gou SX L- Editor: A E- Editor: Liu XM 2954 March 21, 2014 Volume 20 Issue 11

236 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus TOPIC HIGHLIGHT Updates on the treatment and outcomes of dual chronic hepatitis C and B virus infection Chun-Jen Liu, Pei-Jer Chen Chun-Jen Liu, Pei-Jer Chen, Graduate Institute of Clinical Medicine, Department of Internal Medicine, and Hepatitis Research Center, National Taiwan University College of Medicine and National Taiwan University Hospital, Taipei 10002, Taiwan Author contributions: Liu CJ and Chen PJ designed review; Liu CJ prepared the manuscript; Chen PJ gave critical review and approval. Supported by Grants from the National Taiwan University; Department of Health, Executive Yuan, Taiwan; and Taiwan Liver Disease Consortium (TLC), National Research Program for Biopharmaceuticals (NRPB), Taiwan, NSC B Correspondence to: Pei-Jer Chen, MD, PhD, Distinguished Professor, Graduate Institute of Clinical Medicine, Department of Internal Medicine, and Hepatitis Research Center, National Taiwan University College of Medicine and National Taiwan University Hospital, Chang-Te Street, Taipei 10002, Taiwan. peijerchen@ntu.edu.tw Telephone: Fax: Received: September 25, 2013 Revised: December 26, 2013 Accepted: January 14, 2014 Published online: March 21, 2014 Abstract Dual hepatitis C virus (HCV)/hepatitis B virus (HBV) infection is found in HBV or HCV endemic areas, and in specific populations exhibiting a high risk of parenteral viral transmission. Clinical observations have revealed that HCV/HBV dually infected patients demonstrate a higher risk of liver disease progression compared with HBV or HCV monoinfected patients. The viral activity responsible for liver disease progression can be determined by examining the viral loads of HCV and HBV and by conducting liver biopsy examinations. Recent trials have confirmed that the combination therapy of peginterferon alpha-2a or 2b and ribavirin for dual hepatitis patients with HCV dominance appears to be as effective and safe as it is in patients with HCV monoinfections. Strikingly, approximately 60% of dually infected patients with inactive hepatitis B before treatment develop HBV reactivation after the clearance of the HCV. The clinical significance of this HBV reactivation and the strategy to prevent and treat this event should be determined. Furthermore, approximately 30% of dually infected patients lost hepatitis B surface antigen (HBsAg) within 5 years after the start of peginterferonbased therapy, and 40% of them harbored occult HBV infection. The underlying mechanisms of their accelerating HBsAg seroclearance and the development of occult HBV await further investigations. Moreover, the optimal treatment strategies for dually infected patients who are seropositive for the hepatitis B e antigen must be explored. Finally, the advent of new direct-acting antiviral-based anti-hcv therapy may change the optimal therapies for patients with dual hepatitis in the near future, which warrants further clinical trials Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Dual infection; Hepatitis B virus; Hepatitis C virus; Interferon; Pegylated interferon; Ribavirin; Sustained virological response; Hepatitis B surface antigen clearance Core tip: Patients with dual hepatitis C virus (HCV)/hepatitis B virus (HBV) infections have a higher risk of liver disease progression compared with patients with HBV or HCV monoinfections. The combination peginterferon alpha/ribavirin treatment for dual hepatitis patients with HCV dominance appears to be just as effective in the clearance of HCV RNA and safe as it is in patients with HCV monoinfections. The durability of HCV response was 97%. Furthermore, approximately 30% of dually infected patients lost hepatitis B surface antigen within 5 years after the start of peginterferon-based therapy. A population-based study revealed the benefits of combination therapy in the improvement of long-term outcomes in dually infected patients. Liu CJ, Chen PJ. Updates on the treatment and outcomes of dual 2955 March 21, 2014 Volume 20 Issue 11

237 Liu CJ et al. Treatment updates on dual HCV/HBV chronic hepatitis C and B virus infection. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/2955.htm DOI: org/ /wjg.v20.i dually infected patients. In the next scenario, we may provide treatment to control the virus that is likely responsible for liver injury in most patients; or we may prioritize the treatment of the virus most responsive to antiviral therapy. INTRODUCTION Most patients with chronic hepatitis C have a hepatitis C virus (HCV) monoinfection. However, in areas where the hepatitis B virus (HBV) is endemic, a substantial proportion of the patients are coinfected with hepatitis C and B [1-3]. If the prevalence of anti-hcv positivity worldwide is approximately 1%-4% in the general population, the number of individuals with HCV/HBV dual infection among the 320 million HBV carriers would be approximately million. Moreover, HCV/HBV dual infections can also be found in people at risk of parenteral hepatotropic viral transmissions such as people who use intravenous drugs, patients with thalassemia and patients with hemophilia. In patients with dual chronic hepatitis B and C, the disease outcomes, including the development of liver cirrhosis (LC) and hepatocellular carcinoma (HCC), are generally more severe than those in patients with either hepatitis B or hepatitis C [1-8]. In additional to these crosssectional data, a long-term community-based study was conduced and the results confirmed the effect of dual HCV/HBV infections on the cumulative incidences of HCC [9]. Therefore, patients dually infected with hepatitis C and B need attention and require effective antiviral treatments. The treatment priorities in patients with dual viral infections can be determined by analyzing the relative viral activity of both viruses [10]. Data from recent clinical trials suggested that pegylated interferon (Peg-IFN) alpha plus ribavirin (RBV) is effective in the clearance of HCV in dually infected patients with active hepatitis C [11-14] ; the HCV sustained virologic response (SVR) was durable in approximately 97% of the patients during a 5-year posttreatment follow-up [15]. By contrast, the optimal treatment strategy for dually infected patients with active hepatitis B is still unknown. The current data concerning the treatment and outcomes of patients with dual chronic hepatitis C and B will be summarized in this review article. TREATMENT STRATEGIES FOR DUAL HBV AND HCV INFECTIONS The primary goal of the treatment of HCV and HBV dual infections is to eliminate or permanently suppress both viruses. In the meantime, the long-term goal is to reduce or terminate hepatic necroinflammation, prevent progression to LC and the development of HCC, and ultimately prolong the survival of patients [16,17]. We hope to achieve these goals by eradicating both viruses after providing an effective antiviral therapy for VIROLOGIC PROFILES AND THE SELECTION OF VIRAL TARGET(S) FOR TREATMENT A previous study revealed that active hepatitis C can be found in more than 50% of dually infected patients [10]. Besides, HCV can be successfully eradicated in approximately 70% of the patients with chronic HCV monoinfection using Peg-IFN plus RBV combination therapy [16,17]. Accordingly, HCV infection seems to be the priority treatment target in dually infected patients with active hepatitis C. Although this may be true among Asian populations, SVR rates are lower in people from Caucasian populations with the genotype 1 disease, partially because of the differences in IL-28 genotype distribution. TREATMENT OF PATIENTS WITH DUAL CHRONIC HEPATITIS C/B AND ACTIVE HEPATITIS C USING PEG-IFN PLUS RIBAVIRIN In the treatment of chronic hepatitis C monoinfections, interferon (IFN) plus RBV or Peg-IFN plus RBV was effective in clearing the HCV [18,19], and the latter remains the standard of care in many Asian-Pacific countries. Recently, the efficacy of IFN plus RBV or Peg-IFN plus RBV in the treatment of dually infected patients with active hepatitis C was confirmed [11,15,20-22]. The treatment outcomes at the end of treatments and during posttreatment follow ups are shown in Figure 1A. Six months after the end of treatment, the HCV SVR rates were generally similar between dually infected patients and HCV monoinfected patients who had genotype 1 or genotype 2/3 infection. A satisfactory HCV SVR rate obtained by treating dual HBV/HCV infections by using Peg-IFN alpha-2b plus RBV was also documented in a series of 19 German patients [14] and in other small cohorts [12,13]. DURABILITY OF THE HCV RESPONSE The clearance of HCV RNA at 6 mo after the end of treatment may indicate that an HCV infection is cured. Previous studies demonstrated that 0.9%-10% of single chronic hepatitis C patients from whom virologic responses (VRs) were obtained after the end of the treatment developed a hepatitis C relapse [23]. To address this issue, the durability of hepatitis C clearance in HCV-monoinfected and HCV/HBV dually infected patients was investigated 2956 March 21, 2014 Volume 20 Issue 11

238 Liu CJ et al. Treatment updates on dual HCV/HBV A 100 Peg-IFNα-2a 180 µg/wk + RBV mg/d for 48 wk Peg-IFNα-2a 180 µg/wk + RBV 800 mg/d for 24 wk B 100 HCV SVR (%) n = HCV genotype 1 HCV genotype 2/3 HCV genotype 1 HCV genotype 2/3 Patients with durable HCV SVR (%) n = HCV HCV HCV genotype 1 genotype 2/3 genotype 1 HCV genotype 2/3 HCV mono infection HBV-HCV co-infection HCV mono infection HBV-HCV co-infection Figure 1 The treatment of patients with dual chronic hepatitis C/B and the durability of the hepatitis C virus response. A: Hepatitis C virus (HCV) sustained virologic response (SVR) rate at 6 mo after end of peg-interferon plus ribavirin combination treatment; B: Durability of HCV SVR in patients who initially obtained HCV SVR at 6 mo after end of therapy. Median 4.6-years (range: 1-5 years) post-treatment follow-up. SVR: Sustained virologic response; Peg-IFN: Peg-interferon; RBV: Ribavirin. by conducting a 5-year prospective follow-up study [15]. The findings revealed that after a median follow-up of 4.6 ± 1.0 years, HCV RNA reappearance developed in only 6 (2.6%) of the 232 patients who achieved SVR (Figure 1B). This suggests that the durability of the HCV SVR obtained by using Peg-IFN alpha and RBV therapy was satisfactory and not influenced by HBV coinfections. HBV RESPONSE AND REACTIVATION Peg-IFN is one of the first-line choices for the treatment of chronic hepatitis B [24,25]. Thus, in addition to the cure of HCV infections, Peg-IFN-based therapy may also be used to help control chronic HBV infections in patients with dual HCV/HBV infections. Remarkably, we found that hepatitis B surface antigen (HBsAg) disappeared 6 months after the end of therapy in 18 (11.2%) of the 161 dually infected patients [11]. During a 5-year posttreatment follow-up, the rate of HBsAg seroclearance was 5.4% per year [15]. Among the analyzed baseline variables, only low pretreatment serum HBsAg levels substantially correlated with sustained HBsAg seroclearance during follow-up (P < 0.05) [15,26]. In addition to HBsAg loss, VR was also analyzed in this study. Before treatment, the serum HBV DNA level was > 200 IU/mL in 62 patients (45.7%) of a long-term followup subcohort [15]. Five years after the end of treatment, HBV VR was obtained in 33 (53.2%) of the 62 patients; the serum HBV DNA level was < 80 IU/mL in 32 of the 33 patients. Serum HBsAg seroclearance regularly occurred in patients who developed HBV VR (51.5%, 17/33). The reactivation of HBV activity is another clinical concern in dually infected patients receiving anti-hcv therapy [27]. Of 76 patients with pretreatment serum HBV DNA levels < 200 IU/mL, the reactivation of HBV DNA was found in 47 (61.8%) patients; either during the course of treatment (n = 18, 38.3%) or during the posttreatment follow-up (n = 29, 61.7%) [15]. Reactivation was merely transient in 21 (44.7%) of the 47 patients. Serum HBsAg seroclearance was found in 18 (62.1%) of the 29 patients without hepatitis B reactivation. The elevation of serum ALT levels was noted in some patients with HBV reactivation; effective anti-hbv therapy should be provided for these patients if clinically indicated. TREATMENT OF HEPATITIS B IN PATIENTS WITH DUAL CHRONIC C/B AND ACTIVE HEPATITIS B Our study data confirmed that Peg-IFN alpha-2a plus RBV successfully treats patients with active hepatitis C who are also coinfected with HBV. However, whether this approach is suitable for dually infected patients with active HBV infections is unknown. In an earlier report, 8 patients with dual chronic hepatitis C and hepatitis B e antigen (HBeAg)-positive chronic hepatitis B were treated using a combination of IFN and lamivudine [28]. After treatment, 3 patients (37.5%) lost HBeAg, 3 (37.5%) achieved undetectable HBV DNA, and 4 patients (50%) had a sustained clearance of HCV RNA at 12 months. This small series suggested that combining lamivudine with IFN might be helpful in dually infected patients with chronic hepatitis C and active HBV replication. Theoretically, we may also use a combination of Peg-IFN alpha, RBV, and nucleos(t)ide analogues to treat both viruses at the same time; this strategy awaits further investigation. TREATMENT OF DUALLY INFECTED PATIENTS WITH ESTABLISHED LIVER CIRRHOSIS Patients with dual chronic HCV/HBV and established 2957 March 21, 2014 Volume 20 Issue 11

239 Liu CJ et al. Treatment updates on dual HCV/HBV LC may not tolerate Peg-IFN plus RBV combination therapy. For this group of patients with evidence of HBV replication, the tolerability and effects of anti-hbv nucleos(t)ide analogues have been evaluated in a small cohort [29]. Coppola et al [29] used nucleos(t)ide analogues to treat 24 HBV DNA-positive patients with LC and HBV/ HCV dual infections, defined by positivity for HBsAg, serum HBV DNA, and anti-hcv. At the 18th month of treatment, 23 (96%) patients had undetectable serum HBV DNA. However, a deterioration of liver reserve was observed in 8 (47%) of the 17 patients who were HCV RNA-positive at the baseline. These data suggested a favorable HBV virological effect in all HBV/HCV dually infected patients; but favorable clinical results were only observed in patients who were HCV-RNA negative before treatment. Therefore, the efficacy of these strategies remains unknown without being applied in large clinical trials. IMPROVEMENT OF LONG-TERM CLINICAL OUTCOMES The reduction of HCC development, overall mortality, and liver-related mortality In patients with HCV monoinfections, successful anti- HCV therapy has been demonstrated to effectively decrease the incidence of newly developed HCC and liverrelated mortality [30]. Whether an anti-hcv therapy using Peg-IFN plus RBV could obtain similar effects in HCV/ HBV dually infected patients was investigated in a hospital-based cohort [31]. A total of 135 dually infected patients with active hepatitis C receiving IFN or Peg-IFN plus RBV therapy were enrolled. The cumulative incidence of HCC was compared with that of 1470 HCV-monoinfected patients. Dual infection was an independent factor for HCC development. In dually infected patients, age (HR = 1.175, 95%CI: , P = 0.001) and non-hcv SVR (HR = 7.874, 95%CI: , P = 0.001) were independent factors for HCC development. Four (4.2%) of the 96 dually infected patients with HCV SVR developed HCC after a mean follow-up of 4.6 years (annual rate of HCC development: 0.91%); 11 (28.2%) of the 39 patients with HCV SVR developed HCC after a mean follow-up of 3.5 years (annual rate: 8.1%). Moreover, the rate of HCC development was lower in patients with serum HBV DNA levels < 2000 IU/mL at the end of treatment or follow-up compared with those with HBV DNA levels 2000 IU/mL (P < 0.05). These findings supported that HCV SVR achieved by treating with IFN or Peg-IFN plus RBV therapy may significantly reduce HCC in HBV/HCV dually infected patients, whereas the persistence or reactivation of the HBV dampens the benefits of HCV SVR. The benefits of anti-hcv therapy in dually infected patients was confirmed in another large population-based survey in Taiwan [32]. We found that, compared with the patients in an untreated dually infected cohort, the risk of developing HCC, all-cause mortality, and liver-related mortality decreased by 35%, 62%, and 59%, respectively, in patients who received active anti-hcv therapy. Despite the control or eradication of hepatitis virus after treatment, patients may be still at risk of developing advanced liver diseases, including HCC. In our long-term follow-up of the treatment cohort, 9 patients developed HCC [15]. At baseline, 8 (88.9%) of the 9 patients had dual HCV/HBV infections, and only 1 (11.1%) had HCV monoinfection. After treatment, 7 obtained HCV SVR during long term follow-up, and 3 developed seroclearance of HBsAg. Five (55.6%) of the 9 patients had established LC before treatment. This data suggested that some subjects with dual infections still developed HCC after obtaining HCV SVR and even HBsAg seroclearance posttreatment. Therefore, in addition to active antiviral therapy, regular examinations for the occurrence of HCC should be performed in these dually infected patients. HOST AND VIRAL FACTORS AFFECTING TREATMENT OUTCOMES The outcomes of chronic viral hepatitis B and C are possibly determined by both host and viral genomic factors. The effects of certain viral factors (including HCV genotype, HBV genotype, HCV interferon sensitivity determining region polymorphisms, and HBV precore/basal core promoter subgenomic polymorphisms) and host factors (including mir-122 expression and IL28B genotype) on the clinical outcomes of dually infected patients are only partially ascertained. Factors associated with the seroclearance of HBsAg Among the baseline and end-of-treatment variables analyzed in our treatment cohort, only low serum HBsAg levels substantially correlated with sustained HBsAg seroclearance during follow-up (P < 0.05) [11,15]. Baseline hepatitis B viral load did not correlate with HBsAg seroclearance. A subgroup analysis revealed that serum HBsAg seroclearance occurred in 17 (51.5%) of the 33 patients with HBV VR, but in none of the remaining 29 patients without HBV VR. In another study, the host genetic factors associated with spontaneous HBsAg seroclearance were identified [33]. In this case-control study, we collected 100 CHB patients who lost HBsAg spontaneously and 100 matched patients without HBsAg loss. Baseline viral factors including viral load, HBV genotype, and HBsAg level, as well as host genetic factors, including 2 single nucleotide polymorphisms (rs3077 for the HLA-DPA1 region and rs for the HLA-DPB1 region) were investigated. We found that a low baseline ALT, serum HBsAg level, HBV DNA level, and rs non-gg genotype frequency are associated with a higher likelihood of spontaneous HBsAg seroclearance in chronic hepatitis B patients. Factors associated with the development of occult HBV infection in patients with seroclearance of HBsAg Occult HBV infection (OBI) may exist in patients expe March 21, 2014 Volume 20 Issue 11

240 Liu CJ et al. Treatment updates on dual HCV/HBV Table 1 Proposed strategies for the treatment of patients positive for both anti-hepatitis C virus and hepatitis B surface antigen HCV RNA HBV activity Treatment goals Potential strategies Level of evidence Potential benefit of DAA-added therapy Detectable < 2000 IU/mL Cure of HCV infection P + R Large multicenter trial Detectable 2000 IU/mL Cure of HCV infection and potentially control of HBV infection Detectable 2000 IU/mL Cure of HCV infection and control of HBV infection Detectable or undetectable P + R Large multicenter trial 2000 IU/mL Control of HBV infection NUC Small case-control study Increase rate of hepatitis C virus (HCV) sustained virologic response (SVR) in naïve or experienced patients Increase rate of HCV SVR in naïve or experienced patients P + R + NUC Case report Increase rate of HCV SVR in naïve or experienced patients Uncertain, wait for interferon-free regimen Undetectable 2000 IU/mL Control of HBV infection P or NUC Case report None Undetectable < 2000 IU/mL Not necessary Clinical observation No None P: Peginterferon; R: Ribavirin; NUC: Nucleos(t)ide analogue; DAA: Direct-acting antiviral. riencing HBsAg seroclearance. We examined the clinical and virologic features of OBI in 15 dually infected patients who lost HBsAg posttreatment [34]. We found that the prevalence of OBI was 40% (6/15). One mutation, C3050T (pres1t68i), in the surface promoter/polymerase region was identified to be associated with the seroclearance of HBsAg in all 6 cases. This mutation does not change the amino acid sequence of the polymerase protein. The S-promoter activity was significantly lower in the construct containing the C3050T mutation compared with the wild-type (P = ). However, this mutation did not affect HBV replication, transcription, or translation in the context of the full-length HBV genome. Our data suggested that other factors may have more active roles in the clearance of HBsAg in these patients with OBI. Virologic factors associated with treatment outcomes The prevalence and distribution of precore/basal core promoter (BCP) mutations and HBV genotypes in HBV/HCV dually infected patients and their effects on the long-term HBV response of IFN-based therapy were investigated [35]. The HBV genotypes and sequences of the precore/bcp regions were determined in 180 HBV/ HCV dually infected patients and were compared with 90 age, sex, and HBeAg-matched chronic hepatitis B patients as the control group. Dually infected patients had a higher prevalence of genotype C HBV (P = 0.022) and a lower frequency of the G1896A mutation (P = 0.004) compared with those in the control group. Based on the Cox proportional hazards model, young age (HR = 0.952, P = 0.001), HCV SVR (HR = 4.638, P = 0.044), C1766T mutation (HR = 5.216, P = 0.003) and A1846T mutation (HR = 2.332, P = 0.031) correlated with HBV DNA reactivation after therapy. Age (HR = 1.068, P = 0.020), G1896A mutation (HR = 0.140, P = 0.01), and A1846T mutation (HR = 0.086, P = 0.018) were independently associated with HBsAg seroclearance. These data demonstrated that specific mutations in the precore/bcp regions could be useful in predicting the long-term HBV response in HBV/HCV dually infected patients receiving IFN-based therapy. INTERNATIONAL GUIDELINES OR RECOMMENDATIONS REGARDING THE TREATMENT OF PATIENTS WITH DUAL CHRONIC HEPATITIS C AND B In summary, the combination therapy of Peg-IFN alpha and RBV appears to be just as effective for the treatment of HBsAg-positive patients chronically infected with active hepatitis C as it is in patients with HCV monoinfections. The treatment recommendations regarding therapy duration according to genotype in HCV monoinfections appear to be applicable for this patient group as well [18,19]. CONCLUSION HBV/HCV dual infection is not uncommon in endemic areas and among subjects at risk of parenterally transmissible infections. How 2 viruses interact with each other in the same liver awaits further in situ and in vitro studies. Apart from academic interests, these data can be used to develop more effective antiviral therapies. Before the administration of antiviral therapy, thorough serological and virological examinations are required to determine the viral dominance and determine the optimal antiviral regimen. For dually infected patients with active hepatitis C, the same genotype-dependent treatment recommendations for single chronic hepatitis C remain valid. Another intriguing matter concerns the role of IL28B genotypes in the natural course and treatment responses of dual hepatitis patients. The IL28B was effectively influenced in the Peg-IFN therapy for single hepatitis C, but it might also be involved in hepatitis B surface antigen clearance in single hepatitis B. Whether IL28B genotypes participate in the host interactions with HBV and HCV and the outcomes deserves further investigation in a larger group of patients with dual hepatitis. The prevention and management of HBV reactivation in dually infected patients receiving Peg-IFN-based therapy should be investigated. Moreover, the treatment outcomes using a similar Peg-IFN/RBV combination regimen in other ethnic groups and populations exhibit March 21, 2014 Volume 20 Issue 11

241 Liu CJ et al. Treatment updates on dual HCV/HBV ing different chronologic sequences of HCV and HBV infections should be evaluated [36,37]. For patients with active hepatitis B, more studies are necessary to determine the optimal regimen to treat both viruses (Table 1). The host and viral factors affecting the natural and treatment outcomes of patients with dual chronic HCV/HBV should be identified. Finally, the value of direct-acting antiviral-based therapy in treating HCV/HBV dually infected patients seems promising; however, the extent of its efficacy requires further clarification. REFERENCES 1 Liu CJ, Liou JM, Chen DS, Chen PJ. Natural course and treatment of dual hepatitis B virus and hepatitis C virus infections. J Formos Med Assoc 2005; 104: [PMID: ] 2 Chen DS, Kuo GC, Sung JL, Lai MY, Sheu JC, Chen PJ, Yang PM, Hsu HM, Chang MH, Chen CJ. Hepatitis C virus infection in an area hyperendemic for hepatitis B and chronic liver disease: the Taiwan experience. J Infect Dis 1990; 162: [PMID: DOI: /infdis/ ] 3 Liu CJ, Chen PJ, Shau WY, Kao JH, Lai MY, Chen DS. Clinical aspects and outcomes of volunteer blood donors testing positive for hepatitis-c virus infection in Taiwan: a prospective study. Liver Int 2003; 23: [PMID: DOI: /j x] 4 D Amelio R, Matricardi PM, Biselli R, Stroffolini T, Mele A, Spada E, Chionne P, Rapicetta M, Ferrigno L, Pasquini P. Changing epidemiology of hepatitis B in Italy: public health implications. Am J Epidemiol 1992; 135: [PMID: ] 5 Crespo J, Lozano JL, de la Cruz F, Rodrigo L, Rodríguez M, San Miguel G, Artiñano E, Pons-Romero F. Prevalence and significance of hepatitis C viremia in chronic active hepatitis B. Am J Gastroenterol 1994; 89: [PMID: ] 6 Treitinger A, Spada C, Ferreira LA, Neto MS, Reis M, Verdi JC, de Miranda AF, de Oliveira OV, Van der Sander Silveira M, Abdalla DS. Hepatitis B and hepatitis C prevalence among blood donors and HIV-1 infected patients in Florianópolis- -Brazil. Braz J Infect Dis 2000; 4: [PMID: ] 7 Liaw YF, Chen YC, Sheen IS, Chien RN, Yeh CT, Chu CM. Impact of acute hepatitis C virus superinfection in patients with chronic hepatitis B virus infection. Gastroenterology 2004; 126: [PMID: DOI: / j.gastro ] 8 Donato F, Boffetta P, Puoti M. A meta-analysis of epidemiological studies on the combined effect of hepatitis B and C virus infections in causing hepatocellular carcinoma. Int J Cancer 1998; 75: [PMID: ] 9 Huang YT, Jen CL, Yang HI, Lee MH, Su J, Lu SN, Iloeje UH, Chen CJ. Lifetime risk and sex difference of hepatocellular carcinoma among patients with chronic hepatitis B and C. J Clin Oncol 2011; 29: [PMID: DOI: /JCO ] 10 Raimondo G, Brunetto MR, Pontisso P, Smedile A, Maina AM, Saitta C, Squadrito G, Tono N. Longitudinal evaluation reveals a complex spectrum of virological profiles in hepatitis B virus/hepatitis C virus-coinfected patients. Hepatology 2006; 43: [PMID: DOI: /hep.20944] 11 Liu CJ, Chuang WL, Lee CM, Yu ML, Lu SN, Wu SS, Liao LY, Chen CL, Kuo HT, Chao YC, Tung SY, Yang SS, Kao JH, Liu CH, Su WW, Lin CL, Jeng YM, Chen PJ, Chen DS. Peginterferon alfa-2a plus ribavirin for the treatment of dual chronic infection with hepatitis B and C viruses. Gastroenterology 2009; 136: e3 [PMID: DOI: / j.gastro ] 12 Uyanikoglu A, Akyuz F, Baran B, Simsek BP, Ermis F, Demir K, Gulluoglu M, Badur S, Kaymakoglu S. Co-infection with hepatitis B does not alter treatment response in chronic hepatitis C. Clin Res Hepatol Gastroenterol 2013; 37: [PMID: ] 13 Kim YJ, Lee JW, Kim YS, Jeong SH, Kim YS, Yim HJ, Kim BH, Lee CK, Park CK, Park SH. Clinical features and treatment efficacy of peginterferon alfa plus ribavirin in chronic hepatitis C patients coinfected with hepatitis B virus. Korean J Hepatol 2011; 17: [PMID: DOI: / kjhep ] 14 Potthoff A, Wedemeyer H, Boecher WO, Berg T, Zeuzem S, Arnold J, Spengler U, Gruengreiff K, Kaeser T, Schuchmann M, Bergk A, Forestier N, Deterding K, Manns MP, Trautwein C. The HEP-NET B/C co-infection trial: A prospective multicenter study to investigate the efficacy of pegylated interferon-alpha2b and ribavirin in patients with HBV/HCV co-infection. J Hepatol 2008; 49: [PMID: DOI: /j.jhep ] 15 Yu ML, Lee CM, Chen CL, Chuang WL, Lu SN, Liu CH, Wu SS, Liao LY, Kuo HT, Chao YC, Tung SY, Yang SS, Kao JH, Su WW, Lin CL, Yang HC, Chen PJ, Chen DS, Liu CJ. Sustained hepatitis C virus clearance and increased hepatitis B surface antigen seroclearance in patients with dual chronic hepatitis C and B during posttreatment follow-up. Hepatology 2013; 57: [PMID: DOI: / hep.26266] 16 Liu CJ, Chen PJ, Chen DS. Dual chronic hepatitis B virus and hepatitis C virus infection. Hepatol Int 2009; 3: [PMID: DOI: /s ] 17 Chen DS. Fighting against viral hepatitis: lessons from Taiwan. Hepatology 2011; 54: [PMID: ] 18 European Association for the Study of the Liver. EASL Clinical Practice Guidelines: management of hepatitis C virus infection. J Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 19 Omata M, Kanda T, Yu ML, Lim SG, Jafri W, Tateishi R, Hamid SS, Chuang WL, Chutaputti A, Wei L, Sollano J, Sarin SK, Kao JH, McCaughan GW. APASL consensus statements and management algorithms for hepatitis C virus infection. Hepatol Int 2012; 6: [DOI: /s y] 20 Liu CJ, Chen PJ, Lai MY, Kao JH, Jeng YM, Chen DS. Ribavirin and interferon is effective for hepatitis C virus clearance in hepatitis B and C dually infected patients. Hepatology 2003; 37: [PMID: DOI: /jhep ] 21 Hung CH, Lee CM, Lu SN, Wang JH, Tung HD, Chen CH, Changchien CS. Combination therapy with interferon-alpha and ribavirin in patients with dual hepatitis B and hepatitis C virus infection. J Gastroenterol Hepatol 2005; 20: [PMID: DOI: /j x] 22 Chuang WL, Dai CY, Chang WY, Lee LP, Lin ZY, Chen SC, Hsieh MY, Wang LY, Yu ML. Viral interaction and responses in chronic hepatitis C and B coinfected patients with interferon-alpha plus ribavirin combination therapy. Antivir Ther 2005; 10: [PMID: ] 23 Swain MG, Lai MY, Shiffman ML, Cooksley WG, Zeuzem S, Dieterich DT, Abergel A, Pessôa MG, Lin A, Tietz A, Connell EV, Diago M. A sustained virologic response is durable in patients with chronic hepatitis C treated with peginterferon alfa-2a and ribavirin. Gastroenterology 2010; 139: [PMID: DOI: /j.gastro ] 24 European Association For The Study Of The Liver. EASL clinical practice guidelines: Management of chronic hepatitis B virus infection. J Hepatol 2012; 57: [PMID: ] 25 Liaw YF, Kao JH, Piratvisuth T, Chan HLY, Chien RN, Liu CJ, Gane E, Stephen Locarnini S, Lim SG, Han KH, Amarapurkar D, Cooksley G, Jafri W, Mohamed R, Hou JL, Chuang WL, Lesmana LA, Sollano JD, Suh DJ, Omata M. Asian- Pacific consensus statement on the management of chronic hepatitis B: a 2012 update. Hepatol Int 2012; 6: [DOI: 2960 March 21, 2014 Volume 20 Issue 11

242 Liu CJ et al. Treatment updates on dual HCV/HBV /s z] 26 Yu ML, Lee CM, Chuang WL, Lu SN, Dai CY, Huang JF, Lin ZY, Hu TH, Chen CH, Hung CH, Wang JH, Chen CL, Kao JH, Lai MY, Liu CH, Su TH, Wu SS, Liao LY, Kuo HT, Chao YC, Tung SY, Yang SS, Chen PJ, Liu CJ, Chen DS. HBsAg profiles in patients receiving peginterferon alfa-2a plus ribavirin for the treatment of dual chronic infection with hepatitis B and C viruses. J Infect Dis 2010; 202: [PMID: DOI: /653209] 27 Gordon SC, Sherman KE. Treatment of HBV/HCV coinfection: releasing the enemy within. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 28 Scott JD, Gretch DR. Molecular diagnostics of hepatitis C virus infection: a systematic review. JAMA 2007; 297: [PMID: DOI: /jama ] 29 Coppola N, Stanzione M, Messina V, Pisaturo M, De Pascalis S, Macera M, Tonziello G, Fiore M, Sagnelli C, Pasquale G, Sagnelli E. Tolerability and efficacy of anti-hbv nucleos(t)ide analogues in HBV-DNA-positive cirrhotic patients with HBV/HCV dual infection. J Viral Hepat 2012; 19: [PMID: DOI: /j x] 30 Yu ML, Lin SM, Chuang WL, Dai CY, Wang JH, Lu SN, Sheen IS, Chang WY, Lee CM, Liaw YF. A sustained virological response to interferon or interferon/ribavirin reduces hepatocellular carcinoma and improves survival in chronic hepatitis C: a nationwide, multicentre study in Taiwan. Antivir Ther 2006; 11: [PMID: ] 31 Hung CH, Lu SN, Wang JH, Hu TH, Chen CH, Huang CM, Lee CM. Sustained HCV clearance by interferon-based therapy reduces hepatocellular carcinoma in hepatitis B and C dually-infected patients. Antivir Ther 2011; 16: [PMID: DOI: /IMP1842] 32 Liu CJ, Chu YT, Shau WY, Kuo RN, Chen PJ, Lai MS. Treatment of patients with dual hepatitis C and B by peginterferon α and ribavirin reduced risk of hepatocellular carcinoma and mortality. Gut 2014; 63: [PMID: DOI: /gutjnl ] 33 Cheng HR, Liu CJ, Tseng TC, Su TH, Yang HI, Chen CJ, Kao JH. Host genetic factors affecting spontaneous HBsAg seroclearance in chronic hepatitis B patients. PLoS One 2013; 8: e53008 [PMID: DOI: /journal.pone ] 34 Cheng HR, Kao JH, Wu HL, Chen TC, Tseng TC, Liu CH, Su TH, Chen PJ, Chen DS, Liu CJ. Clinical and virological features of occult hepatitis B in patients with HBsAg seroclearance post-treatment or spontaneously. Liver Int 2013; Epub ahead of print [PMID: DOI: /liv ] 35 Hung CH, Chen CH, Lu SN, Wang JH, Hu TH, Huang CM, Tsai MC, Lee CM. Precore/core promoter mutations and hepatitis B virus genotype in hepatitis B and C dually infected patients treated with interferon-based therapy. Antiviral Res 2012; 93: [PMID: DOI: / j.antiviral ] 36 Nguyen LH, Ko S, Wong SS, Tran PS, Trinh HN, Garcia RT, Ahmed A, Lutchman GA, Keeffe EB, Nguyen MH. Ethnic differences in viral dominance patterns in patients with hepatitis B virus and hepatitis C virus dual infection. Hepatology 2011; 53: [PMID: DOI: / hep.24308] 37 Senturk H, Tahan V, Canbakan B, Uraz S, Ulger Y, Ozaras R, Tabak F, Mert A, Ozbay G. Chronic hepatitis C responds poorly to combination therapy in chronic hepatis B carriers. Neth J Med 2008; 66: [PMID: ] P- Reviewers: Abenavoli L, Acevedo JG, Bock T, Singal AG S- Editor: Gou SX L- Editor: A E- Editor: Zhang DN 2961 March 21, 2014 Volume 20 Issue 11

243 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Useful biomarkers for assessment of hepatitis C virus infection-associated autoimmune disorders TOPIC HIGHLIGHT Deng-Ho Yang, Ling-Jun Ho, Jenn-Haung Lai Deng-Ho Yang, Division of Rheumatology, Immunology and Allergy, Department of Internal Medicine, Taichung Armed- Forces General Hospital, Taichung 411, Taiwan Deng-Ho Yang, Institute of Medicine, Chung Shan Medical University, Taichung 402, Taiwan Ling-Jun Ho, Institute of Cellular and System Medicine, National Health Research Institute, Zhunan 350, Taiwan Jenn-Haung Lai, Graduate Institute of Medical Science, National Defense Medical Center, Taipei 114, Taiwan Jenn-Haung Lai, Division of Allergy, Immunology and Rheumatology, Department of Internal Medicine, Chang Gung Memorial Hospital, Chang Gung University, Taoyuan 333, Taiwan Author contributions: Yang DH drafted and wrote the article; Ho LJ revised the paper; and Lai JH wrote and approved the final version. Supported by (In part) the National Science Council, NSC B-182A-103-MY3; and Chang Gung Memorial Hospital, CMRPG3B1751E Correspondence to: Jenn-Haung Lai, MD, PhD, Division of Allergy, Immunology and Rheumatology, Department of Internal Medicine, Chang Gung Memorial Hospital, Chang Gung University, No.5, Fusing St., Gueishan Township, Taoyuan 333, Taiwan. laiandho@gmail.com Telephone: Fax: Received: September 25, 2013 Revised: November 10, 2013 Accepted: December 12, 2013 Published online: March 21, 2014 Abstract During the course of chronic hepatitis C virus (HCV) infection, various extrahepatic manifestations of autoimmune disorders may occur, including arthralgia/arthritis, sicca complex, purpura, cutaneous ulcer, and thyroid dysfunction. In addition, the prevalence of circulating autoantibodies is high among patients with HCV infection. Commonly detected autoantibodies in HCVinfected patients include rheumatoid factor, antinuclear antibody, anti-ssa/anti-ssb antibody, cryoglobulin, antineutrophil cytoplasmic antibody, anti-smooth muscle antibody, anti-liver and anti-thyroid autoantibodies. These autoantibodies may be associated with underlying autoimmune disorders or liver inflammation in HCV infection. A possible reason for antibody production is overactivation and proliferation of B lymphocytes, via the interaction with the surface protein of HCV. Because immunotherapy can cause HCV flare-up or liver damage, overdiagnosis of HCV-related autoimmune symptoms as primary autoimmune disorders should be avoided. This review describes biomarkers that are useful in clinically evaluating autoimmune manifestations and disorders associated with HCV infection Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis C virus; Autoantibody; Autoimmune; Biomarker; Cytokine Core tip: Patients with hepatitis C virus (HCV) infection may develop a variety of immunological manifestations simulating those observed in patients with autoimmune disorders. Concurrently, many laboratory abnormalities commonly present in autoimmune disorders may be detected. Overactivation and proliferation of B lymphocytes, via the interaction with the surface protein of HCV, contributes in part to these abnormalities. These clinical and laboratory findings can potentially mid-lead to the diagnosis of primary autoimmune disorders and result in inappropriate therapy. This review addresses the importance of several clinical and laboratory biomarkers and their usefulness in distinguishing HCV infection-related from primary autoimmune disorderrelated etiologies. Yang DH, Ho LJ, Lai JH. Useful biomarkers for assessment of hepatitis C virus infection-associated autoimmune disorders. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: March 21, 2014 Volume 20 Issue 11

244 Yang DH et al. HCV-related autoimmune biomarkers INTRODUCTION Hepatitis C virus (HCV) infection is a chronic liver disease, and its worldwide prevalence is approximately 2%-3% [1]. The immune system cannot completely clear HCV infection in most affected patients. Thus, a great proportion of chronic HCV-infected patients may end up developing liver cirrhosis or hepatocellular carcinoma. In addition to liver damage, numerous extrahepatic manifestations have been observed among patients with HCV infection. The general symptoms are fever, fatigue, and weakness, and these nonspecific clinical symptoms may be present even when liver function is normal and the virus load is low. Furthermore, autoimmune-related manifestations may develop, including arthritis, arthralgia, dry eye, dry mouth, myalgia, and skin eruption [2,3] (Table 1). Autoimmune diseases such as rheumatoid arthritis (RA), mixed cryoglobulinemia, systemic lupus erythematosus (SLE), Sjögren syndrome (SS) and autoimmune thyroiditis may sometimes co-exist with HCV infection [4-6]. Circulating autoantibodies have been found in about 50% of patients with chronic HCV infection [7]. Antiviral treatment is likely to be beneficial for autoimmunerelated manifestations [6]. Clinical manifestations and autoantibody profiles in chronic HCV infection can easily be misdiagnosed as classical autoimmune disorders. For example, polyarthritis or polyarthralgia of small joints, with positive rheumatoid factor (RF), may be present in individuals with HCV-related arthritis and can be confused with RA. In addition, dry eye and dry mouth with positive RF is easily misdiagnosed as primary SS. Moreover, cutaneous manifestations in patients with low titer of antinuclear antibody (ANA) or other autoantibodies, and hypocomplementemia may be over-diagnosed as SLE [8]. Because autoantibodies and autoimmune-like syndromes are frequent in patients with HCV infection, such patients must be carefully evaluated. This review will focus on the usefulness of these biomarkers in clinically evaluating patients with chronic HCV infection. PATHOGENESIS OF AUTOANTIBODY PRODUCTION HCV has a single positive-strand RNA genome and the envelope protein E2 on its surface. E2 can interact with CD81 receptors in hepatocytes, B and T lymphocytes, and thyroid cells and induce production of interleukin (IL)-8 [9,10]. In addition, the interaction between E2 and CD81 activates B lymphocytes to induce production of numerous immunoglobulins and autoantibodies. These autoantibodies may play roles in the pathogenesis of autoimmune disorders in chronic HCV infection [11]. Cryoglobulin is another autoantibody that can cause immune complex deposition or directly activate neutrophils to attack endothelial cells, through activating the complement system. The consequence of cryoglobulinemia can result in vasculitis-related skin ulcer and immune complexrelated glomerulonephropathy [9,12]. Table 1 Extrahepatic autoimmune-related signs and symptoms in patients with chronic hepatitis C virus infection Clinical manifestations Biological manifestations Autoantibodies Arthralgia/myalgia Arthritis Sicca syndrome Purpura Lymphadenopathy Pulmonary fibrosis Raynaud s phenomenon Fibromyalgia Thyroid dysfunction Cryoglobulinemia Autoimmune hemolytic anemia Thrombocytopenia Hypocomplementemia RF ANA Anti-SM and Anti-LKM1 antibody Anti-thyroglobulin and Anti-TPO antibody Anti-CL antibody RF: Rheumatoid factor; ANA: Anti-nuclear antibody; Anti-SM: Antismooth muscle; Anti-LKM1: Anti-liver kidney microsomal type 1; Anti- TPO: Anti-thyroid peroxidase; Anti-CL: Anti-cardiolipin. The presentation of E2 by antigen-presenting cells can activate helper T lymphocytes to produce proinflammatory cytokines and cause systemic inflammation in chronic HCV infection [13]. E2 may also directly interact with T cells to induce amplification of cytotoxic T cells [14,15]. The activation of immune system by virus or viral proteins finally leads to the production of many autoantibodies and clinical manifestations in patients with HCV infection. RF The autoantibody RF is directed against the Fc portion of immunoglobulin G (IgG). Patients with RA have a high rate of RF positivity; however, RF positivity is also a feature of other rheumatic diseases, including SLE, SS, mixed connective tissue disease, and polymyositis. Patients with chronic HCV infection may have RA-like polyarthralgia and polyarthritis with low RF titers. There is no difference in the prevalence of HCV infection between RA patients and the general population [16,17]. Nevertheless, RF positivity is more prevalent among patients with HCV infection compared to the general population [18]. RF production has been suggested due to activation of B lymphocytes resulting in antigen-dependent somatic hypermutation [19]. However, direct liver damage is not associated with RF induction in a murine model [20]. The titers of circulating RF have been shown to be associated with viral concentrations and antiviral therapy in patients with chronic HCV infection may reduce RF titers [21-23]. ANA Antinuclear antibody is a serologic biomarker that is useful for diagnosing patients with autoimmune or connective tissue diseases. ANA titers are low in 15%-30% 2963 March 21, 2014 Volume 20 Issue 11

245 Yang DH et al. HCV-related autoimmune biomarkers Table 2 Organ involvement in mixed cryoglobulinemia related to hepatitis C virus infection Organ Manifestations Skin Purpura Leg ulcers Leukocytoclastic vasculitis Nerve Mononeuritis multiplex Sensory-motor polyneuropathy Central nervous system vasculitis Kidney Type 1 membranoproliferative glomerulonephritis Vasculitis of small renal artery Gastrointestinal tract Mesenteric vasculitis Lung Interstitial pulmonary fibrosis Heart Mitral valvular damage Coronary vasculitis Pericarditis of patients with chronic HCV infection, among whom a dense fine speckled pattern is usually noted [24,25]. ANApositive compared to ANA-negative patients with HCV infection are older and have greater disease activity, higher serum immunoglobulin, and more advanced liver fibrosis [26-28]. HCV-infected patients with a centromeric ANA pattern and those with anticentromere antibodies typically have worse inflammation and hepatic fibrosis as compared with HCV-infected patients without ANA [29]. ANA positivity cannot be used to predict response to antiviral treatment [30,31] ; however, individuals with non-1 genotype HCV infection and a high ANA titer (> 1:80) have a more sustained virological response [31]. Interferon and ribavirin therapy is considered appropriate in ANApositive HCV-infected patients [32]. Inflammatory joint symptoms develop more frequently among ANA-positive patients [26,28]. Cryoglobulin Cryoglobulins are circulating immunoglobulins that form crystals in serum at temperatures lower than 37 and re-melt when the temperature is re-warmed. On the basis of immunochemical structure, cryoglobulins are classified into three types [9]. Type Ⅰ cryoglobulins are single monoclonal immunoglobulins usually related to B-cell proliferative diseases. Type Ⅱ cryoglobulins are mixed immunoglobulins (including monoclonal IgM and polyclonal IgG) and are typically associated with HCV infection. Type Ⅲ cryoglobulins are another type of mixed immunoglobulins containing polyclonal IgM and polyclonal IgG and can be found in numerous autoimmune diseases, including SS, SLE, and RA. Activation of memory B lymphocytes is noted in HCV-infected patients with mixed cryoglobulinemia [33]. Among individuals with HCV-related mixed cryoglobulinemia, nonspecific symptoms are reported, including arthralgia, fever, and weakness with positive RF activity [12,34]. Additional organs, including skin, nerve, kidney, gastrointestinal tract, heart, and lung may be involved during the course of HCVrelated mixed cryoglobulinemia [9] (Table 2). The most common cause of tissue injury in patients with HCV-related mixed cryoglobulinemia is immunecomplex-mediated vasculitis. Circulating cryoglobulins can combine with other immunoglobulins and complements to form large immune complexes, and deposition of immune complexes may result in vascular inflammation and damage [35]. HCV-infected patients with mixed cryoglobulinemia have a higher risk of progression of liver cirrhosis [36]. Circulating cryoglobulins should be evaluated when patients with HCV infection have extrahepatic manifestations. Anti-cyclic citrullinated peptide antibody Citrulline is the post-translationally modified, deaminated derivative of arginine converted by the enzyme peptidylarginine deiminase (PAD) [37]. In humans, citrullination can occur during the processes of apoptosis, inflammation, and keratinization [38]. Many inflammatory cells express PAD, including RA synovial T and B lymphocytes, macrophages, neutrophils, and synovial fibroblasts [37,39,40]. These autoantigens (citrulline) induce production of anticyclic citrullinated peptide (anti-ccp) antibodies and may precede the onset of clinical symptoms of RA by several years. Reports indicate that the anti-ccp antibodies have greater specificity than RF for the diagnosis of RA [41,42]. Interestingly, a certain percentage of patients with HCVrelated arthritis are also positive for anti-ccp antibodies [43]. In combination with detailed history taking, clinical manifestations and several other laboratory parameters, anti-ccp antibodies can serve as a useful and reliable laboratory marker for differentiating RA from HCV-related arthritis [44,45]. Anti-SSA/Ro and SSB/La antibody The prevalence of sicca syndrome including dry eye and dry mouth is about 20% among patients with HCV infection [46]. Many similarities between HCV-related sicca syndrome and primary SS can be observed [47,48]. Patients with HCV-positive SS are usually older, more photosensitive, and more likely to have circulating cryoglobulins than patients with primary SS [49]. Although low titers of ANA and RF are common among patients with sicca syndrome related to HCV infection, SS-related autoantibodies (anti- SSA/SSB antibody) are uncommon. Thus, circulating anti- SSA/SSB antibodies are specific to primary SS and can be used to differentiate it from HCV-related sicca syndrome. Antiphospholipid antibodies: Anti-cardiolipin antibody IgG and IgM The antiphospholipid antibodies include anti-cardiolipin (anti-cl) antibody IgG/IgM, lupus anticoagulant, and anti-β2-glycoprotein 1. The clinical symptoms of recurrent thrombus and fetal loss with circulating antiphospholipid antibodies can develop in individuals with antiphospholipid antibody syndrome (APS). The prevalence of anti-cl antibodies is higher in patients with chronic HCV infection compared to the general population; however, titers are lower than those in patients with SLE or APS [2,50,51]. In HCV infection, antiphospholipid antibody is not associated with APS progression or pathogen March 21, 2014 Volume 20 Issue 11

246 Yang DH et al. HCV-related autoimmune biomarkers esis [50]. The prevalence of HCV infection is similar among APS patients and the general population [52]. In addition, interferon-α therapy in HCV-infected patients may induce the production of anti-cl antibody [53]. Nevertheless, antiphospholipid antibodies should be assessed when HCVinfected patients have recurrent thrombi, fetal loss or unexplained thrombocytopenia not-related to liver cirrhosis. Anti-liver autoantibodies: Anti-smooth muscle antibody/ anti-liver kidney microsomal type 1 antibody Several anti-liver autoantibodies such as anti-smooth muscle (anti-sm), anti-mitochondria, and anti-liver kidney microsomal type 1 (anti-lkm1) antibody can be detected in patients with HCV infection [25,54]. There is a positive correlation between anti-sm antibody levels and liver function [25] ; however, this correlation is not seen in patients with hepatitis B virus infection. Anti-LKM1- positive patients with HCV infection have higher levels of circulating immunoglobulins and intrahepatic CD8 + lymphocytes as well as greater activation of autoimmunity [55] and thyroid dysfunction [56]. The presence of antiliver autoantibodies in HCV-infected patients do not lead to the overlap with autoimmune hepatitis, as determined by typical histological techniques [54]. Aggressive liver biopsy may be considered to confirm histological findings of autoimmune hepatitis when patients with HCV infection have persistent elevation of liver enzymes even after antiviral therapy. Antineutrophil cytoplasmic antibody The presentations of antineutrophil cytoplasmic antibody (ANCA) on indirect immunofluorescence include the cytoplasmic and perinuclear patterns (C-ANCA/P-ANCA), which are found in chronic HCV-infected patients with and without mixed cryoglobulinemia [57,58]. The clinical symptoms of ANCA-associated vasculitis include renal, dermatologic, pulmonary, and nervous system manifestations [59]. Extrahepatic manifestations of chronic HCV can be easily confused with ANCA-associated vasculitis, due to similar clinical presentations. Both pulmonary and nervous systems manifestations are more frequent among individuals with ANCA-associated vasculitis [60]. In addition, ANCA-positive compared to ANCA-negative individuals with HCV infection have a higher prevalence of skin involvement, anemia, abnormal liver function, and elevated α-fetoprotein [61]. Circulating ANCA is not significantly affected by the treatment with interferon-α. Both corticosteroids and cyclophosphamide are considered appropriate for the treatment of HCV-related vasculitis with low levels of viremia [62]. In considering the complexity of vasculitis-associated clinical manifestations, ANCA should be evaluated in patients with chronic HCV infection presenting with refractory skin ulcer or symptoms of systemic vasculitis. Anti-thyroid autoantibodies: Anti-thyroid peroxidase antibodies, anti-thyroglobulin antibodies Autoimmune thyroid disease is an organ-specific immune disease with thyroid involvement and is characterized by the presence of circulating anti-thyroid autoantibodies such as anti-thyroid peroxidase (anti-tpo) antibodies, anti-thyroglobulin antibodies, and anti-thyrotrophin receptor antibodies. The prevalence of positive anti-thyroid antibodies, including anti-tpo and anti-thyroglobulin antibodies, is higher among patients with HCV infection compared to the general population [24,63-65]. However, the mechanism that triggers anti-thyroid autoantibody production is unclear. Thyroid dysfunction and anti-thyroid antibodies can be found before and after interferon treatment for chronic HCV infection [66-68]. It is possible that autoantibody production is induced by HCV infection or by an autoimmune phenomenon related to interferon therapy [64,69]. Noticeably, anti-tpo antibody production can be induced by thyroid autoimmunity after interferon-α therapy and may be associated with high concentrations of circulating B-cell-activating factor [70]. A recent study demonstrated that positive circulating anti- TPO antibodies (IgG2 subclass) may be a risk factor for progression of thyroid dysfunction in patients with chronic HCV infection [71]. Such patients should therefore undergo regular monitoring of thyroid function and anti-thyroid autoantibodies, especially during and after interferon-α therapy. Anti-C-reactive protein antibodies C-reactive protein (CRP) is produced during the acute phase of inflammation, mainly in response to IL-6 [72]. Short-term mortality risk is higher among patients with liver cirrhosis and elevated CRP [73]. Anti-CRP antibodies have been detected in chronic HCV-infected patients with unknown mechanisms. A report suggests that the presence of anti-crp antibodies is correlated with the presence of RF and cryoglobulinemia [74]. Advanced liver cirrhosis or liver damage and portal inflammation is found in HCV-infected patients with anti-crp antibodies [74,75]. In general, HCV-infected patients with anti-crp antibodies do not have noteworthy rheumatic manifestations. Anti-CRP antibody may serve as a useful biomarker of progression of liver cirrhosis and portal inflammation in patients with chronic HCV infection. Non-autoantibody related biomarkers: Interleukin-6, chemokine ligand 10 and osteopontin IL-6 is a proinflammatory cytokine and is usually elevated during acute infection and inflammation. The biological activities of IL-6 consist of immune regulation, hematopoiesis, inflammation, and oncogenesis [76,77]. HCVinfected patients with mixed cryoglobulinemia have significantly higher levels of circulating IL-6 as compared with those without mixed cryoglobulinemia and the levels are particularly high among patients accompanied with acute vasculitis [78] or autoimmune thyroiditis [79]. The levels of proinflammatory cytokines other than IL-6, including tumor necrosis factor-α and IL-1β, are also elevated in these patients [78,80]. Chemokine (CXC motif) ligand 10 (CXCL10) is a 2965 March 21, 2014 Volume 20 Issue 11

247 Yang DH et al. HCV-related autoimmune biomarkers Table 3 Immunological manifestations and useful autoantibodies in the patients with chronic hepatitis C virus infection Clinical symptoms Useful autoantibodies Differential diagnosis Polyarthritis/polyarthralgia RF, anti-ccp RA Sicca (dry eye/dry mouth) Anti-SSA/SSB SS Purpura Cryoglobulin Cryoglobulinemic vasculitis Leg ulcer ANCA, Cryoglobulin Systemic vasculitis Glomerulonephritis ANCA, Anti-dsDNA SLE, systemic vasculitis Cytopenia Anti-dsDNA SLE Hepatitis Anti-SM, Anti-LKM1 Autoimmune hepatitis Thrombosis Anti-CL IgG/M APS Depression/fatigue Anti-thyroglobulin, Anti-TPO Autoimmune thyroiditis RF: Rheumatoid factor; Anti-CCP: Anti-cyclic citrullinated peptide; ANCA: Anti-neutrophil cytoplasmic antibody; Anti-dsDNA: Anti-double strand DNA; Anti-SM: Anti-smooth muscle; Anti-LKM1: Anti-liver kidney microsomal type 1; Anti-CL: Anti-cardiolipin; Anti-TPO: Anti-thyroid peroxidase; RA: Rheumatoid arthritis; SS: Sjögren syndrome; SLE: Systemic lupus erythematosus; APS: Antiphospholipid antibody syndrome. chemokine involved in recruiting activated T helper-1 lymphocytes to an inflammation site [81,82]. Increased levels of circulating CXCL10 are observed in patients with chronic HCV infection and are associated with mixed cryoglobulinemia and vasculitis presentations in these patients [83-85]. The increased circulating levels of CXCL10 are also associated with elevated interferon-γ [86]. Cryoglobulin in HCV-infected patients can trigger production of pro-inflammatory cytokines via the mechanism of immune-complex formation [9]. There is also evidence indicating that circulating CXCL10 and CXCL11 are elevated among HCV-infected patients with autoimmune thyroiditis [87]. Circulating CXCL10 can thus be used to evaluate the status of cryoglobulinemia and autoimmune thyroiditis during HCV infection. Osteopontin (OPN) is a phosphorylated acidic arginine-glycine-aspartate-containing (delete a space ahead of containing) glycoprotein and is expressed by various cells, including macrophages, neutrophils, dendritic cells, natural killer cells, T and B lymphocytes [88]. OPN has important roles in promoting inflammation, tissue remodeling, fibrosis, and angiogenesis [89]. Serum OPN levels are positively correlated with the severity of liver damage and cirrhosis in patients with chronic hepatitis [90,91]. OPN levels are significantly elevated in HCV-infected patients with rheumatic manifestations, including sicca syndrome, arthritis, vasculitis, pulmonary fibrosis, and neurologic and renal involvement and those positive for autoantibodies like RF or ANA [91]. Elevated serum OPN has also been observed in patients with HCV infection-associated B-cell non-hodgkin lymphoma [92]. Thus, circulating OPN is an important biomarker for HCV infection associated autoimmune disorders and lymphomagenesis. CONCLUSION Autoimmune-related clinical symptoms and signs can develop during the course of chronic HCV infection. Concurrently, many laboratory abnormalities commonly present in autoimmune disorders may be detected. Abnormal autoimmune-related immune dysregulation of B and T lymphocytes, directly or indirectly mediated through the interaction with virus or viral surface proteins, plays important roles in the progression of autoimmune manifestations associated with HCV infection. These clinical and laboratory findings can potentially mislead to the diagnosis of primary autoimmune disorders and result in inappropriate therapy. A number of useful biomarkers can be used in the differential diagnosis of autoimmune disorders during the course of HCV, as shown in Table 3. Anti-CCP antibodies are useful for differentiating between RA and HCVrelated arthritis. Anti-SSA/SSB antibodies are useful for differentiating between primary SS and HCV-related sicca syndrome. When HCV-infected patients have refractory cutaneous purpura or ulcer, cryoglobulin and ANCA should be determined to evaluate the possibility of cryoglobulinemic vasculitis and systemic vasculitis. Circulating ANCA and anti-dsdna should be measured in HCVinfected patients with glomerulonephritis, to monitor the development of SLE and systemic vasculitis. AntidsDNA should also be checked in HCV-infected patients with unexplained cytopenia and positive ANA. When patients have persistent abnormal liver function but low HCV titers, anti-sm and anti-lkm1 antibodies and when necessary liver biopsy should be evaluated to exclude the possibility of autoimmune hepatitis. Anti-CL antibodies are useful markers when HCV-infected patients have recurrent thrombi or fetal loss with unexplained thrombocytopenia not-related to liver cirrhosis. Regular monitoring of thyroid function and anti-thyroglobulin and anti- TPO antibodies is suggested for chronic HCV-infected patients, especially during interferon-α therapy and those with symptoms of fatigue, depression or symptoms/ signs suggesting thyroid dysfunction. Furthermore, during the course of HCV infection, increased production of cytokines and chemokines related to systemic inflammation can be detected. Because immunotherapy can cause changes of these inflammatory mediators as well as induce HCV flares or liver damage, this factor has to be considered when evaluating the autoimmune status of HCV-infected patients. Collectively, adequate evaluation of circulating autoantibodies, cytokines and chemokines is sometimes necessary when HCV-infected patients have extrahepatic manifestations or in considering the possibility of co-existing autoim March 21, 2014 Volume 20 Issue 11

248 Yang DH et al. HCV-related autoimmune biomarkers mune disorders or even malignancy. REFERENCES 1 Lauer GM, Walker BD. Hepatitis C virus infection. N Engl J Med 2001; 345: [PMID: DOI: / NEJM ] 2 Stefanova-Petrova DV, Tzvetanska AH, Naumova EJ, Mihailova AP, Hadjiev EA, Dikova RP, Vukov MI, Tchernev KG. Chronic hepatitis C virus infection: prevalence of extrahepatic manifestations and association with cryoglobulinemia in Bulgarian patients. World J Gastroenterol 2007; 13: [PMID: ] 3 Mohammed RH, ElMakhzangy HI, Gamal A, Mekky F, El Kassas M, Mohammed N, Abdel Hamid M, Esmat G. Prevalence of rheumatologic manifestations of chronic hepatitis C virus infection among Egyptians. Clin Rheumatol 2010; 29: [PMID: DOI: /s x] 4 Ramos-Casals M, Muñoz S, Medina F, Jara LJ, Rosas J, Calvo-Alen J, Brito-Zerón P, Forns X, Sánchez-Tapias JM. Systemic autoimmune diseases in patients with hepatitis C virus infection: characterization of 1020 cases (The HIS- PAMEC Registry). J Rheumatol 2009; 36: [PMID: DOI: /jrheum ] 5 Paroli M, Iannucci G, Accapezzato D. Hepatitis C virus infection and autoimmune diseases. Int J Gen Med 2012; 5: [PMID: DOI: /IJGM.S37580] 6 Vergani D, Mieli-Vergani G. Autoimmune manifestations in viral hepatitis. Semin Immunopathol 2013; 35: [PMID: DOI: /s ] 7 Luo JC, Hwang SJ, Li CP, Lu RH, Chan CY, Wu JC, Chang FY, Lee SD. Clinical significance of serum auto-antibodies in Chinese patients with chronic hepatitis C: negative role of serum viral titre and genotype. J Gastroenterol Hepatol 1998; 13: [PMID: ] 8 Ramos-Casals M, Font J, García-Carrasco M, Cervera R, Jiménez S, Trejo O, de la Red G, Sánchez-Tapias JM, Ingelmo M. Hepatitis C virus infection mimicking systemic lupus erythematosus: study of hepatitis C virus infection in a series of 134 Spanish patients with systemic lupus erythematosus. Arthritis Rheum 2000; 43: [PMID: DOI: / (200012)43:12<2801::AID- ANR21>3.0.CO;2-V] 9 Ramos-Casals M, Stone JH, Cid MC, Bosch X. The cryoglobulinaemias. Lancet 2012; 379: [PMID: DOI: /S (11) ] 10 Blackard JT, Kong L, Huber AK, Tomer Y. Hepatitis C virus infection of a thyroid cell line: implications for pathogenesis of hepatitis C virus and thyroiditis. Thyroid 2013; 23: [PMID: DOI: /thy ] 11 Palazzi C, Buskila D, D Angelo S, D Amico E, Olivieri I. Autoantibodies in patients with chronic hepatitis C virus infection: pitfalls for the diagnosis of rheumatic diseases. Autoimmun Rev 2012; 11: [PMID: DOI: /j.autrev ] 12 Saadoun D, Landau DA, Calabrese LH, Cacoub PP. Hepatitis C-associated mixed cryoglobulinaemia: a crossroad between autoimmunity and lymphoproliferation. Rheumatology (Oxford) 2007; 46: [PMID: DOI: /rheumatology/kem132] 13 Zhou Y, Lukes Y, Anderson J, Fileta B, Reinhardt B, Sjogren M. Hepatitis C virus E2 envelope protein induces dendritic cell maturation. J Viral Hepat 2007; 14: [PMID: ] 14 Sarobe P, Lasarte JJ, García N, Civeira MP, Borrás-Cuesta F, Prieto J. Characterization of T-cell responses against immunodominant epitopes from hepatitis C virus E2 and NS4a proteins. J Viral Hepat 2006; 13: [PMID: ] 15 Gómez CE, Perdiguero B, Cepeda MV, Mingorance L, García- Arriaza J, Vandermeeren A, Sorzano CÓ, Esteban M. High, broad, polyfunctional, and durable T cell immune responses induced in mice by a novel hepatitis C virus (HCV) vaccine candidate (MVA-HCV) based on modified vaccinia virus Ankara expressing the nearly full-length HCV genome. J Virol 2013; 87: [PMID: DOI: / JVI ] 16 Maillefert JF, Muller G, Falgarone G, Bour JB, Ratovohery D, Dougados M, Tavernier C, Breban M. Prevalence of hepatitis C virus infection in patients with rheumatoid arthritis. Ann Rheum Dis 2002; 61: [PMID: ] 17 Hsu FC, Starkebaum G, Boyko EJ, Dominitz JA. Prevalence of rheumatoid arthritis and hepatitis C in those age 60 and older in a US population based study. J Rheumatol 2003; 30: [PMID: ] 18 Banks SE, Riley TR, Naides SJ. Musculoskeletal complaints and serum autoantibodies associated with chronic hepatitis C and nonalcoholic fatty liver disease. Dig Dis Sci 2007; 52: [PMID: DOI: /s ] 19 Charles ED, Orloff MI, Nishiuchi E, Marukian S, Rice CM, Dustin LB. Somatic hypermutations confer rheumatoid factor activity in hepatitis C virus-associated mixed cryoglobulinemia. Arthritis Rheum 2013; 65: [PMID: DOI: /art.38041] 20 Nowak U, Gill K, Skamene E, Newkirk MM. Rheumatoid factor induction in murine models of liver injury. Clin Exp Immunol 2007; 147: [PMID: ] 21 Toubi E, Zuckerman E, Kessel A, Rozenbaum M, Rosner I. IgA rheumatoid factor in patients with chronic HCV infection: prevalence and clinical correlations. Clin Exp Rheumatol 2003; 21: 524 [PMID: ] 22 Agnello V, Elfahal M. Cryoglobulin types and rheumatoid factors associated with clinical manifestations in patients with hepatitis C virus infection. Dig Liver Dis 2007; 39 Suppl 1: S25-S31 [PMID: ] 23 Riccio A, Conca P, Marzocchella C, Tarantino G. Rheumatoid factor after antiviral therapy in patients with HCV chronic hepatitis. Clin Exp Rheumatol 2008; 26: [PMID: ] 24 Zusinaite E, Metskula K, Salupere R. Autoantibodies and hepatitis C virus genotypes in chronic hepatitis C patients in Estonia. World J Gastroenterol 2005; 11: [PMID: ] 25 Chrétien P, Chousterman M, Abd Alsamad I, Ozenne V, Rosa I, Barrault C, Lons T, Hagège H. Non-organ-specific autoantibodies in chronic hepatitis C patients: association with histological activity and fibrosis. J Autoimmun 2009; 32: [PMID: DOI: /j.jaut ] 26 Hsieh MY, Dai CY, Lee LP, Huang JF, Tsai WC, Hou NJ, Lin ZY, Chen SC, Wang LY, Chang WY, Chuang WL, Yu ML. Antinuclear antibody is associated with a more advanced fibrosis and lower RNA levels of hepatitis C virus in patients with chronic hepatitis C. J Clin Pathol 2008; 61: [PMID: ] 27 Bai L, Feng ZR, Lu HY, Li WG, Yu M, Xu XY. Prevalence of antinuclear and anti-liver-kidney-microsome type-1 antibodies in patients with chronic hepatitis C in China. Chin Med J (Engl) 2009; 122: 5-9 [PMID: ] 28 Chen CH, Lee CM, Chen CH, Hu TH, Wang JH, Hung CH, Chung CH, Lu SN. Prevalence and clinical relevance of serum autoantibodies in patients with chronic hepatitis C. Chang Gung Med J 2010; 33: [PMID: ] 29 Himoto T, Nakai S, Kinekawa F, Yoneyama H, Deguchi A, Kurokochi K, Masaki T, Senda S, Haba R, Watanabe S, Nishioka M, Kuriyama S. Clinical characteristics of patients with hepatitis C virus-related chronic liver disease seropositive for anticentromere antibody. Dig Dis Sci 2009; 54: [PMID: DOI: /s y] 30 Narciso-Schiavon JL, Freire FC, Suarez MM, Ferrari MV, 2967 March 21, 2014 Volume 20 Issue 11

249 Yang DH et al. HCV-related autoimmune biomarkers Scanhola GQ, Schiavon Lde L, de Carvalho Filho RJ, Ferraz ML, Silva AE. Antinuclear antibody positivity in patients with chronic hepatitis C: clinically relevant or an epiphenomenon? Eur J Gastroenterol Hepatol 2009; 21: [PMID: ] 31 Hsieh MY, Dai CY, Lee LP, Huang JF, Chuang WL, Hou NJ, Lin ZY, Chen SC, Hsieh MY, Wang LY, Chang WY, Yu ML. Antinuclear antibody titer and treatment response to peginterferon plus ribavirin for chronic hepatitis C patients. Kaohsiung J Med Sci 2012; 28: [PMID: DOI: /j.kjms ] 32 Khairy M, El-Raziky M, El-Akel W, Abdelbary MS, Khatab H, El-Kholy B, Esmat G, Mabrouk M. Serum autoantibodies positivity prevalence in patients with chronic HCV and impact on pegylated interferon and ribavirin treatment response. Liver Int 2013; 33: [PMID: DOI: /liv.12227] 33 Santer DM, Ma MM, Hockman D, Landi A, Tyrrell DL, Houghton M. Enhanced activation of memory, but not naïve, B cells in chronic hepatitis C virus-infected patients with cryoglobulinemia and advanced liver fibrosis. PLoS One 2013; 8: e68308 [PMID: DOI: /journal. pone ] 34 Sansonno D, Carbone A, De Re V, Dammacco F. Hepatitis C virus infection, cryoglobulinaemia, and beyond. Rheumatology (Oxford) 2007; 46: [PMID: ] 35 Charles ED, Dustin LB. Hepatitis C virus-induced cryoglobulinemia. Kidney Int 2009; 76: [PMID: DOI: /ki ] 36 Andrade LJ, Melo PR, Atta AM, Atta ML, Jesus LS, Sousa GM, Silva CA, Paraná R. Smooth muscle antibodies and cryoglobulinemia are associated with advanced liver fibrosis in Brazilian hepatitis C virus carriers. Braz J Infect Dis 2011; 15: [PMID: ] 37 Barra L, Pope J, Bessette L, Haraoui B, Bykerk V. Lack of seroconversion of rheumatoid factor and anti-cyclic citrullinated peptide in patients with early inflammatory arthritis: a systematic literature review. Rheumatology (Oxford) 2011; 50: [PMID: DOI: /rheumatology/ keq190] 38 Baka Z, György B, Géher P, Buzás EI, Falus A, Nagy G. Citrullination under physiological and pathological conditions. Joint Bone Spine 2012; 79: [PMID: DOI: /j.jbspin ] 39 Szodoray P, Szabó Z, Kapitány A, Gyetvai A, Lakos G, Szántó S, Szücs G, Szekanecz Z. Anti-citrullinated protein/peptide autoantibodies in association with genetic and environmental factors as indicators of disease outcome in rheumatoid arthritis. Autoimmun Rev 2010; 9: [PMID: DOI: /j.autrev ] 40 Wiik AS, van Venrooij WJ, Pruijn GJ. All you wanted to know about anti-ccp but were afraid to ask. Autoimmun Rev 2010; 10: [PMID: DOI: /j.autrev ] 41 Lu MC, Hsieh SC, Lai NS, Li KJ, Wu CH, Yu CL. Comparison of anti-agalactosyl IgG antibodies, rheumatoid factors, and anti-cyclic citrullinated peptide antibodies in the differential diagnosis of rheumatoid arthritis and its mimics. Clin Exp Rheumatol 2007; 25: [PMID: ] 42 Orge E, Cefle A, Yazici A, Gürel-Polat N, Hulagu S. The positivity of rheumatoid factor and anti-cyclic citrullinated peptide antibody in nonarthritic patients with chronic hepatitis C infection. Rheumatol Int 2010; 30: [PMID: DOI: /s ] 43 Ezzat WM, Raslan HM, Aly AA, Emara NA, El Menyawi MM, Edrees A. Anti-cyclic citrullinated peptide antibodies as a discriminating marker between rheumatoid arthritis and chronic hepatitis C-related polyarthropathy. Rheumatol Int 2011; 31: [PMID: DOI: / s ] 44 Liu FC, Chao YC, Hou TY, Chen HC, Shyu RY, Hsieh TY, Chen CH, Chang DM, Lai JH. Usefulness of anti-ccp antibodies in patients with hepatitis C virus infection with or without arthritis, rheumatoid factor, or cryoglobulinemia. Clin Rheumatol 2008; 27: [PMID: DOI: /s ] 45 Palazzi C, D Angelo S, Olivieri I. Hepatitis C virus-related arthritis. Autoimmun Rev 2008; 8: [PMID: DOI: /j.autrev ] 46 Jorgensen C, Legouffe MC, Perney P, Coste J, Tissot B, Segarra C, Bologna C, Bourrat L, Combe B, Blanc F, Sany J. Sicca syndrome associated with hepatitis C virus infection. Arthritis Rheum 1996; 39: [PMID: ] 47 Lormeau C, Falgarone G, Roulot D, Boissier MC. Rheumatologic manifestations of chronic hepatitis C infection. Joint Bone Spine 2006; 73: [PMID: ] 48 Carrozzo M. Oral diseases associated with hepatitis C virus infection. Part 1. sialadenitis and salivary glands lymphoma. Oral Dis 2008; 14: [PMID: DOI: / j x] 49 Ceribelli A, Cavazzana I, Cattaneo R, Franceschini F. Hepatitis C virus infection and primary Sjögren s syndrome: a clinical and serologic description of 9 patients. Autoimmun Rev 2008; 8: [PMID: DOI: / j.autrev ] 50 Dalekos GN, Kistis KG, Boumba DS, Voulgari P, Zervou EK, Drosos AA, Tsianos EV. Increased incidence of anticardiolipin antibodies in patients with hepatitis C is not associated with aetiopathogenetic link to anti-phospholipid syndrome. Eur J Gastroenterol Hepatol 2000; 12: [PMID: ] 51 Zachou K, Liaskos C, Christodoulou DK, Kardasi M, Papadamou G, Gatselis N, Georgiadou SP, Tsianos EV, Dalekos GN. Anti-cardiolipin antibodies in patients with chronic viral hepatitis are independent of beta2-glycoprotein I cofactor or features of antiphospholipid syndrome. Eur J Clin Invest 2003; 33: [PMID: ] 52 Muñoz-Rodríguez FJ, Tàssies D, Font J, Reverter JC, Cervera R, Sánchez-Tapias JM, Mazzara R, Ordinas A, Ingelmo M. Prevalence of hepatitis C virus infection in patients with antiphospholipid syndrome. J Hepatol 1999; 30: [PMID: ] 53 Matsuda J, Saitoh N, Gotoh M, Gohchi K, Tsukamoto M, Syoji S, Miyake K, Yamanaka M. High prevalence of antiphospholipid antibodies and anti-thyroglobulin antibody in patients with hepatitis C virus infection treated with interferon-alpha. Am J Gastroenterol 1995; 90: [PMID: ] 54 Badiani RG, Becker V, Perez RM, Matos CA, Lemos LB, Lanzoni VP, Andrade LE, Dellavance A, Silva AE, Ferraz ML. Is autoimmune hepatitis a frequent finding among HCV patients with intense interface hepatitis? World J Gastroenterol 2010; 16: [PMID: ] 55 Ferri S, Muratori L, Quarneti C, Muratori P, Menichella R, Pappas G, Granito A, Ballardini G, Bianchi FB, Lenzi M. Clinical features and effect of antiviral therapy on anti-liver/ kidney microsomal antibody type 1 positive chronic hepatitis C. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 56 Mauss S, Berger F, Schober A, Moog G, Heyne R, John C, Pape S, Hueppe D, Pfeiffer-Vornkahl H, Alshuth U. Screening for autoantibodies in chronic hepatitis C patients has no effect on treatment initiation or outcome. J Viral Hepat 2013; 20: e72-e77 [PMID: DOI: /jvh.12011] 57 Lamprecht P, Gutzeit O, Csernok E, Gause A, Longombardo G, Zignego AL, Gross WL, Ferri C. Prevalence of ANCA in mixed cryoglobulinemia and chronic hepatitis C virus infection. Clin Exp Rheumatol 2003; 21: S89-S94 [PMID: ] 58 Cojocaru M, Cojocaru IM, Iacob SA. Prevalence of antineutrophil cytoplasmic antibodies in patients with chronic hepatitis C infection associated mixed cryoglobulinemia March 21, 2014 Volume 20 Issue 11

250 Yang DH et al. HCV-related autoimmune biomarkers Rom J Intern Med 2006; 44: [PMID: ] 59 Chen M, Kallenberg CG. ANCA-associated vasculitides--advances in pathogenesis and treatment. Nat Rev Rheumatol 2010; 6: [PMID: DOI: /nrrheum ] 60 Bonaci-Nikolic B, Andrejevic S, Pavlovic M, Dimcic Z, Ivanovic B, Nikolic M. Prolonged infections associated with antineutrophil cytoplasmic antibodies specific to proteinase 3 and myeloperoxidase: diagnostic and therapeutic challenge. Clin Rheumatol 2010; 29: [PMID: DOI: /s ] 61 Wu YY, Hsu TC, Chen TY, Liu TC, Liu GY, Lee YJ, Tsay GJ. Proteinase 3 and dihydrolipoamide dehydrogenase (E3) are major autoantigens in hepatitis C virus (HCV) infection. Clin Exp Immunol 2002; 128: [PMID: ] 62 Shahin AA, El Desouky SM, Zayed HS. A retrospective analysis of treatment outcomes in patients with hepatitis C related systemic vasculitis receiving intravenous methylprednisolone and cyclophosphamide. Clin Rheumatol 2011; 30: [PMID: DOI: /s ] 63 Ploix C, Verber S, Chevallier - Queyron P, Ritter J, Bousset G, Monier JC, Fabien N. Hepatitis C virus infection is frequently associated with high titers of anti-thyroid antibodies. Int J Immunopathol Pharmacol 1999; 12: [PMID: ] 64 Antonelli A, Ferri C, Pampana A, Fallahi P, Nesti C, Pasquini M, Marchi S, Ferrannini E. Thyroid disorders in chronic hepatitis C. Am J Med 2004; 117: [PMID: DOI: /j.amjmed ] 65 Yang R, Shan Z, Li Y, Fan C, Li C, Teng W. Prevalence of thyroid autoantibodies in hepatitis C and hepatitis B infection in China. Intern Med 2011; 50: [PMID: ] 66 Mohran ZY, Abdel Kader NA, Abdel Moez AT, Abbas AA. Subclinical autoimmune thyroid disorders in Egyptian patients with untreated chronic hepatitis C virus infection. J Egypt Soc Parasitol 2010; 40: [PMID: ] 67 Nair Kesavachandran C, Haamann F, Nienhaus A. Frequency of thyroid dysfunctions during interferon alpha treatment of single and combination therapy in hepatitis C virus-infected patients: a systematic review based analysis. PLoS One 2013; 8: e55364 [PMID: DOI: / journal.pone ] 68 Teng ZL, Gong WJ, Zhang SQ, Sun YX, Ma XH. Clinical observation of hashimoto thyroiditis in patients with chronic hepatitis C undergoing pegylated-interferon alpha-2a and ribavirin combination therapy. Zhonghua Ganzangbing Zazhi 2013; 21: [PMID: DOI: /cma. j.issn ] 69 Gehring S, Kullmer U, Koeppelmann S, Gerner P, Wintermeyer P, Wirth S. Prevalence of autoantibodies and the risk of autoimmune thyroid disease in children with chronic hepatitis C virus infection treated with interferon-alpha. World J Gastroenterol 2006; 12: [PMID: ] 70 Kajiyama Y, Kikuchi K, Takai A, Hosoya N, Hoshino H, Hino K, Miyakawa H. B-cell-activating factor affects the occurrence of thyroid autoimmunity in chronic hepatitis C patients treated with interferon alpha. Clin Dev Immunol 2012; 2012: [PMID: DOI: /2012/247973] 71 Shao C, Huo N, Zhao L, Gao Y, Fan X, Zheng Y, Wang L, Lu H, Xu X, Guo X. The presence of thyroid peroxidase antibody of IgG2 subclass is a risk factor for thyroid dysfunction in chronic hepatitis C patients. Eur J Endocrinol 2013; 168: [PMID: DOI: /EJE ] 72 Ansar W, Ghosh S. C-reactive protein and the biology of disease. Immunol Res 2013; 56: [PMID: DOI: /s ] 73 Cervoni JP, Thévenot T, Weil D, Muel E, Barbot O, Sheppard F, Monnet E, Di Martino V. C-reactive protein predicts shortterm mortality in patients with cirrhosis. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 74 Kessel A, Elias G, Pavlotzky E, Zuckerman E, Rosner I, Toubi E. Anti-C-reactive protein antibodies in chronic hepatitis C infection: correlation with severity and autoimmunity. Hum Immunol 2007; 68: [PMID: ] 75 Sjöwall C, Cardell K, Boström EA, Bokarewa MI, Enocsson H, Ekstedt M, Lindvall L, Frydén A, Almer S. High prevalence of autoantibodies to C-reactive protein in patients with chronic hepatitis C infection: association with liver fibrosis and portal inflammation. Hum Immunol 2012; 73: [PMID: DOI: /j.humimm ] 76 Papanicolaou DA, Wilder RL, Manolagas SC, Chrousos GP. The pathophysiologic roles of interleukin-6 in human disease. Ann Intern Med 1998; 128: [PMID: ] 77 Kishimoto T. IL-6: from its discovery to clinical applications. Int Immunol 2010; 22: [PMID: DOI: /intimm/dxq030] 78 Antonelli A, Ferri C, Ferrari SM, Ghiri E, Marchi S, Colaci M, Bruschi F, Fallahi P. High interleukin-6 and tumor necrosis factor-alpha serum levels in hepatitis C infection associated or not with mixed cryoglobulinemia. Clin Rheumatol 2009; 28: [PMID: DOI: /s ] 79 Antonelli A, Ferri C, Ferrari SM, Di Domenicantonio A, Ferrari P, Pupilli C, Nicolini A, Zignego AL, Marchi S, Fallahi P. The presence of autoimmune thyroiditis in mixed cryoglobulinemia patients is associated with high levels of circulating interleukin-6, but not of tumor necrosis factor-alpha. Clin Exp Rheumatol 2011; 29: S17-S22 [PMID: ] 80 Antonelli A, Ferri C, Ferrari SM, Ghiri E, Goglia F, Pampana A, Bruschi F, Fallahi P. Serum levels of proinflammatory cytokines interleukin-1beta, interleukin-6, and tumor necrosis factor alpha in mixed cryoglobulinemia. Arthritis Rheum 2009; 60: [PMID: DOI: / art.25003] 81 Cole KE, Strick CA, Paradis TJ, Ogborne KT, Loetscher M, Gladue RP, Lin W, Boyd JG, Moser B, Wood DE, Sahagan BG, Neote K. Interferon-inducible T cell alpha chemoattractant (I- TAC): a novel non-elr CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J Exp Med 1998; 187: [PMID: ] 82 Cox MA, Jenh CH, Gonsiorek W, Fine J, Narula SK, Zavodny PJ, Hipkin RW. Human interferon-inducible 10-kDa protein and human interferon-inducible T cell alpha chemoattractant are allotopic ligands for human CXCR3: differential binding to receptor states. Mol Pharmacol 2001; 59: [PMID: ] 83 Antonelli A, Ferri C, Fallahi P, Ferrari SM, Frascerra S, Sebastiani M, Franzoni F, Galetta F, Ferrannini E. High values of CXCL10 serum levels in patients with hepatitis C associated mixed cryoglobulinemia in presence or absence of autoimmune thyroiditis. Cytokine 2008; 42: [PMID: DOI: /j.cyto ] 84 Antonelli A, Ferri C, Fallahi P, Ferrari SM, Sebastiani M, Ferrari D, Giunti M, Frascerra S, Tolari S, Franzoni F, Galetta F, Marchi S, Ferrannini E. High values of CXCL10 serum levels in mixed cryoglobulinemia associated with hepatitis C infection. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 85 Antonelli A, Ferri C, Ferrari SM, De Marco S, Di Domenicantonio A, Centanni M, Pupilli C, Villa E, Menichetti F, Fallahi P. Interleukin-1β, C-x-C motif ligand 10, and interferon-gamma serum levels in mixed cryoglobulinemia with or without autoimmune thyroiditis. J Interferon Cytokine Res 2010; 30: [PMID: DOI: /jir ] 86 Antonelli A, Ferri C, Ferrari SM, Ghiri E, Marchi S, Sebastiani M, Fallahi P. Serum concentrations of interleukin 1beta, CXCL10, and interferon-gamma in mixed cryoglobulinemia associated with hepatitis C infection. J Rheumatol 2010; 37: [PMID: DOI: /jrheum ] 87 Antonelli A, Fallahi P, Ferrari SM, Sebastiani M, Manfredi A, Mazzi V, Fabiani S, Centanni M, Marchi S, Ferri C. Circulating CXCL11 and CXCL10 are increased in hepatitis C-associated cryoglobulinemia in the presence of autoim March 21, 2014 Volume 20 Issue 11

251 Yang DH et al. HCV-related autoimmune biomarkers mune thyroiditis. Mod Rheumatol 2012; 22: [PMID: DOI: /s x] 88 Wang KX, Denhardt DT. Osteopontin: role in immune regulation and stress responses. Cytokine Growth Factor Rev 2008; 19: [PMID: DOI: /j.cytogfr ] 89 Pedraza CE, Nikolcheva LG, Kaartinen MT, Barralet JE, McKee MD. Osteopontin functions as an opsonin and facilitates phagocytosis by macrophages of hydroxyapatite-coated microspheres: implications for bone wound healing. Bone 2008; 43: [PMID: DOI: /j.bone ] 90 Zhao L, Li T, Wang Y, Pan Y, Ning H, Hui X, Xie H, Wang J, Han Y, Liu Z, Fan D. Elevated plasma osteopontin level is predictive of cirrhosis in patients with hepatitis B infection. Int J Clin Pract 2008; 62: [PMID: ] 91 Bassyouni IH, Bassyouni RH, Ibrahim NH, Soliman AF. Elevated serum osteopontin levels in chronic hepatitis C virus infection: association with autoimmune rheumatologic manifestations. J Clin Immunol 2012; 32: [PMID: DOI: /s ] 92 Libra M, Indelicato M, De Re V, Zignego AL, Chiocchetti A, Malaponte G, Dianzani U, Nicoletti F, Stivala F, McCubrey JA, Mazzarino MC. Elevated Serum Levels of Osteopontin in HCV-Associated Lymphoproliferative Disorders. Cancer Biol Ther 2005; 4: [PMID: ] P- Reviewers: Chen Z, Das UN, Sener A, Tetsuya T S- Editor: Gou SX L- Editor: A E- Editor: Wang CH 2970 March 21, 2014 Volume 20 Issue 11

252 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. MINIREVIEWS Host RNA circles and the origin of hepatitis delta virus John M Taylor John M Taylor, Fox Chase Cancer Center, Philadelphia, PA 19111, United States Author contributions: Taylor JM contributed solely to this manuscript. Correspondence to: John M Taylor, PhD, Professor Emeritus, Fox Chase Cancer Center, 333 Cottman Avenue, Philadelphia, PA 19111, United States. john.taylor@fccc.edu Telephone: Fax: Received: November 12, 2013 Revised: December 20, 2013 Accepted: February 20, 2014 Published online: March 21, 2014 Abstract Recent reports show that many cellular RNAs are processed to form circular species that are relatively abundant and resistant to host nucleases. In some cases, such circles actually bind host micrornas. Such depletion of available micrornas appears to have biological roles; for instance, in homeostasis and disease. These findings regarding host RNA circles support a speculative reappraisal of the origin and mode of replication of hepatitis delta virus, hepatitis delta virus (HDV), an agent with a small circular RNA genome; specifically, it is proposed that in hepatocytes infected with hepatitis B virus (HBV), some viral RNA species are processed to circular forms, which by a series of chance events lead to an RNA that can be both replicated by host enzymes and assembled, using HBV envelope proteins, to form particles some of which are infectious. Such a model also may provide some new insights into the potential pathogenic potential of HDV infections. In return, new insights into HDV might provide information leading to a better understanding of the roles of the host RNA circles Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatitis B virus; Hepatitis delta virus; Circular RNA; Ribozymes; MicroRNA Core tip: This article includes an evaluation of the hypothesis that in hepatocytes of patients chronically infected with hepatitis B virus, some viral RNA sequences can form small RNA circles, leading to the chance selection of one circle that becomes the progenitor of hepatitis delta virus. Taylor JM. Host RNA circles and the origin of hepatitis delta virus. World J Gastroenterol 2014; 20(11): Available from: URL: i11/2971.htm DOI: INTRODUCTION Following the discovery of RNA splicing, a variety of circular RNAs were observed in animal cells. For example, there were reports for a tumor suppressor gene, deleted in colorectal cancer, in brain [1] and a sex-determining gene, SRY, in adult testes [2]. With time more examples of circular RNAs were reported, but there were consistent difficulties in proving that the species which were found, and which were never particularly abundant relative to mature spliced RNAs, had a function in cell biology. That is, that they were not just consequences of conversion from lariats, the canonical splicing intermediate, or worse, an artifact of experimental analysis. However, this picture has changed dramatically in the last three years. Many studies have now shown that circular species are actually abundant in cells [3-8]. Indeed, these RNAs are derived from a large fraction of all host RNA transcripts, both coding and noncoding RNA precursors. In some cases the circles are more abundant even than the canonical mature processed linear mrna to which they are related. Numerous models have been proposed for how the circles are formed. Whatever their mechanism of formation, their circularity presumably confers metabolic stability against host RNases, which are predominantly exorather than endo-nucleases March 21, 2014 Volume 20 Issue 11

253 Taylor JM. RNA circles and HDV origin The finding of many and abundant host circular RNAs has led to searches for a biological role. One such role for an RNA circle, first found in the brain, is the ability to bind multiple copies of a host microrna (mir- NA) [8]. This so-called sponge effect [3,8] has been shown to have an essential role in homeostasis [7] and has also been speculated to play a role in human cancers [6]. No doubt more examples and even additional roles will be found for such RNA circles. The host RNA circles and their possible functions have already become the subject of numerous short commentary articles [9-13]. In 1986, three labs reported that the small RNA genome of hepatitis delta virus (HDV) has a circular conformation [14-16]. Replication of this viral RNA in infected cells leads to accumulation of antigenomes, which are also circular, and exact compliments of the genome. At the time of its discovery, the HDV RNA genome was considered to be unique relative to all other animal virus RNAs in terms of its small size, approximately 1700 nucleotides, and especially its circular conformation. Currently this is still true but it may not be for long, since we now know of the abundant host RNA circles, and as will be discussed, we might expect to soon see reports of other animal viruses producing small RNA circles. The primary aim of this review is to reevaluate what we know about the origin and replication of HDV RNA in the light of the current knowledge of circular cellular RNAs, especially in terms of how they arise and their possible functions. Secondarily, the HDV studies might provide some useful insights for those studying host RNA circles. HDV RNA circles HDV was discovered in 1977 in patients with a more severe form of HBV infection [17]. In 1986, the RNA genome of HDV was shown to be circular in conformation [14-16]. During infection, as many as copies of HDV genomic RNA are transcribed per infected hepatocyte, with a somewhat lower amount of its exact complement, the antigenome [14]. The purified circular HDV RNAs were shown by electron microscopy to fold into an unbranched rod. Computer predictions support this interpretation [18] indicating potential intra-molecular base pairing for around 74% of all nucleotides. Assuming this folding also occurs in infected cells, it might be important in several ways, including RNA replication and stability. Nevertheless, extensive folding into a rod-like structure of purified HDV RNAs is considered to be relevant for binding by the delta antigen. Thus, it will be interesting to see for the recently described host RNA circles, whether intra-molecular base pairing occurs, and if so, whether it can have functional significance. origin of HDV The increasing abundance of nucleotide sequences for viral and host genomes provides many opportunities for considering the origin of viral sequences [19,20], and in some cases viral sequences present as integrated DNA provide measures of the earlier times in history when a virus was present. Such paleovirology is relevant here in that it shows that relatives of duck hepatitis B virus, a relative of HBV, existed at least 20 million years ago [21] and maybe existed before HBV [22]. We and others have previously tried to ascertain the origin of HDV [23,24]. What has been grasped at, as a potentially key element, is the origin of viroids, RNAs that are infectious in plants [25]. Viroids have small genomes, nucleotides in length, which can be circular in conformation. Viroids are thus even smaller than HDV and in addition, have no known protein coding capacity. Antigenomic RNA of HDV, in contrast, encodes one protein, the delta antigen. This protein, 195 amino acids in length, is essential for the accumulation of HDV RNA species in infected cells [26]. It is not translated from the circular antigenome, but from a less abundant linear mrna, that is both 5 -capped and 3 -polyadenylated [27]. Thus, some authors have speculated that HDV might have arisen by a recombination between a viroid-like element and a host mrna [28]. Candidates for such a host mrna include DIPA [29], and more recently of CPEB3 [20]. As will be explained, a better model can now be proposed. HDV has been isolated from patients located in many parts of the world. Others have already compared the nucleotide sequences of eight recognized genotypes of HDV [30] in attempts to determine whether their relatedness indicates a possible common ancestor [31,32]. Some genotypes however differ by as much as 40% in nucleotide sequence, but all encode a delta antigen and all contain ribozyme domains, as discussed subsequently. Since host RNA circles are abundant, diverse, and widespread, one might consider these as a potential source of an HDV RNA progenitor. However we do not have sufficient evidence to conclude that a cellular RNA is a likely origin of HDV, which requires not just a progenitor source of the delta antigen (see above) but, in addition, the ribozyme sequences, not so far found on host circular RNAs. Perhaps instead, HDV is derived from a viral RNA, and an obvious candidate for such a virus is HBV, as co-infection of the two viruses is required for HDV assembly. Several of the following factors might support this hypothetical chance event: (1) The life cycle of HDV depends on co-infection with HBV; (2) HBV causes chronic infections; at this time an estimated 350 million people are chronically infected [33]. This provides a huge reservoir from which HDV might have arisen (since HDV requires HBV as a helper); (3) Chronic infections can typically last years in an individual [33] ; this long time provides an increased window for a chance event; (4) The human liver contains about one trillion hepatocytes, and in a chronically infected individual most of these hepatocytes are infected. Such a large reservoir increases the opportunity for the chance production of an HDVlike RNA; (5) HBV replication involves transcription of RNAs from a covalently-closed circular double-stranded 2972 March 21, 2014 Volume 20 Issue 11

254 Taylor JM. RNA circles and HDV origin DNA, cccdna. The major processed HBV mrnas that accumulate are not spliced. However, in studies of chronic infections, several studies have reported the presence of spliced RNAs [33]. (For duck hepatitis B virus, even during acute infections, one can readily detect spliced RNAs, some of which are derived from multimers, beyond even three times the length of the genome [33,34].) Thus, there are opportunities for aberrant HBV RNA splicing events within the hepatocytes of chronically infected individuals; and (6) In nature HDV replicates in hepatocytes. These cells are predominantly differentiated and non-dividing. As discussed further below, such an environment may be preferred for the accumulation of aberrantly processed RNA circles. One or more of these six factors could increase the chance of producing an RNA circle that, like HDV, is replicated by host RNA polymerases. However, even then there will be the additional need of the circle (or its complement) to contain a coding region. This coding could be derived from HBV sequences or alternatively, by an event such as trans-splicing [5] or perhaps transcription from an integrated HBV DNA sequence, to incorporate host RNA sequences that might be expressed as a translatable RNA, to produce a protein that will support accumulation of new transcripts and the release of some of genomic RNA, via interaction with the envelope proteins produced and released from HBV infected cells. HBV envelope proteins encapsidate HBV (and HDV) nucleoscapids. Importantly, they are produced in vast excess of the amount needed to produce HBV, with the excess being released as distinctive surface antigen particles. It is estimated that surface antigen particles may be released in an up to fold of excess of virus [33]. This excess would favor the chance for release of a particle that contains an HDV RNA and is able to replicate RNA delivered, by HBV envelope proteins, to a new hepatocyte. New rounds of virus production would be ensured if the target cell is already infected by HBV, which is likely to be the case in HBV patients. In terms of the properties demanded of the delta antigen itself, it is worth noting that this protein is highly basic and readily interacts with nucleic acids [35]. Furthermore, it has recently been shown to have a high level of intrinsic disorder [35]. Like other viral proteins also known to have high intrinsic disorder, the delta antigen readily multimerizes and it forms association with many host proteins [36], as well as with a specific HBV envelope protein domain. While this broad hypothesis regarding the origin of HDV might seem plausible at this time, there are negative aspects that have to be faced. The most significant of these is that no sequence homology has yet been detected between HDV and any strain of HBV. However, it could be that the HDV sequence has evolved so much that an original homology is no longer apparent. Errorprone RNA-directed RNA transcription could be a major source of nucleotide sequence divergence [20]. In addition, the folding of RNA molecules might have provided multiple targets for post-transcriptional RNA editing, such as by adenosine deaminases, which would be especially important over time if that RNA was able to replicate. Interestingly, site-specific editing by an adenosine deaminase already plays an essential role in the HDV life cycle, leading to production of a modified form of delta antigen that has an essential role in genome packing into virions [37]. A summary of the steps involved in the above hypothesis is presented in Table 1. With regard to tracing the origins of HDV, it is important to note that the eight known HDV genotypes show extensive nucleotide sequence diversity, with an extreme of 40% mismatch between two genotypes [30]. Such extensive divergence might even allow the further speculation that there may be not one but multiple distinct origins of HDV arising from HBV-infected hepatocytes. That is, HDV is not a relic of an RNA world [38,39] or even a virus only as old as the hepadnaviruses [21] but is, instead, a satellite of HBV that has arisen much more recently and possibly several times through chance splicing events linked to individuals chronically infected with HBV. The hypothesis regarding the origin of HDV from HBV infected hepatocytes, together with the facts concerning its replication, allow some additional speculations. First, virus infections other than HBV may also produce RNA circles. A promising example might be polyoma virus, where double-stranded DNA circles act as templates for multiple RNA transcripts, some of which are up to several times unit-length, and all subject to RNA splicing events [40]. Second, it is possible that some host RNA circles, and even hypothetical non-hdv viral circles, can be replicated by host RNA polymerases. RNA-dependent RNA synthesis does not have to be as efficient as that of HDV. Even limited RNA-directed RNA transcription could enhance effects of the circular RNAs on the host cell; for example, it would increase the sponge effect on specific host mirnas that are able to bind to the RNAs [3,8]. HDV ribozymes and host HDV-like ribozymes Both the genomic and antigenomic RNA of HDV contain a single small sequence that will function in vitro, as a ribozyme [41-43]. Such activities have suggested relatedness to examples of self-splicing of host RNAs, but to date, this or a connection to canonical splicing has not been confirmed. The two HDV ribozymes have sequence and predicted structure relatedness to each other, which has been linked to the rod-like folding of the genome and antigenome [42-44]. In vitro, HDV ribozyme activity can be reversed to achieve self-ligation [45]. However, others have argued that in vivo this end joining reaction, like that involved in trna precursor splicing, is carried out by a cellular ligase, rather than a viral ribozyme [46]. The HDV self-cleaving ribozymes were first thought 2973 March 21, 2014 Volume 20 Issue 11

255 Taylor JM. RNA circles and HDV origin Table 1 Hypothesis for the origin of hepatitis delta virus An acute hepatitis B virus (HBV) infection becomes chronic, spreading to virtually all the hepatocytes in the liver HBV replication also involves transcription of many viral sequences some of which undergo splicing, with the potential to form stable RNA circles A rare RNA circle is selected both because it has the rare capacity to undergo RNA directed replication using host polymerase(s) and because it expresses a short protein that is both intrinsically disordered (favoring multimerization) and positively-charged (favoring RNA binding) Further replication and accumulation selects for increased efficiency, as facilitated by the encoded binding protein, which becomes the small delta antigen. The replicating RNA sequence undergoes many nucleotide changes, rendering it unrecognizable relative to HBV sequences. Such changes could be introduced by misincorporation during transcription and post-transcriptional RNA editing events A site-specific post-transcriptional modification of the RNA by an RNA editing enzyme leads to translation of a C-terminal elongated second form of the protein, the large delta antigen which undergoes farnesylation. This farnesylation facilitates the binding of the hepatitis delta virus (HDV) ribonucleoprotein complexes to HBV envelope proteins, leading to the release of virus particles that can infect susceptible hepatocytes and undergo further rounds of replication. This, in the presence of HBV co-infection, leads to the release of more HDV As listed above the hypothesis involves multiple steps, several of which would be rare events that have to be selected for. However, as separately enumerated in the text, there are other parameters that could favor such events. to be quite unique relative to other known ribozymes, both in sequence and predicted folding. Even after experimental determination of the tertiary structure of the HDV ribozymes [47], they seemed unique relative to previously determined structures of other ribozymes. However, when the structure and folding were used in order to search for HDV-like ribozymes, one was found in the intron of a host mrna, CPEB3 [48], and then many, many, more were found, across all kingdoms of life except Archaea [49,50]. In several cases these putative ribozymes were tested in vitro and proven to be functional [49]. In addition, it has been noted that some HDV-like ribozymes are so located that they may process transcripts of non-ltr retrotransposons, and possibly facilitate translation of such RNAs [50,51]. In apparent contrast to this, the ribozyme located on HDV antigenomic RNA is located downstream rather than upstream of the open reading frame for the delta antigen. This downstream location is immediately preceded by sequence signals, such as AAUAAA, as are used in typical polyadenylation of host mrnas [52]. A weakness of the present hypothesis of HDV origin via HBV sequences (as summarized in Table 1) is that it does not explain the origin of the two ribozymes. The model implies they may have been associated solely with expressed HBV sequences, but a modification is that variant splicing of expressed HBV sequences (possibly as transcribed from integrated HBV sequences) created a link to host sequences, leading to an RNA circle with associated HDV-like ribozyme sequences and even the protein encoding region that becomes the small delta antigen. It should be mentioned that in vitro studies have demonstrated the ability of HDV RNAs to bind proteins some of which are involved in RNA processing [53]. Examples include the splicing factor, ASF/SF2 [54] and the polypyrimidine tract-binding protein-associated splicing factor, PSF [55]. In terms of the latter finding, others have previously noted that the HDV RNAs have multiple polypyrimidine tracts [56]. While this may seem supportive of a splicing hypothesis, some caution is still needed since many host proteins not involved with splicing have been reported as binding to HDV RNAs; examples include eef1a1, p54(nrb), hnrnp-l, and GAPDH [53,54,57]. Replication/transcription of HDV RNAs For many years attempts have been made to understand how HDV RNAs are transcribed from RNA templates, and whether such transcription could be reconstructed in vitro with host nuclear extracts or even purified host polymerases. There is agreement that host RNA polymerase Ⅱ is redirected to act on an HDV RNA template [58]. In addition, there are data supporting a model of how RNA polymerase Ⅱ might act to transcribe RNA from an HDV RNA template [59]. The participation of this host enzyme normally used for the transcription from host DNA (and of course HBV cccdna) templates leading to mrna species, maybe provides circumstantial evidence for the above-described hypothesis concerning the origin of HDV. That is, host RNA polymerase Ⅱ transcripts are the ones destined for processing events that include splicing and polyadenylation, and as now understood, RNA circle formation. Nevertheless, there remains controversy as to whether or not HDV RNA-directed RNA transcription also makes use of another host RNA polymerase [60]. There is also controversy as to how aspects of HDV RNAdirected transcription deduced from in vitro transcription assays reflect what happens in vivo. For example, while polymerase Ⅱ has been found to bind the ends of HDV rod-like RNA sequences [61], subsequent studies show that so also do polymerases Ⅰ and Ⅲ [62]. At the present time, it is not entirely clear how transcription from HDV genomic and antigenomic RNA templates is initiated. One clue comes from the observation that HDV replication leads to the accumulation of a less than full-length linear RNA (it is up to 500-times less abundant than the accumulated genomic RNA circles [14,52] ). This RNA has a 5 -cap and a 3 -polyadenylation. It contains the open reading frame for the delta antigen, the one protein of HDV, and is considered the relevant mrna. In other words, it looks like a typical mrna produced by RNA polymerase Ⅱ. Thus, it is assumed that its 5 -end, which maps near one end of the rod-like genomic RNA template, might be a site of initiation and 2974 March 21, 2014 Volume 20 Issue 11

256 Taylor JM. RNA circles and HDV origin therefore help define a promoter element on the HDV RNA template. However there must also be at least one additional promoter site on the antigenomic RNA template for transcription of genomic RNA. Indeed, there may be additional, possibly multiple initiation sites on both RNAs; after all, on circular RNA templates, transcripts (by whatever RNA polymerase, not necessarily polymerase Ⅱ) that can elongate to beyond greater than unit-length, can have more than one ribozyme site, and could thus be processed to unit-length, and subsequently ligated to form new circles. This concept has for quite some time been included in a somewhat vague rolling-circle model of HDV replication [63]. Maybe, theoretically, replication of host RNA circles [9] might occur by a similar process. No one has yet determined if HDV RNA circles, like host RNA circles, bind host mirnas. If such binding does occur, this might lead to primed transcription of viral transcripts, some of which might be processed to unit length linear and then circular RNAs. As discussed below, circular RNAs, once formed, may have unique advantages, especially in terms of stability. RNA circles and their resistance to exo-nucleases For some time it has been known that in cell extracts, RNA species in a circular conformation have much greater stability than the corresponding linear species [64]. The interpretation is that host nucleases are primarily exo- rather than endo-nucleases. This advantage has been ascribed to the naturally occurring HDV circular RNAs and more recently to the host RNA circles. One recent study confirmed the stability of the host RNA circles relative to other linear RNA species [5]. In addition, it has been noted that host RNA circle stability increases with decreasing size. Earlier studies established this relationship for deleted forms of the HDV RNA [65]. In addition, while the presence of the delta antigen enhanced the accumulation of processed full-length HDV RNA circles, the presence of delta antigen became irrelevant for RNA species that were about four times shorter [65]. Further study revealed that small and large circles could only accumulate when the ribozyme domain present on the circle was able to make intra-molecular base pairings that have been presumed to force the ribozyme into an alternative, inactive conformation [66,67]. The susceptibility of RNA circles to degradation via targeting with small interfering RNA, sirna, might be variable. One study of individual host RNA circles demonstrated susceptibility [5]. In contrast, a study of HDV RNAs, both in vivo and in vitro, detected no degradation associated with DICER activity [68]. ROLE(S) OF THE SMALL DELTA ANTIGEN A form of the delta antigen, 195 amino acids long, is essential for the accumulation of HDV RNAs in an infected cell [26]. Later it was found that a second form, 19 amino acids longer at the C-terminus, arises as a consequence of site-directed RNA editing of antigenomic RNA during replication [69]. This so-called large form of delta antigen is farnesylated near its novel C-terminus. Although it cannot support HDV RNA accumulation and is a dominant-negative inhibitor of replication supported by the small form, it is essential for the formation of enveloped virions via interaction with the HBV envelope proteins [70]. While the small delta antigen is essential for the accumulation of processed HDV RNAs it is not yet clear in what manner(s) it is essential. For example, it is controversial as to whether the protein has a direct or even indirect role in the transcription process [71,72]. Another example is whether or not the small delta antigen is needed as a chaperone for the cleavage and processing by the HDV ribozyme [65,73]. PathoGENIC POTENTIAL of HDV While it is clear that HDV/HBV co-infection is more damaging than one with HBV alone, the mechanism(s) involved are still controversial [74]. Experimentally it is possible to set up situations where HDV is replicating its genome in the absence of HBV. It is relevant to the present discussion that two different outcomes might arise from such mono-infections. First, in hepatocytes that are well-differentiated and non-dividing, it seems that HDV replication, per se, is not pathogenic. HDV to a small extent will infect mouse hepatocytes, in vivo, and the clearance of such infections takes 5-15 d, independent of the presence or absence of a host immune response [75]. Similarly, HDV will infect woodchuck hepatocytes, and even after 5 wk infected cells remain from which HDV can be rescued by a superinfection with woodchuck hepatitis virus [76]. And of most relevance, HDV can infect human hepatocytes maintained by transplantation into mice in which the resident mouse hepatocytes have been largely destroyed. These HDV infected cells do not decrease with time and even after 6 wk, superinfection with HBV rescues HDV, leading to spread of HDV to human hepatocytes that were not initially infected by HDV [77]. Second, consider the following model system [78]. A human cell line, HEK293, was transfected with an HDV RNA, one mutated so that the delta antigen cannot be expressed. This cell line also contained a stably integrated cdna copy of the HDV antigen, with expression inducible by tetracycline. Even without induction, the amount of delta antigen produced was sufficient to maintain low levels of HDV RNA replication and accumulation for at least three years. However, when the antigen was induced, the amount of HDV RNA accumulation increased up to 40-fold, and within 48 h led to cell cycle arrest and detachment of the cells from monolayer culture. More importantly, when host individual host RNA levels were assayed, even by 24 h the levels of more than March 21, 2014 Volume 20 Issue 11

257 Taylor JM. RNA circles and HDV origin host genes were altered by at least 2-fold (with > 95% confidence level). In control cells expressing only the increased amount of delta antigen, the number of host mrnas changed was ten times less [74]. Thus, in some cells high level replication and accumulation of HDV RNAs might have a significant impact on cell gene expression and viability. From the above studies, we might conclude that HDV RNA replication and accumulation is more damaging when the cells are dividing than when they are nondividing (as is typically the case with human hepatocytes). If this interpretation is correct, one of many inferences could be that host RNA circles can accumulate to a greater extent and with less deleterious effect in differentiated non-dividing cells, such as hepatocytes and yet, when the cells are induced to divide (e.g., to replace hepatocytes destroyed by the antiviral immune response), RNA circles might perturb host RNA levels and lead to decreased viability of the infected cells. Interestingly, in HEK293 cells, Memczak et al [8] have described the accumulation of a specific 1500 nt circular host RNA that binds multiple copies of a specific host mirna, and has a regulatory role. Changes in the amount of this RNA or of the mirna that binds to it, had profound effects on the levels of many host RNA species. CONCLUSION New realizations concerning circular forms of host RNAs have provoked this re-examination of aspects of HDV, especially its origin and the mode of replication, and also suggested new insights into potential HDV-associated pathogenesis. However, it should also be acknowledged that HDV studies might have a reciprocal relevance to the host circular RNAs, such as how they arise and affect the host cell. And, although not considered here, there remains a need for a similar re-examination of the replicating small circular RNAs of plants, that is, the viroids and virusoids. ACKNOWLEDGMENTS Helpful comments on this manuscript were provided by William Mason and Jinhong Chang. The RNA array data cited in reference 74 were obtained at the Fox Chase Cancer Center, in collaboration with Zi-Ying Han, Jinhong Chang, Mike Slifka, Suraj Peri, Karthik Devarajan and Yu-Sheng Li. REFERENCES 1 Nigro JM, Cho KR, Fearon ER, Kern SE, Ruppert JM, Oliner JD, Kinzler KW, Vogelstein B. Scrambled exons. Cell 1991; 64: [PMID: DOI: / (91)90244-S] 2 Capel B, Swain A, Nicolis S, Hacker A, Walter M, Koopman P, Goodfellow P, Lovell-Badge R. Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 1993; 73: [PMID: DOI: / (93) Y] 3 Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems J. Natural RNA circles function as efficient microrna sponges. Nature 2013; 495: [PMID: DOI: /nature11993] 4 Danan M, Schwartz S, Edelheit S, Sorek R. Transcriptomewide discovery of circular RNAs in Archaea. Nucleic Acids Res 2012; 40: [PMID: DOI: /nar/ gkr1009] 5 Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF, Sharpless NE. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA 2013; 19: [PMID: DOI: /rna ] 6 Hansen TB, Kjems J, Damgaard CK. Circular RNA and mir-7 in cancer. Cancer Res 2013; 73: [PMID: DOI: / CAN ] 7 Hansen TB, Wiklund ED, Bramsen JB, Villadsen SB, Statham AL, Clark SJ, Kjems J. mirna-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA. EMBO J 2011; 30: [PMID: DOI: /emboj ] 8 Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L, Mackowiak SD, Gregersen LH, Munschauer M, Loewer A, Ziebold U, Landthaler M, Kocks C, le Noble F, Rajewsky N. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013; 495: [PMID: DOI: /nature11928] 9 Valdmanis PN, Kay MA. The expanding repertoire of circular RNAs. Mol Ther 2013; 21: [PMID: DOI: /mt ] 10 Wilusz JE, Sharp PA. Molecular biology. A circuitous route to noncoding RNA. Science 2013; 340: [PMID: DOI: /science ] 11 Perkel JM. Assume nothing: the tale of circular RNA. Biotechniques 2013; 55: [PMID: ] 12 Ledford H. Circular RNAs throw genetics for a loop. Nature 2013; 494: 415 [PMID: DOI: /494415a] 13 Kosik KS. Molecular biology: Circles reshape the RNA world. Nature 2013; 495: [PMID: ] 14 Chen PJ, Kalpana G, Goldberg J, Mason W, Werner B, Gerin J, Taylor J. Structure and replication of the genome of the hepatitis delta virus. Proc Natl Acad Sci USA 1986; 83: [PMID: DOI: /pnas ] 15 Kos A, de Reus A, Dubbeld M, Murray K, Bruce S, Beattie P, Arnberg A, Schellekens H. Biological and molecular characterization of the hepatitis delta virus. Prog Clin Biol Res 1987; 234: [PMID: DOI: /323558a0] 16 Wang KS, Choo QL, Weiner AJ, Ou JH, Najarian RC, Thayer RM, Mullenbach GT, Denniston KJ, Gerin JL, Houghton M. Structure, sequence and expression of the hepatitis delta (delta) viral genome. Nature 1986; 323: [PMID: DOI: /323508a0] 17 Rizzetto M, Canese MG, Aricò S, Crivelli O, Trepo C, Bonino F, Verme G. Immunofluorescence detection of new antigenantibody system (delta/anti-delta) associated to hepatitis B virus in liver and in serum of HBsAg carriers. Gut 1977; 18: [PMID: DOI: /gut ] 18 Kuo MY, Goldberg J, Coates L, Mason W, Gerin J, Taylor J. Molecular cloning of hepatitis delta virus RNA from an infected woodchuck liver: sequence, structure, and applications. J Virol 1988; 62: [PMID: ] 19 Moelling K. What contemporary viruses tell us about evolution: a personal view. Arch Virol 2013; 158: [PMID: DOI: /s ] 20 Holmes EC. Virus evolution. In: Knipe DM, Howley PM, editors. Fields Virology. 6th ed. Philadelphia: Lippincott Williams & Wilkins, 2013: Gilbert C, Feschotte C. Genomic fossils calibrate the long-term evolution of hepadnaviruses. PLoS Biol 2010; 8: pii: e [PMID: ] 22 Suh A, Brosius J, Schmitz J, Kriegs JO. The genome of a Mesozoic paleovirus reveals the evolution of hepatitis B viruses March 21, 2014 Volume 20 Issue 11

258 Taylor JM. RNA circles and HDV origin Nat Commun 2013; 4: 1791 [PMID: DOI: / ncomms2798] 23 Taylor J, Pelchat M. Origin of hepatitis delta virus. Future Microbiol 2010; 5: [PMID: DOI: / fmb.10.15] 24 Brazas R, Ganem D. A cellular homolog of hepatitis delta antigen: implications for viral replication and evolution. Science 1996; 274: [PMID: DOI: /science ] 25 Flores R, Ruiz-Ruiz S, Serra P. Viroids and hepatitis delta virus. Semin Liver Dis 2012; 32: [PMID: DOI: /s ] 26 Chao M, Hsieh SY, Taylor J. Role of two forms of hepatitis delta virus antigen: evidence for a mechanism of self-limiting genome replication. J Virol 1990; 64: [PMID: ] 27 Gudima S, Wu SY, Chiang CM, Moraleda G, Taylor J. Origin of hepatitis delta virus mrna. J Virol 2000; 74: [PMID: DOI: /JVI ] 28 Robertson HD. How did replicating and coding RNAs first get together? Science 1996; 274: [PMID: DOI: /science ] 29 Long M, de Souza SJ, Gilbert W. Delta-interacting protein A and the origin of hepatitis delta antigen. Science 1997; 276: [PMID: ] 30 Dény P. Hepatitis delta virus genetic variability: from genotypes I, II, III to eight major clades? Curr Top Microbiol Immunol 2006; 307: [PMID: DOI: / _8] 31 Huang CR, Lo SJ. Evolution and diversity of the human hepatitis d virus genome. Adv Bioinformatics 2010; [PMID: ] 32 Anisimova M, Yang Z. Molecular evolution of the hepatitis delta virus antigen gene: recombination or positive selection? J Mol Evol 2004; 59: [PMID: DOI: /s x] 33 Seeger C, Zoulim F, Mason WS. Hepadnaviruses. In: Knipe DM, Howley PM, editors. Fields Virology. 6th ed. Philadelphia: Lippincott Williams & Wilkins, 2013: Mason WS, Taylor JM, Seal G, Summers J. The duck hepatitis B virus, an HBV-like virus of domestic ducks. In: Alter H, Maynard J, Szmuness W, editors. Proceedings of the Symposium on Viral Hepatitis. Philadelphia: Franklin Institute Press, 1981: Alves C, Cheng H, Roder H, Taylor J. Intrinsic disorder and oligomerization of the hepatitis delta virus antigen. Virology 2010; 407: [PMID: DOI: / j.virol ] 36 Cao D, Haussecker D, Huang Y, Kay MA. Combined proteomic-rnai screen for host factors involved in human hepatitis delta virus replication. RNA 2009; 15: [PMID: DOI: /rna ] 37 Casey JL, Tennant BC, Gerin JL. Genetic changes in hepatitis delta virus from acutely and chronically infected woodchucks. J Virol 2006; 80: [PMID: DOI: /JVI ] 38 Diener TO. Circular RNAs: relics of precellular evolution? Proc Natl Acad Sci USA 1989; 86: [PMID: DOI: /pnas ] 39 Ma W, Yu C, Zhang W. Circularity and self-cleavage as a strategy for the emergence of a chromosome in the RNAbased protocell. Biol Direct 2013; 8: 21 [PMID: DOI: / ] 40 Acheson NH. Polyoma virus giant RNAs contain tandem repeats of the nucleotide sequence of the entire viral genome. Proc Natl Acad Sci USA 1978; 75: [PMID: DOI: /pnas ] 41 Kuo MY, Sharmeen L, Dinter-Gottlieb G, Taylor J. Characterization of self-cleaving RNA sequences on the genome and antigenome of human hepatitis delta virus. J Virol 1988; 62: [PMID: ] 42 Sharmeen L, Kuo MY, Dinter-Gottlieb G, Taylor J. Antigenomic RNA of human hepatitis delta virus can undergo selfcleavage. J Virol 1988; 62: [PMID: ] 43 Chang J, Moraleda G, Gudima S, Taylor J. Efficient site-specific nonribozyme opening of hepatitis delta virus genomic RNA in infected livers. J Virol 2000; 74: [PMID: ] 44 Macnaughton TB, Wang YJ, Lai MM. Replication of hepatitis delta virus RNA: effect of mutations of the autocatalytic cleavage sites. J Virol 1993; 67: [PMID: ] 45 Sharmeen L, Kuo MY, Taylor J. Self-ligating RNA sequences on the antigenome of human hepatitis delta virus. J Virol 1989; 63: [PMID: ] 46 Reid CE, Lazinski DW. A host-specific function is required for ligation of a wide variety of ribozyme-processed RNAs. Proc Natl Acad Sci USA 2000; 97: [PMID: DOI: /pnas ] 47 Ferré-D Amaré AR, Zhou K, Doudna JA. A general module for RNA crystallization. J Mol Biol 1998; 279: [PMID: DOI: /jmbi ] 48 Salehi-Ashtiani K, Lupták A, Litovchick A, Szostak JW. A genomewide search for ribozymes reveals an HDVlike sequence in the human CPEB3 gene. Science 2006; 313: [PMID: DOI: /science ] 49 Webb CH, Riccitelli NJ, Ruminski DJ, Lupták A. Widespread occurrence of self-cleaving ribozymes. Science 2009; 326: 953 [PMID: DOI: /science ] 50 Riccitelli N, Lupták A. HDV family of self-cleaving ribozymes. Prog Mol Biol Transl Sci 2013; 120: [PMID: DOI: /B ] 51 Ruminski DJ, Webb CH, Riccitelli NJ, Lupták A. Processing and translation initiation of non-long terminal repeat retrotransposons by hepatitis delta virus (HDV)-like selfcleaving ribozymes. J Biol Chem 2011; 286: [PMID: DOI: /jbc.M ] 52 Hsieh SY, Taylor J. Regulation of polyadenylation of hepatitis delta virus antigenomic RNA. J Virol 1991; 65: [PMID: ] 53 Sikora D, Greco-Stewart VS, Miron P, Pelchat M. The hepatitis delta virus RNA genome interacts with eef1a1, p54(nrb), hnrnp-l, GAPDH and ASF/SF2. Virology 2009; 390: [PMID: DOI: /j.virol ] 54 Sikora D, Zhang D, Bojic T, Beeharry Y, Tanara A, Pelchat M. Identification of a binding site for ASF/SF2 on an RNA fragment derived from the hepatitis delta virus genome. PLoS One 2013; 8: e54832 [PMID: DOI: /journal. pone ] 55 Greco-Stewart VS, Thibault CS, Pelchat M. Binding of the polypyrimidine tract-binding protein-associated splicing factor (PSF) to the hepatitis delta virus RNA. Virology 2006; 356: [PMID: DOI: /j.virol ] 56 Branch AD, Lee SE, Neel OD, Robertson HD. Prominent polypurine and polypyrimidine tracts in plant viroids and in RNA of the human hepatitis delta agent. Nucleic Acids Res 1993; 21: [PMID: DOI: / nar/ ] 57 Greco-Stewart V, Pelchat M. Interaction of host cellular proteins with components of the hepatitis delta virus. Viruses 2010; 2: [PMID: DOI: /v ] 58 Chang J, Nie X, Chang HE, Han Z, Taylor J. Transcription of hepatitis delta virus RNA by RNA polymerase II. J Virol 2008; 82: [PMID: DOI: / JVI ] 59 Lehmann E, Brueckner F, Cramer P. Molecular basis of RNA-dependent RNA polymerase II activity. Nature 2007; 450: [PMID: DOI: /nature06290] 60 Tseng CH, Lai MM. Hepatitis delta virus RNA replication. Viruses 2009; 1: [PMID: DOI: / v ] 2977 March 21, 2014 Volume 20 Issue 11

259 Taylor JM. RNA circles and HDV origin 61 Greco-Stewart VS, Miron P, Abrahem A, Pelchat M. The human RNA polymerase II interacts with the terminal stem-loop regions of the hepatitis delta virus RNA genome. Virology 2007; 357: [PMID: DOI: /j.virol ] 62 Greco-Stewart VS, Schissel E, Pelchat M. The hepatitis delta virus RNA genome interacts with the human RNA polymerases I and III. Virology 2009; 386: [PMID: DOI: /j.virol ] 63 Taylor JM. Hepatitis delta virus: cis and trans functions required for replication. Cell 1990; 61: [PMID: DOI: / (90)90516-H] 64 Puttaraju M, Been MD. Generation of nuclease resistant circular RNA decoys for HIV-Tat and HIV-Rev by autocatalytic splicing. Nucleic Acids Symp Ser 1995; (33): [PMID: ] 65 Lazinski DW, Taylor JM. Expression of hepatitis delta virus RNA deletions: cis and trans requirements for self-cleavage, ligation, and RNA packaging. J Virol 1994; 68: [PMID: ] 66 Lazinski DW, Taylor JM. Regulation of the hepatitis delta virus ribozymes: to cleave or not to cleave? RNA 1995; 1: [PMID: ] 67 Lazinski DW, Taylor JM. Intracellular cleavage and ligation of hepatitis delta virus genomic RNA: regulation of ribozyme activity by cis-acting sequences and host factors. J Virol 1995; 69: [PMID: ] 68 Chang J, Provost P, Taylor JM. Resistance of human hepatitis delta virus RNAs to dicer activity. J Virol 2003; 77: [PMID: DOI: /JVI ] 69 Polson AG, Bass BL, Casey JL. RNA editing of hepatitis delta virus antigenome by dsrna-adenosine deaminase. Nature 1996; 380: [PMID: DOI: /380454a0] 70 Wang HW, Chen PJ, Lee CZ, Wu HL, Chen DS. Packaging of hepatitis delta virus RNA via the RNA-binding domain of hepatitis delta antigens: different roles for the small and large delta antigens. J Virol 1994; 68: [PMID: ] 71 Yamaguchi Y, Deléhouzée S, Handa H. HIV and hepatitis delta virus: evolution takes different paths to relieve blocks in transcriptional elongation. Microbes Infect 2002; 4: [PMID: DOI: /S (02) ] 72 Yamaguchi Y, Mura T, Chanarat S, Okamoto S, Handa H. Hepatitis delta antigen binds to the clamp of RNA polymerase II and affects transcriptional fidelity. Genes Cells 2007; 12: [PMID: DOI: /j x] 73 Wang CC, Chang TC, Lin CW, Tsui HL, Chu PB, Chen BS, Huang ZS, Wu HN. Nucleic acid binding properties of the nucleic acid chaperone domain of hepatitis delta antigen. Nucleic Acids Res 2003; 31: [PMID: DOI: /nar/gkg857] 74 Taylor JM. Viral Hepatitis D. In: Monga SPS, editor Molecular Pathology of Liver Diseases. New York: Springer Business Media, 2011: Netter HJ, Kajino K, Taylor JM. Experimental transmission of human hepatitis delta virus to the laboratory mouse. J Virol 1993; 67: [PMID: ] 76 Netter HJ, Gerin JL, Tennant BC, Taylor JM. Apparent helper-independent infection of woodchucks by hepatitis delta virus and subsequent rescue with woodchuck hepatitis virus. J Virol 1994; 68: [PMID: ] 77 Giersch K, Helbig M, Volz T, Allweiss L, Mancke LV, Lohse AW, Polywka S, Pollok JM, Petersen J, Taylor J, Dandri M, Lütgehetmann M. Persistent hepatitis D virus mono-infection in humanized mice is efficiently converted by hepatitis B virus to a productive co-infection. J Hepatol 2014; 60: [PMID: DOI: /j.jhep ] 78 Chang J, Gudima SO, Tarn C, Nie X, Taylor JM. Development of a novel system to study hepatitis delta virus genome replication. J Virol 2005; 79: [PMID: DOI: /JVI ] P- Reviewers: Assy N, Cunha C, Liu HF S- Editor: Gou SX L- Editor: A E- Editor: Ma S 2978 March 21, 2014 Volume 20 Issue 11

260 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. ORIGINAL BRIEF ARTICLE Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines Sajjad Khan, Silke Cameron, Martina Blaschke, Federico Moriconi, Naila Naz, Ahmad Amanzada, Giuliano Ramadori, Ihtzaz Ahmed Malik Sajjad Khan, Silke Cameron, Martina Blaschke, Federico Moriconi, Naila Naz, Ahmad Amanzada, Giuliano Ramadori, Ihtzaz Ahmed Malik, Clinic of Gastroenterology and Endocrinology, University Medical Center, Robert-Koch-Str. 40, Goettingen, Germany Author contributions: Khan S, Ramadori G and Malik IA defined the research theme; Khan S designed methods and experiments, carried out all the laboratory experiments, analyzed the data, interpreted the results and wrote the paper; Cameron S and Blaschke M co-worked on associated data collection and their interpretation; Naz N, Moriconi F and Amanzada A co-designed experiments, discussed analyses, interpretation, and presentation; all authors have contributed to, seen and approved the manuscript. Supported by The German Research Foundation and the Open Access Publication Funds of the Göttingen University Correspondence to: Dr. Ihtzaz Ahmed Malik, Clinic of Gastroenterology and Endocrinology, University Medical Center, Robert-Koch-Str. 40, Goettingen, Germany. i.malik@med.uni-goettingen.de Telephone: Fax: Received: August 21, 2013 Revised: December 5, 2013 Accepted: January 2, 2014 Published online: March 21, 2014 Abstract AIM: To study KRAS /BRAF mutations in colorectalcancer (CRC) that influences the efficacy of treatment. To develop strategies for overcoming combination of treatment. METHODS: Five colonic cell-lines were investigated: DLD-1 with KRAS (G13D) mutation, HT 29 and Colo 205 with BRAF (V600E) mutation as well as the wild type (Wt) cell-lines Caco2 and Colo-320. DLD-1 (KRAS), HT-29 (BRAF) and Caco2 (Wt) cell lines were treated with cytokines (TNFα 50 ng, IL-1β 1 ng and IFNγ 50 ng) and harvested at different time points (1-24 h). KRAS inhibition was performed by the sirna-approach. Two colorectal cancer cells DLD-1 and Caco2 were used for KRAS inhibition. About 70% confluency were confirmed before transfection with small interferring RNA (sirna) oligonucleotides. All the synthetic sirna sequences were designed in our laboratory. Total RNA and protein was isolated from the cells for RT-PCR and Western blotting. Densitometry of the Western blotting was analyzed with the Image J software (NIH). Results are shown as mean ± SD. RESULTS: RT-PCR analysis in non-stimulated cells showed a low basal expression of TNFα and IL-1β in the DLD-1 KRAS -mutated cell-line, compared to Caco2 wild type. No detection was found for IL-6 and IFNγ in any of the studied cell lines. In contrast, pro-angiogenic chemokines (CXCL1, CXCL8) showed a high constitutive expression in the mutated cell-lines DLD-1 (KRAS), HT-29 and Colo205 (BRAF), compared to wild type (Caco2). The anti-angiogenic chemokine (CXCL10) showed a high basal expression in wild-type, compared to mutated cell-lines. KRAS down-regulation by sirna showed a significant decrease in CXCL1 and CXCL10 gene expression in the DLD-1 (KRAS) cell-line in comparison to wild type (Caco2) at 72 h after KRAS silencing. In contrast, the specific KRAS inhibition resulted in an up-regulation of CXCL1 and CXCL10. The results of our study show a higher expression of pro-angiogenic chemokines at basal level in mutated cell-lines, which was further increased by cytokine treatment. CONCLUSION: To summarize, basal chemokine gene expression for pro-angiogenic chemokines was high in mutated as compared to wild type cell-lines. This reflects the likely existence of a different microenvironment in tumours consistent of wild type or mutated cells. This may help to rationalize the choice of molecular targets for suitable therapeutic investigation in clinical studies Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Colorectal-cancer; KRAS; BRAF; CXCL1 (GROα); CXCL10 (IP-10); CXCL8 (IL-8); Tumor necrosis factor-α; Interleukin-1β; Interferon-γ; sirna 2979 March 21, 2014 Volume 20 Issue 11

261 Khan S et al. Chemokines gene expression in CRC cell-lines Core tip: The presence of KRAS /BRAF mutations in advanced colorectal-cancer influences the efficacy of treatment. It is not known whether the composition of tumor-associated immune cells is influenced by the mutational status of the tumor. The results of our study show a higher expression of pro-angiogenic chemokines at basal level in mutated cell-lines, which was further up-regulated by cytokine treatment. Moreover, specific KRAS inhibition resulted in an increase of pro-angiogenic chemokines, mainly through the NF-κB pathway in wt (Caco2). Our findings point to the interconnection of tumor mutation and its microenvironment. Khan S, Cameron S, Blaschke M, Moriconi F, Naz N, Amanzada A, Ramadori G, Malik IA. Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/2979.htm DOI: i INTRODUCTION Colorectal carcinoma (CRC) is considered as one of the most common lethal cancers all over the world [1]. The major causes for CRC are environmental factors rather than heritable genetic changes. The most important risk factors for sporadic CRC include food-born mutagens, specific intestinal pathogens, chronic intestinal inflammation and age [2]. Mutations in oncogenic and loss of tumor suppressor genes trigger tumor development through mutiple pathways [3]. KRAS and BRAF are the most common mutations found in CRC which can alter the cell signalling pathways [4,5]. The RAS and RAF family of genes code for proteins which belong to the RAS/RAF/MEK/ERK signalling cascade within cells [6]. This cascade is involved in the transmission of extracellular signals which control a variety of biological processes such as cell growth, cell survival and migration [7]. Disruption of this pathway, through gain-of-function mutations in RAS and RAF family members, is well described in several different types of cancer. In CRCs, mutations are less frequently found in the BRAF and to a larger extent in the KRAS genes [8,9]. The later is an early event [10,11] and occuring in 30%-50% of these tumors [8]. KRAS and its downstream effector molecules play a central role in the development of several tumor types, including colon cancer [12]. In fact, the KRAS and BRAF proteins are known to be a key downstream component of epidermal growth factor receptor (EGFR) signaling [13]. EGFR signaling is an important mediator within the tumor microenvironment and is well established in autocrine and paracrine circuits that result in enhanced tumor growth [14]. A major contributor to the tumor microenvironment are inflammation and its mediators (especially the cytokines) [15]. Tumor cells themselves can produce cytokines, including interleukin-1 α/β (IL-1α/β), interferon gamma (IFNγ) and tumor necrosis factor α (TNFα) [16] maintaining a proinflammatory microenvironment. They also secrete chemokines inducing further infiltration of immune-cells. It is known that colorectal tumors that are not associated with clinically detectable inflammatory bowel disease (IBD) show an immune cell infiltrate and an increased expression of pro-inflammatory cytokines (IL-1β, IFNγ and TNFα) [17-20]. Not only tumor cells themselves, but also stromal cells of the tumor microenvironment may release pro-inflammatory cytokines which in turn act on CRCcells to secrete chemokines [21]. These chemokines attract immune cells which act on the tumor cell and its microenvironment, thereby multiplying the inflammatory effects and subsequent tumor initiation and promotion [22]. Chemo-attractant cytokines play a key role in the modulation of the immune system [23]. Chemokines are thought to be responsible for recruiting immune cells. They are actively involved in inflammation, tissue repair, development of fibrosis and tumor growth [24-26]. Chemokines, comprise a set of low-molecular weight cytokines (7-10 kda), which play a key role in directing migration and activation of leukocytes in the inflammatory processes [27]. Based on their primary structure, chemokines are distinguished as C, CC, CXC or CX3C where X represents a non-conserved amino acid substitution [28]. Several studies have been published to elucidate the dual role of chemokines in promotion and inhibition of angiogenesis [22,29]. Of the CXC chemokines which regulate angiogenesis, CXCL1 promotes tumor angiogenesis, whilst CXCL10 inhibits neo-vascularisation [20,30-32]. Based on these studies, we hypothesized that stromal cells of the tumor microenvironment may release proinflammatory cytokines (IL-1β, IFNγ, and TNFα) EGF which in turn act on CRC-cells to secrete chemokines (CXCL1 and CXCL10). These chemokines in turn attract inflammatory cells which influence on the tumor cells and their microenvironment, thereby multiplying the inflammatory effects and subsequent tumor initiation and promotion. Little is known about the effect of these pro-inflammatory mediators on the gene expression of chemokines (CXCL1 and CXCL10) in the presence/absence of KRAS mutation. Hence, the profile of cytokine (TNFα, IFNγ and IL-1β) and pro- (CXCL1) and anti-angiogenic (CXCL10) chemokine gene expression was examined in view of the different mutations in CRC cell lines. It was the aim of this study to further investigate the regulation of these chemokines in CRC mutated and non-mutated cell lines after administration of pro-inflammatory cytokines (TNFα, IFNγ and IL-1β). Finally, the role of these chemokines was explored by knocking down the KRAS gene in mutant (DLD-1) and wild type (Caco2) colorectal cancer cell lines. Our findings would give an insight into the interconnec March 21, 2014 Volume 20 Issue 11

262 Khan S et al. Chemokines gene expression in CRC cell-lines Table 1 List of human primers sequences used for polymerase chain reactions Primer 5 3 forward 5 3 reverse Human β-actin CTG GCACCCAGCACAATG CCGATCCACACGGAGTACTTG Human CXCL1 (GROα) GTGTGAACGTGAAGTCCCCC GCTGCAGAAATCAGGAAGGC Human CXCL8 (IL-8) ATGACTTCCAAGCTGGCCG GCTGCAGAAATCAGGAAGGC Human CXCL10 (IP-10) CCAGAATCGAAGGCCATCAA CATTTCCTTGCTAACTGCTTTCAG Human TNFα CCCAGGCAGTCAGATCATCTTC AGCTGCCCCTCAGCTTGA Human IFNγ CCAACGCAAAGCAATACATGA TTTTCGCTTCCCTGTTTTAGC Human IL-1β AATTTGAGTCTGCCCAGTTCCC AGTCAGTTATATCCTGGCCGCC Human TNFα Rec1 AGGAAGAACCAGTACCGGCAT TCTGTTTCTCCTGGCAGGAGA Human IL1β Rec1 TGTTCAGGAGCTGAAGCCCAT AATTCACACAGCAGGACAG Human IFNγ Rec1 AAGAGCCGTTGTCTCCAGCAA TAAAGCGATGCTGCCAGGTTC Human KRAS Codon 12 and 13 RAS A (Forward): 5' ACTGAATATAAACTTGTGGTCCATGGAGCT 3' RAS B (Reverse): 5' TTATCTGTATCAAAGAATGGTCCTGCACCA 3' RAS C (Reverse): 5' GGATGGTCCTCCACCAGTAATATGGATATT 3' Human BRAF V600E A-Allele (Forward): 5' AAAAATAGGTGATTTTGGTCTAGCTACTGTA 3' T-Allele (Forward): 5' AAAAATAGGTGATTTTGGTCTAGCTACTGT 3' (Reverse): 5' ACACTGATTTTTGTGAATACTGGGAACT 3' TNFα:Tumor necrosis factor α; INFγ: Interferon-γ; IL-1β: Interleukin-1β. tion of the tumour and its micro-environmental factors. MATERIALS AND METHODS Chemicals and antibodies The chemicals used in the present study were of analytical/molecular biology grade and purchased from commercial sources as follows: The recombinant cytokines IL-1β, TNFα and IFNγ were purchased from Roche (Mannheim, Germany). The chemicals and solutions were purchased from Sigma (Steinheim, Germany): aprotinin, DL-dithiothreitol (DTT), EDTA, leupeptin, phenylmethylsulfonyl fluoride (PMSF), phorbol 12-myristate 13-acetate (PMA), phosphatase inhibitor cocktail 1 and 2, thiourea, urea; from Merck (Darmstadt, Germany): Glycerin, HCl; RPMI 1640 medium, foetal calf serum (FCS), penicillin/streptomycin and phosphate buffered saline were purchased from Biochrom AG (Berlin,Germany); and from Bio-Rad (Munich, Germany): The protein assay kit and ampholytes (Bio-Lyte 3/10) were obtained from BIO-RAD (Munich, Germany): Primers, protector RNAse inhibitor and 1x RT buffer were supplied by Invitrogen (Darmstadt, Germany). The FAST Sybr Green master mix was purchased from Applied Biosystems (Darmstadt, Germany) and moloney murine leukaemia virus reverse transcriptase (M-MLV RT) from Promega (Mannheim, Germany). A list of primers used in the study is shown in (Tables 1 and 2). A list of all antibodies used in this study is listed with its concentrations in (Table 3). Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany). Caco2 cells were grown in EMEM (Eagle s minimal essential medium), BioWhittacker, (Darmstadt, Germany) containing 20% fetal calf serum (FCS) supplemented with 100 U/mL each of penicillin and streptomycin and 1% non-essential amino acids at 37 and 5% CO2. DLD-1, HT-29, Colo-320 and Colo-205 were grown in RPMI (Roswell Park Memorial Institute Medium) with glutamin purchased from Biochrom AG (Berlin,Germa ny);containing 10% FCS and 100 U/mL penicillin and streptomycin at 37 and 5% CO2. Caco2, HT-29 and DLD-1 cells were plated into six-well plates at a density of cells per well for real-time polymerase chain reactions (PCRs), Western Blot analysis and sirna experiments unless until stated and grown till they reached 70%-80% confluence. These cells were then stimulated with IL-1β (1 ng/ml), TNFα (50 ng/ml) and IFNγ (50 ng/ml) based on the type of experiments. RNA isolation and real-time PCR Total Ribonucleic acid (RNA) was isolated from cell lysates by using Qiagen (Hilden,Germany) RNeasy mini kit, according to the manufacturer s protocol. The RNA concentrations were determined photometrically using a Gene Quant RNA/deoxyribonucleic acid (DNA) calculator Pharmacia, (Freiburg, Germany). RNA was subsequently used for real-time PCR. The cdna was generated by reverse transcription of 1µg of total RNA using 100 nmol/l of dntps from Invitrogen (Darmstadt, Germany), 50 pm of primer oligo(dt)15 Roche (Mannheim, Germany), 200 units of (M-MLV) Moulony murine leukemia virus reverse (Roche) transcriptase 16U of protector RNAse inhibitor (Roche) in 1 RT buffer Invitrogen (Darmstadt, Germany) and 2.5 ml of 0.1 mol/l dithiothreitol (DTT) from Invitrogen (Darmstadt, Germany) for 1 h at 40 as described [33]. Reverse transcription of messenger RNA (mrna) was performed using 1 μg of total cellular RNA. To determine the mrna expression real-time PCR was carried out using human gene-specific primers Invitrogen GmbH (Karlsruhe, Germany). Primers sequences are given in (Tables 1 and 2) for in an ABI Prism 7000 sequence detection system. PCR reaction was set up with Sybr Green PCR Master mix 2981 March 21, 2014 Volume 20 Issue 11

263 Khan S et al. Chemokines gene expression in CRC cell-lines Table 2 List of KRAS sirna sequences for knockdown KRAS sirna sequence 5 3 forward 5 3 reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Table 3 List of antibodies used in Western blotting analysis Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology from Invitrogen (Darmstadt, Germany) containing 0.3 μmol/l primers each and 1 μl of RT-product in 25 μl volume. A two-step amplification protocol was chosen consisting of initial denaturation at 95 for 10 min followed by 45 cycles with 15 s denaturation at 95 and 30 s annealing/extension at 60. Finally, a dissociation protocol was performed to control specificity of amplification products. The results were normalised to the house keeping gene, and fold change expression was calculated using threshold cycle (Ct) values. Beta actin was chosen as house keeping gene its expression remained stable thoughout the study. Western blotting Proteins were isolated from the cell lysate at the different time points and Western blotting was performed as described previously [34]. Briefly, protein contents were calculated by the Commassie Protein Assay BIO-RAD (Munich, Germany). 20 μg of total protein were loaded on a 4%-12% Nu-PAGE Bis-Tris Invitrogen (Darmstadt, Germany) gel and separated after 2 h electrophoresis at 80 V. After the transfer of gel into nitrocellulose membrane in a semi-dry apparatus at 30 V for 1.5 h, the membranes were blocked in 5% (non-fat dried milk), and blotted with primary antibodies overnight at 4. The secondary antibodies were horse raddish peroxidase conjugated goat anti-rabbit and goat anti-mouse immunoglobulins Dako (Hamburg, Germany) diluted at 1:1000. Membranes were developed with the ECL chemiluminescence Kit purchased from Amersham Pharmacia Biotech (Freiburg, Germany). β-actin was used as an internal loading control. RNA interference Two colorectal cancer cells DLD-1 and Caco2 were plated in 24 wells at a density of cells per well. About 70% confluency were confirmed before transfection with small interferring RNA (sirna) oligonucleotides. All the synthetic sirnas sequences were designed in our laboratory and synthesized by Eurofins MWG Operon (Ebersberg, Germany). Transfection reagent Lipofectamine from Invitrogen (Darmstadt, Germany) according to the standard protocol of the manufacturer parameters were optimized for each cell line prior to validation according to the instructions given in the transfection reagent handbook. Briefly, for triplicate transfections, sirna and Lipofectamine from Invitrogen (Darmstadt, Germany) were diluted in 100 μl DMEM from Gibco (Grand Island, United States) without serum and incubated for 10 min at room temperature. After cell culture medium removal, 500 μl fresh medium and 100 μl transfection complexes were added per well. Cells were incubated for 48 and 72 h before analyzing the degree of knockdown. 20 nmol/l sirna (6 μl) and 10 nmol/ L lipofectamine (12 μl) which was considered to be a combination which resulted in an acceptable KRAS knock down after 48 and 72 h incubation time for the following experiments. Transfection performance was monitored using a validated scrambled sirna control Qiagen (Hilden, Germany). The experiments were performed in three replicates for both cell lines. KRAS was determined by real time PCR and at protein level through Western blotting. A list of the KRAS sirna sequences is shown in Table 2. Statistical analysis The data were analyzed using Prism Graph pad 5 software (San Diego, United States). All experimental errors are shown as SEM. Statistical significance was calculated by one way ANOVA test and Student s t test. Significance was accepted at P < Densitometry of the Western blotting was analyzed with the Image-J software (NIH). Results are shown as mean ± SD. Significant difference was accepted at P < 0.05 against control group and calculated according to the Student t-test. RESULTS Basal changes in mrna expression of acute phase cytokines in intestinal epithelial cell lines The gene expression of major cytokines (TNFα, IL- 1β and IFNγ) was studied at basal level in five CRC cell lines. Previously, it has been published that intestinal epithelial cell lines (IECs) depending on their origin and maturity may have a different and distinct pattern of chemokine/cytokine expression [35]. Using gene specific primers the real time PCR data showed that the basal mrna expression of TNFα, normalised to β-actin expression, was highest in Caco2 (Wt) followed by HT-29 (BRAF) and the lowest expression was observed in the DLD- 1(KRAS) cell line (Figure 1A; P < 0.05). The highest IL- 1β expression was observed in both BRAF mutated cell 2982 March 21, 2014 Volume 20 Issue 11

264 Khan S et al. Chemokines gene expression in CRC cell-lines A 2.5 a a TNFa B 1.0 a IL-1b a TNFa/b-actin IL-1b/b-actin a Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) C 5 IFN-g D 5 Interleukin IFN-g/b-actin 3 2 Below detection limit IL-6/b-actin 3 2 Below detection limit Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) Figure 1 Basal mrna expression of acute-phase cytokines in different intestinal epithelial cell-lines. A: Tumor necrosis factor-α (TNF-α); B: Interleukin (IL-β); C: Interferon-γ (IFN-γ); D: Interleukin-6 (IL-6). The mutation is given in parenthesis cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cdna was prepared from 1 µg of total RNA. Ct values were normalized to β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mrna expression, taken as a control. Results represent mean ± SE ( a P < 0.05 vs Caco2 analyzed by one way ANOVA, n = 4). lines HT-29 and Colo-205, followed by the two wild type Colo-320 and Caco2 cell lines respectively. The lowest expression for IL-1β was found in DLD-1 (KRAS) (Figure 1B; P < 0.05). To summarize, basal expression was very low in the KRAS mutated cell line DLD-1 for the proinflammatory cytokines (TNFα and IL-1β). Moreover, IFNγ and IL-6 showed no expression in any of the cell lines (Figure 1C, D). Basal changes in mrna expression of acute phase cytokine receptors in IECs The basal level of cytokine receptor mrna expression in the five cell lines revealed that Colo-205 and HT-29 (BRAF mutated) have the highest expression of TNFα Rec1 (Figure 2A; P < 0.05). IL-1β Rec was found in Caco2 (Wt) followed by DLD-1 (KRAS) and Colo-205 (BRAF) (Figure 2B; P < 0.05). Even though IFNγ did not show any expression for the five cell lines at the basal level. However, IFNγ Rec1 showed the maximum expression in Colo-205 and HT-29 (BRAF) followed by Caco2 (Wt) in comparison with TNFα Rec1 and IL-1β Rec 1. (Figure 2C; P < 0.05). Basal mrna expression of proinflammatory chemokines (CXCL1,CXCL8 and CXCL10) in colorectal cell lines The differences in the basal level of mrna expression of chemokines were studied in five different cell lines. The mrna expression of CXCL1 was significantly higher in the mutated cell lines HT-29 (BRAF) followed by Colo-205 (BRAF) and DLD-1 (KRAS) (Figure 3A, B; P < 0.05). However, the expression was low in the wild type cell lines Caco2 and Colo-320. In contrast, CXCL10 mrna was significantly increased in the wild type cell lines Caco2 and Colo-320. It was found that CXCL10 mrna expression was lowest in the mutated cell lines (HT-29, DLD-1 and Colo-205) (Figure 3C; P < 0.05) March 21, 2014 Volume 20 Issue 11

265 Khan S et al. Chemokines gene expression in CRC cell-lines A 2.5 TNFa Rec1 b A 3 CXCL1/Gro-alpha a 2.0 TNFa Rec1/b-actin CXCL1/b-actin a 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) B IL-1b Rec1/b-actin a a IL-1b Rec1 a B CXCL8/b-actin CXCL8/Interleukin-8 b b 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) C 0.10 IFNg Rec1 a C 2 CXCL10/IP-10 b IFNg Rec1/b-actin b a CXCL10/b-actin b Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) 0 Caco2 (Wt) Colo-320 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Colo-205 (BRAF) Figure 2 Basal mrna expression of cytokine receptors in intestinal epithelial cells. A: Tumor necrosis factor-α (TNFα)- Rec1; B: Interleukin-1β (IL-1β); C: Interferon-γ (IFNγ)-Rec cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cdna was prepared from 1 µg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mrna expression, taken as a control. Results represent mean ± SE ( a P < 0.05, b P < 0.01 vs Caco2 analyzed by one way ANOVA, n = 4). Figure 3 Basal mrna expression of chemokines in intestinal epithelial cells. A: CXCL1; B: CXCL8; C: CXCL cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cdna was prepared from 1 µg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mrna expression, taken as a control. Results represent mean ± SE ( a P < 0.05, b P < 0.01 vs Caco2 analyzed by one way ANOVA, n = 4). CXCL1: Chemokine (C-X-C motif) ligand March 21, 2014 Volume 20 Issue 11

266 Khan S et al. Chemokines gene expression in CRC cell-lines A CXCL1/b-actin (fold change) Caco2 (Wt) DLD-1 (KRAS) HT-29 (BRAF) Control t /h B a a TNFa a a Caco2 (Wt) 1 h -, 4 h, 8 h, 24 h DLD-1 (KRAS) 1 h, 2 h, 24 h HT-29 (BRAF) 1 h, 2 h, 4 h t /h a a a a a C CXCL1/b-actin (fold change) a a IL-1b a a Caco2 (Wt) 1 h -, 4 h -, 8 h -, 24 h DLD-1 (KRAS) 1 h, 2 h, 24 h - HT-29 (BRAF) 1 h, 2 h, 8 h, 24 h t /h a a a D a IFNg Caco2 (Wt) 1 h -, 8 h, 24 h DLD-1 (KRAS) 1 h, 24 h HT-29 (BRAF) 2 h, 8 h a t /h a a a a a Figure 4 Regulation of CXCL1 mrna expression by cytokine in intestinal epithelial cells. A: Relative transcript expression of chemokine (C-X-C motif) ligand (CXCL)1/Gro-alpha in unstimulated cell-lines; B: Relative transcript expression of CXCL1/Gro-alpha in tumor necrosis factor-α (TNFα) stimulated cell-lines; C: Relative transcript expression of CXCL1/Gro-alpha in interleukin (IL)-1beta stimulated cell-lines; D: Relative transcript expression of CXCL1/Gro-alpha in interferon (IFN)-gamma stimulated cell-lines. [ cells were plated into 6 well plates and grown for 24 h and then stimulated with tumor necrosis factor α (50 ng), interleukin-1β (1 ng), and interferon-γ (50 ng)]. The cells were harvested, total RNA was isolated and first strand cdna was prepared from 1 µg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. Results represent mean ± SE ( a P < 0.05 vs non-stimulated zero controls) analyzed by one way ANOVA, n = 3). Regulation of CXCL1 mrna expression by cytokines Three cell lines with two different mutations DLD-1 (KRAS), HT-29 (BRAF) and Caco2 (Wild type) were examined for the time kinetics of CXCL1 mrna expression and protein secretion. The cytokines were administered at the following concentrations: IL-1β (1 ng/ml), TNFα (50 ng/ml) and IFNγ (50 ng/ml) were administered to IECs. Under control conditions (Figure 4A), CXCL1 mrna expression did not change over the experiment. CXCL1 mrna was inducible early at 1h after stimulation with TNFα in DLD-1 (KRAS) (310 ± 2.18 fold), followed by HT-29 (BRAF; ± 3.28 fold), whereas no change was detected in CXCL1 mrna expression in the Caco2 cell line. The induction by TNFα of CXCL1 in HT-29 was milder as compared to DLD-1 but lasted until 8 h after stimulation, while in DLD-1 it lasted only until 2 h at high levels (Figure 4B; P < 0.05). IL-1β induced the highest gene expression of CXCL1 in HT-29 (BRAF; ± 5.98 fold), followed by DLD-1 (KRAS; ± 0.37 fold), However, in Caco2 (Wt) IL-1β did not affect the CXCL1 gene expression (Figure 4C; P < 0.05). IFNγ stimulation showed a delayed increase of CXCL1 gene expression in Caco2 (Wt; ± fold) which was highest at 24 h, followed by HT-29 (BRAF; ± 2.50 fold) at 8 h (Figure 4D; P < 0.05). Changes in the protein expression of CXCL1 in colorectal cancer cell lines Caco2 (Wt), DLD-1 (KRAS) and HT-29 (BRAF) by cytokines (TNFα, IL-1β and IFNγ) The effect of cytokine stimulation on CXCL1 was further analysed at protein level by Western blotting (Figure 5A-C) in Caco2 (Wt), DLD-1 (KRAS) and HT-29 (BRAF) cell lines. Western blotting analysis was performed by using anti-cxcl1 antibody to confirm the changes occurring at mrna level and to document the protein expression of CXCL1 chemokine in IECs over the time. TNFα stimulation: The CXCL1 protein secretion under control conditions did not vary to a greater extent in the analysed cell lines. Similar to what was observed at mrna level, DLD-1 showed a significant and early increase at 1h and a maximum at 2h after TNFα stimula March 21, 2014 Volume 20 Issue 11

267 Khan S et al. Chemokines gene expression in CRC cell-lines A B Caco2 (Wt) DLD-1 (KRAS) HT-29 (BRAF) C Control TNFα IL-1b CXCL1 (11 kda) IFNγ (h) (h) (h) Control TNFα IL-1b β-actin (43 kda) IFNγ (h) (h) (h) Figure 5 Caco2 (Wt), DLD-1 (KRAS) and HT-29 (BRAF) Western blotting analysis. The bands represent chemokine (C-X-C motif) ligand (CXCL)-1 protein expression (upper panel) at different time points after stimulation of Caco2 (A), DLD-1 (B) and HT-29 (C) cell lines with tumor necrosis factor-α (TNFα) (50 ng/ml), interleukin (IL)-1beta (1 ng/ml) and interferon (IFN)-gamma (50 ng/ml) compared to the loading control betabb-actin (lower panel). tion compared to the baseline conditions. In contrary to mrna level, an increase in CXCL1 was detected with a maximum at 8 h in the Caco2 cell line in comparison to their controls. The HT-29 cell line showed an increase at 2 h and 8 h followed by decrease at 24 h as compared to respective controls. The data demonstrates that TNFα at protein level also showed significant increase in KRAS mutated cell line (DLD-1). IL-1β stimulation: Similar to the mrna expression, IL- 1β induced a significant protein level of CXCL1 in all the studied cell lines. Among them, an increase in Caco2 was the most pronounced at 2 and 8 h compared to untreated cells. However, a statistically significant expression was detected in all studied time points as was also observed for HT-29 and DLD-1 after IL-1β stimulation. IFNγ stimulation: Likewise regarding mrna expression, a clear gradual increase for CXCL1 in Caco2 was observed after IFNγ stimulation. This increase was at its maximum by 8 h in Caco2. HT-29 (BRAF) and DLD-1 (KRAS) also showed an increase with a maximum at 2h after IFNγ stimulation (Figure 5A-C). Taken together, a significant increased protein level of CXCL1 was observed by treatment of cytokines (TNFα, IL1-β and IFNγ) in all studied cell lines Caco2(Wt), DLD-1 (KRAS) and HT-29 (BRAF). However, we could observe a difference among some cytokines treatments and cell lines between the mrna and protein expression. It might be due to the secretory nature of proteins which makes it difficult to compare CXCL1 protein expression to mrna expression in mutated and wild type cell lines, as the proteins might be released into the supernatant. Regulation of CXCL10 mrna expression by cytokines CXCL10 showed a distinct expression after cytokine stimulation in each cell line. The mrna expression under control conditions showed no difference in the cell lines during the study (Figure 6A). TNFα induced the maximum CXCL10 gene expression in HT-29 (BRAF; ± 0.1 fold) after 8 h. In DLD-1 (KRAS) and Caco2 (Wt) cell lines a low CXCL10 mrna expression was observed (Figure 6B; P < 0.05). IL-1β treatment showed a maximum CXCL10 gene expression in HT-29 (BRAF) (49.72 ± 6.25 fold) followed by Caco2 (Wt) (36.86 ± 5.13 fold) with a maximum expression at 2h, whereas DLD-1 only showed mild changes compared to non-stimulated controls (Figure 6C; P < 0.05). In our experiment, IFNγ significantly enhanced CXCL10 mrna expression in mutated cell lines HT-29 (BRAF; ± fold) followed by DLD-1 (KRAS; ± fold) in contrast to the wild type cell line Caco2 (Wt; ± 1.44 fold) (Figure 6D; P < 0.05). Changes in the protein expression of CXCL10 in colorectal cancer cell lines Caco2 (Wt), DLD-1 (KRAS) and HT-29 (BRAF) by cytokines (TNFα, IL-1β and IFNγ) The Western blotting analysis of CXCL10 revealed weak expression for all the cell lines under control conditions (Figure 7A-C). IL-1β stimulation showed no significant changes in any of the three cell lines. HT-29 showed a highly significant increase due to TNFα after one hour and reaching at its maximum by 24 h. Also IFNγ stimulation increased CXCL10 expression 2986 March 21, 2014 Volume 20 Issue 11

268 Khan S et al. Chemokines gene expression in CRC cell-lines A CXCL10/b-actin (fold change) Control Caco2 (Wt) DLD-1 (KRAS) HT-29 (BRAF) B TNFa Caco2 (Wt) 1 h, 4 h, 8 h, 24 h DLD-1 (KRAS) HT-29 (BRAF) 2 h, 8 h a a a a a a t /h t /h C CXCL10/b-actin (fold change) IL-1b Caco2 (Wt) 2 h, 4 h, 24 h DLD-1 (KRAS) 2 h HT-29 (BRAF) 24 h a a t /h a a a D IFNg Caco2 (Wt) 8 h, 24 h DLD-1 (KRAS) 1 h -, 2 h, 4 h, 24 h HT-29 (BRAF) 24 h a t /h a a a a a Figure 6 Time Kinetics of chemokine (C-X-C motif) ligand 10 mrna expression in intestinal epithelial cells cells were plated into 6 well plates and grown for 24 h (A) and then stimulated with tumor necrosis factor-α (TNFα) (B, 50 ng), interleukin (IL)-1β (C, 1 ng), and interferon (IFN)-γ (D, 50 ng). The cells were harvested, total RNA was isolated and first strand cdna was prepared from 1 µg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. Results represent mean ± SE ( a P < 0.05 vs non-stimulated zero control) analyzed by one way ANOVA, n = 3). CXCL: Chemokine (C-X-C motif) ligand. in HT-29 at early 1h and the same expression was found throughout the study (Figure 7A-C). KRAS mrna and protein expression in DLD-1 and Caco2 after KRAS knockdown For down-regulation of KRAS expression in DLD-1 (KRAS) and Caco2 (Wt) cells, KRAS-specific sirna was used in transfection studies. Two human colorectal carcinoma cell lines DLD-1 and Caco2 were chosen to examine the different effects of KRAS knockdown in a wild type compared to a KRAS mutated cell line after 48 h and 72 h in comparison to the scrambled sirna. The results revealed that sirnas down-regulated KRAS mrna expression after 48 h in DLD-1 (25%) and Caco2 (20%), respectively. After 72 h, incubation with sirna significantly reduced KRAS mrna expression to approximately DLD-1 (55%) and Caco2 (58%), respectively (Figure 8A, B; P < 0.05). The silencing of KRAS was more pronounced at protein level compared to mrna data. By using a KRAS antibody, Western blotting analysis of three independent experiments revealed a significant reduction in KRAS protein expression in the DLD-1 cell line. The most pronounced inhibition was observed at 48 h (67% KRAS knockdown) and 72 h (85% KRAS knockdown) after sirna transfection (Figure 8C, E). Similar results were also detected in the Caco2 cell line with a maximum at 48 h (67% KRAS knockdown) and after 72 h (62% KRAS knockdown) (Figure 8D, F; P < 0.05). Changes in chemokine mrna expression due to KRAS knockdown in DLD-1 and Caco2 To further explore the consequences of decreased KRAS expression due to KRAS sirna silencing, we studied the chemokine gene expression at mrna level. In the DLD-1 cell line, a significant decrease in CXCL1 mrna level was detected at 72 h (0.31 ± 0.07 fold; P < 0.05 vs scrambled control) after transfection. Similarly CXCL10 also showed a decreased (0.30 ± 0.08 fold; P < 0.05 vs scrambled control) gene expression after 72 h transfection due to KRAS inhibition (Figure 9A, B; P < 0.05). Contrary to DLD-1 (KRAS), in Caco2 (Wt) cells, the KRAS knockdown resulted in significant up-regulation of CXCL1 (9.79 ± 3.6 fold; P < 0.05 vs scrambled Control), and CXCL10 (18.40 ± fold; P < 0.05 vs scrambled Control) mrna expression after 72 h transfection (Figure 2987 March 21, 2014 Volume 20 Issue 11

269 Khan S et al. Chemokines gene expression in CRC cell-lines A B Caco2 (Wt) DLD-1 (KRAS) HT-29 (BRAF) C Control TNFα IL-1b CXCL10 (11 kda) IFNγ (h) (h) (h) Control TNFα IL-1b β-actin (43 kda) IFNγ (h) (h) (h) Figure 7 Shows Caco2 (Wt) (A), DLD-1 (KRAS) (B) and HT-29 (BRAF) (C) Western blotting analysis. The cytokines interleukin-1β (1 ng/ml), tumor necrosis factor α (50 ng/ml) and interferon-γ (50 ng/ml) were stimulated to the cells and the total cell lysates was isolated and 20 µg were separated by 15%-20% NuPAGE Bis- Tris gel electrophoresis, blotted and probed with chemokine (C-X-C motif) ligand (CXCL) 10 antibody. β-actin (43 kda) was analyzed as an internal control. 9C, D; P < 0.05). To summarize, the results indicate a change in cytokine-gene expression of both cell lines after KRAS inhibition. Moreover, CXCL1 and CXCL10 showed an opposite expression in the two cell lines. Changes in protein expression of MAPK1 and IκBα due to KRAS knockdown in DLD-1 (KRAS) and Caco2 To further evaluate the reason of change in chemokine gene expression by KRAS-knock down in both DLD-1 and Caco2 cell lines, transcription factors MAPK1 and IκBα were analysed at protein level (Figure 10A, D). MAPK1 specific protein band was detectable at 44 kda in DLD-1 and Caco2 cells. The MAPK1 desitometric analysis of three experiments showed no significant change after 48 h and 72 h by KRAS reduction. The data suggested that inhibition of KRAS has no significant effect in either cell lines for MAPK1 (Figure 10B, E). To analyse the activation of the NF-κB pathway, cell lysates were analyzed for changes in the level of total IκBα (subunits of NF-κB), as phosphorylation of the p65 subunit and the degradation of IκBα are known to be associated with activation of the NF-κB classical pathway [36]. However, inhibition of KRAS expression by sirna affects significantly the levels of IκBα in Caco2 (Figure 10F). Our results revealed that after 48 h of transfection, it reduced IκBα protein level to 46% and approximately 70% after 48 h and 72 h respectively. Furthermore, a non-significant decrease in DLD-1 was also detected after KRAS gene knockdown (Figure 10C). DISCUSSION Chronic inflammation drives cancer development through tissue damage and release of pro-inflammatory mediators [37]. It is known that cytokine stimulation of tumor cells can cause the tumor to produce growth factors, inflammatory mediators (i.e., chemokines) and proangiogenic factors [38]. The tumor is thus able to influence and maintain its own microenvironment, which includes immune cells, stromal cells and microvessels. It can be hypothesized that different mutations caused during tumorigenesis might drive a varying microenvironment. KRAS and BRAF mutation has been reported in approximately 50% of CRCs. For lung tumors, it has been shown that KRAS activation generates a proinflammatory microenvironment which may promote tumor growth and invasion [39]. Similar data have also been reported for pancreatic cancer [40]. Recently, a RAS-mutation dependent behaviour of CRC cell lines after exposure to inflammatory mediators was documented [41]. The significance of WT, KRAS and BRAF mutational status for chemokine production of the various CRC cell lines has not been studied so far. Hence, the aim of our study was to investigate the influence of different CRC-mutations in view of the regulation and induction of inflammatory cytokines and chemokines. A panel of cytokines (TNFα, IL-1β, IFNγ and IL-6) and cytokine receptors, which are more commonly involved in the tumor control and progression in colorectal carcinoma cell lines, was evaluated. We showed a low basal transcript expression of TNFα and IL-1β in the KRAS mutated (DLD-1) cell line, compared to wild type (Caco2). No detection at basal level was found for IL-6 and IFNγ in any of the studied cell lines. In contrast, the pro-angiogenic chemokines CXCL1, CXCL8 showed a high constitutive expression in mutated cell lines DLD-1 (KRAS), HT-29 and Colo205 (BRAF), compared to wild 2988 March 21, 2014 Volume 20 Issue 11

270 Khan S et al. Chemokines gene expression in CRC cell-lines A 0.8 DLD-1 (KRAS) B 4 Caco2 (Wt) a a Relative expression of KRAS Relative expression of KRAS Scrambled 48 h sirna 48 h Scrambled 72 h sirna 72 h 0 Scrambled 48 h sirna 48 h Scrambled 72 h sirna 72 h C DLD-1 (KRAS) D Caco2 (Wt) KRAS 21 kda KRAS 21 kda β-actin 43 kda β-actin 43 kda 48 h 72 h 48 h 72 h Co Scrambled sirna 48 h 72 h 48 h 72 h Co Scrambled sirna E 200 DLD-1 (KRAS) F 200 Caco2 (Wt) a 150 a 150 % Age change 100 a % Change 100 a Co 48 h scrambled 48 h sirna Co 72 h scrambled 72 h sirna 0 Co 48 h scrambled 48 h sirna Co 72 h scrambled 72 h sirna Figure 8 The figure shows the results of KRAS inhibition from transient transfection of KRAS sirna in DLD-1 and Caco2 cell lines at RNA and protein level. A-D: Relative expression of KRAS at RNA-level by RT-PCR (A and B) and protein expression by Western blotting (C and D) at 48 h and 72 h after KRAS inhibition; E, F: Note the significant down-regulation of KRAS at 48 and 72 h at protein level by densitometric analysis in both, DLD1 and Caco2 cell-lines. Changes are shown in percent, compared to scrambled sirna. Data are presented as mean ± SE of 3 independent experiments with double confirmation. a P < 0.05 vs scrambled 72 h. type (Caco2). However, the anti-angiogenic chemokine (CXCL10) showed a high basal expression in wild type, compared to the mutated cell lines. The high basal expression of pro-angiogenic chemokines together with a low basal expression of inflammatory cytokines in mutated cell lines implies that these cell-lines became independent of external pro-inflammatory stimuli. A proangiogenic microenvironment promotes neovascularisation and as a consequence facilitates metastasis [14]. Treatment with pro-inflammatory cytokines showed an induction of CXCL1 gene expression in mutated, and to a lesser extent in wild type cell lines at mrna and protein level. The most pronounced and quick induction of CXCL1 gene expression was detected after TNFα stimulation in DLD-1 (KRAS-mutated) followed by HT-29 (BRAF-mutated) compared to Caco2 (Wt). Similar results were found after treatment with IL-1β which induced the maximum gene expression of CXCL1 in HT-29 followed by DLD-1; a minor but significant increase was also found in Caco2 (Wt). CXCL10 at mrna level were significantly induced by IFNγ in the mutated cell lines HT-29 followed by DLD-1, in comparison to wild type (Caco2). A decreased CXCL1 and CXCL10 gene expression was detected in the DLD-1 (KRAS) cell line in comparison to wild type (Caco2) at 72h after KRAS silencing. The specific KRAS inhibition resulted in an up-regulation of CXCL1 and CXCL10 and induction of the NF-κB 2989 March 21, 2014 Volume 20 Issue 11

271 Khan S et al. Chemokines gene expression in CRC cell-lines A 1.5 DLD-1 (KRAS) a C 15 Caco2 (Wt) a Relative expression of CXCL Relative expression of CXCL Scrambled 72 h sirna 72 h 0 Scrambled 72 h sirna 72 h B Relative expression of CXCL DLD-1 (KRAS) a D Relative expression of CXCL Caco2 (Wt) a 0 Scrambled 72 h sirna 72 h 0 Scrambled 72 h sirna 72 h Figure 9 Transient transfection of KRAS sirna in DLD-1 (KRAS) and Caco2 (Wt) cell line. Expression of chemokine (C-X-C motif) ligand (CXCL)-1/Gro-alpha (A) and CXCL10/IP-10 (B) in the DLD-1 (KRAS-mutant) cell-line. Expression of CXCL-1/Gro-alpha (C) and CXCL-10/IP-10 (D) in the Caco2 (WT) cell-line cells were plated into 24 well plates and grown for 24 h and then transfected with KRAS sirna or scrambled (20 nmol/l) for 72 h. Real time PCR was performed for chemokine CXCL1 and CXCL10 with gene specific primers and the expression was normalized to β-actin expression measured in the same sample as an internal control. Data presented are the mean ± SE of 4 independent experiments with double confirmation. a P < 0.05 vs scrambled 72 h. pathway in wild type (Caco2) cell line. Inflammatory cytokines play an important role in CRC [37]. Significant differences were observed for basal TNFα and IL-1β expression between mutated (KRAS and BRAF) and non-mutated CRC cell lines. A pro- as well as anti-cancer role of TNF has been described [42]. This anticancer effect is multi-factorial as TNF can cause vascular necrosis, tumor necrosis and has a direct apoptotic effect on tumor cells [32]. Gene expression of TNFα was found to be the lowest in KRAS and BRAF mutated cell lines compared to non-mutated cells. Based on these data, it could be suggested that a reduction in basal TNFα level in mutated cell lines compared to wild type cell lines could be related to a reduced cell necrosis and apoptosis in this rapid turnover system. In other words, reduction in TNF expression might help mutated cells to survive in a rather hypoxic tumor microenvironment. Similar results were obtained for IL-1β basal expression with the exception of BRAF mutated cell lines which showed an induction of IL-1β compared to KRAS mutated or non-mutated cell lines. Another important aspect of the current study was the absence of IFNγ and IL-6 at basal mrna level. However, IFNγ and IL-6 cytokine receptors were detected, as were TNFα and IL-1β receptors at basal level. The presence of the receptors points to a functional cytokine sensitivity. A role of IL-6 in tumor progression has already been described [43]. In fact, interferons are proteins involved in many functions including, apoptosis, cell cycle control and they act as mediators of other cytokines [44,45]. IFNγ is known for anti-proliferative and furthermore anti-tumor activity in CRC [46]. The lack of detection of these main pro-inflammatory cytokines in any of the studied cell lines could explain that tumor cells are able to promote their microenvironment according to their needs. Additionally, IFNγ might induce the anti-tumorigenic role of TNF [47] and the absence of IFNγ might thus prevent TNFinduced classic apoptosis pathway. Reduced expression of 2990 March 21, 2014 Volume 20 Issue 11

272 Khan S et al. Chemokines gene expression in CRC cell-lines A DLD-1 (KRAS) D Caco2 (Wt) MAPK1 44 kda MAPK1 44 kda IκBα 41 kda IκBα 41 kda b-actin 43 kda b-actin 43 kda 48 h 72 h 48 h 72 h Scrambled sirna 48 h 72 h 48 h 72 h Scrambled sirna B 200 MAPK1 E 200 MAPK % Age change 100 % Age change h scrambled 48 h sirna 72 h scrambled 72 h sirna 0 48 h scrambled 48 h sirna 72 h scrambled 72 h sirna C 150 IκBα F 300 a IκBα a % Age change 50 % Age change h scrambled 48 h sirna 72 h scrambled 72 h sirna 0 48 h scrambled 48 h sirna 72 h scrambled 72 h sirna Figure 10 Effect of MAPK1 and IκBα protein expression in DLD-1 and Caco2 cells after KRAS knockdown. Proteins (20 μg) from whole-cell lysates were size-fractionated by SDS-PAGE and transferred on to membranes, and incubated with antibodies as indicated. Representative Western blotting of mitogen-activated protein kinase (MARK)-1 (44 kda) and IκBα (41 kda) proteins in DLD-1 cells (A) and Caco2 cells (D). Densitometric analysis of MAPK-1 (B and C) and IκBα proteins (E and F) in DLD-1 cells and Caco2 cells. Proteins were densitometrically quantified and expressed as percent increase or decrease compared with scrambled controls. Equal loading of total proteins were ensured by β-actin (43 kda). Data presented are the mean ± SE of 3 independent experiments with double confirmation. a P < 0.05 vs scrambled. TNFα in mutated cell lines and the complete abolishment of IFNγ expression in our data could be associated with increased tumor progression as has been suggested above. Chemokines are known to attract leukocytes during stress conditions [27] and promote tumor development [48]. According to our results, the increased gene expression of CXCL1 and CXCL8 as well as the decreased CXCL10 gene expression in KRAS and BRAF mutated cell lines compared to wild type (Caco2 and Colo-320) cell lines indicates the likely existence of a specific microenvironment depending on the mutation status. Previously, CXCL1 protein secretion was found to be enhanced in a highly metastatic cell line as compared to a cell line with low metastatic potential [49]. This is in accordance with our results. Recent studies have also shown a difference of chemokine expression in intestinal epithelial cells of normal and IBD patients [50]. The levels of chemokine expression also correlated well with activity of the disease. Some differences were found in chemokine expression between ulcerative colitis (UC) and Crohn s disease 2991 March 21, 2014 Volume 20 Issue 11

273 Khan S et al. Chemokines gene expression in CRC cell-lines (CD) [50], suggesting that they share common inflammatory pathways. Moreover, in the tumor microenvironment, the balance between pro-and anti-angiogenic chemokines may determine the degree of angiogenesis and the ensuing tumor progression. In our experiments, TNFα and IFNγ were the main inducers for CXCL1 and CXCL10 gene expression in mutated cell lines compared to the wild type (Caco2) cell line. However, an exception was observed for CXCL8 which showed a higher induction in wild type than in mutated cell lines after IL1β administration. To understand the possible role of KRAS and the consequences of inhibiting its activity or expression in colorectal cancer cell lines, a KRAS knockdown experiment was performed in KRAS-mutant (DLD-1) and wild type (Caco2) cell lines. Specific sirna inhibition of the KRAS gene in a KRAS-mutated cell line (DLD-1) showed a reduced gene expression of the chemokines CXCL1 and CXCL10. These results support that mutation of the RAS gene in colon cancer influences gene regulation of chemokines which is in accordance to previous reports. A previous report stated a reduced expression of chemokines after mutant KRAS inhibition in a human cancer cell line [51]. Furthermore, a stable knockdown of oncogenic KRAS led to reduced proliferation rates and anchorage independent growth in lung adenocarcinoma cell lines [52]. It suggests that mutant KRAS may affect the chemokine levels by shifting to additional pathways. An upregulated chemokine levels mean increased recruitment of immune cells or stromal cells which are known to play a role in tumor growth and metastasis [53-55]. A large fraction of CRC tumors and cell lines exhibit constitutive activation of transcription factors that are essential components of multiple inflammatory pathways such as NF-κB and MAPK1 [38,56] which can be acivated by inflammatory cytokines [37,40]. A previous study reported that inhibition of NF-κB pathway reduces chemokine gene expression which could imply a pharmacological importance in treating IBD [33]. These results are in accordance with our study, where inhibition of KRAS by the sirna approach induced NF-κB (reduced IκBα-level) followed by an increase in chemokine gene expression in the wild type cell line (Caco2). To summarize the data, basal chemokine gene expression for pro-angiogenic chemokines was high in mutated as compared to wild type cell lines. Furthermore, cytokine treatment induces the expression of pro-angiogenic (CXCL1) and anti-angiogenic (CXCL10) chemokines differentially in mutated cell lines compared to wild type. Our findings give an insight into the interconnection of the tumor and its microenvironmental factors. A proangiogenic microenvironment promotes neovascularisation and as a consequence facilitates metastasis [38]. The pro-angiogenic microenvironment in mutated CRC cell lines might thus be prognostic for a more aggressive and pro-metastatic tumor behaviour, predictive for the use of anti-angiogenic therapies. It is known, that wild type mutational status is an important predictor of anti-egfreceptor therapies [57]. In the head-to-head comparison of the FOLFIRI chemotherapy with anti-egfr or anti- VEGF-supplementation, patients with RAS-mutant tumors seem to benefit from anti-vegf therapy in view of the progression free survival. However, these data still need further validation. The results of this study may be helpful to build a rationale for the understanding of microenvironment remodelling and tumor-microenvironment interactions in view of the different mutations. It may help to rationalize the choice of molecular targets for suitable therapeutic investigation in clinical studies. ACKNOWLEDGMENTS We acknowledge support by the German Research Foundation and the Open Access Publication Funds of the Göttingen University. We also greatly appreciate the skillful technical assistance of Mrs. Elke Neumann, Ms. Daniela Gerke and Corrina Dunaiski. COMMENTS Background Colorectal-cancer (CRC) is the third most common malignancy. In CRC, the most frequently found mutations are in the KRAS (30%-50%) and BRAF (approximately 10%) genes. It is known that the presence of KRAS and BRAF mutations in CRC may influence the efficacy of chemotherapy. It is not known whether the composition of the immune cells recruited into the tumor is influenced by the KRAS or BRAF mutational status. Research frontiers The tumor is able to influence and maintain its own microenvironment, which includes immune cells, stromal cells and micro-vessels. It can be hypothesized that different mutations caused during tumorigenesis might drive a varying microenvironment. KRAS and BRAF mutation has been reported in approximately 50% of CRCs. For tumors, it has been shown that KRAS activation generates a proinflammatory microenvironment which may promote tumor growth and invasion. Hence the presence of these mutations suggests that mutant KRAS may affect the chemokine levels by shifting to additional pathways. Innovations and breakthroughs Their data suggests that mutant KRAS may affect the chemokine levels by shifting to additional pathways. In addition an upregulated chemokine levels mean increased recruitment of immune cells or stromal cells which are known to play a role in tumor growth and metastasis. The current study build a rationale for the understanding of microenvironment remodelling and tumor-microenvironment interactions in view of the different mutations. Applications The chemotherapy with anti-epidermal growth factor receptor or anti-vascular endothelial growth factor -supplementation, patients with RAS-mutant tumors seem to benefit from anti-vegf therapy in view of the progression free survival. However, these data still need further validation. The results of this study may be helpful to build a rationale for the understanding of microenvironment remodelling and tumor-microenvironment interactions in view of the different mutations. It may help to rationalize the choice of molecular targets for suitable therapeutic investigation in clinical studies. Peer review This research work in this manuscript relates to KRAS mutational status in colorectal carcinoma cell lines. It states that the pro-angiogenic microenvironment in mutated CRC cell lines might thus be prognostic for a more aggressive and prometastatic tumor behaviour, predictive for the use of anti-angiogenic therapies. The study is interesting and well addressed. The point is clearly made March 21, 2014 Volume 20 Issue 11

274 Khan S et al. Chemokines gene expression in CRC cell-lines REFERENCES 1 Weitz J, Koch M, Debus J, Höhler T, Galle PR, Büchler MW. Colorectal cancer. Lancet 2005; 365: [PMID: DOI: /S (05)17706-X] 2 Cappell MS. Pathophysiology, clinical presentation, and management of colon cancer. Gastroenterol Clin North Am 2008; 37: 1-24, v [PMID: DOI: /j.gtc ] 3 Shaw P, Tardy S, Benito E, Obrador A, Costa J. Occurrence of Ki-ras and p53 mutations in primary colorectal tumors. Oncogene 1991; 6: [PMID: ] 4 Sheng H, Shao J, Williams CS, Pereira MA, Taketo MM, Oshima M, Reynolds AB, Washington MK, DuBois RN, Beauchamp RD. Nuclear translocation of beta-catenin in hereditary and carcinogen-induced intestinal adenomas. Carcinogenesis 1998; 19: [PMID: DOI: /carcin/ ] 5 Lakatos PL, Lakatos L. Risk for colorectal cancer in ulcerative colitis: changes, causes and management strategies. World J Gastroenterol 2008; 14: [PMID: DOI: /wjg ] 6 Dhomen N, Marais R. New insight into BRAF mutations in cancer. Curr Opin Genet Dev 2007; 17: [PMID: DOI: /j.gde ] 7 Malumbres M, Barbacid M. RAS oncogenes: the first 30 years. Nat Rev Cancer 2003; 3: [PMID: DOI: /nrc1097] 8 Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 2003; 3: [PMID: DOI: /nrc969] 9 McWilliams A. Author s reply. Can Vet J 1990; 31: 9 [PMID: DOI: /CritRevOncog.v12.i3-4.50] 10 Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990; 61: [PMID: DOI: / (90)90186-I] 11 Ilyas M, Straub J, Tomlinson IP, Bodmer WF. Genetic pathways in colorectal and other cancers. Eur J Cancer 1999; 35: [PMID: DOI: /S (98) ] 12 Karapetis CS, Khambata-Ford S, Jonker DJ, O Callaghan CJ, Tu D, Tebbutt NC, Simes RJ, Chalchal H, Shapiro JD, Robitaille S, Price TJ, Shepherd L, Au HJ, Langer C, Moore MJ, Zalcberg JR. K-ras mutations and benefit from cetuximab in advanced colorectal cancer. N Engl J Med 2008; 359: [PMID: DOI: /NEJMoa ] 13 Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000; 100: [PMID: DOI: /S (00) ] 14 De Luca A, Carotenuto A, Rachiglio A, Gallo M, Maiello MR, Aldinucci D, Pinto A, Normanno N. The role of the EGFR signaling in tumor microenvironment. J Cell Physiol 2008; 214: [PMID: DOI: /jcp.21260] 15 Secombes C, Cunningham C. Cytokines: an evolutionary perspective. Dev Comp Immunol 2004; 28: [PMID: DOI: /j.dci ] 16 Popivanova BK, Kitamura K, Wu Y, Kondo T, Kagaya T, Kaneko S, Oshima M, Fujii C, Mukaida N. Blocking TNFalpha in mice reduces colorectal carcinogenesis associated with chronic colitis. J Clin Invest 2008; 118: [PMID: ] 17 Atreya I, Neurath MF. Immune cells in colorectal cancer: prognostic relevance and therapeutic strategies. Expert Rev Anticancer Ther 2008; 8: [PMID: DOI: / ] 18 Clevers H. At the crossroads of inflammation and cancer. Cell 2004; 118: [PMID: DOI: /j.cell ] 19 MacDermott RP. Chemokines in the inflammatory bowel diseases. J Clin Immunol 1999; 19: [PMID: DOI: /A: ] 20 Wang JM, Deng X, Gong W, Su S. Chemokines and their role in tumor growth and metastasis. J Immunol Methods 1998; 220: 1-17 [PMID: DOI: /S (98) ] 21 Waldner MJ, Neurath MF. Cytokines in colitis associated cancer: potential drug targets? Inflamm Allergy Drug Targets 2008; 7: [PMID: DOI: / ] 22 Keeley EC, Mehrad B, Strieter RM. Chemokines as mediators of neovascularization. Arterioscler Thromb Vasc Biol 2008; 28: [PMID: DOI: /AT- VBAHA ] 23 Aggarwal BB, Pocsik E. Cytokines: from clone to clinic. Arch Biochem Biophys 1992; 292: [PMID: DOI: / (92)90002-E] 24 Malik IA, Moriconi F, Sheikh N, Naz N, Khan S, Dudas J, Mansuroglu T, Hess CF, Rave-Fränk M, Christiansen H, Ramadori G. Single-dose gamma-irradiation induces upregulation of chemokine gene expression and recruitment of granulocytes into the portal area but not into other regions of rat hepatic tissue. Am J Pathol 2010; 176: [PMID: DOI: /ajpath ] 25 Marra F. Chemokines in liver inflammation and fibrosis. Front Biosci 2002; 7: d1899-d1914 [PMID: ] 26 Owen JD, Strieter R, Burdick M, Haghnegahdar H, Nanney L, Shattuck-Brandt R, Richmond A. Enhanced tumor-forming capacity for immortalized melanocytes expressing melanoma growth stimulatory activity/growth-regulated cytokine beta and gamma proteins. Int J Cancer 1997; 73: [PMID: ] 27 Mackay CR. Chemokines: immunology s high impact factors. Nat Immunol 2001; 2: [PMID: ] 28 Fernandez EJ, Lolis E. Structure, function, and inhibition of chemokines. Annu Rev Pharmacol Toxicol 2002; 42: [PMID: DOI: /annurev.pharmtox ] 29 Kiefer F, Siekmann AF. The role of chemokines and their receptors in angiogenesis. Cell Mol Life Sci 2011; 68: [PMID: DOI: /s ] 30 Belperio JA, Keane MP, Arenberg DA, Addison CL, Ehlert JE, Burdick MD, Strieter RM. CXC chemokines in angiogenesis. J Leukoc Biol 2000; 68: 1-8 [PMID: ] 31 Moore BB, Arenberg DA, Addison CL, Keane MP, Strieter RM. Tumor angiogenesis is regulated by CXC chemokines. J Lab Clin Med 1998; 132: [PMID: DOI: / S (98)90004-X] 32 Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000; 18: [PMID: DOI: /annurev.immunol ] 33 Yeruva S, Ramadori G, Raddatz D. NF-kappaB-dependent synergistic regulation of CXCL10 gene expression by IL- 1beta and IFN-gamma in human intestinal epithelial cell lines. Int J Colorectal Dis 2008; 23: [PMID: DOI: /s ] 34 Naz N, Moriconi F, Ahmad S, Amanzada A, Khan S, Mihm S, Ramadori G, Malik IA. Ferritin L is the sole serum ferritin constituent and a positive hepatic acute-phase protein. Shock 2013; 39: [PMID: DOI: / SHK.0b013e b9] 35 Yang SK, Eckmann L, Panja A, Kagnoff MF. Differential and regulated expression of C-X-C, C-C, and C-chemokines by human colon epithelial cells. Gastroenterology 1997; 113: [PMID: DOI: /gast.1997.v113. pm ] 36 Hayden MS, Ghosh S. Shared principles in NF-kappaB signaling. Cell 2008; 132: [PMID: DOI: / j.cell ] 37 Coussens LM, Werb Z. Inflammation and cancer. Nature 2002; 420: [PMID: DOI: /nature01322] 38 Terzić J, Grivennikov S, Karin E, Karin M. Inflammation and colon cancer. Gastroenterology 2010; 138: e5 [PMID: DOI: /j.gastro ] 39 Iwanaga K, Yang Y, Raso MG, Ma L, Hanna AE, Thilaganathan N, Moghaddam S, Evans CM, Li H, Cai WW, Sato 2993 March 21, 2014 Volume 20 Issue 11

275 Khan S et al. Chemokines gene expression in CRC cell-lines M, Minna JD, Wu H, Creighton CJ, Demayo FJ, Wistuba II, Kurie JM. Pten inactivation accelerates oncogenic K-rasinitiated tumorigenesis in a mouse model of lung cancer. Cancer Res 2008; 68: [PMID: DOI: / CAN ] 40 O Hayer KM, Brady DC, Counter CM. ELR+ CXC chemokines and oncogenic Ras-mediated tumorigenesis. Carcinogenesis 2009; 30: [PMID: DOI: / carcin/bgp198] 41 Kreeger PK, Mandhana R, Alford SK, Haigis KM, Lauffenburger DA. RAS mutations affect tumor necrosis factorinduced apoptosis in colon carcinoma cells via ERK-modulatory negative and positive feedback circuits along with non- ERK pathway effects. Cancer Res 2009; 69: [PMID: DOI: / CAN ] 42 Dalum I, Butler DM, Jensen MR, Hindersson P, Steinaa L, Waterston AM, Grell SN, Feldmann M, Elsner HI, Mouritsen S. Therapeutic antibodies elicited by immunization against TNF-alpha. Nat Biotechnol 1999; 17: [PMID: DOI: /10878] 43 Waldner MJ, Foersch S, Neurath MF. Interleukin-6--a key regulator of colorectal cancer development. Int J Biol Sci 2012; 8: [PMID: DOI: /ijbs.4614] 44 Gough DJ, Levy DE, Johnstone RW, Clarke CJ. IFNgamma signaling-does it mean JAK-STAT? Cytokine Growth Factor Rev 2008; 19: [PMID: DOI: / j.cytogfr ] 45 Slattery ML, Lundgreen A, Bondurant KL, Wolff RK. Interferon-signaling pathway: associations with colon and rectal cancer risk and subsequent survival. Carcinogenesis 2011; 32: [PMID: DOI: /carcin/bgr189] 46 Schroder K, Hertzog PJ, Ravasi T, Hume DA. Interferongamma: an overview of signals, mechanisms and functions. J Leukoc Biol 2004; 75: [PMID: DOI: / jlb ] 47 Liu F, Hu X, Zimmerman M, Waller JL, Wu P, Hayes-Jordan A, Lev D, Liu K. TNFα cooperates with IFN-γ to repress BclxL expression to sensitize metastatic colon carcinoma cells to TRAIL-mediated apoptosis. PLoS One 2011; 6: e16241 [PMID: DOI: /journal.pone ] 48 Mukaida N, Baba T. Chemokines in tumor development and progression. Exp Cell Res 2012; 318: [PMID: DOI: /j.yexcr ] 49 Li A, Varney ML, Singh RK. Constitutive expression of growth regulated oncogene (gro) in human colon carcinoma cells with different metastatic potential and its role in regulating their metastatic phenotype. Clin Exp Metastasis 2004; 21: [PMID: DOI: /s ] 50 Banks C, Bateman A, Payne R, Johnson P, Sheron N. Chemokine expression in IBD. Mucosal chemokine expression is unselectively increased in both ulcerative colitis and Crohn s disease. J Pathol 2003; 199: [PMID: DOI: /path.1245] 51 Cunningham D, Humblet Y, Siena S, Khayat D, Bleiberg H, Santoro A, Bets D, Mueser M, Harstrick A, Verslype C, Chau I, Van Cutsem E. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med 2004; 351: [PMID: DOI: /NEJMoa033025] 52 Sunaga N, Shames DS, Girard L, Peyton M, Larsen JE, Imai H, Soh J, Sato M, Yanagitani N, Kaira K, Xie Y, Gazdar AF, Mori M, Minna JD. Knockdown of oncogenic KRAS in non-small cell lung cancers suppresses tumor growth and sensitizes tumor cells to targeted therapy. Mol Cancer Ther 2011; 10: [PMID: DOI: / MCT ] 53 Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, Ross S, Conrads TP, Veenstra TD, Hitt BA, Kawaguchi Y, Johann D, Liotta LA, Crawford HC, Putt ME, Jacks T, Wright CV, Hruban RH, Lowy AM, Tuveson DA. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 2003; 4: [PMID: DOI: /S (03)00309-X] 54 Milne AN, Carneiro F, O Morain C, Offerhaus GJ. Nature meets nurture: molecular genetics of gastric cancer. Hum Genet 2009; 126: [PMID: DOI: / s x] 55 Schubbert S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 2007; 7: [PMID: DOI: /nrc2109] 56 Duyao MP, Kessler DJ, Spicer DB, Bartholomew C, Cleveland JL, Siekevitz M, Sonenshein GE. Transactivation of the c-myc promoter by human T cell leukemia virus type 1 tax is mediated by NF kappa B. J Biol Chem 1992; 267: [PMID: ] 57 Modest DP, Camaj P, Heinemann V, Schwarz B, Jung A, Laubender RP, Gamba S, Haertl C, Stintzing S, Primo S, Bruns CJ. KRAS allel-specific activity of sunitinib in an isogenic disease model of colorectal cancer. J Cancer Res Clin Oncol 2013; 139: [PMID: ] P- Reviewers: Luca M, Kannen V, Sagaert X, Wang SK, Yu YX S- Editor: Wen LL L- Editor: A E- Editor: Zhang DN 2994 March 21, 2014 Volume 20 Issue 11

276 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. BRIEF ARTICLE Frequency and prognostic role of mucosal healing in patients with Crohn s disease and ulcerative colitis after one-year of biological therapy Klaudia Farkas, Péter László Lakatos, Mónika Szűcs, Éva Pallagi-Kunstár, Anita Bálint, Ferenc Nagy, Zoltán Szepes, Noémi Vass, Lajos S Kiss, Tibor Wittmann, Tamás Molnár Klaudia Farkas, Éva Pallagi-Kunstár, Anita Bálint, Ferenc Nagy, Zoltán Szepes, Noémi Vass, Tibor Wittmann, Tamás Molnár, First Department of Medicine, University of Szeged, H6720 Szeged, Hungary Péter László Lakatos, Lajos S Kiss, First Department of Medicine, Semmelweis University, H1088 Budapest, Hungary Mónika Szűcs, Department of Medical Physics and Informatics, University of Szeged, H6720 Szeged, Hungary Noémi Vass, Faculty of Medicine, Pediatrics Department, University of Szeged, H6720 Szeged, Hungary Author contributions: Molnar T, Farkas K and Wittmann T contributed to supervision of patient selection; Molnar T, Farkas K and Lakatos PL contributed to study design and statistical analysis; Molnar T, Farkas K, Lakatos PL, Nagy F, Szepes Z, Vass N, Kiss LS, Bálint A, Pallagi-Kunstár É contributed to data collection and manuscript preparation; all authors have approved the final draft submitted. Supported by TAMOP A-11/1/KONV , TA- MOP A-11/1/KONV TAMOP A-11/1/ KONV ; and OTKA Research Proposal PD (PI: Klaudia Farkas) Correspondence to: Tamás Molnár, MD, PhD, First Department of Medicine, University of Szeged, Korányi fasor 8-10, H6720 Szeged, Hungary. molnar.tamas@med.u-szeged.hu Telephone: Fax: Received: July 21, 2013 Revised: September 28, 2013 Accepted: November 2, 2013 Published online: March 21, 2014 Abstract AIM: To assess the endoscopic activity before and after a one-year period of biological therapy and to evaluate the frequency of relapses and need for retreatment after stopping the biologicals in patients with Crohn s disease (CD) and ulcerative colitis (UC). METHODS: The data from 41 patients with CD and 22 patients with UC were assessed. Twenty-four CD patients received infliximab, and 17 received adalimumab. The endoscopic severity of CD was quantified with the simplified endoscopic activity score for Crohn s disease in CD and with the Mayo endoscopic subscore in UC. RESULTS: Mucosal healing was achieved in 23 CD and 7 UC patients. Biological therapy had to be restarted in 78% of patients achieving complete mucosal healing with CD and in 100% of patients with UC. Neither clinical remission nor mucosal healing was associated with the time to restarting the biological therapy in either CD or UC. CONCLUSION: Mucosal healing did not predict sustained clinical remission in patients in whom the biological therapies had been stopped Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Crohn s disease; Ulcerative colitis; Biological therapy; Endoscopy; Mucosal healing Core tip: Mucosal healing has become a subject of renewed interest, as tumor necrosis factor-α blockers have proven their efficacy in inducing and maintaining clinical and endoscopic remission. In this study, mucosal healing was observed in 56% and 32% of Crohn s disease (CD) and ulcerative colitis (UC) patients. Retreatment with biological therapies was required in 78% of CD patients and in 100% of UC patients, despite achieving mucosal healing within 12 mo. Our results showed that mucosal healing after 12 mo of treatment was not associated with sustained clinical remission March 21, 2014 Volume 20 Issue 11

277 Farkas K et al. Prognostic role of mucosal healing Farkas K, Lakatos PL, Szűcs M, Pallagi-Kunstár É, Bálint A, Nagy F, Szepes Z, Vass N, Kiss LS, Wittmann T, Molnár T. Frequency and prognostic role of mucosal healing in patients with Crohn s disease and ulcerative colitis after one-year of biological therapy. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Colonoscopies still play an important role in the diagnosis, management and monitoring of inflammatory bowel disease (IBD) - a chronic, relapsing inflammatory condition of the gut. IBD comprises Crohn s disease (CD) and ulcerative colitis (UC). Mucosal healing is now regarded as one of the most important goals in the treatment of IBD, considering that mucosal healing can alter the course of the disease due to its association with sustained clinical remission and reduced rates of hospitalization and surgery [1]. Although endoscopy provides a direct evaluation of the mucosal lesions in IBD and intestinal activity may be quantified by indices of endoscopic activity, a clear definition of mucosal healing is still lacking. Most of the clinical trials on CD define mucosal healing as the total disappearance of mucosal ulcerations [2]. The simplified endoscopic activity score for Crohn s disease (SES-CD), developed by Daperno et al [3] has become a relatively easy tool for the assessment of mucosal lesions in CD, although it is not widely used in practice. In UC, several endoscopic indices have been used in clinical trials to evaluate the endoscopic activity [4] ; however, the Mayo endoscopic score remains the most commonly used, not only in trials but also in clinical practice [5]. The weaknesses of these endoscopic activity indices include the absence of a clear definition and the lack of validation of mucosal healing [6]. Mucosal healing has become a subject of renewed interest, as TNF-α blockers have proven their efficacy in inducing and maintaining clinical and endoscopic remission in both CD and UC. In CD, the effect of infliximab on mucosal healing has been examined in substudies of larger clinical trials. In the substudy of the ACCENT I trial [7], 50% of patients receiving scheduled infliximab achieved mucosal healing at week 54. Routine endoscopic follow-up is recommended for all CD patients who have achieved clinical remission with medical therapy; for those with persistent complaints, in order to rule out post-inflammatory irritable bowel syndrome; for those still within their first year after surgery; and for those who are stopping biological therapies but continuing immunosuppressants [8,9]. Combined immunosuppression is seems to be associated with higher rates of mucosal healing therefore treatment intensification is not recommended. However, mucosal healing at the time of treatment withdrawal may predict better outcomes in CD [2]. According to the Hungarian reimbursement regulations (National Health Insurance Fund Administration), biological therapies (infliximab approved for the treatment of CD and UC and adalimumab approved for the treatment of CD) have to be discontinued after a oneyear treatment period. The endoscopic healing of the mucosa is commonly evaluated at the end of the one-year treatment period with anti-tnf blockers in the Hungarian biological centers. In the present study, our aim was to assess the endoscopic activity and the rate of mucosal healing after a one-year period of biological therapy and to evaluate how the endoscopic findings of the mucosa predict the frequency of relapses and the need for restarting biological therapy after stopping in patients with CD and UC. MATERIALS AND METHODS Study design and patients This was a prospective observational study conducted at 2 Hungarian tertiary referral biological centers in the First Department of Medicine, University of Szeged and First Department of Medicine, Semmelweis University between January 2010 and December The study was approved by the Semmelweis University Regional and Institutional Committee of Science and Research Ethics and by the Regional and Institutional Human Medical Biological Research Ethics Committee of the University of Szeged. The analysis focused on patients who underwent an ileocolonoscopy before and after the one-year biological therapy and in whom anti-tnfs were discontinued at the end of the year. Endoscopies were performed by four experienced gastroenterologists (Molnár T, Lakatos PL, Nagy F, and Szepes Z) after stopping the one-year biological therapy. Forty-one consecutive CD patients (25 females, 16 males, mean disease duration at the beginning of biological therapy: 5 years) and 22 UC patients (14 females, 8 males, mean disease duration at the beginning of biological therapy: 9.1 years) were prospectively followed up in this study. All patients received maintenance infliximab or adalimumab therapy for one year in accordance with Hungarian regulations. Diagnosis was based on the Lennard-Jones Criteria [10]. CD disease phenotypes were determined according to the Montreal Classification [11]. Twenty-four CD patients received infliximab, and 17 received adalimumab. All of the UC patients received infliximab. These patients received the last dose of biological therapy at least 3 mo before the repeated one-year therapy. Twenty-eight patients were naive to biological therapy (did not receive biological therapy before the one-year treatment period analyzed in the study) in the CD group, and 21 patients, in the UC group. The concomitant immunosuppression during the induction therapy was steroids in 42 and azathioprine in 51 patients. The clinical characteristics of the patients are presented in Table 1. Patient data regarding smoking status, previous appendectomy, perianal involvement, presence of extraintestinal manifestation, concomitant immunosuppressive medications, outcome of induction therapy, previous 2996 March 21, 2014 Volume 20 Issue 11

278 Farkas K et al. Prognostic role of mucosal healing Table 1 Demographic and clinical characteristics of patients enrolled in the study CD patients (n = 41) UC patients (n = 22) Female/male 25/16 14/8 Mean age at diagnosis (yr) 28 (15-59) 33 (14-53) Mean age at the beginning of 32 (20-62) 43 (17-66) biological therapy (yr) Age at diagnosis < 16 yr (A1) yr (A2) > 40 yr (A3) 6 6 Location Ileal (L1) 6 - Colonic (L2) 7 - Ileocolonic (L3) 28 - Upper GI (L4) 0 - Proctitis - 0 Left-sided colitis - 14 Extensive colitis - 8 Behaviour Inflammatory (B1) 12 - Stricturing (B2) 8 - Penetrating (B3) 21 - Perianal manifestation 23 - Extraintestinal manifestation 26 9 Concomitant medications Corticosteroids Azathioprine Surgery before the biological 19 3 therapy Previous biological therapy 13 1 Median CDAI/pMayo at the start of biological therapy Median CRP level at the start of biological therapy (mg/l) Current smokers 18 0 Appendectomy 7 0 CD: Crohn s disease; UC: Ulcerative colitis; GI: Gastrointestinal; CRP: C-reactive protein; CDAI: Crohns disease activity index. surgical procedures, and previous biological therapy were collected. Biopsy samples were not taken routinely. Assessment of clinical and endoscopic remission based on biological therapy Clinical activities, as determined by the Crohn s Disease Activity Index (CDAI - with hematocrit value) [12] in CD and by the Mayo score [4] in UC, were calculated at the end of the biological therapy when the endoscopic assessment was performed, while partial Mayo scores were calculated when biological therapy needed to be restarted. Clinical remission was defined as a CDAI of < 150 points and a Mayo score of < 2 points. Sustained clinical remission was defined as a stable, steroid-free clinical remission during the 1-year follow-up period. The definition of relapse and indication for restarting biologicals were an increase of > 100 points in CDAI and a CDAI of > 150 points and a partial Mayo score of > 3 points. The endoscopic severity of CD was quantified with SES-CD in CD [2] and with Mayo endoscopic subscore in UC [4]. The endoscopic scores were prospectively assessed by two investigators (Molnár T, Lakatos PL). Mucosal healing was defined using the endoscopic indices as SES- CD between 0 and 3 and Mayo endoscopic subscore as 0. Endpoints Data collection and analysis were performed at the 1st Department of Medicine at the University of Szeged. The primary endpoint of the study was the proportion of mucosal healing in IBD after the one-year period of biological therapy. The secondary endpoint was the frequency of relapses in the next year after achieving mucosal healing. Statistical analysis Variables were tested for normality using Shapiro-Wilk s W test. The χ 2 -test and χ 2 -test with Yates correction and logistic regression analysis were used to assess the association between categorical clinical variables and clinical/endoscopic outcomes. The variables analyzed were gender, disease duration, active smoking, appendectomy, location/extent, behavior, associated perineal disease, type of anti-tnf agent, extraintestinal manifestations, steroid and azathioprine therapy during the induction period, previous surgery, previous biological therapy, clinical activities, CRP levels (mg/l), and outcomes of induction therapy. The difference between patients with mucosal healing and those who failed to achieve endoscopic remission was assessed by chi-square or Fisher s exact tests. Kaplan-Meier survival curves were plotted for analysis with the Log-Rank and Breslow tests. A P value < 0.05 was considered significant. For the statistical analysis, SPSS15.0 (SPSS Inc., Chicago, IL) was used. RESULTS Clinical activity of CD and UC after the one-year period of biological therapy The median CDAI was 60 (interquartile range: ) (P < 0.001) and the partial Mayo score was 0 (interquartile range: 0-4) (P < 0.001) at the end of the treatment period. A total of 35/41 patients with CD (85%) and 12/22 with UC (55%) achieved clinical remission at the end of the year of biological therapy. Endoscopic activity of CD and UC before and after the one year period of biological therapy Colonoscopies reached the terminal ileum in every case. The median values of the SES-CD and the Mayo endoscopic subscores significantly improved after the anti-tnf therapy [16 (interquartile range: 12-23) vs 5 (interquartile range: 3-9), P < 0.001, and 3 (interquartile range: 2-3) vs 1 (interquartile range: 0-2), P < 0.001]. Mucosal healing was achieved in 23 CD (56%) and 7 UC (32%) patients. At the end of one year of treatment, clinical remission was achieved in 96% of CD patients with mucosal healing and in 71% of UC patients with mucosal healing. Deep remission - both mucosal healing and clinical remission - was achieved in 22 CD and 5 UC patients March 21, 2014 Volume 20 Issue 11

279 Farkas K et al. Prognostic role of mucosal healing Probability of survival without need to restart biologicals No mucosal healing Mucosal healing Censored Censored Time from cessasion of index biological therapy (mo) Figure 1 Kaplan-Meier analysis using Log-Rank and Breslow tests; clinical remission or mucosal healing was not associated with the time to restarting biological therapy in Crohn s disease. Need for restarting biological therapy and association between mucosal healing and restarting biological therapy During the one-year follow up period, 11 patients in the clinical remission group and 18 patients in the deep remission group had to be retreated. In CD, biological therapy was restarted due to clinical relapse in 32 (78%) patients after a median 5 mo (interquartile range: mo). The median CDAI was 332 (interquartile range: ) at the time of relapse. In UC, biological therapy needed to be restarted in 13 patients (59%) after a median 7.5 mo (interquartile range: 4-11 mo). The median partial Mayo score was 6.5 (interquartile range: 5.3-7) at the time of retreatment. Of note, therapy was restarted in the two patients who achieved mucosal healing, and 5 of the 7 patients who achieved clinical remission and all 5 patients who achieved deep remission had to be retreated within one year. Endoscopic activity was not assessed in every patient when the biological therapy was restarted. The response rates for retreatment were 81% in CD and 54% in UC within an average of 8 wk after the reintroduction of the therapy. In a univariate or Kaplan-Meier analysis using the Log-Rank and Breslow tests, neither clinical remission nor mucosal healing was associated with the time to restarting biological therapy in either CD (Figure 1) or UC. In univariate analysis, none of the investigated parameters (e.g., gender, disease duration, smoking status, history of appendectomy, location/extent, behavior, the type of anti TNF-α therapy, extraintestinal manifestations, steroid therapy at inclusion, previous surgery, previous biological therapy, CRP level, or the effect of induction therapy) was associated with the need to restart biological therapy in either CD or UC (Table 2). No association was found between combined immunomodulator therapy and mucosal healing (Table 2). Table 2 Univariate regression analysis of need for retreatment with biologicals Factor CD-P value UC-P value Gender Disease duration Smoking status Appendectomy Location/extent Behaviour Type of anti TNF-α therapy Extraintestinal manifestations Steroid therapy at inclusion Previous surgery Previous biological therapy Elevated CRP level Combined immunomodulator use Outcome of induction therapy TNF-α: Tumor necrosis factor-α; CD: Crohn s disease; UC: Ulcerative colitis; CRP: C-reactive protein. DISCUSSION In this prospective observational study conducted in patients with CD and UC receiving biological therapy for one year, mucosal healing was observed in 56% and 32% of the patients, respectively. Deep remission, including both clinical and endoscopic remission, was detected in 54% and 23% of patients with CD and UC. Retreatment with biological therapy was necessary in 78% of CD patients and in 100% of UC patients, despite their achieving mucosal healing within 12 mo. Our results showed that mucosal healing after 12 mo of treatment was not associated with sustained clinical remission. Mucosal healing seems to be associated with better outcomes (reduced rate of hospitalization, complications, surgery) in CD [13,14]. The study of Ananthakrishnan demonstrated that mucosal healing as an endpoint is cost effective in CD patients initiating infliximab therapy [15]. In a Norwegian study, mucosal healing was associated with lower colectomy rate in UC and decreased need for steroid treatment in CD [16]. The STORI trial suggested that one of the predictors of relapse after discontinuation of biological therapy was the absence of mucosal healing at the time of drug withdrawal [9]. The study of Baert et al [17] confirmed that complete mucosal healing after 2 years of therapy in patients with early stage CD predicted sustained steroid-free remission 3 and 4 years after therapy was initiated. Regarding the therapeutic repertoire of IBD, biological agents proved to be the most effective in inducing mucosal healing. The ACCENT Ⅰ study confirmed that scheduled infliximab therapy is more effective in achieving mucosal healing than episodic treatment [14] for CD. The beneficial effect of the combined use of infliximab and azathioprine on mucosal healing was proven by the SONIC trial, in which the achievement of mucosal healing occurred in 44% of patients receiving both therapies [18]. In the EXTEND trial, 24% of adalimumab-treated patients reached complete mucosal healing at week 2998 March 21, 2014 Volume 20 Issue 11

280 Farkas K et al. Prognostic role of mucosal healing 52 [19]. The ACT trials confirmed the efficacy of infliximab in inducing and maintaining mucosal healing in active UC [7]. The combined use of infliximab and azathioprine resulted in 63% mucosal healing in the SUCCESS trial [20]. In our study, anti TNF-α therapy proved to be more effective in achieving mucosal healing in CD than in UC (almost twice as many CD patients achieved endoscopic remission as UC patients). This result may be due to the difference in the sizes of the inflamed area, the enrolled patient number and the proportion of patients with previous biological therapy in the CD and UC groups. No differences were detected in the efficacy between infliximab and adalimumab; however, it should be noted that adalimumab was used in a lower number of patients. In the future, an important question for discussion is exactly when mucosal healing should be established. International guidelines recommend assessing endoscopic healing after stopping the therapy with anti-tnf agents. Our results do not support this recommendation after one-year therapy because more than 80% of the patients with mucosal healing relapsed and needed retreatment. From another point of view, to date, there is no established guideline on when biological therapy can be discontinued. According to the recent London Position Statement of the World Congress of Gastroenterology on Biological Therapy for IBD, the withdrawal of biological therapy is suggested in CD patients who have both complete mucosal healing and no biological evidence of inflammation [21]. In our study, 85% of patients with deep remission relapsed within a year. The response rates for retreatment were 81% in CD and 54% in UC. In the STORI study, infliximab therapy was terminated in 115 CD patients in clinical remission after treatment with a combination of scheduled infliximab and a stable dose of immunosuppressant for at least one year [9]. Forty-five percent of patients relapsed following withdrawal from infliximab. Re-treatment with infliximab was effective and well tolerated in 88% of patients who experienced a relapse. In a Danish single-center study, 24% of CD patients and 30% of UC patients discontinued infliximab while in clinical steroid-free remission [22]. The proportion of patients in remission declined steadily, with 61% of CD patients and 75% of UC patients remaining in remission after 1 year. Half of these patients maintained their remission after a median of 2 years. In total, 96% of CD patients and 71% of UC patients experienced complete clinical remission when retreated with infliximab after their relapses. In the longitudinal cohort study by Waugh et al [23] 50% of patients relapsed within 477 d, while 35% remained in sustained clinical remission for nearly 7 years. There are some limitations of this study that should be mentioned. First, biopsy samples were not taken routinely to assess microscopic activity of IBD. Theoretically, the microscopic evaluation of the mucosa reflects the therapeutic response more accurately than an endoscopy, but it should be noted that the histological assessment of biopsy samples demonstrates only mucosal abnormalities. In CD, the transmural pattern is difficult to evaluate [24] in this way. The recently published paper by Bessissow et al [25] demonstrated that the presence of basal plasmacytosis predicts UC clinical relapse in patients with complete mucosal healing (OR = 5.13, 95%CI: ). Moreover, the study of Laharie et al [26] did not find any correlation between histologically confirmed microscopic inflammation and endoscopic activity indices. Therefore, the need for microscopic evaluation in the assessment of mucosal healing may be worth reassessing. Second, the sample size is a bit small to draw significant conclusions, although we think that the tendency of these results is interesting and worth considering. Third, there is no universal agreement regarding an acceptable definition of mucosal healing. In this study, mucosal healing was evaluated on the basis of validated endoscopic activity indices; however, in clinical practice, the disappearance of mucosal ulcers and erosions may be used more frequently. Currently, the primary goals of treatment in IBD are not only the induction and maintenance of clinical remission but also the induction of mucosal healing in an attempt to alter the course of the disease. Endoscopy is still the gold standard method of assessing changes of the mucosa. Considering that the macroscopic findings of the mucosa represent its real alterations after the initiation of a new therapy, mucosal healing represents a more reliable and objective marker in the assessment of therapeutic response than clinical activity indices. However, none of the studies mentioned above support that mucosal healing correlates with clinical activity. Our results also revealed a high proportion of patients who relapsed after mucosal healing. The higher relapse rates in patients who achieved mucosal healing may be explained by the shorter duration of their biological therapy and less frequent use of combined immunosuppressive therapy than in previous similar studies. In this respect, our results call into question the routine endoscopic examinations at the end of the oneyear period of biological therapy. Stopping or continuing the biological therapy may be determined by assessing the patient s general condition and the clinical activity. Certainly, large controlled clinical trials are required to confirm these results. However, based on our observations, we conclude that the long-term advantages of mucosal healing can be achieved only if we continue previous effective therapies, even after the endoscopic examination. COMMENTS Background Mucosal healing is now regarded as one of the most important goals in the treatment of inflammatory bowel disease. Mucosal healing is associated with a lower colectomy rate and a decreased need for steroid treatment. Tumor necrosis factor (TNF)-α blockers have proven their efficacy in inducing and maintaining clinical and endoscopic remission in both Crohn s disease (CD) and ulcerative colitis (UC). In Hungarian biological centers, the endoscopic healing of the mucosa is commonly evaluated at the end of the one-year treatment period with anti-tnf blockers. Research frontiers Previous studies have suggested that the absence of mucosal healing at the time of discontinuation of biological therapy predicted a relapse. Scheduled 2999 March 21, 2014 Volume 20 Issue 11

281 Farkas K et al. Prognostic role of mucosal healing infliximab therapy is more effective in achieving mucosal healing than episodic treatment. Innovations and breakthroughs Mucosal healing can alter the course of the disease, as it is associated with sustained clinical remission and reduced rates of hospitalization and surgery. Exactly when mucosal healing should be established is an important question. The results call into question the routine endoscopic examinations at the end of a one-year period of biological therapy. Applications Anti TNF-α therapy proved to be more effective in achieving mucosal healing in CD than in UC. Retreatment with biological therapy was needed in 78% of CD patients and in 100% of UC patients, despite their achieving mucosal healing within 12 mo. The results call into question the routine endoscopic examinations performed at the end of the one-year period of biological therapy. Peer review This is an interesting study with the important message that mucosal healing does not predict sustained clinical remission if the biologicals are stopped after one year of treatment. REFERENCES 1 Pineton de Chambrun G, Peyrin-Biroulet L, Lémann M, Colombel JF. Clinical implications of mucosal healing for the management of IBD. Nat Rev Gastroenterol Hepatol 2010; 7: [PMID: DOI: /nrgastro ] 2 Armuzzi A, Van Assche G, Reinisch W, Pineton de Chambrun G, Griffiths A, Sladek M, Preiss JC, Lukas M, D Haens G. Results of the 2nd scientific workshop of the ECCO (IV): therapeutic strategies to enhance intestinal healing in inflammatory bowel disease. J Crohns Colitis 2012; 6: [PMID: ] 3 Daperno M, D Haens G, Van Assche G, Baert F, Bulois P, Maunoury V, Sostegni R, Rocca R, Pera A, Gevers A, Mary JY, Colombel JF, Rutgeerts P. Development and validation of a new, simplified endoscopic activity score for Crohn s disease: the SES-CD. Gastrointest Endosc 2004; 60: [PMID: DOI: /S (04) ] 4 Dave M, Loftus EV. Mucosal healing in inflammatory bowel disease-a true paradigm of success? Gastroenterol Hepatol (N Y) 2012; 8: [PMID: ] 5 Schroeder KW, Tremaine WJ, Ilstrup DM. Coated oral 5-aminosalicylic acid therapy for mildly to moderately active ulcerative colitis. A randomized study. N Engl J Med 1987; 317: [PMID: DOI: /NEJM ] 6 Neurath MF, Travis SP. Mucosal healing in inflammatory bowel diseases: a systematic review. Gut 2012; 61: [PMID: DOI: /gutjnl ] 7 Rutgeerts P, Feagan BG, Lichtenstein GR, Mayer LF, Schreiber S, Colombel JF, Rachmilewitz D, Wolf DC, Olson A, Bao W, Hanauer SB. Comparison of scheduled and episodic treatment strategies of infliximab in Crohn s disease. Gastroenterology 2004; 126: [PMID: DOI: / j.gastro ] 8 Rutgeerts P, Sandborn WJ, Feagan BG, Reinisch W, Olson A, Johanns J, Travers S, Rachmilewitz D, Hanauer SB, Lichtenstein GR, de Villiers WJ, Present D, Sands BE, Colombel JF. Infliximab for induction and maintenance therapy for ulcerative colitis. N Engl J Med 2005; 353: [PMID: DOI: /NEJMoa050516] 9 Louis E, Mary JY, Vernier-Massouille G, Grimaud JC, Bouhnik Y, Laharie D, Dupas JL, Pillant H, Picon L, Veyrac M, Flamant M, Savoye G, Jian R, Devos M, Porcher R, Paintaud G, Piver E, Colombel JF, Lemann M. Maintenance of remission among patients with Crohn s disease on antimetabolite therapy after infliximab therapy is stopped. Gastroenterology 2012; 142: e5; quiz e31 [PMID: DOI: / j.gastro ] 10 Lennard-Jones JE. Classification of inflammatory bowel disease. Scand J Gastroenterol Suppl 1989; 170: 2-6; discussion [PMID: DOI: / ] 11 Silverberg MS, Satsangi J, Ahmad T, Arnott ID, Bernstein CN, Brant SR, Caprilli R, Colombel JF, Gasche C, Geboes K, Jewell DP, Karban A, Loftus EV, Peña AS, Riddell RH, Sachar DB, Schreiber S, Steinhart AH, Targan SR, Vermeire S, Warren BF. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol 2005; 19 Suppl A: 5A-36A [PMID: ] 12 Best WR, Becktel JM, Singleton JW, Kern F. Development of a Crohn s disease activity index. National Cooperative Crohn s Disease Study. Gastroenterology 1976; 70: [PMID: ] 13 Schnitzler F, Fidder H, Ferrante M, Noman M, Arijs I, Van Assche G, Hoffman I, Van Steen K, Vermeire S, Rutgeerts P. Mucosal healing predicts long-term outcome of maintenance therapy with infliximab in Crohn s disease. Inflamm Bowel Dis 2009; 15: [PMID: DOI: / ibd.20927] 14 Rutgeerts P, Diamond RH, Bala M, Olson A, Lichtenstein GR, Bao W, Patel K, Wolf DC, Safdi M, Colombel JF, Lashner B, Hanauer SB. Scheduled maintenance treatment with infliximab is superior to episodic treatment for the healing of mucosal ulceration associated with Crohn s disease. Gastrointest Endosc 2006; 63: ; quiz 464 [PMID: ] 15 Ananthakrishnan AN, Korzenik JR, Hur C. Can mucosal healing be a cost-effective endpoint for biologic therapy in Crohn s disease? A decision analysis. Inflamm Bowel Dis 2013; 19: [PMID: DOI: /ibd.22951] 16 Frøslie KF, Jahnsen J, Moum BA, Vatn MH. Mucosal healing in inflammatory bowel disease: results from a Norwegian population-based cohort. Gastroenterology 2007; 133: [PMID: DOI: /j.gastro ] 17 Baert F, Moortgat L, Van Assche G, Caenepeel P, Vergauwe P, De Vos M, Stokkers P, Hommes D, Rutgeerts P, Vermeire S, D Haens G. Mucosal healing predicts sustained clinical remission in patients with early-stage Crohn s disease. Gastroenterology 2010; 138: ; quiz e10-11 [PMID: DOI: /j.gastro ] 18 Colombel JF, Sandborn WJ, Reinisch W, Mantzaris GJ, Kornbluth A, Rachmilewitz D, Lichtiger S, D Haens G, Diamond RH, Broussard DL, Tang KL, van der Woude CJ, Rutgeerts P. Infliximab, azathioprine, or combination therapy for Crohn s disease. N Engl J Med 2010; 362: [PMID: DOI: /NEJMoa ] 19 Rutgeerts P, Van Assche G, Sandborn WJ, Wolf DC, Geboes K, Colombel JF, Reinisch W, Kumar A, Lazar A, Camez A, Lomax KG, Pollack PF, D Haens G. Adalimumab induces and maintains mucosal healing in patients with Crohn s disease: data from the EXTEND trial. Gastroenterology 2012; 142: e2 [PMID: DOI: /j.gastro ] 20 Panaccione R, Ghosh S, Middleton S. Infliximab, azathioprine, or infliximab azathioprine for treatment of moderate to severe ulcerative colitis. Gastroenterology 2011; 140 (Suppl 1): S D Haens GR, Panaccione R, Higgins PD, Vermeire S, Gassull M, Chowers Y, Hanauer SB, Herfarth H, Hommes DW, Kamm M, Löfberg R, Quary A, Sands B, Sood A, Watermeyer G, Lashner B, Lémann M, Plevy S, Reinisch W, Schreiber S, Siegel C, Targan S, Watanabe M, Feagan B, Sandborn WJ, Colombel JF, Travis S. The London Position Statement of the World Congress of Gastroenterology on Biological Therapy for IBD with the European Crohn s and Colitis Organization: when to start, when to stop, which drug to choose, and how to predict response? Am J Gastroenterol 2011; 106: ; quiz 213 [PMID: DOI: /ajg ] 22 Steenholdt C, Molazahi A, Ainsworth MA, Brynskov J, Østergaard Thomsen O, Seidelin JB. Outcome after discontinuation of infliximab in patients with inflammatory bowel 3000 March 21, 2014 Volume 20 Issue 11

282 Farkas K et al. Prognostic role of mucosal healing disease in clinical remission: an observational Danish single center study. Scand J Gastroenterol 2012; 47: [PMID: ] 23 Waugh AW, Garg S, Matic K, Gramlich L, Wong C, Sadowski DC, Millan M, Bailey R, Todoruk D, Cherry R, Teshima CW, Dieleman L, Fedorak RN. Maintenance of clinical benefit in Crohn s disease patients after discontinuation of infliximab: long-term follow-up of a single centre cohort. Aliment Pharmacol Ther 2010; 32: [PMID: ] 24 Freeman HJ. Limitations in assessment of mucosal healing in inflammatory bowel disease. World J Gastroenterol 2010; 16: [PMID: ] 25 Bessissow T, Lemmens B, Ferrante M, Bisschops R, Van Steen K, Geboes K, Van Assche G, Vermeire S, Rutgeerts P, De Hertogh G. Prognostic value of serologic and histologic markers on clinical relapse in ulcerative colitis patients with mucosal healing. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ] 26 Laharie D, Filippi J, Roblin X, Nancey S, Chevaux JB, Hébuterne X, Flourié B, Capdepont M, Peyrin-Biroulet L. Impact of mucosal healing on long-term outcomes in ulcerative colitis treated with infliximab: a multicenter experience. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12289] P- Reviewers: Efthymiou A, Liu TC, Nielsen OH S- Editor: Wen LL L- Editor: A E- Editor: Zhang DN 3001 March 21, 2014 Volume 20 Issue 11

283 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. BRIEF ARTICLE A randomized trial of iron depletion in patients with nonalcoholic fatty liver disease and hyperferritinemia Luca Valenti, Anna Ludovica Fracanzani, Paola Dongiovanni, Serena Rovida, Raffaela Rametta, Erika Fatta, Edoardo Alessandro Pulixi, Marco Maggioni, Silvia Fargion Luca Valenti, Anna Ludovica Fracanzani, Paola Dongiovanni, Serena Rovida, Raffaela Rametta, Erika Fatta, Edoardo Alessandro Pulixi, Silvia Fargion, Department of Pathophysiology and Transplantation, Metabolic Liver Diseases Research Center, Università degli Studi di Milano, Fondazione IRCCS Ca' Granda Ospedale Policlinico, via F Sforza 35, 20122, Milano, Italy Marco Maggioni, Pathology, Fondazione IRCCS Ca Granda Ospedale Policlinico, Milano, Italy Author contributions: All Authors contributed to literature review and writing of this paper. Supported by Associazione Malattie Metaboliche del Fegato ONLUS (Non-profit organization for the Study and Care of Metabolic Liver Diseases), Centro Studi Malattie Metaboliche del Fegato, Università degli Studi di Milano Correspondence to: Luca Valenti, MD, Department of Pathophysiology and Transplantation, Metabolic Liver Diseases Research Center, Università degli Studi di Milano, Fondazione IRCCS Ca' Granda Ospedale Policlinico, via F Sforza 35, 20122, Milano, Italy. luca.valenti@unimi.it Telephone: Fax: Received: September 16, 2013 Revised: November 6, 2013 Accepted: December 3, 2013 Published online: March 21, 2014 Abstract AIM: To compare iron depletion to lifestyle changes alone in patients with severe nonalcoholic fatty liver disease (NAFLD) and hyperferritinemia, a frequent feature associated with more severe liver damage, despite at least 6 mo of lifestyle changes. METHODS: Eligible subjects had to be years old who underwent liver biopsy for ultrasonographically detected liver steatosis and hyperferritinemia, ferritin levels 250 ng/ml, and NAFLD activity score > 1. Iron depletion had to be achieved by removing 350 cc of blood every d according to baseline hemoglobin values and venesection tolerance, until ferritin < 30 ng/ ml and/or transferrin saturation (TS) < 25%. Thirtyeight patients were randomized 1:1 to phlebotomy (n = 21) or lifestyle changes alone (n = 17). The main outcome of the study was improvement in liver damage according to the NAFLD activity score at 2 years, secondary outcomes were improvements in liver enzymes [alanine aminotransferases (ALT), aspartate aminotransferase (AST), and gamma-glutamyl-transferases (GGT)]. RESULTS: Phlebotomy was associated with normalization of iron parameters without adverse events. In the 21 patients compliant to the study protocol, the rate of histological improvement was higher in iron depleted vs control subjects (8/12, 67% vs 2/9, 22%, p = 0.039). There was a better improvement in steatosis grade in iron depleted vs control patients (p = 0.02). In patients followed-up at two years (n = 35), ALT, AST, and GGT levels were lower in iron-depleted than in control patients (p < 0.05). The prevalence of subjects with improvement in histological damage or, in the absence of liver biopsy, ALT decrease 20% (associated with histological improvement in biopsied patients) was higher in the phlebotomy than in the control arm (p = 0.022). The effect of iron depletion on liver damage improvement as assessed by histology or ALT decrease 20% was independent of baseline AST/ALT ratio and insulin resistance (p = ). CONCLUSION: Iron depletion by phlebotomy is likely associated with a higher rate of improvement of histological liver damage than lifestyle changes alone in patients with NAFLD and hyperferritinemia, and with amelioration of liver enzymes Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Nonalcoholic fatty liver disease; Iron depletion; Randomized controlled trial; Ferritin 3002 March 21, 2014 Volume 20 Issue 11

284 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia Core tip: We compared in a randomized controlled trial iron depletion by phlebotomy (n = 21) to standard therapy (n = 17) in patients with severe nonalcoholic fatty liver disease and hyperferritinemia despite at least 6 mo of lifestyle changes. Phlebotomy was associated with normalization of iron parameters without adverse events. In the 21 patients compliant to the study protocol, the rate of histological improvement was higher in iron depleted vs control subjects (p = 0.039). In patients followed-up at two years (n = 35), by the end of the study alanine aminotransferases, aspartate aminotransferase, and gamma-glutamyl-transferases levels were lower in iron-depleted than in control patients (p < 0.05). Valenti L, Fracanzani AL, Dongiovanni P, Rovida S, Rametta R, Fatta E, Pulixi EA, Maggioni M, Fargion S. A randomized trial of iron depletion in patients with nonalcoholic fatty liver disease and hyperferritinemia. World J Gastroenterol 2014; 20(11): Available from: URL: com/ /full/v20/i11/3002.htm DOI: org/ /wjg.v20.i INTRODUCTION Nonalcoholic fatty liver disease (NAFLD), the hepatic expression of the metabolic syndrome [1], affects 20%-30% of the Western population [2,3]. When associated with necroinflammation and ballooning, defining nonalcoholic steatohepatitis (NASH), NAFLD may evolve to cirrhosis and hepatocarcinoma [4]. Although lifestyle modifications improve liver damage [5], long-term compliance is difficult to achieve [6], and no pharmacological approach is yet approved for NASH. Hyperferritinemia with mild hepatic iron accumulation is observed in 20%-30% of patients with NAFLD referred to tertiary centres [7-10], and is commonly referred as dysmetabolic iron overload syndrome [11]. Besides directly inducing liver damage [11], excess iron is involved in the pathogenesis of metabolic syndrome by inducing adipose tissue insulin resistance and modifying the release of adipokines [11-13]. Furthermore, hyperferritinemia and increased iron stores have been associated with the severity of liver disease and hepatocellular carcinoma in patients with NAFLD [10,14-17]. Therefore, previous studies have evaluated the therapeutic value of iron depletion in NAFLD. Phlebotomy ameliorated insulin resistance more than lifestyle changes alone in a matched case-control study including 128 patients [18], whereas in a propensity score adjusted multicenter study with prospective evaluation of 198 patients, it increased the likelihood of alanine aminotransferases (ALT) normalization at the end of follow-up [19]. Furthermore, in a phase Ⅱ trial in 31 patients with NAFLD, phlebotomy was associated with and improvement in disease activity [20]. Aim of this study was to compare the effect of iron depletion by phlebotomy to that of maintenance of lifestyle changes alone (i.e., the standard of care) on histological liver damage evaluated at 24 mo in a randomized controlled phase Ⅲ trial in subjects with NAFLD and hyperferritinemia (ClinicalTrials.gov Identifier: NCT ). MATERIALS AND METHODS Eligible subjects had to be years old who underwent liver biopsy between January 1 st 2007, and December 31 st 2010 for ultrasonographically detected liver steatosis and hyperferritinemia despite at least 6 mo of lifestyle modifications, ferritin levels 250 ng/ml or histological evidence of increased iron stores, and NAFLD activity score (NAS) > 1 (henceforth defined as severe NAFLD ) at a liver biopsy obtained within 6 mo before randomization, as commonly accepted in NAFLD trials [21]. Subjects had to be willing to maintain diet and exercise during the full course of the study, to give written informed consent, and to comply with all study requirements. We excluded patients with decompensated liver disease, pregnant or lactating females, type 1 or secondary forms of diabetes, thyroid diseases (by TSH evaluation), alcohol consumption > 20 g/d for females and > 30 g/d for males, BMI 35 kg/m 2, other liver diseases, alpha- 1-antitrypsin deficiency (alpha-1-antitrypsin levels < 80 mg/dl or PiZ/PiZ or PiZ/PiS genotype), and hereditary hemochromatosis (HFE C282Y/C282Y or C282Y/ H63D or hepatic iron index 1.9), previous or active chronic HCV and HBV hepatitis (HBsAg, ABcAg, and anti-hcv Ab were evaluated in all subjects), congestive heart failure and ischemic heart disease, systolic dysfunction (ejection fraction 45%), ECG abnormalities, malignancy within the last 5 years, serum creatinine levels > 1.5 mg/dl males, > 1.4 mg/dl females, use of drugs known to induce NAFLD, and basal hemoglobin levels < 11 g/dl. Before randomization, all patients underwent electrocardiographic evaluation, and in the presence of hyperglycemia or hypertension also echocardiography. Carriers of HFE gene mutation without hemochromatosis were enrolled, as HFE mutations are strong risk factors for mildly increased iron stores in NAFLD [17,22]. Patients were randomized 1:1 by random numbers generation to lifestyle changes alone or lifestyle changes associated with iron depletion by phlebotomy. In the phlebotomy group, iron depletion had to be achieved by removing 350 cc of blood every d according to baseline hemoglobin (Hb) values and venesection tolerance, until ferritin < 30 ng/ml and/or transferrin saturation (TS) < 25%. Weekly phlebotomies were allowed for carriers of the C282Y HFE mutation, smaller phlebotomies (250 cc) for carriers of beta-thalassaemia trait. Maintenance phlebotomies (as much as required) were then performed to keep iron stores depleted (target: ferritin < 50 ng/ml and < 25%, MCV < 85 fl). Iron removed to 3003 March 21, 2014 Volume 20 Issue 11

285 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia 128 patients underwent liver biopsy for suspected NAFLD excluded because of normal ferritin and iron stores 23 excluded because of mild liver disease 3 refused randomization 38 patients underwent randomization: 21 iron depletion by phlebotomy 17 lifestyle changes 3 lost to follow-up 2 developed serious adverse events (neoplasia) 14 refused control liver biopsy 19 patients underwent follow-up liver biopsy Figure 1 Study flow chart. NAFLD: Nonalcoholic fatty liver disease. depletion was estimated as previously described [23]. Visits were scheduled at week: -2, baseline (day 1), and at months 6, 12, 18, 24, for physical examination, evaluation of vital signs and anthropometric measures (weight, abdominal circumference), laboratory evaluation, including complete blood count, liver enzymes, iron parameters, C reactive protein, glucose, insulin, serum lipids. Hepatic ultrasonography was performed at baseline, year 1, year 2. Adverse event were reported at each visit, and when notified by the patients. Changes in diabetes medication dosage or start of new therapy (metformin) have been allowed for HbA1C values < 6% or 7%. The primary outcome of the study was improvement of histological damage related to NAFLD, as defined by any improvement of NAS (based on the severity of steatosis graded 0-3, lobular necroinflammation graded 0-3, and hepatocellular ballooning graded 0-2) without worsening of liver fibrosis, or an improvement of liver fibrosis without worsening of NAS [21]. Liver biopsies have been reviewed in a blinded fashion by an expert pathologist (Maggioni M). Hepatic iron concentration was quantified by atomic absorption spectrometry [24], and scored according to Deugnier et al [25]. Secondary outcomes included the evaluation of the effect of phlebotomy on liver enzymes [ALT, aspartate aminotransferareses (AST), and gammaglutamyl-transferases (GGT) levels]. The protocol was approved by the Ethical Committee of the Fondazione IRCCS Ca Granda Ospedale Policlinico Milano, and conforms to the principles of the Declaration of Helsinki. Informed written consent has been recorded for each subject participating in the study. The study flow chart is presented in Figure 1. The clinical features of enrolled patients are shown in Table 1. Statistical analysis The sample size was based on the estimate that 20% of the patients would spontaneously improve liver histology in the lifestyle changes group. To detect a 45% response rate among the treatment patients, using an alpha level of 0.05 with 80% power, we estimated we needed to include 62 patients per group. However, the study was closed before the completion of enrolment because of the difficulties in accepting 24 mo control liver biopsies. Therefore, we report the results obtained in patients enrolled in the proposing center (Fondazione IRCCS Ca Granda Milano) during the predefined time period ( ). Data are expression as mean ± SD, median (interquartile range), and frequency (%) according to distribution. Study outcomes were compared between the two treatment arms by χ 2 test, Student t test or Wilcoxon, as required according to data distribution. Improvement in histological indices of liver damage activity were compared by Wilcoxon signed-rank test. Logistic regression analysis considering the treatment arms and major clinical confounders was conducted to adjust the effect of treatment on histological improvement and ALT normalization for clinical factors (included variables are reported in the results section). P values were considered significant when 0.05 (two-tailed). RESULTS Study cohort We enrolled 38 subjects: 21 were randomized to phlebotomy and 17 to the lifestyle changes arm (Figure 1). Patients were mostly middle-aged overweight men with central distribution of adiposity, moderate to severe ste March 21, 2014 Volume 20 Issue 11

286 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia Table 1 Baseline features of 38 randomized subjects with nonalcoholic fatty liver disease and hyperferritinemia/ increased iron stores according to treatment allocation Baseline features Lifestyle changes alone (n = 17) Phlebotomy (n = 21) P value Age (yr) 53 ± ± Gender (female) 3 (18) 1 (5) 0.31 Waist circumference, cm 103 ± ± BMI (kg/m 2 ) 28.2 ± ± HOMA-IR 4.1 ± ± HDL chol (mg/dl) 47 ± ± Triglycerides (mg/dl) 141 ± ± Type 2 diabetes 1 (6) 4 (19) 0.23 Ferritin (ng/ml) 642 ( ) 710 ( ) 0.40 TS (%) 40 ± ± HIC (μg/100 mg dry tissue) 234 (98-358) 303 ( ) 0.23 TIS 6 (4-12) 9 (6-11) 0.19 ALT (UI/mL) 39 ± ± AST (UI/mL) 30 ± ± GGT (UI/mL) 40 (24-56) 28 (21-41) 0.36 US Steatosis grade > 1 17 (100) 17 (81) 0.11 NAS 3 11 (65) 13 (63) 1.00 Fibrosis stage (18) 7 (33) 0.46 HFE genotype C282Y+ or H63D +/+ 2 (11) 2 (10) 0.82 Beta-thalassemia trait 4 (23) 4 (19) 1.00 Data are expressed as absolute numbers (percentage), mean ± SD or median (interquartile range). ALT: Alanine aminotransferases; AST: Aspartate aminotransferases; BMI: Body mass index; Chol: Cholesterol; GGT: Gamma-glutamyl-transferases; HDL: High density lipoprotein; HFE: Hemochromatosis gene; HIC: Hepatic iron concentration; HOMA-IR: Homeostasis model assessment insulin resistance index; NAS: Nonalcoholic fatty liver disease activity score; TIS: Tissue iron score; TS: Transferrin saturation; US: Ultrasonographic. atosis and insulin resistance (Table 1). At baseline, about two thirds of patients had NASH, and roughly a quarter moderate to severe fibrosis (stage 2-4; Table 1). There were no significant differences in basal demographic, clinical, histological and genetic features between the two treatment arms (Table 1). The majority of patients (22/38, 58%) had already lost > 5% of body weight after clinical presentation, while the other were not able to modify body weight despite at least 6 mo of lifestyle counseling. All patients had hyperferritinemia at baseline. Four patients (10%) had hepatic iron concentration within the upper reference range (150 μg-100 mg), but all were positive for stanaible iron at liver biopsy. Effect of treatment on iron metabolism and body mass In patients randomized to iron depletion, phlebotomy achieved a reduction in biochemical iron parameters (Figure 2A, B, p < ). Ferritin levels dropped progressively towards the treatment target, whereas TS was already reduced to low to normal levels at 6 mo and remained stable throughout the study period. In phlebotomized patients, iron depletion was reached after a median of 16 phlebotomies, interquartile range (IQR) 12-18, corresponding to a median of 4.3 g of iron, IQR In patients with follow-up liver biopsies, tissue iron score was significantly decreased in phlebotomized patients (median -9, IQR -9/-1, p = 0.018), but not in controls (median -2, IQR -5/0, p > 0.05). No patient reported adverse events nor developed anemia (Hb levels during the study are shown in Figure 2C), or alterations in renal function tests (not shown). No significant loss in body weigth was achieved and maintained during the study in either arms (p > 0.7), and there was no significant difference in body mass between treatment groups at the end of the study (27.2 ± 3.9 kg/m 2 in the phlebotomy arm vs 27.6 ± 5.2 kg/m 2 in the control arm, p = 0.8). Effect of treatment on histological damage Follow-up liver biopsy was performed in 19/38 patients (50%). Two patients developed severe adverse events (neoplastic diseases, all in the control group), precluding follow-up liver biopsy. Therefore, 21 patients were evaluated in a per protocol analysis. Of the remaining patients, three were lost to follow-up, and 14 refused control liver biopsy (Figure 1). Reasons most commonly reported for retiring consent from control liver biopsy were complete normalization of iron indices and liver function tests in the phlebotomy group, and the possibility to undergo phlebotomy for persistently abnormal iron indices in the control group. Histological improvement of liver damage in an intention to treat analysis considering all randomized patients was non-significantly higher in iron depleted vs control patients (Figure 3A, p = 0.067), but the difference was statistically significant in the per protocol analysis (Figure 3B, p = 0.039). Variations in histological indices of liver damage activity in individual patients subdivided according to treatment arm are presented in Figure 4. Patients randomized to iron depletion had a significantly better improvement in steatosis grade to that observed in the control group (p = 0.02), whereas differences in the improvement of necroinflammation and ballooning were not statistically significant. Effect of treatment on liver enzymes The time course of liver enzymes during the study period is shown in Figure 5. At later time points, ALT, AST, and GGT levels were significantly lower in phlebotomized patients than in controls (p < 0.05). At receiver-operating characteristic curve analysis conducted in the 19 patients who underwent both baseline and follow-up liver biopsy (not shown), a decrease in ALT levels 20% from baseline to the end of the study represented the best cut-off among the available biomarkers for predicting improvement of histological damage (sensitivity = 100%, specificity = 78%, positive predictive value = 83%, negative predictive value = 100%, positive likelihood ratio = 4.54, negative likelihood ratio = 0.00). The prevalence of subjects with improvement in histological damage or, in the absence of liver biopsy, ALT decrease 20% (overall liver damage assessment) was 3005 March 21, 2014 Volume 20 Issue 11

287 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia A 1200 B 50 b b b b Ferritin ng/ml a b b b Transferrin saturation % t /mo t /mo C Phlebotomy Control Hemoglobin g/dl t /mo Figure 2 Effect of treatment on iron status and erythropoiesis. Effect of treatment on the levels of ferritin (A), transferrin saturation (B), and hemoglobin (C). Phlebotomy: dashed lines and black squares; Lifestyle changes alone: continuous lines and empty squares. a P < 0.05, b P < 0.01 between phlebotomy and lifestyle changes alone treatment arms. A B C 80 P = P = Histological improvement % Control Phlebotomy (n = 17) (n = 21) Histological improvement % Control Phlebotomy (n = 9) (n = 12) Liver damage improvement % P = Control Phlebotomy (n = 15) (n = 20) Figure 3 Effect of treatment on liver damage. Prevalence of demonstrated histological improvement of liver damage at 2 years (any improvement in NAS score without worsening of fibrosis stage; main outcome of the study) in all patients who underwent randomization (panel A; n = 38; intention to treat analysis), and in patients compliant to the study protocol [panel B; n = 21 (19 biopsied and 2 failures due to serious adverse events), per protocol analysis]. The effect of treatment on overall liver damage assessment [improvement in liver histology or alanine aminotransferases (ALT) decrease 20% at the end of the study (n = 35, three patients could not be assessed because lost to final follow-up evaluation); direct and indirect analysis of liver damage evolution in all patients that completed follow-up] is shown in panel C. higher in the phlebotomy than in the control arm (p = 0.022; Figure 3C). Independent predictors of liver damage progression Independent predictors of liver damage improvement (overall assessment) by multivariate logistic regression analysis considering variables most strongly associated at univariate analysis (p < 0.01) are shown in Table 2. Iron depletion was strongly associated with improvement in liver damage independently of confounders. In addition, higher baseline AST/ALT ratio (a validated non-invasive index of liver fibrosis) and insulin resistance (homeostatic metabolic assessment insulin resistance: HOMA- IR index) were negative predictors of a favourable outcome. There was no significant influence of age, gender, baseline iron parameters and hepatic iron stores, and 3006 March 21, 2014 Volume 20 Issue 11

288 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia A 3 P = 0.02 B 3 C Control Phlebotomy Baseline Steatosis 24 mo Baseline 24 mo Lobular necroinflammation Baseline Ballooning 24 mo Figure 4 Variations in histological indices of liver damage activity in individual patients subdivided according to treatment arm. A: Steatosis grade (P = 0.02 at Wilcoxon signed-rank test); B: Necroinflammation (P > 0.05); C: Ballooning (P > 0.05). A 60 a B a a ALT IU/mL AST IU/mL t /mo t /mo C 100 Phlebotomy Control a GGT IU/mL t /mo Figure 5 Effect of treatment on liver enzymes. Time course of liver enzymes: alanine aminotransferases (ALT, A), aspartate aminotransferases (AST, B), and gamma-glutamyl-transferases (GGT, C) during the study. Phlebotomy: Dashed lines and black squares; Lifestyle changes alone: Continuous lines and empty squares. a P < 0.05 between phlebotomy and lifestyle changes alone treatment arms. the genetic background on liver damage improvement (not shown). The outcome was worse in patients with higher baseline abdominal circumference, but the effect was not independent of insulin resistance (not shown). There was no significant interaction between treatment arm and either AST/ALT ratio or HOMA-IR on the improvement of liver damage. DISCUSSION In this paper, we present the results of a phase Ⅲ randomized controlled trial of iron depletion by phlebotomy on histological liver damage in patients with severe NAFLD and hyperferritinemia, a commonly observed clinical syndrome associated with a substantial risk of progressive liver disease [10,11,14-17]. Difficulties in recruiting patients due to the requirement of follow-up liver biopsy, and to the low rate of compliance to this procedure, reduced the statistical power of the study. Notwithstanding, results, that for the first time are derived from a randomized trial with a histological outcome, are consistent with improvement 3007 March 21, 2014 Volume 20 Issue 11

289 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia Table 2 Independent predictors of improvement of liver damage evaluated by multivariate logistic regression analysis at the end of the trial in 35 patients with nonalcoholic fatty liver disease and hyperferritinemia/increased iron stores (P < for model) Independent predictors 1 OR 95%CI P value Iron depletion by phlebotomy AST/ALT ratio < HOMA-IR index Liver damage included direct or indirect evaluation of liver damage in all patients that completed follow-up. AST/ALT: Alanine aminotransferases/ aspartate aminotransferases; HOMA-IR: Homeostasis model assessment insulin resistance index. of histological damage in patients who underwent iron depletion, also in line with previous results based on the assessment of non-invasive markers of liver damage and on the results of uncontrolled studies [18-20]. Indeed, despite iron depletion was not associated with a significant improvement of liver damage at the intention to treat analysis, there was a higher rate of histological improvement of NAFLD activity score in patients randomized to iron depletion who attained to the clinical protocol. The difference in the improvement rate (roughly 65% vs 25% in the control group) was maintained when liver damage improvement was estimated by a non-invasive predictor of liver damage evolution, i.e., serum ALT decrease 20% compared to baseline, which showed a high accuracy in the prediction of histological improvement in patients with follow-up liver biopsy. The limited rate of improvement in the control group is consistent with the selection of patients that were already resistant to lifestyle changes at baseline [6], and by the persistence of altered iron metabolism during the study. Strengths of the study include the high comparability of clinical features in the two treatment arms at baseline, and the fact that all the secondary outcomes related to improvement of liver enzymes (which could be evaluated in the majority on randomized patients) were met. Finally, at multivariate logistic regression analysis the favourable effect of iron depletion on liver damage improvement was independent of the other identified predictors, including the AST/ALT ratio, reflecting baseline severity of liver damage, and of insulin resistance. Notably, phlebotomy normalized iron parameters and hepatic iron stores without adverse effects, whereas two severe adverse events were observed in the control group, consisting in diagnosis of neoplastic diseases after 1 year of follow-up. The difference is likely due to chance, even if increased iron stores have been linked with cancer risk [26], and iron depletion may reduce carcinogenesis [27]. Limitations related to the limited power of the present study must be weighted against the lack of available pharmacological treatments for progressive liver disease in NAFLD and NASH, which is at least partly related to the difficulty of conducting trials requiring short-term followup liver biopsies [28]. The difficulties in maintaining protocol compliance were amplified in the treatment arm by the positive effect of phlebotomy on biochemical indices, and in the controls by the possibility to switch to active treatment (which can be prescribed even in the absence of evidence of efficacy on liver damage progression) without the need of control biopsy. We believe that these difficulties are inherent to the lack of possibility to perform a phlebotomy trial in blinded fashion, and to the availability of active treatment outside the research setting. Finally, we think that the choice of considering any improvement of NAFLD activity score without worsening fibrosis as primary outcome (instead of higher cutoffs), and liver enzymes as secondary outcomes was appropriate for this study. Indeed, the pathophysiology of liver damage progression is different in patients with increased hepatic iron stores than in those with classic NAFLD, in that in the presence of hepatocellular iron liver damage is associated with lesser severity of steatosis and is not invariably dependent on apoptosis [11-13,29,30], but also on other forms of cellular damage including ferroptosis [31]. Given the evidence that, when associated with histopathological signs of liver damage, even steatosis without a diagnosis of definite NASH frequently progress to fibrosis [32], we also believe that the inclusion in the trial of subjects without definite NASH, but with iron overload coupled with severe steatosis or necroinflammation/hepatocellular damage, was appropriate. In conclusion, iron depletion by phlebotomy is probably associated with a higher rate of improvement of liver damage improvement than the maintenance of lifestyle changes alone in patients with severe NAFLD and hyperferritinemia, who did not normalize liver enzymes after at least 6 mo of lifestyle counseling. In addition, iron depletion ameliorates liver enzymes, with a possible impact on the natural history of the disease. The present and previous results [18-20] suggest that, in the absence of pharmacological treatments, larger trials evaluating phlebotomy treatment may be conducted in patients with severe NAFLD and hyperferritinemia resistant to lifestyle changes. ACKNOWLEDGMENTS We thank all the members of the Metabolic Liver Diseases Reseach Center, Università degli Studi di Milano. COMMENTS Background Hyperferritinemia associated with mildly increased hepatic iron stores is frequently observed in nonalcoholic fatty liver disease (NAFLD), the hepatic manifestation of the metabolic syndrome and now a leading cause of liver disease, and has been associated with more advanced liver damage. Pathophysiological studies suggested that iron stores may be involved in the pathogenesis of insulin resistance and liver disease progression, and controlled studies indicated that iron depletion by phlebotomy may decrease insulin resistance and liver enzymes in patients with NAFLD. Research frontiers However, the effect of iron depletion on the progression of liver damage as evaluated by histological examination, the gold standard for assessment, has 3008 March 21, 2014 Volume 20 Issue 11

290 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia not been previously tested in a randomized controlled trial in patients with NAFLD. Innovations and breakthroughs In a selected population of Italian patients with NAFLD and hyperferritinemia which persisted despite at least 6 mo of lifestyle counseling, who were found to have mild hepatic iron overload, iron depletion by phlebotomy was well tolerated and induced a more marked amelioration of liver enzymes, non-invasive markers of liver damage, than lifestyle counseling alone. In addition, in a subgroup of patients who underwent follow-up liver biopsy at 2 years, iron depletion was associated with a higher probability of improvement of the histological activity of NAFLD. Applications These findings suggest that iron depletion by phlebotomy should be further studied, as it represents as an attractive therapeutic approach for patients with NAFLD with persistent hyperferritinemia despite a trial of lifestyle change/additional therapies or with increased iron stores. Peer review Authors present their findings on a randomized controlled Phase III trial investigating the therapeutic efficacy of phlebotomy to treat fatty liver disease associated with high ferritin. The concept is intriguing. The article is well written and clearly presented. The low power does not allow us to draw any definitive conclusions, though the results support a large Phase III trial. To their credit, the authors fully acknowledge the limitations. REFERENCES 1 Marchesini G, Brizi M, Bianchi G, Tomassetti S, Bugianesi E, Lenzi M, McCullough AJ, Natale S, Forlani G, Melchionda N. Nonalcoholic fatty liver disease: a feature of the metabolic syndrome. Diabetes 2001; 50: [PMID: ] 2 Browning JD, Szczepaniak LS, Dobbins R, Nuremberg P, Horton JD, Cohen JC, Grundy SM, Hobbs HH. Prevalence of hepatic steatosis in an urban population in the United States: impact of ethnicity. Hepatology 2004; 40: [PMID: ] 3 Blachier M, Leleu H, Peck-Radosavljevic M, Valla DC, Roudot-Thoraval F. The burden of liver disease in Europe: a review of available epidemiological data. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 4 Bugianesi E, Leone N, Vanni E, Marchesini G, Brunello F, Carucci P, Musso A, De Paolis P, Capussotti L, Salizzoni M, Rizzetto M. Expanding the natural history of nonalcoholic steatohepatitis: from cryptogenic cirrhosis to hepatocellular carcinoma. Gastroenterology 2002; 123: [PMID: ] 5 Suzuki A, Lindor K, St Saver J, Lymp J, Mendes F, Muto A, Okada T, Angulo P. Effect of changes on body weight and lifestyle in nonalcoholic fatty liver disease. J Hepatol 2005; 43: [PMID: ] 6 Centis E, Moscatiello S, Bugianesi E, Bellentani S, Fracanzani AL, Calugi S, Petta S, Dalle Grave R, Marchesini G. Stage of change and motivation to healthier lifestyle in non-alcoholic fatty liver disease. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 7 Valenti L, Dongiovanni P, Fracanzani AL, Santorelli G, Fatta E, Bertelli C, Taioli E, Fiorelli G, Fargion S. Increased susceptibility to nonalcoholic fatty liver disease in heterozygotes for the mutation responsible for hereditary hemochromatosis. Dig Liver Dis 2003; 35: [PMID: ] 8 Bugianesi E, Manzini P, D Antico S, Vanni E, Longo F, Leone N, Massarenti P, Piga A, Marchesini G, Rizzetto M. Relative contribution of iron burden, HFE mutations, and insulin resistance to fibrosis in nonalcoholic fatty liver. Hepatology 2004; 39: [PMID: ] 9 Mendler MH, Turlin B, Moirand R, Jouanolle AM, Sapey T, Guyader D, Le Gall JY, Brissot P, David V, Deugnier Y. Insulin resistance-associated hepatic iron overload. Gastroenterology 1999; 117: [PMID: ] 10 Kowdley KV, Belt P, Wilson LA, Yeh MM, Neuschwander- Tetri BA, Chalasani N, Sanyal AJ, Nelson JE. Serum ferritin is an independent predictor of histologic severity and advanced fibrosis in patients with nonalcoholic fatty liver disease. Hepatology 2012; 55: [PMID: DOI: /hep.24706] 11 Dongiovanni P, Fracanzani AL, Fargion S, Valenti L. Iron in fatty liver and in the metabolic syndrome: a promising therapeutic target. J Hepatol 2011; 55: [PMID: DOI: /j.jhep ] 12 Dongiovanni P, Ruscica M, Rametta R, Recalcati S, Steffani L, Gatti S, Girelli D, Cairo G, Magni P, Fargion S, Valenti L. Dietary iron overload induces visceral adipose tissue insulin resistance. Am J Pathol 2013; 182: [PMID: DOI: /j.ajpath ] 13 Gabrielsen JS, Gao Y, Simcox JA, Huang J, Thorup D, Jones D, Cooksey RC, Gabrielsen D, Adams TD, Hunt SC, Hopkins PN, Cefalu WT, McClain DA. Adipocyte iron regulates adiponectin and insulin sensitivity. J Clin Invest 2012; 122: [PMID: DOI: /JCI44421] 14 Valenti L, Fracanzani AL, Bugianesi E, Dongiovanni P, Galmozzi E, Vanni E, Canavesi E, Lattuada E, Roviaro G, Marchesini G, Fargion S. HFE genotype, parenchymal iron accumulation, and liver fibrosis in patients with nonalcoholic fatty liver disease. Gastroenterology 2010; 138: [PMID: DOI: /j.gastro ] 15 Valenti L, Dongiovanni P, Fargion S. Diagnostic and therapeutic implications of the association between ferritin level and severity of nonalcoholic fatty liver disease. World J Gastroenterol 2012; 18: [PMID: DOI: / wjg.v18.i ] 16 Sorrentino P, D Angelo S, Ferbo U, Micheli P, Bracigliano A, Vecchione R. Liver iron excess in patients with hepatocellular carcinoma developed on non-alcoholic steato-hepatitis. J Hepatol 2009; 50: [PMID: DOI: / j.jhep ] 17 Valenti L, Canavesi E, Galmozzi E, Dongiovanni P, Rametta R, Maggioni P, Maggioni M, Fracanzani AL, Fargion S. Beta-globin mutations are associated with parenchymal siderosis and fibrosis in patients with non-alcoholic fatty liver disease. J Hepatol 2010; 53: [PMID: DOI: /j.jhep ] 18 Valenti L, Fracanzani AL, Dongiovanni P, Bugianesi E, Marchesini G, Manzini P, Vanni E, Fargion S. Iron depletion by phlebotomy improves insulin resistance in patients with nonalcoholic fatty liver disease and hyperferritinemia: evidence from a case-control study. Am J Gastroenterol 2007; 102: [PMID: ] 19 Valenti L, Moscatiello S, Vanni E, Fracanzani AL, Bugianesi E, Fargion S, Marchesini G. Venesection for non-alcoholic fatty liver disease unresponsive to lifestyle counselling--a propensity score-adjusted observational study. QJM 2011; 104: [PMID: DOI: /qjmed/hcq170] 20 Beaton MD, Chakrabarti S, Levstik M, Speechley M, Marotta P, Adams P. Phase II clinical trial of phlebotomy for nonalcoholic fatty liver disease. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12255] 21 Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC, Torbenson MS, Unalp- Arida A, Yeh M, McCullough AJ, Sanyal AJ. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005; 41: [PMID: ] 22 Valenti L, Rametta R, Dongiovanni P, Motta BM, Canavesi E, Pelusi S, Pulixi EA, Fracanzani AL, Fargion S. The A736V TMPRSS6 polymorphism influences hepatic iron overload in nonalcoholic fatty liver disease. PLoS One 2012; 7: e48804 [PMID: DOI: /journal.pone ] 23 Guillygomarc h A, Mendler MH, Moirand R, Lainé F, Quentin V, David V, Brissot P, Deugnier Y. Venesection therapy of insulin resistance-associated hepatic iron overload. J Hepatol 2001; 35: [PMID: ] 3009 March 21, 2014 Volume 20 Issue 11

291 Valenti L et al. Iron depletion in NAFLD with hyperferritinemia 24 Barry M, Sherlock S. Measurement of liver-iron concentration in needle-biopsy specimens. Lancet 1971; 1: [PMID: ] 25 Deugnier YM, Loréal O, Turlin B, Guyader D, Jouanolle H, Moirand R, Jacquelinet C, Brissot P. Liver pathology in genetic hemochromatosis: a review of 135 homozygous cases and their bioclinical correlations. Gastroenterology 1992; 102: [PMID: ] 26 Fargion S, Valenti L, Fracanzani AL. Hemochromatosis gene (HFE) mutations and cancer risk: expanding the clinical manifestations of hereditary iron overload. Hepatology 2010; 51: [PMID: DOI: /hep.23541] 27 Zacharski LR, Chow BK, Howes PS, Shamayeva G, Baron JA, Dalman RL, Malenka DJ, Ozaki CK, Lavori PW. Decreased cancer risk after iron reduction in patients with peripheral arterial disease: results from a randomized trial. J Natl Cancer Inst 2008; 100: [PMID: DOI: /jnci/djn209] 28 Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, Charlton M, Sanyal AJ. The diagnosis and management of non-alcoholic fatty liver disease: practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology 2012; 55: [PMID: DOI: /hep.25762] 29 Maliken BD, Nelson JE, Klintworth HM, Beauchamp M, Yeh MM, Kowdley KV. Hepatic reticuloendothelial system cell iron deposition is associated with increased apoptosis in nonalcoholic fatty liver disease. Hepatology 2013; 57: [PMID: DOI: /hep.26238] 30 Gualdi R, Casalgrandi G, Montosi G, Ventura E, Pietrangelo A. Excess iron into hepatocytes is required for activation of collagen type I gene during experimental siderosis. Gastroenterology 1994; 107: [PMID: ] 31 Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B, Stockwell BR. Ferroptosis: an irondependent form of nonapoptotic cell death. Cell 2012; 149: [PMID: DOI: /j.cell ] 32 Pais R, Charlotte F, Fedchuk L, Bedossa P, Lebray P, Poynard T, Ratziu V. A systematic review of follow-up biopsies reveals disease progression in patients with non-alcoholic fatty liver. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] P- Reviewers: Buchler C, Czaja MJ, Rostami-Nejad M S- Editor: Zhai HH L- Editor: A E- Editor: Ma S 3010 March 21, 2014 Volume 20 Issue 11

292 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. BRIEF ARTICLE Hyperoxia accelerates progression of hepatic fibrosis by upregulation of transforming growth factor-β expression Sang Hwa Lee, Sung-Im Do, Hyun-Soo Kim Sang Hwa Lee, Hyun-Soo Kim, Department of Pathology, Aerospace Medicine Research Center, Aerospace Medical Center, Republic of Korea Air Force, Chungcheongbuk-do , South Korea Sung-Im Do, Department of Pathology, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul , South Korea Author contributions: Lee SH and Do SI contributed equally to this work in the design of the study, acquisition of the data and interpretation of the results; Do SI provided vital reagents and analytical tools; Lee SH drafted the manuscript; Kim HS and Do SI revised the manuscript critically and provided vital guidance to the study; all authors approved the final version of the manuscript. Supported by Aerospace Medicine Research Project funded by the Medical Division, Headquarter, Republic of Korea Air Force (2012) Correspondence to: Hyun-Soo Kim, MD, Department of Pathology, Aerospace Medicine Research Center, Aerospace Medical Center, Republic of Korea Air Force, 635 Danjae-ro, Namil-myeon, Cheongwon-gun, Chungcheongbuk-do , South Korea. apkimhs@gmail.com Telephone: Fax: Received: July 1, 2013 Revised: November 20, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract AIM: To investigate the effect of hypoxia or hyperoxia on the progression of hepatic fibrosis and to examine the role of transforming growth factor-β (TGF-β) in the livers of rats exposed to hypoxic or hyperoxic conditions. METHODS: Male Sprague-Dawley rats were injected intraperitoneally with thioacetamide to induce hepatic fibrosis and were randomly divided into a hypoxia group, a hyperoxia group and an untreated control group. Ten rats in the hypoxia group were exposed to an altitude of ft for 1 h/d during 7 wk. Ten rats in the hyperoxia group were exposed to a water depth of 20 m with 100% oxygen supply for 1 h/d during 7 wk. We evaluated the degree of hepatic fibrosis using Masson trichrome stain and examined the expression level of hepatic TGF-β mrna using quantitative realtime reverse transcriptase-polymerase chain reaction analysis. RESULTS: Eight of 10 rats exposed to hypoxia showed diffuse and confluent fibrosis with the formation of structurally abnormal parenchymal nodules involving the entire liver, consistent with hepatic cirrhosis. Nine of 10 rats exposed to hyperoxia also demonstrated obvious histological findings of hepatic cirrhosis identical to those in hypoxic rat livers. In contrast, 8 of 10 untreated rats had periportal or septal fibrosis only. The frequency of hepatic cirrhosis in hypoxic rats (P = 0.009) and hyperoxic rats (P = 0.003) was significantly higher than that in untreated rats. In addition, hepatic TGF-β mrna levels in hyperoxic rats were significantly higher than those in untreated rats. The mean value of the normalized TGF-β mrna/β-actin expression ratio in the hyperoxic rats was 1.9-fold higher than that in the untreated rats (P = 0.027). CONCLUSION: We demonstrated that both hypoxia and hyperoxia accelerated the progression of hepatic fibrosis in rats. Significant up-regulation of hepatic TGF-β in hyperoxic rats suggests that TGF-β is involved in the acceleration of hepatic fibrosis under hyperoxic conditions Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatic fibrosis; Cirrhosis; Hypoxia; Hyperoxia; Transforming growth factor-β Core tip: We observed that both hypoxic and hyperoxic rat livers exhibited significantly higher frequencies of hepatic cirrhosis than untreated rat livers. We also observed that hepatic transforming growth factor-β 3011 March 21, 2014 Volume 20 Issue 11

293 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats (TGF-β) expression in hyperoxic rats was significant higher than that in untreated rats, suggesting that TGF-β is involved in the acceleration of hepatic fibrosis under hyperoxic conditions. To the best of our knowledge, up-regulated TGF-β expression in the livers of cirrhotic rats exposed to hyperoxia has not been reported. Lee SH, Do SI, Kim HS. Hyperoxia accelerates progression of hepatic fibrosis by up-regulation of transforming growth factor-β expression. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/3011.htm DOI: i INTRODUCTION Hepatic fibrosis is an essential pathophysiological consequence of various chronic liver injuries and a common underlying mechanism for hepatic insufficiency [1]. Hepatic fibrosis is currently known to be part of a dynamic process in the setting of liver injury that leads to an abnormal accumulation of extracellular matrix in the liver. The endpoint of hepatic fibrosis is cirrhosis, which is characterized by the formation of regenerative nodules of liver parenchyma separated by confluent fibrotic septa and is accompanied by significant morbidity and mortality [2]. Complex interaction between various liver cell types, such as hepatic stellate cells, hepatocytes, Kupffer cells, and liver sinusoidal endothelial cells, contributes to hepatic fibrosis. Each of these cell types releases a subset of mediators and cytokines that have diverse effects on the progression of hepatic fibrosis and the development of hepatic cirrhosis [1]. Extensive studies using animal models of hepatic fibrosis have revealed that several groups of key genes mediate liver fibrogenesis [3,4]. For example, genes regulating hepatocellular apoptosis and necrosis influence the extent of tissue damage and the subsequent profibrogenic response [5,6]. Genes regulating the generation of pro-inflammatory cytokines and reactive oxygen species (ROS) determine the profibrogenic response to injury and extracellular matrix deposition [7-10]. Among these, a particularly well-studied molecule is transforming growth factor-β (TGF-β), which is widely regarded as profibrogenic in liver injury [11]. A number of studies have identified TGF-β as the most important fibrogenesisstimulating cytokine in the liver [1,2,12]. The findings of increased hepatic stellate cell activation and hepatic fibrosis in mice with elevated hepatic TGF-β level provide direct evidence for the critical role of TGF-β in hepatic fibrosis [13]. TGF-β is also considered profibrogenic because it inhibits hepatic stellate cell apoptosis, thereby contributing to the increased number of these cells in the setting of liver injury [14]. In addition, TGF-β stimulates extracellular matrix production by liver sinusoidal endothelial cells [15]. Strategies aimed at disrupting the TGF-β signaling pathway have markedly decreased hepatic fibrosis in experimental models [16,17]. Oxygen has important functions as a substrate for biochemical reactions and a modulator of gene expression. Impaired tissue oxygenation and cellular hypoxia are major components in the pathophysiology of a variety of clinical conditions, including infection, wounds, stroke, myocardial infarction, chronic lung disease, and hepatic fibrosis [18,19]. Hypoxia always occurs during liver injury or inflammation, in which swelling of hepatocytes, accumulation of extracellular matrix in the spaces of Disse, construction of regenerating parenchymal nodules and fibrotic septa, and the formation of abnormal vascular networks indicate that hepatocellular hypoxia is involved in the progression of hepatic fibrosis and tissue remodeling [20-25]. Conversely, exposure to hyperoxic conditions generally improves tissue oxygenation. A dramatic increase in oxygen content and arterial blood oxygen pressures accounts for the markedly facilitated diffusion of oxygen to tissues during hyperoxic exposure [26]. However, the advantage of hyperoxia in augmenting oxygen availability to tissues is challenged by the commonly accepted paradigm of cell injury, which emphasizes the role of ROS formation leading to the up-regulation of pro-inflammatory mediators and aggravation of tissue damage [27]. In particular, previous data have suggested that ROS generation is a fundamental mechanism of liver injury [28]. ROS can damage cellular macromolecules and therefore may participate in hepatocellular injury when produced in excess [29]. Moreover, increasing evidence implicates ROS in the pathogenesis of hepatic fibrosis and cirrhosis [29,30]. Although several studies have investigated the relationship between tissue fibrosis and hypoxia, they have focused on the effects of hypoxia in diseases of the heart, lung, and kidney [18,31,32]. Furthermore, the effect of hyperoxic exposure on hepatic fibrosis has not yet been reported. Therefore, the relationship between hepatic fibrosis and hypoxic or hyperoxic conditions in vivo remain to be elucidated. The aim of this study was to investigate the effects of hypoxia or hyperoxia on the progression of hepatic fibrosis and to examine the expression level of TGF-β in the livers of rats exposed to hypoxic or hyperoxic conditions. MATERIALS AND METHODS Experimental model Throughout the experimental period (7 wk), 30 Sprague- Dawley adult male rats (Samtako Bio Korea Co., Ltd., Osan, Gyeonggi-do, South Korea) 6-7 wk of age and weighing between 200 and 230 g were fed standard laboratory rat chow, provided with free access to water, and maintained on a 12-h light-dark cycle under pathogen-free conditions. Temperature and moisture were controlled at and 40%-45%, respectively. To induce hepatic fibrosis, the rats were injected intraperitoneally with 200 mg/kg of thioacetamide (dissolved in 3012 March 21, 2014 Volume 20 Issue 11

294 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats Table 1 Degree of hepatic fibrosis Descriptive diagnosis No fibrosis Portal fibrosis Periportal fibrosis Septal fibrosis Cirrhosis Definition Normal connective tissue Fibrous portal expansion Periportal fibrosis with short septa extending into lobules or rare porto-portal septa (intact architecture) Fibrous septa reaching adjacent portal tracts and terminal hepatic venules (architectural distortion, but no obvious cirrhosis) Diffuse nodular formation saline; Sigma-Aldrich Co., St. Louis, MO, United States) twice per week. The rats were randomly divided into 3 experimental groups. Ten rats in the hypoxia group were exposed to an altitude of ft for 1 h/d. Ten rats in the hyperoxia group were exposed to a water depth of 20 m with 100% oxygen supply for 1 h/d. The remaining 10 rats were used as an untreated control group. Animals were killed using diethyl ether 3 d after the last thioacetamide injection and laparotomized via a midline incision. Livers were removed from the animals and immediately preserved in a 10% formaldehyde (formalin) solution or frozen in liquid nitrogen and stored at -70 until quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) analysis was performed. The institutional animal ethics committee of the Republic of Korea Air Force Aerospace Medical Center approved all experimental procedures involving animals. Histological evaluation After 48 h of formalin fixation, the liver tissues were embedded in paraffin and processed for routine hematoxylin-eosin and for Masson trichrome stains. The degree of hepatic fibrosis was graded according to the standardized guideline proposed by the Korean Study Group for Pathology of Digestive Diseases (Table 1) [33]. Quantitative real-time RT-PCR analysis Total RNA was extracted from the liver tissue samples using a NucleoSpin RNA Ⅱ extraction kit (Macherey- Nagel GmbH and Co. KG, Dueren, Germany). For complementary DNA (cdna) synthesis, 1 μg of total RNA was reverse-transcribed using a ReverTra Ace-αreverse transcriptase kit (Toyobo Co., Ltd., Osaka, Japan). The reverse-transcribed cdna was used for real-time RT-PCR with SsoAdvanced SYBR Green Supermix (Bio- Rad Laboratories, Inc., Hercules, CA, United States). PCR was performed using a Bio-Rad CFX384 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). The primer sequences used for TGF-β were as follows: forward 5 -AGGGCTACCATGCCAACTTC-3 ; reverse 5 -CCACGTAGTAGACGATGGGC-3. The primer sequences used for β-actin were as follows: forward 5 -TCTTCCAGCCTTCCTTCCTG-3 ; reverse 5 -CA- CACAGAGTACTTGCGCTC-3. PCR reactions for TGF-β and β-actin were initiated with an initial PCR activation step at 95 for 30 s, followed by 45 cycles at 95 for 2 s, 58 for 5 s, and 65 for 10 s. A melting curve, ramping from 65 to 95, was produced after each RT-PCR to test for the presence of primer dimers. When primer dimer formation was detected, the PCR was rerun using a separate aliquot of cdna. Each measurement was repeated twice. The normalized expression ratio was calculated using the 2 -ΔΔCt method [34]. Statistical analysis Fisher s exact test was performed to compare the degree of hepatic fibrosis between groups. The Kruskal-Wallis test was performed to examine whether the expression level of hepatic TGF-β messenger RNA (mrna) differed significantly between the groups. Statistical analyses were performed using SPSS version 20.0 (IBM SPSS Inc., Chicago, IL, United States). A P value of less than 0.05 was deemed statistically significant. RESULTS Histologically, all specimens showed hepatic fibrosis, although the degree of fibrosis was variable. Eight of 10 rats exposed to hypoxia showed diffuse and confluent fibrosis with the formation of structurally abnormal parenchymal nodules involving the entire liver, consistent with hepatic cirrhosis (Figure 1A). Nine of 10 rats exposed to hyperoxia also demonstrated obvious histological findings of hepatic cirrhosis identical to those in hypoxic rat livers (Figure 1B). In contrast, only 2 of 10 untreated rats exhibited hepatic cirrhosis; the remaining 8 rats in the control group exhibited periportal (2 rats) or septal (6 rats) fibrosis only (Figure 1C). The frequency of hepatic cirrhosis in the hypoxic rats (P = 0.009) and hyperoxic rats (P = 0.003) was significantly higher than that in the untreated rats (Table 2). Quantitative real-time RT-PCR revealed that the expression level of hepatic TGF-β mrna in the hyperoxic rats was significantly higher than that in the untreated rats (P = 0.027; Figure 2). The mean value of the normalized TGF-β mrna/β-actin expression ratio in the hyperoxic rats was 1.9-fold higher than that in the untreated rats (Table 3). In contrast, the TGF-β mrna levels in the livers of hypoxic rats were not significantly different from those in the untreated rats (P = 1.000; Figure 2). DISCUSSION In this study, we investigated the effect of hypoxia or hyperoxia on hepatic fibrosis progression using an animal model of hepatic fibrosis. We observed that both hypoxic and hyperoxic rat livers exhibited frequencies of hepatic cirrhosis that were significantly higher than those in untreated, normoxic rat livers. Hypoxia is known to be a key factor in tissue damage and to play a crucial role in chronic liver injury. Exposure to hypoxic conditions stimulates the release of a variety of mediators from he March 21, 2014 Volume 20 Issue 11

295 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats A B C Figure 1 Histology of hepatic fibrosis and cirrhosis. A, B: The livers obtained from 8 of 10 hypoxic rats (A) and 9 of 10 hyperoxic rats (B) demonstrated obvious histological findings of hepatic cirrhosis, including the formation of structurally abnormal parenchymal nodules and confluent fibrotic septa; C: In contrast, 6 of 10 untreated rat livers showed periportal fibrosis only (Masson trichrome stain; original magnification, 40). peroxidation and up-regulation of pro-inflammatory cytokines[41-44]. In the liver, Kupffer cells and neutrophils can induce oxidative tissue damage both directly via the effect of ROS on cellular components and indirectly through the release of protease [45]. Increased oxidative stress and the formation of ROS cause extensive necrosis of the liver and ultimately contribute to the development of fibrosis and cirrhosis. Oxidative stress figures prominently in several scenarios of liver fibrogenesis[46,47]. Bhandari et al[48] demonstrated that patients with Child-Pugh class C cirrhosis have greater oxidative stress than those with class B cirrhosis, suggesting that the severity of hepatic cirrhosis is associated with the degree of oxidative stress. Given these data, our findings suggest that hyperoxic exposure accelerates the progression of hepatic fibrosis. In addition, this study can serve as a background for assessing the role of antioxidants in preventing the progression of hepatic cirrhosis. To clarify the role of TGF- β on hepatic fibrosis under hypoxic or hyperoxic conditions, we investigated the expression of hepatic TGF- β mrna in rats exposed to hypoxia or hyperoxia. Although a number of studies have examined the effect of TGF-β in experimental models of hepatic fibrosis, to the best of our knowledge, TGF-β expression in the livers of cirrhotic rats exposed to hypoxia or hyperoxia has not been reported. We observed that hepatic TGF-β mrna level in hyperoxic rats was significantly higher than that in untreated rats. This finding is consistent with previous Table 2 Difference in the degree of hepatic fibrosis among the three groups Diagnosis Periportal fibrosis Septal fibrosis Cirrhosis Number of rats Control group Hypoxia group Hyperoxia group (n = 10) (n = 10) (n = 10) P = vs control group; 2P = vs control group. patic stellate cells and affects the progression of hepatic fibrosis[21,35-37]. Hernandez-Guerra et al[38] revealed that hypoxia aggravates intrahepatic endothelial dysfunction in cirrhotic rat livers. Some in vitro studies have also reported that hypoxia activates hepatic stellate cells and accelerates hepatic fibrosis[22,23,25]. In this context, our finding supports the notion that exposure to hypoxia worsens hepatic fibrosis. In contrast, the effect of hyperoxia on the progression of hepatic fibrosis or the development of hepatic cirrhosis has very rarely been reported. Instead, some available data are sufficient to support the suggestion that hyperoxia exerts beneficial anti-inflammatory effects in models of tissue hypoxia and has protective effects on hemodynamic and metabolic parameters against splanchnic ischemia-reperfusion in rats[39,40]. However, hyperoxic exposure is generally accepted to often result in the formation of ROS in tissues directly implicated in the induction of cell injury via lipid 3014 March 21, 2014 Volume 20 Issue 11

296 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats 200 a Table 3 Quantitative real-time reverse-transcriptase polymerase chain reaction results Normalized TGF-β/β-action mrna expression ratio (%) Control group Hypoxia group Hyperoxia group Measurement Control group Hypoxia group Hyperoxia group TGF-β mrna ± ± ± 0.96 average Ct β-actin mrna ± ± ± 0.72 average Ct Δ Ct 7.52 ± ± ± 0.67 ΔΔ Ct 0 ± ± ± 0.74 Normalized expression ratio P = vs control group, 2 P = vs control group. Figure 2 Quantitation of hepatic transformation growth factor-β mrna expression level using real-time reverse-transcriptase polymerase chain reaction analysis. Results are mean values of 2 independent experiments with 10 rats in each group. The mean value of the normalized hepatic transformation growth factor-β (TGF-β)/β-actin mrna expression ratio in the hyperoxic rats was significantly higher than that in the untreated rats. a P < 0.05 vs the corresponding values in the control group. data which showed that hyperoxic exposure elevated the expression level of TGF-β [49]. Similarly, Alejandre- Alcazar et al [50] demonstrated that hyperoxia up-regulates the expression level of key components of the TGF-β signaling pathway, including type Ⅱ TGF-β receptor, type Ⅰ bone morphogenetic protein receptors, and Smad proteins. They further illustrated that TGF-β stimulation dramatically elevates the levels of tissue inhibitors of metalloproteinase-1 mrna in fibroblasts, supporting the idea that dysregulation of TGF-β signaling impacts extracellular matrix deposition and tissue remodeling [50]. Together with these results, the observation in the present study that hyperoxic rats exhibited a significantly higher frequency of hepatic cirrhosis than untreated rats suggests that TGF-β is partially responsible for the acceleration of hepatic fibrosis progression in rats exposed to hyperoxia. However, no significant difference between hepatic TGF-β mrna levels in hypoxic rats and untreated rats was found. In fact, relevant experimental studies have provided conflicting results regarding the effect of hypoxia on TGF-β expression. An in vitro study demonstrated that hypoxic exposure induces an increase in the expression level of TGF-β mrna [51]. A study using a model of carbon tetrachloride-induced hepatic fibrosis also showed that hypoxic rat livers release TGF-β protein [52]. Similarly, hypoxia has been shown to up-regulate TGF-β synthesis and enhance its effect in human skin and lung fibroblasts [53,54]. In contrast, a study using a cell culture method has shown that hypoxia increases the production of fibronectin, collagen Ⅰ, and collagen Ⅳ, but not TGF-β, in placental fibroblasts, suggesting that increased extracellular matrix production under hypoxia is not mediated directly by increased TGF-β [55]. Our observation raises 2 possibilities. First, hepatic fibrosis might be accelerated independent of TGF-β under hypoxic conditions. Second, intermittent exposure to hypobaric hypoxia at the altitude of ft might be insufficient to affect TGF-β mrna transcription in rat liver. Further investigations are necessary to clarify the relationship between TGF-β expression and the progression of hepatic fibrosis under hypoxic conditions. In conclusion, we demonstrated that both hypoxia and hyperoxia accelerated the progression of hepatic fibrosis in rats. In addition, a significant up-regulation of hepatic TGF-β in hyperoxic rats suggests that TGF-β is involved in the acceleration of hepatic fibrosis under hyperoxic conditions. COMMENTS Background Hepatic fibrosis is a pathophysiological consequence of chronic liver injuries and a common underlying mechanism for hepatic insufficiency. Experimental models of hepatic fibrosis have provided a means to study the cell and molecular mediators of fibrosis and revealed that several groups of key genes mediate liver fibrogenesis. In particular, extensive studies have identified transforming growth factor (TGF)-β as the most important profibrogenic cytokine in the liver. Although a number of studies have investigated the relationship between tissue fibrosis and oxygen tension, they have focused on the effects of hypoxia in diseases of the heart, lung, and kidney. The effect of exposure to hyperoxic conditions on hepatic fibrosis and the role of TGF-β in the progression of fibrosis in hyperoxic livers have not yet been reported. Research frontiers Hyperoxic exposure is generally accepted to result in the formation of reactive oxygen species (ROS) in a variety of tissues directly implicated in the induction of cell injury via lipid peroxidation and up-regulation of pro-inflammatory cytokines. In the liver, Kupffer cells and neutrophils can induce oxidative tissue damage both directly via the effect of ROS on cellular components and indirectly through the release of proteolytic enzymes. Furthermore, the formation of ROS and increased oxidative stress cause extensive hepatocellular necrosis and ultimately contribute to the development of hepatic fibrosis and cirrhosis. Oxidative stress figures prominently in several scenarios of liver fibrogenesis. Innovations and breakthroughs The authors observed that hyperoxic livers exhibited frequencies of hepatic cirrhosis that were significantly higher than those in untreated, normoxic livers. In addition, they further observed that hepatic TGF-β mrna level in hyperoxic rats was significant higher than that in untreated rats. To the best of our knowledge, no reports have been published demonstrating a significant relationship between exposure to hyperoxia and frequencies of hepatic cirrhosis and discussing the role of TGF-β in the progression of hepatic fibrosis in hyperoxic rat livers. The observations in the present study suggest that TGF-β is partially responsible for the acceleration of hepatic fibrosis progression in rats exposed to hyperoxia. Applications Based on the observation that hyperoxic exposure accelerates the progression of hepatic fibrosis, this study may serve as a background for assessing the role of antioxidants in preventing the progression of hepatic cirrhosis March 21, 2014 Volume 20 Issue 11

297 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats Terminology Hepatic cirrhosis is the endpoint of hepatic fibrosis and various chronic liver diseases characterized by the formation of regenerative nodules of liver parenchyma separated by confluent fibrotic septa. It is typically accompanied by significant morbidity and mortality. TGF-β is a protein that controls the cell cycle, apoptosis, proliferation and differentiation in most cells. In the liver, it plays a crucial role in inhibiting hepatic stellate cell apoptosis, thereby contributing to the increased number of these cells in the setting of liver injury. In addition, TGF-β stimulates extracellular matrix production by liver sinusoidal endothelial cells. Peer review This is well performed study, in which authors analyzed the frequency of hepatic cirrhosis and TGF-β expression status in rats exposed to hyperoxia. The results are interesting and suggest that TGF-β accelerates the progression of hepatic fibrosis following hyperoxic exposure. Further investigations are recommended to elucidate the molecular biological functions of TGF-β and a potential role of ROS in association with hyperoxia in the liver. REFERENCES 1 Moreira RK. Hepatic stellate cells and liver fibrosis. Arch Pathol Lab Med 2007; 131: [PMID: ] 2 Guyot C, Lepreux S, Combe C, Doudnikoff E, Bioulac-Sage P, Balabaud C, Desmoulière A. Hepatic fibrosis and cirrhosis: the (myo)fibroblastic cell subpopulations involved. Int J Biochem Cell Biol 2006; 38: [PMID: DOI: /j.biocel ] 3 Bataller R, Brenner DA. Liver fibrosis. J Clin Invest 2005; 115: [PMID: DOI: /JCI ] 4 Friedman SL. Liver fibrosis -- from bench to bedside. J Hepatol 2003; 38 Suppl 1: S38-S53 [PMID: ] 5 Canbay A, Higuchi H, Bronk SF, Taniai M, Sebo TJ, Gores GJ. Fas enhances fibrogenesis in the bile duct ligated mouse: a link between apoptosis and fibrosis. Gastroenterology 2002; 123: [PMID: DOI: /gast ] 6 Takehara T, Tatsumi T, Suzuki T, Rucker EB, Hennighausen L, Jinushi M, Miyagi T, Kanazawa Y, Hayashi N. Hepatocyte-specific disruption of Bcl-xL leads to continuous hepatocyte apoptosis and liver fibrotic responses. Gastroenterology 2004; 127: [PMID: DOI: /j.gastro ] 7 Sahai A, Malladi P, Melin-Aldana H, Green RM, Whitington PF. Upregulation of osteopontin expression is involved in the development of nonalcoholic steatohepatitis in a dietary murine model. Am J Physiol Gastrointest Liver Physiol 2004; 287: G264-G273 [PMID: DOI: /ajpgi ] 8 Streetz KL, Tacke F, Leifeld L, Wüstefeld T, Graw A, Klein C, Kamino K, Spengler U, Kreipe H, Kubicka S, Müller W, Manns MP, Trautwein C. Interleukin 6/gp130-dependent pathways are protective during chronic liver diseases. Hepatology 2003; 38: [PMID: DOI: /jhep ] 9 Bataller R, Schwabe RF, Choi YH, Yang L, Paik YH, Lindquist J, Qian T, Schoonhoven R, Hagedorn CH, Lemasters JJ, Brenner DA. NADPH oxidase signal transduces angiotensin II in hepatic stellate cells and is critical in hepatic fibrosis. J Clin Invest 2003; 112: [PMID: DOI: / JCI ] 10 Shi Z, Wakil AE, Rockey DC. Strain-specific differences in mouse hepatic wound healing are mediated by divergent T helper cytokine responses. Proc Natl Acad Sci USA 1997; 94: [PMID: DOI: /pnas ] 11 Bissell DM, Roulot D, George J. Transforming growth factor beta and the liver. Hepatology 2001; 34: [PMID: DOI: /jhep ] 12 Forbes SJ, Parola M. Liver fibrogenic cells. Best Pract Res Clin Gastroenterol 2011; 25: [PMID: DOI: /j.bpg ] 13 Ueberham E, Löw R, Ueberham U, Schönig K, Bujard H, Gebhardt R. Conditional tetracycline-regulated expression of TGF-beta1 in liver of transgenic mice leads to reversible intermediary fibrosis. Hepatology 2003; 37: [PMID: DOI: /jhep ] 14 George J, Roulot D, Koteliansky VE, Bissell DM. In vivo inhibition of rat stellate cell activation by soluble transforming growth factor beta type II receptor: a potential new therapy for hepatic fibrosis. Proc Natl Acad Sci USA 1999; 96: [PMID: DOI: /pnas ] 15 George J, Wang SS, Sevcsik AM, Sanicola M, Cate RL, Koteliansky VE, Bissell DM. Transforming growth factor-beta initiates wound repair in rat liver through induction of the EII- IA-fibronectin splice isoform. Am J Pathol 2000; 156: [PMID: DOI: /S (10) ] 16 Schnur J, Oláh J, Szepesi A, Nagy P, Thorgeirsson SS. Thioacetamide-induced hepatic fibrosis in transforming growth factor beta-1 transgenic mice. Eur J Gastroenterol Hepatol 2004; 16: [PMID: DOI: / ] 17 Shek FW, Benyon RC. How can transforming growth factor beta be targeted usefully to combat liver fibrosis? Eur J Gastroenterol Hepatol 2004; 16: [PMID: DOI: / ] 18 Higgins DF, Kimura K, Iwano M, Haase VH. Hypoxia-inducible factor signaling in the development of tissue fibrosis. Cell Cycle 2008; 7: [PMID: DOI: / cc ] 19 Kietzmann T, Dimova EY, Flügel D, Scharf JG. Oxygen: modulator of physiological and pathophysiological processes in the liver. Z Gastroenterol 2006; 44: [PMID: DOI: /s ] 20 Ben-Yosef Y, Lahat N, Shapiro S, Bitterman H, Miller A. Regulation of endothelial matrix metalloproteinase-2 by hypoxia/reoxygenation. Circ Res 2002; 90: [PMID: DOI: /01.RES DC] 21 Chen PS, Zhai WR, Zhou XM, Zhang JS, Zhang YE, Ling YQ, Gu YH. Effects of hypoxia, hyperoxia on the regulation of expression and activity of matrix metalloproteinase-2 in hepatic stellate cells. World J Gastroenterol 2001; 7: [PMID: ] 22 Copple BL, Bai S, Burgoon LD, Moon JO. Hypoxia-inducible factor-1α regulates the expression of genes in hypoxic hepatic stellate cells important for collagen deposition and angiogenesis. Liver Int 2011; 31: [PMID: DOI: /j x] 23 Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 2003; 9: [PMID: DOI: /nm ] 24 Shi YF, Fong CC, Zhang Q, Cheung PY, Tzang CH, Wu RS, Yang M. Hypoxia induces the activation of human hepatic stellate cells LX-2 through TGF-beta signaling pathway. FEBS Lett 2007; 581: [PMID: DOI: / j.febslet ] 25 Troeger JS, Schwabe RF. Hypoxia and hypoxia-inducible factor 1α: potential links between angiogenesis and fibrogenesis in hepatic stellate cells. Liver Int 2011; 31: [PMID: DOI: /j x] 26 Gill AL, Bell CN. Hyperbaric oxygen: its uses, mechanisms of action and outcomes. QJM 2004; 97: [PMID: DOI: /qjmed/hch074] 27 Eppihimer MJ, Granger DN. Ischemia/reperfusion-induced leukocyte-endothelial interactions in postcapillary venules. Shock 1997; 8: [PMID: DOI: / ] 28 Parks DA, Bulkley GB, Granger DN. Role of oxygen-derived free radicals in digestive tract diseases. Surgery 1983; 94: [PMID: ] 29 Britton RS, Bacon BR. Role of free radicals in liver diseases and hepatic fibrosis. Hepatogastroenterology 1994; 41: [PMID: ] 30 Farrell GC, Teoh NC, McCuskey RS. Hepatic microcirculation in fatty liver disease. Anat Rec (Hoboken) 2008; 291: 3016 March 21, 2014 Volume 20 Issue 11

298 Lee SH et al. Hepatic cirrhosis and TGF-β up-regulation in hyperoxic rats [PMID: DOI: /ar.20715] 31 Estrada KD, Chesler NC. Collagen-related gene and protein expression changes in the lung in response to chronic hypoxia. Biomech Model Mechanobiol 2009; 8: [PMID: DOI: /s ] 32 Lin YM, Huang SK, Wang HF, Chen LM, Tsai FJ, Hsu HH, Kuo CH, Wang PS, Huang CY, Lee SD. Short-term versus long-term intermittent hypobaric hypoxia on cardiac fibrosis and Fas death receptor dependent apoptotic pathway in rat hearts. Chin J Physiol 2008; 51: [PMID: ] 33 Park YN, Kim H, Chon CY, Park JB, Sohn JH, Yang SH, Yu E, Lee MS, Jang JJ, Chang HK, Jeong JJ, Kang DY, Kim YI, Park C. Histological grading and staging of chronic hepatitis: Standardized guideline proposed by the Korean Study Group for Pathology of Digestive Diseases. Korean J Pathol 1999; 33: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: [PMID: DOI: /meth ] 35 Ankoma-Sey V, Wang Y, Dai Z. Hypoxic stimulation of vascular endothelial growth factor expression in activated rat hepatic stellate cells. Hepatology 2000; 31: [PMID: DOI: /hep ] 36 Novo E, Cannito S, Zamara E, Valfrè di Bonzo L, Caligiuri A, Cravanzola C, Compagnone A, Colombatto S, Marra F, Pinzani M, Parola M. Proangiogenic cytokines as hypoxiadependent factors stimulating migration of human hepatic stellate cells. Am J Pathol 2007; 170: [PMID: DOI: /ajpath ] 37 Taura K, De Minicis S, Seki E, Hatano E, Iwaisako K, Osterreicher CH, Kodama Y, Miura K, Ikai I, Uemoto S, Brenner DA. Hepatic stellate cells secrete angiopoietin 1 that induces angiogenesis in liver fibrosis. Gastroenterology 2008; 135: [PMID: DOI: /j.gastro ] 38 Hernández-Guerra M, de Ganzo ZA, González-Méndez Y, Salido E, Abreu P, Moreno M, Felipe V, Abrante B, Quintero E. Chronic intermittent hypoxia aggravates intrahepatic endothelial dysfunction in cirrhotic rats. Hepatology 2013; 57: [PMID: DOI: /hep.26152] 39 Bitterman H. Oxygen: an anti-inflammatory drug. Isr Med Assoc J 2007; 9: [PMID: ] 40 Bitterman H, Bitterman N, Melamed Y, Cohen L. Effects of hyperbaric oxygen in circulatory shock induced by splanchnic artery occlusion and reperfusion in rats. Can J Physiol Pharmacol 1989; 67: [PMID: DOI: /y89-163] 41 Stogner SW, Payne DK. Oxygen toxicity. Ann Pharmacother 1992; 26: [PMID: ] 42 Gille JJ, van Berkel CG, Joenje H. Mutagenicity of metabolic oxygen radicals in mammalian cell cultures. Carcinogenesis 1994; 15: [PMID: DOI: /carcin/ ] 43 Freeman BA, Crapo JD. Hyperoxia increases oxygen radical production in rat lungs and lung mitochondria. J Biol Chem 1981; 256: [PMID: ] 44 D'Angio CT, Finkelstein JN. Oxygen regulation of gene expression: a study in opposites. Mol Genet Metab 2000; 71: [PMID: DOI: /mgme ] 45 Weiss SJ. Tissue destruction by neutrophils. N Engl J Med 1989; 320: [PMID: ] 46 Bissell DM. Chronic liver injury, TGF-beta, and cancer. Exp Mol Med 2001; 33: [PMID: DOI: / emm ] 47 Casini A, Ceni E, Salzano R, Biondi P, Parola M, Galli A, Foschi M, Caligiuri A, Pinzani M, Surrenti C. Neutrophil-derived superoxide anion induces lipid peroxidation and stimulates collagen synthesis in human hepatic stellate cells: role of nitric oxide. Hepatology 1997; 25: [PMID: DOI: /jhep.1997.v25.pm ] 48 Bhandari S, Agarwal MP, Dwivedi S, Banerjee BD. Monitoring oxidative stress across worsening Child Pugh class of cirrhosis. Indian J Med Sci 2008; 62: [PMID: DOI: / ] 49 Lecart C, Cayabyab R, Buckley S, Morrison J, Kwong KY, Warburton D, Ramanathan R, Jones CA, Minoo P. Bioactive transforming growth factor-beta in the lungs of extremely low birthweight neonates predicts the need for home oxygen supplementation. Biol Neonate 2000; 77: [PMID: DOI: / ] 50 Alejandre-Alcázar MA, Kwapiszewska G, Reiss I, Amarie OV, Marsh LM, Sevilla-Pérez J, Wygrecka M, Eul B, Köbrich S, Hesse M, Schermuly RT, Seeger W, Eickelberg O, Morty RE. Hyperoxia modulates TGF-beta/BMP signaling in a mouse model of bronchopulmonary dysplasia. Am J Physiol Lung Cell Mol Physiol 2007; 292: L537-L549 [PMID: DOI: /ajplung ] 51 Suzuki A, Kusakai G, Shimojo Y, Chen J, Ogura T, Kobayashi M, Esumi H. Involvement of transforming growth factor-beta 1 signaling in hypoxia-induced tolerance to glucose starvation. J Biol Chem 2005; 280: [PMID: DOI: /jbc.M ] 52 Jeong WI, Do SH, Yun HS, Song BJ, Kim SJ, Kwak WJ, Yoo SE, Park HY, Jeong KS. Hypoxia potentiates transforming growth factor-beta expression of hepatocyte during the cirrhotic condition in rat liver. Liver Int 2004; 24: [PMID: DOI: /j x] 53 Falanga V, Qian SW, Danielpour D, Katz MH, Roberts AB, Sporn MB. Hypoxia upregulates the synthesis of TGF-beta 1 by human dermal fibroblasts. J Invest Dermatol 1991; 97: [PMID: DOI: / ep ] 54 Papakonstantinou E, Roth M, Tamm M, Eickelberg O, Perruchoud AP, Karakiulakis G. Hypoxia differentially enhances the effects of transforming growth factor-beta isoforms on the synthesis and secretion of glycosaminoglycans by human lung fibroblasts. J Pharmacol Exp Ther 2002; 301: [PMID: DOI: /jpet ] 55 Chen CP, Yang YC, Su TH, Chen CY, Aplin JD. Hypoxia and transforming growth factor-beta 1 act independently to increase extracellular matrix production by placental fibroblasts. J Clin Endocrinol Metab 2005; 90: [PMID: DOI: /jc ] P- Reviewer: Olaso E S- Editor: Zhai HH L- Editor: Webster JR E- Editor: Liu XM 3017 March 21, 2014 Volume 20 Issue 11

299 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. BRIEF ARTICLE Midkine promotes perineural invasion in human pancreatic cancer Jun Yao, Wen-Yao Li, Shuo-Guo Li, Xiao-Shan Feng, She-Gan Gao Jun Yao, Wen-Yao Li, Shuo-Guo Li, Xiao-Shan Feng, She- Gan Gao, Department of Oncology, First Affiliated Hospital, Henan University of Science and Technology, Luoyang , Henan Province, China Author contributions: Yao J and Li WY contributed equally to this work; Yao J, Li SG and Feng XS designed the research; Yao J and Li WY performed the research; Gao SG provided some reagents; Yao J and Li WY analyzed data and wrote the paper. Supported by National Natural Science Foundation of China, No. U ; the Health Science and Technology Innovation Talents Program of Henan Province, No Correspondence to: Xiao-Shan Feng, PhD, MD, Professor, Department of Oncology, First Affiliated Hospital, Henan University of Science and Technology, King Wah Road 24, Luoyang , Henan Province, China. yaojun74@163.com Telephone: Fax: Received: September 16, 2013 Revised: November 14, 2013 Accepted: January 6, 2014 Published online: March 21, 2014 Abstract AIM: To investigate midkine (MK) and syndecan-3 protein expression in pancreatic cancer by immunohistochemistry, and to analyze their correlation with clinicopathological features, perineural invasion, and prognosis. METHODS: Pancreatic cancer tissues (including adequately sized tumor tissue samples and tissue samples taken from areas less than 2.0 cm around the tumor) were taken from 42 patients who were undergoing a partial duodenopancreatectomy. MK and syndecan-3 proteins were detected by immunohistochemistry using a standardized streptavidin-peroxidase method, and analyzed for their correlation with clinicopathological features, perineural invasion, and prognosis. Associations of neural invasion with aggressive characteristics of pancreatic cancer and the presence of perineural invasion were assessed by two independent observers blinded to the patient status. RESULTS: MK and syndecan-3 were found in 26 (61.9%) and 24 (57.1%) specimens, respectively. MK and syndecan-3 expression was associated with perineural invasion (P = and 0.031, respectively). High MK expression was closely associated with advanced tumor, node and metastasis stage (P = 0.008), lymph node metastasis (P = 0.042), and decreased postoperative survival at 3 years (51.0% vs 21.8%, P = 0.001). Syndecan-3 levels were correlated with tumor size (P = 0.028). Patients who were syndecan-3 negative had a higher cumulative survival rate than those who were positive, but the difference was not significant (44.0% vs 23.0%, P > 0.05). CONCLUSION: MK and syndecan-3 are frequently expressed in pancreatic cancer and associated with perineural invasion. High expression of MK and syndecan-3 may contribute to the highly perineural invasion and poor prognosis of human pancreatic cancer Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Midkine; Syndecan-3; Pancreatic cancer; Neurite growth; Perineural invasion Core tip: Midkine (MK) has diverse biological properties, including neuritis outgrowth and tumor progression. Syndecan-3 is a high-affinity receptor for MK and an essential component for neurite outgrowths. MK and its receptor may play an important role during perineural invasion. In this study, MK and syndecan-3 proteins levels were detected and analyzed for correlations with clinicopathological features, perineural invasion, and prognosis. Our results show that high expression of MK contributes to the highly perineural invasion and poor prognosis of human pancreatic cancer. Yao J, Li WY, Li SG, Feng XS, Gao SG. Midkine promotes perineural invasion in human pancreatic cancer. World J Gastroenterol 2014; 20(11): Available from: URL: March 21, 2014 Volume 20 Issue 11

300 Yao J et al. Midkine in human pancreatic cancer wjgnet.com/ /full/v20/i11/3018.htm DOI: org/ /wjg.v20.i INTRODUCTION Pancreatic cancer is one of the most aggressive and intractable human malignant cancers [1,2]. Perineural invasion extending into the pancreatic nerve plexus is a histopathologic characteristic of pancreatic cancer. However, the mechanisms contributing to the invasion of intrapancreatic nerves and spread of cancer cells along the extrapancreatic nerves during pancreatic tumorigenesis remain poorly understood. A family of proteins consisting of neurotrophic factors is of interest due to recent experimental data that showed their involvement in the neural invasion of pancreatic cancer [3,4]. Midkine (MK), a type of neurotrophic factor, is also known as a neurite growth promoting factor. MK has a molecular weight of 13 kda [5]. MK proteins in humans and rats are identical and share a 45% amino acid similarity with pleiotrophin (PTN), which is the only other member of this family [6]. The MK family possesses diverse biological properties, including neuritis outgrowth [7,8], neuronal survival [9,10], carcinogenesis, and tumor progression [6,11]. MK is mainly expressed during early embryogenesis. In human adult tissues, MK is markedly down-regulated and present only at minimal levels in very few tissues. It is not expressed in normal pancreatic tissues, but highly expressed in pancreatic cancer [12]. Syndecan-3 is a high-affinity receptor for MK and an essential component for neurite outgrowths [13]. MK-induced neurite outgrowth can be inhibited by antisyndecan-3 antibodies in vitro [14]. This MK receptor is mainly expressed in neural tissues by neurons and localized in neurites [15]. High expression of MK has been reported in a number of malignant tumors, including breast cancer, prostate cancer, pancreatic cancer, and neuroblastoma [16-20]. Interestingly, perineural invasion is prone to occur in these MK-positive tumors. Therefore, this suggests that as a neurite growth-promoting factor, MK and its receptor syndecan-3 may play an important role in the perineural invasion of pancreatic cancer. In previous studies, we have confirmed that another member of the MK family, PTN, and its receptor could promote neurite outgrowth [21] and perineural invasion of pancreatic cancer [22]. To elucidate the function of MK and its receptor in pancreatic cancer, we compared the expression patterns of MK and syndecan-3 by immunohistochemistry in patients with data containing clinicopathological features, perineural invasion, and overall survival. MATERIALS AND METHODS Patient specimens From March 2005 to May 2009, pancreatic cancer tissues (including adequately sized tumor tissue samples and tissue samples taken from areas less than 2.0 cm around the tumor) were taken from 42 patients who were undergoing a partial duodenopancreatectomy (Whipple resection) for pancreatic cancer at Department of Pancreatic Surgery (First Affiliated Hospital of Henan University of Science and Technology). Samples were fixed with 4% formalin for histological studies and analysis of perineural invasion was performed according to a previously described method [23]. In addition, 10 samples containing normal pancreatic tissues from patients who received partial pancreatectomy for benign tumors were used as normal controls. Of the 42 patients, 26 were men and 16 were women. The median age at the time of surgery was 62.5 years (range: years). The histological type of all 42 patients was pancreatic ductal adenocarcinoma. Tumor stage and histopathological grade were recorded based on the classification of the International Union Against Cancer [24]. There were 10 stage Ⅰ, 11 stage Ⅱ, 16 stage Ⅲ, and 5 stage Ⅳ cancers. Histological grades were as follows: 5 grade Ⅰ, 22 grade Ⅱ, and 15 grade Ⅲ. All patients were followed and the median duration of followup was 24 (2-46) mo. All studies were approved by the Human Subjects Committee of Henan University of Science and Technology, China. Immunohistochemistry MK and syndecan-3 proteins were detected by immunohistochemistry using a standardized streptavidin peroxidase (SP) method. Sections (4-μm) from paraffinembedded tissue were used for immunohistochemistry. Slides were deparaffinized in fresh xylene and rehydrated through sequential graded ethanol. Antigen retrieval was performed in citrate buffer (10 mmol/l, ph 6.0) using a pressure cooker for 2 min after air jetting. Slides were cooled for 20 min, incubated for 10 min with 0.3% (v/v) hydrogen peroxide, blocked for 20 min in 20% normal goat serum or rabbit serum, and incubated with primary antibodies overnight at 4. The next day, the slides were washed in phosphate-buffered saline (PBS; ph 7.4) and incubated for 30 min with secondary antibody of biotinylated rabbit antigoat immunoglobulin G (IgG) (1:200 dilution; DAKO, Glostrup, Denmark) or biotinylated goat antirabbit IgG (1:200 dilution, DAKO). Samples were then incubated with peroxidase-conjugated streptavidin (1:200 dilution, DAKO) for 20 min at room temperature. Color was developed with 0.02% 3, 3 -diaminobenzidine (Sigma, St Louis, MO, United States) in 50 mmol/l Tris-HCl buffer (ph 7.6) for 5-7 min. The slides were washed three times in 0.25% Tween-20 in PBS for 15 min between each step, and all incubations were carried out in a humidified chamber. Finally, the sections were counterstained with hematoxylin, rinsed with water, dehydrated, cleared and cover-slipped. The following primary antibodies were applied: anti-mk (1:200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, United States) and anti-syndecan-3 (1:100 dilution; Boster, Wuhan, China). Non-immune goat or rabbit serum were used as negative 3019 March 21, 2014 Volume 20 Issue 11

301 Yao J et al. Midkine in human pancreatic cancer Table 1 Associations between midkine, syndecan-3 protein expression and clinicopathologic factors in pancreatic cancers n (%) Factor Midkine positive cases Syndecan-3 positive cases Age (yr) > 60 (n = 26) 17 (65.4) 17 (65.4) 60 (n = 16) 9 (56.3) 7 (43.8) Sex Female (n = 16) 12 (75.0) 10 (62.5) Male (n = 26) 14 (53.8) 14 (53.8) CA19-9 (n = 42) >37 U/mL (n = 24) 16 (66.7) 12 (50.0) 37 U/mL (n = 18) 12 (66.7) 10 (55.6) Histological grade Ⅰ (n = 5) 4 (80.0) 2 (40.0) Ⅱ (n = 22) 16 (72.7) 15 (68.2) Ⅲ (n = 15) 7 (46.7) 7 (46.7) Tumor size T 2 cm (n = 10) 4 (40.0) 3 (30.0) a 2 cm < T 5 cm (n = 24) 14 (58.3) 15 (62.5) a T > 5 cm (n = 8) 8 (100.0) 7 (87.5) a Lymph node metastasis Negative (n = 17) 7 (41.2) a 7 (41.2) Positive (n = 25) 19 (76.0) a 17 (68.0) Distant metastasis Negative (n = 36) 21 (58.3) 19 (52.8) Positive (n = 6) 5 (83.3) 5 (83.3) TNM grade Ⅰ + Ⅱ (n = 21) 9 (42.9) b 10 (47.6) Ⅲ (n = 16) 13 (81.3) b 10 (62.5) Ⅳ (n = 5) 5 (100.0) b 5 (100.0) a P < 0.05, b P < 0.01 vs negative cases. controls. The known positive breast carcinoma and neuroblastoma were used as positive controls for MK and syndecan-3, respectively. The results of MK and syndecan-3 staining were evaluated in terms of the percentage of positively stained cells, with > 10% considered positive. Analysis of perineural invasion Associations of neural invasion with aggressive characteristics of pancreatic cancer and the presence of perineural invasion were assessed in all pancreatic cancer specimens by two independent observers blinded to the patient status. Any differences were resolved by a joint review and consultation with a third observer. For each cancer sample, approximately 10 tissue sections from different tumor locations were checked. Perineural invasion was defined as positive if the infiltration of cancer cells into the perineurium or neural fasciculus was detected at the leading point, as reported previously [23]. The degree of perineural invasion was defined microscopically as follows: 0, perineural invasion was difficult to find, with less than one occurrence per slide; 1, perineural invasion was easy to find, with two to four occurrences per slide; and 2, perineural invasion was easy to find, with more than four occurrences per slide or intraneural invasion. Statistical analysis Univariate analysis was used for the χ 2 test. Survival rate was calculated by the Kaplan-Meier method, and differences were examined by the Log-rank test. Factors found to be significant were then chosen for a stepwise Cox multivariate proportional hazard model to determine their prognostic values. SPSS for Windows (Version 14.0; SPSS Inc., Chicago, IL, United States) was used for statistical analysis. P values less than 0.05 were considered statistically significant. RESULTS Expression of MK and syndecan-3 in pancreatic cancer MK was expressed in the cytoplasm of tumor cells and found predominantly in invasive carcinoma cells. No staining was observed in normal pancreatic cells (Figure 1A-D). Interestingly, the cells in the adjacent tissue also displayed moderate staining for MK. Immunoreactions were also observed in the desmoplastic stromal cells within the tumor mass in MK-positive cases, but not in stromal cells in the areas distant from MK-positive cancer cell nests. In normal pancreatic tissues, no syndecan-3 was observed in the perineurium of nerves. Immunostaining revealed that syndecan-3 was not present in ductal and acinar cells. Pancreatic cancer cells were devoid of any syndecan-3 (Figure 1E). In tissues surrounding the tumor mass, syndecan-3 was not detected in the perineurium. However, in pancreatic cancer tissues, strong syndecan-3 immunoreactivity was present in the perineurium (Figure 1F). The perineurium infiltrated by pancreatic cancer cells was frequently severely damaged. Therefore, the intensity of the immunohistochemical signal in these regions could not be conclusively evaluated (data not shown). In total, the expression rates of MK in pancreatic cancers and tissues around the tumor mass were 61.9% (26/42) and 26.2% (11/42), respectively (P < 0.05). Relationships of MK and syndecan-3 expression with clinicopathological features Table 1 summarizes the associations of MK and syndecan-3 expression with clinicopathological parameters in pancreatic cancer. The MK immunostaining was positive in 9 of 21 stage Ⅰ-Ⅱ cases (42.9%), and the positive rate was significantly lower than those in stage Ⅲ (81.3%, 13 of 16 cases) and stage Ⅳ (100%, all 5 cases) cases (P = 0.008). High MK expression was also associated with lymph nodes metastasis (P = 0.042). Syndecan-3 expression was associated with tumor size (P = 0.028). There was also a correlation between MK expression and tumor size, but it was not statistically significant (P = 0.060). We also investigated the relationship between plasma levels of the tumor marker CA19-9 in 42 patients, and MK and syndecan-3 expression. However, no relationships were observed between them (P = and P = 0.475, respectively). Relationship between perineural invasion and expression of MK and syndecan-3 MK-positive cases had statistically higher levels of synde March 21, 2014 Volume 20 Issue 11

302 Yao J et al. Midkine in human pancreatic cancer A B Figure 1 Representative immunohistochemistry results of midkine and syndecan-3 ( 200). Paraffin sections were immunostained as described in Materials and Methods. A: Normal tissue showing negative midkine (MK) expression; B: Tumor tissue showing negative MK expression; C: Tumor tissue showing moderate MK expression; D: Tumor tissue showing intense MK expression; E: Negative syndecan-3 expression in cancer; F: Positive syndecan-3 expression in the perineurium of nerves in pancreatic cancer. C D E F Perineural invasion is defined as the presence of cancer cells along nerves and/or within the epineurial, perineurial, and endoneurial spaces of the neuronal sheath [25]. Perineural invasion is a multifactorial process that involves various signaling molecules from different signaling pathways [26-28]. These signaling molecules include NGFs, neurotrophic factors, chemokines, and cell-surface ligands, and receptors [29,30]. Pancreatic ductal adenocarcinoma cells respond strongly to neurotrophic factors. Since the pancan-3 expression (P = 0.045). High MK expression was associated with perineural invasion (P = 0.018). Syndecan-3 expression was also associated with perineural invasion (P = 0.031). MK and syndecan-3 expression levels in pancreatic cancer were significantly higher in patients with perineural invasion than in those without perineural invasion (Table 2). Prognostic value of MK and syndecan-3 in patients with pancreatic cancer To determine the prognostic value of MK and syndecan-3 in pancreatic cancer, we analyzed the cumulative survival of patients based on their status (Figure 2). The cumulative survival rate in MK-negative patients (n = 16) at 3 years was 51.0% (median time 34.5 mo). In contrast, the cumulative survival rate in MK-positive patients (n = 26) was 21.8% (median time 14 mo) (P = 0.001). In addition, patients who were negative for syndecan-3 (n = 18) had a higher cumulative survival rate than those who were positive for syndecan-3 (n = 24), but this difference was not significant (44.0%, median time 31.5 mo vs 23.0%, median time 18 mo, respectively; P > 0.05). A multivariate analysis revealed that lymph node metastasis (P = 0.010) and tumor size (P = 0.035) were independent prognostic factors for overall survival in patients with pancreatic cancer. The expression of MK or syndecan-3 was not an independent prognostic factor for overall survival (P > 0.05). Perineural invasion and other clinical parameters were also found not to be independent prognostic factors. DISCUSSION 3021 March 21, 2014 Volume 20 Issue 11

303 Yao J et al. Midkine in human pancreatic cancer A 1.0 Positive Negative B 1.0 Positive Negative Overall survival rate Overall survival rate P = P = Postoperative survival time (mo) Postoperative survival time (mo) Figure 2 Kaplan-Meier analysis of overall postoperative survival curves in pancreatic cancer cases according to their immunohistochemical staining for midkine (A) and syndecan-3 (B). Table 2 Associations between midkine, syndecan-3 protein expression and perineural invasion in pancreatic cancer Protein PNI P value MK (+) (n = 26) MK (-) (n = 16) Syndecan-3 (+) (n = 24) Syndecan-3 (-) (n = 18) Perineural invasion was scored as follows: 0, perineural invasion was difficult to find, with less than one occurrence per slide; 1, perineural invasion was easy to find, with two to four occurrences per slide; and 2, perineural invasion was easy to find, with more than four occurrences per slide or intraneural invasion. PN: Perineural invasion; MK: Midkine. creas is in close proximity to several neural plexuses, this might partially explain the high incidence of perineural invasion in pancreatic cancer [31]. It is likely that as a neurite growth-promoting factor, MK acts synergistically to promote the development of perineural invasion. Our present study suggests that high MK expression is closely correlated with advanced tumor, node and metastasis stage, lymph node metastasis, and perineural invasion. In contrast, although tissue samples reveal moderate to intense MK-immunoreactive staining in patients with distant metastasis, univariate analysis did not indicate a positive correlation between intense MK expression and distant metastasis. This may be due to the small sample size and because only six patients with distant metastasis had received operations and were entered into our cohort. Surprisingly, positive MK expression is also observed in normal tissue surrounding the tumor. We believe that MK upregulation in normal cells surrounding the tumor might be due to the binding and uptake of MK produced by nearby tumor cells. Perineural invasion extending into the pancreatic nerve plexus is a histopathological characteristic of pancreatic cancer [32]. Perineural invasion occurs not only in the extrapancreatic nerve, but also in the intrapancreatic nerve in pancreatic carcinoma [33]. Previous studies have demonstrated that syndecan-3 acts as a receptor or a coreceptor in MK-induced neurite outgrowth in perinatal rat brain neurons [34,35]. It is possible that MK-syndecan interactions play key roles in neurite outgrowth and development of perineural invasion in human pancreatic cancer. In this study, MK and syndecan-3 protein levels were markedly increased in pancreatic cancer samples compared to normal pancreas samples by immunostaining analysis. MK was highly expressed in pancreatic cancer cells, whereas syndecan-3 was primarily found in neuritis and the perineurium of pancreatic nerves and absent in pancreatic cancer cells. Raulo also showed that syndecan-3 is localized on the surface of neuritis and growth cones in rat primary neurons found on MKcoated matrix in vitro [14]. The statistical analysis in our study demonstrated that high MK expression was associated with perineural invasion (P = 0.018). Syndecan-3 expression was also associated with perineural invasion (P = 0.031). MK and syndecan-3 expression levels in pancreatic cancer were significantly higher in patients with perineural invasion than in those without perineural invasion. Therefore, these observations suggest that the MK/syndecan-3 pathway may have an important role in perineural invasion. Whether high MK expression is a prognostic factor for pancreatic cancer is unknown. In our study, patients with negative MK expression had a higher 3-year survival rate and a longer established survival time than those who were positive for MK expression (survival rate 51.0% vs 21.8%, P = and survival time 34.5 mo vs 14 mo, respectively). This indicates that the MK negative expression correlated with a better survival outcome. We believe that the coexpression of syndecan-3 and MK was associated with perineural invasion of pancreatic cancer, and that invasion is significantly associated with the prognosis [36]. Furthermore, patients with negative MK expression were early-staged (stages Ⅰand Ⅱ) and accounted for almost half the number of patients who received a pancreaticoduodenectomy or radical operation. Patients who were positive for MK expression had advanced tu March 21, 2014 Volume 20 Issue 11

304 Yao J et al. Midkine in human pancreatic cancer mors without an option for undergoing radical surgery. These findings also demonstrated that MK activation appeared to be a crucially progressive step for tumor invasion and metastasis. In conclusion, the present data suggest that MK may act as a useful biomarker for aggressive pancreatic cancer. MK and its receptor protein are frequently expressed in human pancreatic cancer. Their co-expression may suggest their coordination in the tumor perineural invasion and prognosis of pancreatic cancer. In future studies, we will determine the functional role of MK in the progression and neural invasion of pancreatic cancer by in vitro and in vivo loss-of-function studies. COMMENTS Background Pancreatic cancer is still one of the most aggressive and intractable human malignant tumors. Perineural invasion extending into the pancreatic nerve plexus is a histopathological characteristic of pancreatic cancer. However, the mechanisms contributing to the invasion of intrapancreatic nerves and spread of cancer cells along the extrapancreatic nerves during pancreatic cancer progression are still poorly understood. As a neurite growth-promoting factor, midkine (MK) and its receptor syndecan-3 may play an important role in the perineural invasion and prognosis of human pancreatic cancer. Therefore, in this study, MK and syndecan-3 proteins levels in pancreatic cancer were detected by immunohistochemistry and analyzed for correlations with clinicopathological features, perineural invasion, and prognosis. Research frontiers Perineural invasion extending into the pancreatic nerve plexus is a histopathological characteristic of pancreatic cancer. The neural invasion of pancreatic cancer leads to local recurrence, metastasis and poor prognosis, which have brought difficulty for diagnosing and treating pancreatic cancer. Innovations and breakthroughs In recent years, studies on pancreatic cancer have focused on biological characteristics, especially perineural invasion. This study found that high expression of MK and syndecan-3 may contribute to the highly perineural invasion and poor prognosis of human pancreatic cancer, which might reveal the functional mechanism of neural invasion. Applications The study indicates that MK and syndecan-3 might be an attractive target for gene therapy of nerve infiltration of pancreatic cancer. Terminology MK is a type of neurotrophic factor and is also known as a neurite growth promoting factor. Syndecan-3 is a transmembrane protein and a high-affinity receptor for MK. MK and syndecan-3 are important in promoting neurite outgrowth. High expression of MK and its receptor may contribute to the highly perineural invasion and poor prognosis of human pancreatic cancer. Peer review The authors provided data on the relevance between expression of midkine and its receptor syndecan-3 and some clinical features in pancreatic cancer patients. These findings contribute to the highly perineural invasion and poor prognosis of ductal adenocarcinoma of the pancreas. The number of cases included is small but the evidence of such expression of neurite growth-promoting factors in pancreatic cancer is interesting. REFERENCES 1 Li D, Xie K, Wolff R, Abbruzzese JL. Pancreatic cancer. Lancet 2004; 363: [PMID: DOI: / S (04) ] 2 Laheru D, Jaffee EM. Immunotherapy for pancreatic cancer - science driving clinical progress. Nat Rev Cancer 2005; 5: [PMID: DOI: /nrc1630] 3 Ceyhan GO, Giese NA, Erkan M, Kerscher AG, Wente MN, Giese T, Büchler MW, Friess H. The neurotrophic factor artemin promotes pancreatic cancer invasion. Ann Surg 2006; 244: [PMID: DOI: /01. sla ] 4 Veit C, Genze F, Menke A, Hoeffert S, Gress TM, Gierschik P, Giehl K. Activation of phosphatidylinositol 3-kinase and extracellular signal-regulated kinase is required for glial cell line-derived neurotrophic factor-induced migration and invasion of pancreatic carcinoma cells. Cancer Res 2004; 64: [PMID: DOI: / CAN ] 5 Tomomura M, Kadomatsu K, Matsubara S, Muramatsu T. A retinoic acid-responsive gene, MK, found in the teratocarcinoma system. Heterogeneity of the transcript and the nature of the translation product. J Biol Chem 1990; 265: [PMID: ] 6 Muramatsu T. Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem 2002; 132: [PMID: DOI: /oxfordjournals.jbchem.a003231] 7 Rauvala H, Peng HB. HB-GAM (heparin-binding growthassociated molecule) and heparin-type glycans in the development and plasticity of neuron-target contacts. Prog Neurobiol 1997; 52: [PMID: DOI: / S (97) ] 8 Kurosawa N, Chen GY, Kadomatsu K, Ikematsu S, Sakuma S, Muramatsu T. Glypican-2 binds to midkine: the role of glypican-2 in neuronal cell adhesion and neurite outgrowth. Glycoconj J 2001; 18: [PMID: ] 9 Sakaguchi N, Muramatsu H, Ichihara-Tanaka K, Maeda N, Noda M, Yamamoto T, Michikawa M, Ikematsu S, Sakuma S, Muramatsu T. Receptor-type protein tyrosine phosphatase zeta as a component of the signaling receptor complex for midkine-dependent survival of embryonic neurons. Neurosci Res 2003; 45: [PMID: DOI: / S (02) ] 10 Owada K, Sanjo N, Kobayashi T, Mizusawa H, Muramatsu H, Muramatsu T, Michikawa M. Midkine inhibits caspasedependent apoptosis via the activation of mitogen-activated protein kinase and phosphatidylinositol 3-kinase in cultured neurons. J Neurochem 1999; 73: [PMID: ] 11 Kadomatsu K, Muramatsu T. Midkine and pleiotrophin in neural development and cancer. Cancer Lett 2004; 204: [PMID: DOI: /S (03) ] 12 Maeda S, Shinchi H, Kurahara H, Mataki Y, Noma H, Maemura K, Aridome K, Yokomine T, Natsugoe S, Aikou T, Takao S. Clinical significance of midkine expression in pancreatic head carcinoma. Br J Cancer 2007; 97: [PMID: DOI: /sj.bjc ] 13 Kinnunen A, Kinnunen T, Kaksonen M, Nolo R, Panula P, Rauvala H. N-syndecan and HB-GAM (heparin-binding growth-associated molecule) associate with early axonal tracts in the rat brain. Eur J Neurosci 1998; 10: [PMID: DOI: /j x] 14 Raulo E, Chernousov MA, Carey DJ, Nolo R, Rauvala H. Isolation of a neuronal cell surface receptor of heparin binding growth-associated molecule (HB-GAM). Identification as N-syndecan (syndecan-3). J Biol Chem 1994; 269: [PMID: ] 15 Kinnunen T, Kaksonen M, Saarinen J, Kalkkinen N, Peng HB, Rauvala H. Cortactin-Src kinase signaling pathway is involved in N-syndecan-dependent neurite outgrowth. J Biol Chem 1998; 273: [PMID: DOI: / jbc ] 16 Ohhashi S, Ohuchida K, Mizumoto K, Egami T, Yu J, Cui L, Toma H, Takahata S, Nabae T, Tanaka M. Midkine mrna is overexpressed in pancreatic cancer. Dig Dis Sci 2009; 54: [PMID: DOI: /s ] 17 Ibusuki M, Fujimori H, Yamamoto Y, Ota K, Ueda M, Shinriki S, Taketomi M, Sakuma S, Shinohara M, Iwase H, Ando 3023 March 21, 2014 Volume 20 Issue 11

305 Yao J et al. Midkine in human pancreatic cancer Y. Midkine in plasma as a novel breast cancer marker. Cancer Sci 2009; 100: [PMID: DOI: / j x] 18 Nordin A, Wang W, Welén K, Damber JE. Midkine is associated with neuroendocrine differentiation in castrationresistant prostate cancer. Prostate 2013; 73: [PMID: DOI: /pros.22607] 19 Ikematsu S, Nakagawara A, Nakamura Y, Ohira M, Shinjo M, Kishida S, Kadomatsu K. Plasma midkine level is a prognostic factor for human neuroblastoma. Cancer Sci 2008; 99: [PMID: DOI: /j x] 20 Kishida S, Mu P, Miyakawa S, Fujiwara M, Abe T, Sakamoto K, Onishi A, Nakamura Y, Kadomatsu K. Midkine promotes neuroblastoma through Notch2 signaling. Cancer Res 2013; 73: [PMID: ] 21 Yao J, Zhang M, Ma QY, Wang Z, Wang LC, Zhang D. PAdshRNA-PTN reduces pleiotrophin of pancreatic cancer cells and inhibits neurite outgrowth of DRG. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17. i ] 22 Yao J, Ma Q, Wang L, Zhang M. Pleiotrophin expression in human pancreatic cancer and its correlation with clinicopathological features, perineural invasion, and prognosis. Dig Dis Sci 2009; 54: [PMID: DOI: / s ] 23 Zhu Z, Friess H, dimola FF, Zimmermann A, Graber HU, Korc M, Büchler MW. Nerve growth factor expression correlates with perineural invasion and pain in human pancreatic cancer. J Clin Oncol 1999; 17: [PMID: ] 24 Wittekind C, Compton CC, Greene FL, Sobin LH. TNM residual tumor classification revisited. Cancer 2002; 94: [PMID: DOI: /cncr.10492] 25 Liebig C, Ayala G, Wilks JA, Berger DH, Albo D. Perineural invasion in cancer: a review of the literature. Cancer 2009; 115: [PMID: DOI: /cncr.24396] 26 Bapat AA, Hostetter G, Von Hoff DD, Han H. Perineural invasion and associated pain in pancreatic cancer. Nat Rev Cancer 2011; 11: [PMID: ] 27 Ceyhan GO, Demir IE, Altintas B, Rauch U, Thiel G, Müller MW, Giese NA, Friess H, Schäfer KH. Neural invasion in pancreatic cancer: a mutual tropism between neurons and cancer cells. Biochem Biophys Res Commun 2008; 374: [PMID: DOI: /j.bbrc ] 28 Gil Z, Cavel O, Kelly K, Brader P, Rein A, Gao SP, Carlson DL, Shah JP, Fong Y, Wong RJ. Paracrine regulation of pancreatic cancer cell invasion by peripheral nerves. J Natl Cancer Inst 2010; 102: [PMID: DOI: / jnci/djp456] 29 Ma J, Jiang Y, Jiang Y, Sun Y, Zhao X. Expression of nerve growth factor and tyrosine kinase receptor A and correlation with perineural invasion in pancreatic cancer. J Gastroenterol Hepatol 2008; 23: [PMID: DOI: / j x] 30 Marchesi F, Piemonti L, Fedele G, Destro A, Roncalli M, Albarello L, Doglioni C, Anselmo A, Doni A, Bianchi P, Laghi L, Malesci A, Cervo L, Malosio M, Reni M, Zerbi A, Di Carlo V, Mantovani A, Allavena P. The chemokine receptor CX3CR1 is involved in the neural tropism and malignant behavior of pancreatic ductal adenocarcinoma. Cancer Res 2008; 68: [PMID: DOI: / CAN ] 31 Ceyhan GO, Schäfer KH, Kerscher AG, Rauch U, Demir IE, Kadihasanoglu M, Böhm C, Müller MW, Büchler MW, Giese NA, Erkan M, Friess H. Nerve growth factor and artemin are paracrine mediators of pancreatic neuropathy in pancreatic adenocarcinoma. Ann Surg 2010; 251: [PMID: DOI: /SLA.0b013e3181d974d4] 32 Hirai I, Kimura W, Ozawa K, Kudo S, Suto K, Kuzu H, Fuse A. Perineural invasion in pancreatic cancer. Pancreas 2002; 24: [PMID: DOI: / ] 33 Yi SQ, Miwa K, Ohta T, Kayahara M, Kitagawa H, Tanaka A, Shimokawa T, Akita K, Tanaka S. Innervation of the pancreas from the perspective of perineural invasion of pancreatic cancer. Pancreas 2003; 27: [PMID: DOI: / ] 34 Kinnunen T, Raulo E, Nolo R, Maccarana M, Lindahl U, Rauvala H. Neurite outgrowth in brain neurons induced by heparin-binding growth-associated molecule (HB-GAM) depends on the specific interaction of HB-GAM with heparan sulfate at the cell surface. J Biol Chem 1996; 271: [PMID: DOI: /jbc ] 35 Nolo R, Kaksonen M, Raulo E, Rauvala H. Co-expression of heparin-binding growth-associated molecule (HB-GAM) and N-syndecan (syndecan-3) in developing rat brain. Neurosci Lett 1995; 191: [PMID: DOI: / (94) ] 36 Mitsunaga S, Hasebe T, Kinoshita T, Konishi M, Takahashi S, Gotohda N, Nakagohri T, Ochiai A. Detail histologic analysis of nerve plexus invasion in invasive ductal carcinoma of the pancreas and its prognostic impact. Am J Surg Pathol 2007; 31: [PMID: DOI: / PAS.0b013e318065bfe6] P- Reviewers: Chowdhury P, Gu DS, Sperti C S- Editor: Zhai HH L- Editor: Wang TQ E- Editor: Wu HL 3024 March 21, 2014 Volume 20 Issue 11

306 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. Mass spectrometry-based serum peptide profiling in hepatocellular carcinoma with bone metastasis BRIEF ARTICLE Jian He, Zhao-Chong Zeng, Zuo-Lin Xiang, Ping Yang Jian He, Zhao-Chong Zeng, Zuo-Lin Xiang, Ping Yang, Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai , China Author contributions: He J and Zeng ZC designed the research; He J and Xiang ZL performed the research; Yang P contributed new reagents and analytic tools; He J and Zeng ZC analyzed the data; He J, Zeng ZC, Xiang ZL and Yang P wrote the paper. Supported by the Medical Guidance Program of the Science and Technology Commission of Shanghai Municipality, No Correspondence to: Zhao-Chong Zeng, Professor, Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai , China. zeng.zhaochong@zs-hospital.sh.cn Telephone: Fax: Received: August 21, 2013 Revised: December 5, 2013 Accepted: January 2, 2014 Published online: March 21, 2014 Abstract AIM: To investigate the potential of serum peptides as a diagnostic tool for hepatocellular carcinoma (HCC) with bone metastasis. METHODS: Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF-MS) was used to characterize the serum peptide profile of HCC patients with bone metastasis. Serum samples from 138 HCC patients (66 cases with and 72 cases without bone metastasis) were randomly assigned into a training set (n = 76) and a test set (n = 62). Differential serum peptides were examined using ClinProt magnetic bead-based purification followed by MALDI- TOF-MS. The sequences of differentially expressed serum peptides were identified using liquid chromatography-mass spectrometry. A diagnostic model was established using a learning algorithm of radial basis function neural network verified by a single blind trial. Receiver operating characteristic (ROC) analysis was performed to evaluate the diagnostic power of the established model. RESULTS: Ten peptide peaks were significantly different between HCC patients with or without bone metastasis (P < 0.001). Sequences of seven peptides with mass to charge ratios (m/z) of , , , , , , and were successfully identified. These seven peptides were derived from alpha-fetoprotein, prothrombin, serglycin, isoform 2 of inter-alpha-trypsin inhibitor heavy chain H4, isoform 1 of autophagy-related protein 16-2, and transthyretin and fibrinogen beta chains, respectively. The recognition rate and predictive power of a diagnostic model established on the basis of six significant peptides (m/z for these six peptides were , , , , , and ) were 89.47% and 82.89%, respectively. The sensitivity and specificity of this model based upon a single blind trial were 85.29% and 85.71%, respectively. ROC analysis found that the AUC (area under the ROC curve) value was CONCLUSION: Our study suggested that serum peptides may serve as a diagnosis tool for HCC bone metastasis Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Hepatocellular carcinoma; Serum; Peptides; Matrix-assisted laser desorption ionization-time of flight mass spectrometry; Tumor biomarker Core tip: Advances in the diagnosis and treatment of hepatocellular carcinoma (HCC) and extension of overall survival rates have led to an increase in the incidence of bone metastasis of HCC, which accounts for approximately 38.5% of all cases of extrahepatic metastasis of HCC. The patient s quality of life would significantly be affected by the time of diagnosis. However, early diagnostic molecular markers for bone metastasis from HCC have not yet been identified. In this study, we 3025 March 21, 2014 Volume 20 Issue 11

307 He J et al. Serum peptides predict HCC bone metastasis performed differential serum peptide profiling in HCC patients with bone metastasis, which can be used for early prediction of this disorder. He J, Zeng ZC, Xiang ZL, Yang P. Mass spectrometry-based serum peptide profiling in hepatocellular carcinoma with bone metastasis. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/3025.htm DOI: i INTRODUCTION The incidence of primary hepatocellular carcinoma (HCC) in male and female patients with malignant tumors is ranked globally at the fifth and eighth place, respectively [1]. The median survival period for HCC patients with bone metastasis is only mo [2] due to bone metastasis resulting in severe bone pain, pathologic fracture, neurological deficits, and even paralysis. The long-term outcome of HCC patients with bone metastasis receiving external beam radiotherapy is poor, and most patients die within 1 year [3]. Advances in the diagnosis and treatment of HCC and extension of overall survival rates have led to an increase in the incidence of bone metastasis of HCC, which accounts for approximately 38.5% of all cases of extrahepatic metastasis of HCC [4]. However, molecular markers for bone metastasis from HCC have not yet been identified. Relying primarily on clinical imaging tools, diagnosis of bone metastasis from HCC is based on radiological imaging studies which have both low sensitivity and low specificity. Moreover, by the time bone metastasis images are obtained, patients often already have developed paralysis extensively in the body due to pain, dysfunction, and metastasis. Because the outcomes of palliative treatment for bone metastasis of HCC are dependent on its diagnosis, the patient s quality of life would significantly be affected by the time of diagnosis. In this study, we investigated differential serum peptide profiling in HCC patients with bone metastasis using matrixassisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF-MS), to identify potential serum biomarkers for diagnosis of bone metastasis, which can be used for early molecular prediction of this disorder [5]. MATERIALS AND METHODS Clinical information All serum specimens were obtained from patients with and without bone metastasis from primary HCC between June 2009 and December 2012 at the Department of Radiation Oncology, Zhongshan Hospital, Fudan University. Approval for collecting and processing serum samples was obtained from the research Table 1 Patient characteristics, n (%) Variable With bone metastasis (n = 66) Without bone metastasis (n = 72) Age, yr Range Mean Sex Male 46 (70) 53 (71) Female 20 (30) 19 (29) Liver resection With 55 (83) 58 (81) Without 11 (17) 14 (19) Set Training set 38 (58) 38 (53) Validation set 28 (42) 34 (47) TNM stage of HCC Ⅰ 0 0 Ⅱ 0 8 Ⅲ 0 64 Ⅳ 66 0 Method for metastasis detection 1 / MRI/CT 54 ECT/SPET-CT 66 PET-CT 12 1 Multiple methods were used to detect bone metastasis. TNM: Tumor node metastasis; HCC: Hepatocellular carcinoma; MRI: Magnetic resonance imaging; PET-CT: Positron emission tomography-computed tomography. ethics committee of Zhongshan Hospital, and written informed consent was obtained from each patient. Criterion for HCC with bone metastasis was diagnosis with bone metastasis for the first time with no other distant metastasis. Criterion for HCC without bone metastasis was first time diagnosis with HCC with radiological examination showing no bone or other distant metastasis. None of the patients received radiotherapy, chemotherapy, or other intervention treatments before the collection of serum samples. Patient characteristics are summarized in Table 1. Among 66 patients with bone metastasis, 55 bone cases occurred after liver resection, and 11 cases occurred without resection. The cases included 46 men and 20 women, with the age ranging from 23 to 84 years, and with a median age of 58 years. Among the other 72 patients without bone metastasis, 58 underwent resection, and 14 patients did not. These cases included 53 men and 19 women, with an age range of years, and a median age of 59 years. One hundred thirty-eight serum samples were randomly assigned into two groups: a training set of 76 cases, including 38 patients with bone metastasis and 38 cases without bone metastasis, and a test set of 62 cases with HCC, including 28 patients with bone metastasis and 34 cases without bone metastasis. According to biopsy and postoperative specimen results, the 138 patients with and without bone metastasis were all diagnosed with HCC, of whom 116 were diagnosed by postoperative pathological examination, and 22 by biopsy March 21, 2014 Volume 20 Issue 11

308 He J et al. Serum peptides predict HCC bone metastasis Diagnostic criteria for bone metastasis and bone metastasis-free HCC were as follows: (1) diagnosis of primary tumors based on pathology; and (2) diagnosis of bone metastasis or no bone metastasis based upon clinical symptoms, isotopes and MRI/CT/X-rays, or whether or not SPET-CT/PET-CT detected bone metastasis. Sample collection Two milliliters of blood from fasting patients were obtained from each of the 66 HCC cases with bone metastasis, then placed into EDTA anticoagulant tubes at 4, incubated for one hour, and centrifuged at 8000 g for 5 min. The supernatant was stored at -80 in aliquots of 20 μl. Paired serum samples of 72 patients without bone metastasis as the control group were processed in an identical manner. Peptide extration Serum peptides were enriched using WCX beads (Clin- Prot bead Kit, Bruker Daltonics, United States) according to the manufacturer s instructions, and then subjected to MALDI-TOF-MS analysis. Quality control of standard serum Seven samples were processed simultaneously with standard serum (Sigma-Aldrich, St. Louis, MO, United States). Standard serum was used as the quality control for experiments using magnetic beads, as well as other experiments throughout the study. Eluent data from standard serum magnetic bead processing were collected using an auto flex mass spectrum instrument (Bruker Daltonics), then compared with data of standard serum, using the same magnetic beads and collection methods. In this manner the instrument parameters were adjusted to obtain a relative standard deviation (CV) < 30%, to ensure that the experimental protocol had good reproducibility and met operational process standards. MALDI-TOF-MS screening of differential peptides Enriched peptide samples were mixed with matrix (alphacyano-4-hydroxycinnamic acid (CHCA; Sigma-Aldrich), and after crystallization data were acquired using the auto flex mass spectrometer. Scan range was from 1000 to Daltons (Da) in positive mode, and laser frequency was 20 Hz. A 50% high energy laser was used to irradiate each crystal point eight times, then a 30% low energy laser was used to capture 50 times. The data was summarized four times and saved. MALDI-TOF-MS data analysis and statistics ClinProTools software (version 2.2, Bruker Daltonics) was used to analyze mass to charge ratio (m/z) and intensity of all peptide spectra, consisting of baseline deductions, normalization of the spectra, and chromatographic peak alignment correction. Wilcoxon-test method in the ClinProTools software was used to determine the m/z of peptides with significant differences [P < 0.001, (Wilcoxon-test)]. Diagnostic model establishment Six different peaks showing significant differences were selected between the two groups (38 patients with bone metastasis from HCC and 38 HCC patients without bone metastasis) using the ClinProTools software (Clin- Prot software version 2.0; Bruker Daltonics), and a diagnostic model was established by RBFNN-based model to filter out patients at a high risk with bone metastasis from HCC. This model was validated by a 10-fold cross validation method, which randomly selected eight case samples (about 10%) as test samples, and utilized other samples as training sets for model validation. The validation process was repeated 10 times. Sera from the validation group of 28 patients with bone metastasis from HCC and 34 HCC patients without bone metastasis underwent single blind experimental verification. Receiver operating characteristic (ROC) analysis was performed to evaluate the diagnostic power of the established model. Sequence confirmation of the identified peptides Significant differences in peptide characteristics were identified using liquid chromatography-mass spectrometry, which combined Nano Acquity UPLC liquid chromatography (Waters, United States) with an LTQ Orbitrap XL mass spectrometer system (Thermo Fisher Scientific, United States). Peptide trapping was performed using a captrap C18 (2 mm 0.5 mm) column (Michrom Corporation, United States), and an analytical Magic C18, AQ (100 μm 150 mm) column (Michrom Corporation). Mobile phase A was a solution of 5% acetonitrile and 0.1% formic acid, and mobile phase B was a solution of 90% acetonitrile and 0.1% formic acid. Peptide mixtures were injected into the trap column at a flow rate of 20 μl/min for 5 min, then eluted with a three step linear gradient, starting from 5% B to 45% B for 40 min, increased to 80% B for 1 min, and then held at 80% B for 4 min. The column was re-equilibrated under the initial conditions for 15 min. Column flow rate was maintained at 500 nl/min and column temperature was maintained at 35. Electrospray voltage of 1.9 kv versus the inlet of the mass spectrometer was used. LTQ Orbitrap XL mass spectrometer was operated in the data-dependent mode to switch automatically between MS and MS/MS acquisition. Survey full scan MS spectra with two microscans (m/z ) were acquired in the Obitrap with a mass resolution of at an m/z of 400, followed by eight sequential LTQ-MS/MS scans. Dynamic exclusion was used with two repeat counts, consisting of a 10 second repeat duration, and a 60 s exclusion duration. For MS/MS, precursor ions were activated using 25% normalized collision energy at the default activation q of All MS/MS spectra were identified using SEQUEST [v.28 (revision 12), Thermo Electron Corp.] that searched the human International Protein Index (IPI) database (IPI 3027 March 21, 2014 Volume 20 Issue 11

309 He J et al. Serum peptides predict HCC bone metastasis A B Peak (m/2) = HCC groups Bone metastasis HCC groups Intensity Intensity Mean + variance Mean Mean - variance Mean + variance Mean Mean - variance m/2 0 Bone metastasis HCC groups HCC groups C D Intensity Peak (m/2) = HCC groups Bone metastasis HCC groups Intensity Mean + variance Mean Mean - variance Mean + variance Mean Mean - variance m/2 0 Bone metastasis HCC groups HCC groups Figure 1 Profiles of peptides with m/z of and A, C: The profiles of peptides and , respectively. X-axis, molecular mass (m/z); y-axis, intensity; the green line represents the bone metastasis hepatocellular carcinoma (HCC) group and the red line represents the HCC group; B, D: The mean variance figures for (A) and (C). X-axis: Groups; y-axis: Intensity. human v3.64 fasta with entries). To minimize false positives, a decoy database containing all of the reverse protein sequences was added to this database. Search parameters were the following: no enzyme digestion, oxidation of methionine as a variable modification, peptide mass tolerance of 20 ppm, and fragment ion tolerance of 1.0 Da. The resulting filter parameters were the following: Cn 0.10, Xcorr 2.3 for two charged ions, Xcorr 2.6 for three charged ions, Xcorr 3.0 for four or more charged state ions, and peptide probability The errors were less than 0.1 Da between the m/z of peptide determined by LC-MS and MALDI-TOF-MS. RESULTS Serum peptide profiling of bone metastasis and bone metastasis-free groups A total of 10 peptides with P < 0.01 (Wilcoxon test P value) were screened. All peptides were upregulated in the bone metastasis group (Table 2). Taking the two most significantly different peptides (m/z , ; P < ) as an example, the zoom spectrum and the variance comparison chart are shown in Figure 1. The intensities of peaks at m/z of and in the bone metastasis group were significantly higher than those in the bone metastasis-free group. The variance chart showed that the experimental results could fully distinguish between the peptides. Peptide sequence identification Because the MALDI-TOF-MS and the LC-MS have different mass resolution and mass accuracy, to obtain the correct identification result, we used the following rules: the error mass of peptides between the MALDI- TOF-MS data and LC-MS data must be less than 1.0 Da; within this error range, no other precursor of peptide is observed in LC-MS data. For the 10 peptides that showed significant differences, we successfully identified 7 sequences (m/z , , , , , , and ) using LC-MS/MS. The sequence of peptide (m/z ) was GEYYLQNAFLVAYTK, which belonged to alphafetoprotein (AFP), as shown in Figure 2. All sequences and their protein identities are shown in Table 3. Diagnosis model validation As shown in Table 2, a pattern of peaks was selected for RBFNN model building, which was the best model built by this method. The six selected peptides were detected by MALDI-TOF-MS in every patients and each selected peptide showed a peak after the detection by 3028 March 21, 2014 Volume 20 Issue 11

310 He J et al. Serum peptides predict HCC bone metastasis Table 2 Significant differential peptide peaks between bone metastasis hepatocellular carcinoma group and bone metastasis-free hepatocellular carcinoma group Serial number m/z PTTA (t) P -W test PAD_1 PAD_2 HCC groups (n = 38) Bone metastasis HCC groups (n = 38) Serial numbers of the top ten peaks; m/z: Mass to charge ratio; PTTA (t): P value of t-test or ANOVA (analysis of variance); P-W test: P value of the Wilcoxon test; PAD_1: P value of the Anderson-darling normal test (HCC groups); PAD_2: P value of the Anderson-darling normality test (bone metastasis HCC group); HCC group (38): Average peak of the arithmetic means of 38 HCC samples; Bone metastasis HCC group (38): Average peak of the arithmetic means of 38 bone metastasis from HCC samples. HCC: Hepatocellular carcinoma. Relative abundance Z = Z =? MS GEYYLQNAFLVAYTK Z = Z =? Z =? Z =? Z =? Z =? Z =? Z =? Z = Z = Z =? Z =? Relative abundance Z =? Z =? +1 y y3 +2 b b Z =? +1 y Z =? +1 y y b Z =? Z =? Z =? Z =? Z =? Z =? Z = 2 y MS/MS +2 y y m/z +1 y b y y Z =? +1 y y y y m/z Figure 2 Mass spectrometry spectra and mass spectrometry/mass spectrometry spectra of peptide with an m/z of mass spectrum. The area under the peak was subject to RBFNN and finally a model value was generated for each patients. This diagnostic model was able to accurately identify 68 among 76 cases, which were used as the training group, with a recognition rate of 89.47% (68/76). The model could accurately predict an average of 63 cases by using the 10-fold cross validation method, with a predictive ability of 82.89% (63/76). ROC analysis found that the AUC (area under the ROC curve) value was (Figure 3) March 21, 2014 Volume 20 Issue 11

311 He J et al. Serum peptides predict HCC bone metastasis Table 3 Sequences of significant differential peptides m/z a m/z b Delta mass Peptide sequence Protein name Accession number GEYYLQNAFLVAYTK Alpha-fetoprotein IPI TATSEYQTFFNPRTFG Prothrombin IPI NLPSDSQDLGQHGLEEDFM Serglycin IPI RPGVLSSRQLGLPGPPDVPDHAAYHPF Isoform 2 of inter-alpha-trypsin inhibitor heavy chain H4 IPI CSRDNTLKVIDLR Isoform 1 of autophagy-related protein 16-2 IPI YTIAALLSPYSYSTTAVVTNPKE Transthyretin IPI KREEAPSLRPAPPPISGGGYR Fibrinogen beta chain IPI m/z a : Mass to charge ratio of the peptide observed in matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF-MS); m/z b : Mass to charge ratio of the peptide observed in LC-MS; Delta mass: The difference of the mass of peptide observed in MALDI-TOF-MS and LC-MS; Peptide sequence: The amino sequence of the peptide; Protein name: The full description of the protein that contained the peptide; Accession number: The accession number of the protein from the international protein index database. Sensitivity Single blind model validation Of the sera from 28 HCC patients with bone metastasis in the validation group and 34 patients without bone metastasis, 24 patients with bone metastasis and 29 patients without bone metastasis were correctly identified. The model accuracy, specificity and sensitivity were 85.48% (53/62), 85.29% (29/34) and 85.71% (24/28), respectively. DISCUSSION 1-specificity AUC = Figure 3 Receiver operating characteristic curve. Receiver operating characteristic (ROC) analysis was performed to evaluate the diagnostic power of the model. The area under the ROC curve value was Bone metastasis from HCC seriously affects quality of life, and palliative treatments are the main clinical treatments to maximize the quality of life [6]. Currently, the main diagnostic methods for bone metastasis are imaging such as technetium-99m bone scintigraphy, CT, MRI, and SPECT, which are not the most effective methods for prediction and early diagnosis of this disorder [7]. Colleoni et al [8] and Diel et al [9] made a breakthrough in early intervention of metastatic tumors of the bone resulting from breast cancer, reporting that diphosphate drugs were effective in prevention of bone metastasis. Early prediction of metastasis and early detection of patients with a high risk of bone metastasis are important clinical objectives. Bone metastasis of HCC consists of tumor angiogenesis, matrix degradation, shedding of tumor cells into the circulation, spreading to bone tissue and survival. These cancer cells evade local nonspecific immune functions of the host, and grow in the presence of various growth factors, resulting in bone metastasis. This is a multi-step and multifactorial process, affected by biological characteristics such as genetic background, host environment, and other factors [10]. A timeline model clearly demonstrated that the development of disease is a continuum, with the initial events being molecular perturbations following histomorphological changes and clinical manifestations occurring relatively late in the disease timeline [11]. This theory implied that molecular biomarkers were more likely to be used as early diagnosis/prediction tools than imaging. Furthermore, blood test is convenient and rapid with relative low cost, which also can be used for dynamic monitoring [12]. Abnormal expression of peptides and proteins by tumor cell genes encoding cytokines, reactivity of the organism, and tissue factors released into the blood provide an excellent source of protein markers for prediction and early diagnosis of tumor recurrence [13-17]. Detection of serum markers is technically feasible and of great clinical importance, because multiple characteristics of peptides and proteins in peripheral blood are likely to be important diagnostic predictors of HCC bone metastasis. So it is theoretically feasible to develop procedures to identify different peptides and proteins from serum to establish protein marker models. Mass spectrometry is the most important analytical method in proteome research, and mass spectrometry based on MALDI-TOF-MS of biomarkers for specific diseases has already played a major role in the development of molecular diagnostics [18,19]. Using mass spectrometry, Liu et al [20] screened HCC-associated molecular markers from sera of 30 patients with hepatitis B-related HCC, from 30 patients with chronic hepatitis B, and from 24 normal control donors, and identified markers for HCC diagnosis. Their protocol accurately distinguished between the three groups, and has been verified in 64 patients with liver cancer and 80 patients with chronic hepatitis B. HCC-associated proteins in that model include prothrombin precursor (fragment), calcium-dependent secretion activator protein-1, and BIRC6. Orvisky et al [21] used MALDI-TOF to screen HCC-associated serum proteins, and found 45 peptide peaks with significant differences (P < 0.001) out of 332 peptide peaks, with an accuracy as 3030 March 21, 2014 Volume 20 Issue 11

312 He J et al. Serum peptides predict HCC bone metastasis high as 90%. Protein sequence analysis revealed that the most significant differences were in peptides with alanine residues. Feng et al [22] used image analysis and MALDI- TOF-MS/MS to identify eight proteins unique to sera of patients with HCC. This was consistent with the discovery that heat shock protein 27 was found in sera in 90% of patients with HCC, but was not detected in normal human serum, showing that this protein can be used as a molecular marker for diagnosis of HCC. Nonetheless, all the above mentioned studies were for diagnosis of HCC, and not for diagnosis of bone metastasis from HCC. MALDI-TOF-MS uses magnetic beads with different functional surfaces for analysis of HCC serum, to identify potential biomarkers, and to identify single molecular markers with high accuracy, high stability, high sensitivity, high reproducibility, and high flux, whose identification can be automated [23,24]. The present study used a combination of MALDI-TOF-MS and technology-related information to characterize the specific serum peptide spectra of patients with bone metastasis from HCC, obtained from serum samples of 66 patients with bone metastasis from HCC compared to 72 HCC patients without bone metastasis. ClinProt magnetic bead purification and MALDI- TOF-MS ClinProTools bioinformatics methods were used to characterize differences in serum polypeptide spectra. Using analyses and comparison of serum peptide spectra from bone metastasis patients and bone metastasis-free control patients, 10 peptides with P-W test < were identified, with a RBFNN recognition rate up to 89.47%. LC-MS was successfully used to identify sequences of seven of the different peptides [25,26], with m/z of , , , , , , and Peptides with m/z of and were from alphafetoprotein and prothrombin, respectively. Compared with sera from HCC patients without bone metastasis, these two peptides were significantly upregulated in sera from patients with bone metastasis from HCC. The other five peptides from serglycin, transthyretin, etc. (Table 3) also increased in HCC patients with bone metastasis. We did not find any downregulated peptides in HCC patients with bone metastasis, which might be due to limitations of sample size. Researchers have reported that serglycin is a clinical sign of metastasis from nasopharyngeal cancer (NPC), and high levels of serglycin are closely related to poor prognosis in patients with NPC and metastasis of NPC [27]. Furthermore, studies showed that NPC cells with high metastatic potential had high expression levels of serglycin. The seven peptide sequences identified in our study are protein fragments of molecules, rather than the full protein, therefore the expression levels of peptide may not necessarily reflect the expression of the protein [28]. The 10 peptides that were significantly different in serum of patients with bone metastasis of HCC may possibly be used to establish simple and practical molecular markers for this disorder. They may be used as a potential early clinical predictor of metastasis, or used to monitor palliative treatment and active preventative intervention. In conclusion, we believe that the serum peptides identified by MALDI-TOF-MS may be adopted as potential tumor makers for bone metastasis of HCC. In addition, their identification facilitates the development of molecular markers to predict bone metastasis of HCC in high risk patients. ACKNOWLEDGMENTS We thank our patients for their willingness to take part in this study. We sincerely thank Guoquan Yan for valuable discussions and technical assistance. COMMENTS Background Liver cancer is the second leading cause of cancer death in men and the sixth leading cause of cancer death in women worldwide. Advances in diagnosis and treatment of hepatocellular carcinoma (HCC) and extension of overall survival rates have led to an increase in the incidence of bone metastasis of HCC, which accounts for approximately 38.5% of all cases of extrahepatic metastasis of HCC. Bone metastasis often results in severe bone pain, pathologic fracture, neurological deficits, and even paralysis, which reduce quality of life and add health care costs. The diagnosis of bone metastasis from HCC is based on imaging tests which have a low sensitivity. Moreover, by the time bone metastasis images are obtained, patients often already have developed paralysis extensively in the body due to pain, dysfunction, and metastasis. Molecular markers for bone metastasis from HCC have not yet been identified. Research frontiers Peptidomics is special form of functional proteomics. Since its introduction at the beginning of 2000, peptidomics has defined a new promising omics approach for the qualitative-quantitative analysis of endogenous peptides in biological samples, and has experienced a rapid development in the last decade. In this study, the authors tried to screen potential serum biomarkers for diagnosis of bone metastasis from HCC, and this can be used for early molecular prediction of HCC bone metastasis. Innovations and breakthroughs A timeline model clearly demonstrated that the development of disease is a continuum, with the initial events being molecular perturbations following histomorphological changes and clinical manifestations occurring relatively late in the disease timeline. This theory implied that molecular biomarkers were more likely to be used as early diagnosis/prediction tools than imaging [such as computed tomography (CT), magnetic resonance imaging (MRI), and single photon emission computed tomography (SPECT)]. Furthermore, blood test is convenient and rapid with relative low cost, which also can be used for dynamic monitoring. Applications The serum peptides screened by MALDI-TOF-MS may be adopted as potential tumor makers for bone metastasis of HCC. In addition, their identification facilitates the development of molecular markers to predict bone metastasis of HCC in high risk patients. Terminology Peptidomics, as a subset of proteomics, analyzes low molecular weight proteins (< 10 kda) or endogenous peptides from biological source. Peer review The study design and labor are well organized and should be admired. This work would be more attractive if the authors more clearly presented the advantages of these new biomarkers as compared with the current diagnostic strategy, such as CT, MRI, and PET-CT. REFERENCES 1 Morgan TR, Mandayam S, Jamal MM. Alcohol and hepatocellular carcinoma. Gastroenterology 2004; 127: S87-S96 [PMID: DOI: /j.gastro ] 2 He J, Zeng ZC, Tang ZY, Fan J, Zhou J, Zeng MS, Wang JH, Sun J, Chen B, Yang P, Pan BS. Clinical features and prognostic factors in patients with bone metastases from hepatocellular carcinoma receiving external beam radiotherapy. Cancer 2009; 115: [PMID: DOI: /cncr.24300] 3031 March 21, 2014 Volume 20 Issue 11

313 He J et al. Serum peptides predict HCC bone metastasis 3 He J, Zen ZC, Tang ZY. Radiotherapy for primary liver neoplasms with bone metastases and analysis of related prognostic factors. Tumor 2002; 22: Natsuizaka M, Omura T, Akaike T, Kuwata Y, Yamazaki K, Sato T, Karino Y, Toyota J, Suga T, Asaka M. Clinical features of hepatocellular carcinoma with extrahepatic metastases. J Gastroenterol Hepatol 2005; 20: [PMID: DOI: /j x] 5 Villanueva J, Shaffer DR, Philip J, Chaparro CA, Erdjument- Bromage H, Olshen AB, Fleisher M, Lilja H, Brogi E, Boyd J, Sanchez-Carbayo M, Holland EC, Cordon-Cardo C, Scher HI, Tempst P. Differential exoprotease activities confer tumor-specific serum peptidome patterns. J Clin Invest 2006; 116: [PMID: DOI: /JCI26022] 6 Hsieh CH, Wei MC, Lee HY, Hsiao SM, Chen CA, Wang LY, Hsieh YP, Tsai TH, Chen YJ, Shueng PW. Whole pelvic helical tomotherapy for locally advanced cervical cancer: technical implementation of IMRT with helical tomotherapy. Radiat Oncol 2009; 4: 62 [PMID: DOI: / X-4-62] 7 Nakamoto Y, Cohade C, Tatsumi M, Hammoud D, Wahl RL. CT appearance of bone metastases detected with FDG PET as part of the same PET/CT examination. Radiology 2005; 237: [PMID: DOI: /radiol ] 8 Colleoni M, O Neill A, Goldhirsch A, Gelber RD, Bonetti M, Thürlimann B, Price KN, Castiglione-Gertsch M, Coates AS, Lindtner J, Collins J, Senn HJ, Cavalli F, Forbes J, Gudgeon A, Simoncini E, Cortes-Funes H, Veronesi A, Fey M, Rudenstam CM. Identifying breast cancer patients at high risk for bone metastases. J Clin Oncol 2000; 18: [PMID: ] 9 Diel IJ, Solomayer EF, Costa SD, Gollan C, Goerner R, Wallwiener D, Kaufmann M, Bastert G. Reduction in new metastases in breast cancer with adjuvant clodronate treatment. N Engl J Med 1998; 339: [PMID: DOI: / NEJM ] 10 Hiratsuka S, Duda DG, Huang Y, Goel S, Sugiyama T, Nagasawa T, Fukumura D, Jain RK. C-X-C receptor type 4 promotes metastasis by activating p38 mitogen-activated protein kinase in myeloid differentiation antigen (Gr-1)-positive cells. Proc Natl Acad Sci USA 2011; 108: [PMID: DOI: /pnas ] 11 Anglicheau D, Suthanthiran M. Noninvasive prediction of organ graft rejection and outcome using gene expression patterns. Transplantation 2008; 86: [PMID: DOI: /TP.0b013e31817eef7b] 12 Hu J, Wang Z, Tan CJ, Liao BY, Zhang X, Xu M, Dai Z, Qiu SJ, Huang XW, Sun J, Sun QM, He YF, Song K, Pan Q, Wu Y, Fan J, Zhou J. Plasma microrna, a potential biomarker for acute rejection after liver transplantation. Transplantation 2013; 95: [PMID: DOI: /TP.0b013e d8] 13 Chen Y, Lin MC, Wang H, Chan CY, Jiang L, Ngai SM, Yu J, He ML, Shaw PC, Yew DT, Sung JJ, Kung HF. Proteomic analysis of EZH2 downstream target proteins in hepatocellular carcinoma. Proteomics 2007; 7: [PMID: DOI: /pmic ] 14 Ren P, Yu ZT, Xiu L, Wang M, Liu HM. Elevated serum levels of human relaxin-2 in patients with esophageal squamous cell carcinoma. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i ] 15 Su BB, Shi H, Wan J. Role of serum carcinoembryonic antigen in the detection of colorectal cancer before and after surgical resection. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 16 Cao XY, Jia ZF, Jin MS, Cao DH, Kong F, Suo J, Jiang J. Serum pepsinogen II is a better diagnostic marker in gastric cancer. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 17 Dong QM, Zhang JQ, Li Q, Bracher JC, Hendricks DT, Zhao XH. Clinical significance of serum expression of GROβ in esophageal squamous cell carcinoma. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 18 Melle C, Ernst G, Scheibner O, Kaufmann R, Schimmel B, Bleul A, Settmacher U, Hommann M, Claussen U, von Eggeling F. Identification of specific protein markers in microdissected hepatocellular carcinoma. J Proteome Res 2007; 6: [PMID: DOI: /pr060439b] 19 Yang MH, Tyan YC, Jong SB, Huang YF, Liao PC, Wang MC. Identification of human hepatocellular carcinoma-related proteins by proteomic approaches. Anal Bioanal Chem 2007; 388: [PMID: DOI: /s ] 20 Liu T, Xue R, Huang X, Zhang D, Dong L, Wu H, Shen X. Proteomic profiling of hepatitis B virus-related hepatocellular carcinoma with magnetic bead-based matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Acta Biochim Biophys Sin (Shanghai) 2011; 43: [PMID: DOI: /abbs/gmr044] 21 Orvisky E, Drake SK, Martin BM, Abdel-Hamid M, Ressom HW, Varghese RS, An Y, Saha D, Hortin GL, Loffredo CA, Goldman R. Enrichment of low molecular weight fraction of serum for MS analysis of peptides associated with hepatocellular carcinoma. Proteomics 2006; 6: [PMID: DOI: /pmic ] 22 Feng JT, Liu YK, Song HY, Dai Z, Qin LX, Almofti MR, Fang CY, Lu HJ, Yang PY, Tang ZY. Heat-shock protein 27: a potential biomarker for hepatocellular carcinoma identified by serum proteome analysis. Proteomics 2005; 5: [PMID: DOI: /pmic ] 23 Takashima M, Kuramitsu Y, Yokoyama Y, Iizuka N, Harada T, Fujimoto M, Sakaida I, Okita K, Oka M, Nakamura K. Proteomic analysis of autoantibodies in patients with hepatocellular carcinoma. Proteomics 2006; 6: [PMID: DOI: /pmic ] 24 Zinkin NT, Grall F, Bhaskar K, Otu HH, Spentzos D, Kalmowitz B, Wells M, Guerrero M, Asara JM, Libermann TA, Afdhal NH. Serum proteomics and biomarkers in hepatocellular carcinoma and chronic liver disease. Clin Cancer Res 2008; 14: [PMID: DOI: / ] 25 Kapp EA, Schütz F, Reid GE, Eddes JS, Moritz RL, O Hair RA, Speed TP, Simpson RJ. Mining a tandem mass spectrometry database to determine the trends and global factors influencing peptide fragmentation. Anal Chem 2003; 75: [PMID: DOI: /ac034616t] 26 Chen J, Anderson M, Misek DE, Simeone DM, Lubman DM. Characterization of apolipoprotein and apolipoprotein precursors in pancreatic cancer serum samples via two-dimensional liquid chromatography and mass spectrometry. J Chromatogr A 2007; 1162: [PMID: DOI: / j.chroma ] 27 Li XJ, Ong CK, Cao Y, Xiang YQ, Shao JY, Ooi A, Peng LX, Lu WH, Zhang Z, Petillo D, Qin L, Bao YN, Zheng FJ, Chia CS, Iyer NG, Kang TB, Zeng YX, Soo KC, Trent JM, Teh BT, Qian CN. Serglycin is a theranostic target in nasopharyngeal carcinoma that promotes metastasis. Cancer Res 2011; 71: [PMID: DOI: / ] 28 Koomen JM, Li D, Xiao LC, Liu TC, Coombes KR, Abbruzzese J, Kobayashi R. Direct tandem mass spectrometry reveals limitations in protein profiling experiments for plasma biomarker discovery. J Proteome Res 2005; 4: [PMID: DOI: /pr050046x] P- Reviewers: Kaplan DE, Tomizawa M S- Editor: Wen LL L- Editor: Wang TQ E- Editor: Liu XM 3032 March 21, 2014 Volume 20 Issue 11

314 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. SYSTEMATIC REVIEW Reappraisal of xenobiotic-induced, oxidative stress-mediated cellular injury in chronic pancreatitis: A systematic review Ajith K Siriwardena Ajith K Siriwardena, Hepatobiliary Surgery Unit, Manchester Royal Infirmary, Manchester M13 9WL, United Kingdom Author contributions: Siriwardena AK solely contributed to this paper. Correspondence to: Ajith K Siriwardena, MD, FRCS, Professor, Hepatobiliary Surgery Unit, Manchester Royal Infirmary, Oxford Road, Manchester M13 9WL, United Kingdom. ajith.siriwardena@cmft.nhs.uk Telephone: Fax: Received: September 19, 2013 Revised: November 5, 2013 Accepted: December 3, 2013 Published online: March 21, 2014 Abstract AIM: To reappraise the hypothesis of xenobiotic induced, cytochrome P450-mediated, micronutrient-deficient oxidative injury in chronic pancreatitis. METHODS: Individual searches of the Medline and Embase databases were conducted for each component of the theory of oxidative-stress mediated cellular injury for the period from 1 st January 1990 to 31 st December 2012 using appropriate medical subject headings. Boolean operators were used. The individual components were drawn from a recent update on theory of oxidative stress-mediated cellular injury in chronic pancreatitis. RESULTS: In relation to the association between exposure to volatile hydrocarbons and chronic pancreatitis the studies fail to adequately control for alcohol intake. Cytochrome P450 (CYP) induction occurs as a diffuse hepatic and extra-hepatic response to xenobiotic exposure rather than an acinar cell-specific process. GSH depletion is not consistently confirmed. There is good evidence of superoxide dismutase depletion in acute phases of injury but less to support a chronic intraacinar depletion. Although the liver is the principal site of CYP induction there is no evidence to suggest that oxidative by-products are carried in bile and reflux into the pancreatic duct to cause injury. CONCLUSION: Pancreatic acinar cell injury due to short-lived oxygen free radicals (generated by injury mediated by prematurely activated intra-acinar trypsin) is an important mechanism of cell damage in chronic pancreatitis. However, in contemporary paradigms of chronic pancreatitis this should be seen as one of a series of cell-injury mechanisms rather than a sole mediator Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Chronic pancreatitis; Cellular injury; Oxidative stress; Xenobiotics; Cytochrome P450 Core tip: This review systematically appraises the evidence for the key components of the hypothesis of environmental xenobiotic exposure leading to induction of the cytochrome P450 (CYP) system in the pancreatic acinar cell and in turn compromising the free radical quenching pathway in chronic pancreatitis. The central components of the hypothesis of xenobiotic-induced, micronutrient-deficient oxidative-stress mediated cell injury in chronic pancreatitis: xenobiotic exposure causing CYP induction, acinar CYP induction and hepatocyte mediated CYP by-products causing acinar injury by bile reflux do not withstand objective scrutiny. Siriwardena AK. Reappraisal of xenobiotic-induced, oxidative stress-mediated cellular injury in chronic pancreatitis: A systematic review. World J Gastroenterol 2014; 20(11): Available from: URL: v20/i11/3033.htm DOI: i March 21, 2014 Volume 20 Issue 11

315 Siriwardena AK. Oxidative stress and chronic pancreatitis INTRODUCTION The oxidative stress hypothesis proposed that cellular injury in chronic pancreatitis (CP) originated at the level of the acinar cell and was principally mediated by shortlived oxygen-derived free radicals [1]. The hypothesis stated that these oxygen-derived free radicals were produced as a result of an imbalance between the processes producing these agents and those involved in de-activating or quenching them [1]. The endogenous peptide glutathione- {(2S)-2-amino-4-{[(1R)-1-[(carboxymethyl) carbamoyl]- 2-sulfanylethyl] carbamoyl} butanoic acid} (GSH) is a central mediator in this model [2]. GSH is synthesized in the cytosol of all mammalian cells in a highly regulated manner [3]. The major determinants of GSH synthesis are the availability of cysteine and the activity of the ratelimiting enzyme, glutamate cysteine ligase (GCL) [3]. The sulfhydryl (thiol) group (SH) of cysteine serves as a proton donor and is responsible for the biological activity of glutathione [3]. The model for the aetiology and pathogenesis of chronic pancreatitis proposed by Braganza is multi-faceted and proposes that chronic exposure to xenobiotics, either through dietary imbalance, ingested toxins (such as alcohol) or inhaled toxins (such as volatile hydrocarbons) leads to chronic induction of both hepatic and pancreatic acinar cytochrome P450 (CYP) [1]. In the setting of chronic pancreatitis, CYP-mediated production of toxic metabolites then results in a disturbance of the equilibrium of endogenous oxidant quenching pathways and the resultant overwhelming of these pathways leads to unbalanced oxygen-free radical activity and acinar injury [4]. In their model, they propose that pancreatic acinar cells are susceptible to oxidant injury mediated by CYPgenerated oxidative metabolites as there is a dearth of glutathione transferase in these cells, very little copper superoxide dismutase (required for free radical scavenging) and that the pool of cysteine is small [1]. Evidence in support of this model came from the demonstration that patients with chronic pancreatitis had increased serum/plasma levels of free radical oxidation products but lower levels of precursor methionine, thiols and glutathione [5,6]. Further, there was evidence that the dietary intake of some patients with CP was deficient in selenium, methionine and vitamin C, key cofactors in these transulfuration pathways [7]. A logical completion of this paradigm was the development of antioxidant therapy - a pharmacological preparation containing methionine, vitamin C, vitamin E and selenium designed to restore these critical co-factors to patients with CP [5,6]. Following clinical evaluation in Manchester UK, antioxidant therapy was introduced into regular clinical practice in that city initiating a polarisation of practice in pancreatology and a long-running debate which remains on-going, with the central question being whether antioxidant therapy is effective for pain control in chronic pancreatitis [8]. Proponents argued that positive clinical trials continued to accrue from outside Manchester [9-11]. Opponents argued that the evidence-base remained small (Neoptolemos JP - personal communication). To address this problem, the Manchester group recently conducted and reported the largest randomized controlled trial of antioxidant therapy for treatment of pain in chronic pancreatitis - the ANTICIPATE study [12]. In this, 356 patients with CP were screened for eligibility, 92 randomised and 70 completed intervention with 6 mo of antioxidant therapy with antox version 1.2 (Pharmanord, Morpeth, United Kingdom) or matched placebo. Unique features of trial design were that the study focused exclusively on patients with radiological and clinical evidence of chronic pancreatitis but not solely on patients with end-stage disease. In keeping with modern trial design the study assessed treatment-related quality of life and both self-reported and clinician-assessed pain-related endpoints [13]. At the end of a 6 mo period of intervention with either drug or placebo there was no difference in the primary endpoint of abdominal pain assessed on an 11-point numerical rating scale with this finding being under-pinned by the absence of any difference in secondary endpoints of pain assessed by pain diaries or in quality of life assessed by validated questionnaires [12]. However, blood and plasma antioxidant levels were significantly elevated in patients in the antioxidant arm [12]. Although ANTICIPATE is the largest study of antox in chronic pancreatitis to date valid criticisms related to the inclusion of patients with prior pancreatic intervention and possibly also to the lack of screening for opiate addiction [14]. However, a striking finding is that the lack of benefit of antioxidant therapy seen in ANTICIPATE was also observed in patients with alcohol-related chronic pancreatitis in the large randomised trial from Delhi [15]. The Indian study used reduction in painful days as a primary endpoint and after 3 mo of intervention the mean difference between placebo and antioxidant groups was not significant for individuals with alcohol-induced chronic pancreatitis [15]. This clinical debate is likely to continue at least until the report of the currently ongoing EUROPAC study evaluating antox in hereditary and idiopathic chronic pancreatitis [16]. However, these studies change the landscape of clinical evidence and the aim of the present study is to undertake a re-appraisal of the validity of the hypothesis of xenobiotic induced, CYP-mediated, micronutrient deficient oxidative injury in chronic pancreatitis, to integrate this hypothesis into current paradigms of the aetiology and pathogenesis of chronic pancreatitis and to provide direction for any future clinical evaluation of antioxidant therapy in this complex disease. MATERIALS AND METHODS Literature search strategy The optimum structure for assessing the individual components of the oxidative stress hypothesis is to undertake a series of discrete searches. In order to do this, the components of the theory of oxidative-stress mediated cellular injury were isolated into the key elements proposed 3034 March 21, 2014 Volume 20 Issue 11

316 Siriwardena AK. Oxidative stress and chronic pancreatitis by its authors. These components were drawn from a recent update on theory of oxidative stress-mediated cellular injury in chronic pancreatitis [1] : (1) Evidence that the inhalational route of xenobiotic entry allows for a direct strike to the pancreas; (2) Evidence for acinar cell induction of cytochrome P450 (CYP) in chronic pancreatitis; (3) Evidence that glutathione transferase is deficient in acinar cells in chronic pancreatitis; (4) Evidence that copper superoxide dismutase is deficient in acinar cells in chronic pancreatitis; (5) Evidence that CYP induction in hepatocytes leads to exposure of pancreatic acinar cells to oxidative stress by-products in chronic pancreatitis; and (6) Evidence that exogenous (dietary or medicinal) supplementation with antioxidants has a modulating effect on pancreatic injury in experimental chronic pancreatitis. It is accepted that there may be other components or facets of the theory but the features which are actively promoted as being central to the hypothesis are listed above. For each individual component, a search of the Medline and Embase databases together with the web of knowledge SM was undertaken for the period from 1 st January 1990 to 31 st December 2012 using appropriate medical subject headings which are listed individually below. Boolean operators were used to ensure that variations in key words were captured in the searches. Searches were restricted to articles in the English language. Experimental evidence was included only in relation to the final category (evidence that exogenous supplementation with antioxidants modulates pancreatic injury). For all other categories, searches were restricted to clinical studies. Case reports, reviews, duplicate reports and papers not providing original data were not included. Abstracts of all papers identified in each search were reviewed and full papers of all potentially relevant articles were retrieved. Additional manuscripts were also identified from the bibliography of these reviewed papers. Data were extracted from the full paper by one individual. As the majority of the evidence is at the level of clinical case series, formal assessments for bias were not possible. Where there are potential sources of bias or distortion, these are individually highlighted. No pooling of data in the form of metaanalysis is undertaken in this study. Individual component searches Search 1: Inhalational xenobiotics and chronic pancreatitis: The search terms inhalational xenobiotics, xenobiotics, chronic pancreatitis and pancreatitis (All fields) yielded 26 articles. No additional articles were found after secondary searches using these words as topic headings in web of knowledge. After exclusion of reviews and articles relating to acute pancreatitis there were three studies which examined the association between xenobiotic exposure and chronic pancreatitis. Search 2: Acinar cell induction of cytochrome P450 and chronic pancreatitis: The search terms cytochrome P450 and chronic pancreatitis yielded 39 articles of which 34 were within the time limits of the search. The following were excluded: 9 reviews, 1 article on pancreatic cancer, 3 experimental studies, 4 on aspects unrelated to acinar cytochrome induction. No additional articles were found on secondary searches in web of knowledge using the topic terms cytochrome P450 and chronic pancreatitis. Search 3: Glutathione transferase deficiency and chronic pancreatitis: The search terms glutathione s-transferase and chronic pancreatitis yielded 19 articles in PubMed and 26 when used as topic terms in web of knowledge (the additional articles in web of knowledge related either to liver disease or to pancreatic cancer). Search 4: Copper superoxide dismutase deficiency and chronic pancreatitis: The search terms super oxide dismutase and chronic pancreatitis yielded 38 articles. Fourteen related to experimental studies, 3 to cancer and 2 to acute pancreatitis. Not all of the remaining 19 addressed the question of superoxide dismutase deficiency in chronic pancreatitis. When secondary searches were undertaken in web of knowledge no additional articles were found. Search 5: CYP induction in hepatocytes and exposure of pancreatic acinar cells to oxidative stress by-products: The search terms hepatocyte, cytochrome P450 and chronic pancreatitis yielded 3 articles. No additional articles were found by secondary searches in web of knowledge. Only one of these 3 articles addressed the relationship between hepatocyte-derived agents and chronic pancreatitis. Search 6: Antioxidant supplementation and modulation of pancreatic injury in experimental chronic pancreatitis: The terms antioxidant and experimental chronic pancreatitis were first assessed and yielded 34 articles in PubMed and 35 in web of knowledge. Examined in detail, the 34 citations in PubMed included 8 reviews, 8 studies on experimental acute pancreatitis, 5 studies on mechanism of disease in chronic pancreatitis, 4 clinical studies, 1 article in Russian and 1 on liver disease. The additional study identified in web of knowledge was retrieved and a total of 8 studies of various antioxidants or antioxidantlike interventions in experimental chronic pancreatitis were examined. Broader search criteria such as animal models of chronic pancreatitis yielded 332 articles including further intervention studies but it is not clear whether the interventions target oxidative injury and thus the more restrictive criteria were adopted for this study, accepting that not all relevant articles may have been captured. Clinical trials of antioxidant supplementation in chronic pancreatitis have not been included in this re-appraisal a they have been summarised extensively elsewhere [1,5-7,9-11]. RESULTS Evidence that the inhalational route of xenobiotic entry allows for a direct strike to the pancreas Occupational exposure to hydrocarbons was proposed 3035 March 21, 2014 Volume 20 Issue 11

317 Siriwardena AK. Oxidative stress and chronic pancreatitis as a risk factor for chronic pancreatitis with these compounds hypothesised as inducers of phase Ⅰ CYP 450 in the pancreas and liver. McNamee undertook a case control study comparing likely hydrocarbon exposure in 102 patients with chronic pancreatitis to 204 age and gendermatched reference cases [17]. This remains to date, the only study of its kind. The reference cases were selected as they lived in the same localities as the index cases and thus could be hypothesised to have similar environmental hydrocarbon exposure (although occupational exposure would potentially be different). A potential methodological limitation of the study is that it uses a previously unreported and unvalidated exposure to hydrocarbon score which categorises exposure into discrete groups: zero, low and high. The main findings were that 56 (55%) of cases and 81 (40%) of controls had a hydrocarbon exposure score of > zero. McNamee reported an OR for hydrocarbon exposure in cases with chronic pancreatitis compared to controls of 2.21 (90%CI: ). It should be noted that 48 (47%) of the cases consumed alcohol to excess ( 50 units per week for men, 35 units per week for women) compared to only 44 (22%) of the controls [17]. In a more modern study, Jeppe and Smith examined xenobiotic exposure in patients undergoing surgery for chronic pancreatitis in Johannesburg, South Africa [18]. Their findings are similar to those of McNamee. Although 86 (77%) of their 112 patients had been exposed to hydrocarbons in the form of burning firewood and coal, 104 (93%) consumed alcohol with 44 (39%) taking this daily [18]. Segal and colleagues demonstrated that alcohol intake was higher in 21 patients with alcoholic psychosis than 14 controls with chronic pancreatitis [19]. Patients with CP had higher scores for exposure to occupational xenobiotics than alcoholics. No causal relationship was demonstrated between hydrocarbon exposure and chronic pancreatitis. Evidence for acinar cell induction of CYP in chronic pancreatitis A mainstay of the original concept of oxidative stressmediated injury was a recognition that the pancreas was one of the extrahepatic sites of production of cytochrome P450 [1]. Chronic exposure to xenobiotics, either in the form of ingested toxins such as alcohol or inhaled volatile chemicals was hypothesised as leading to CYP induction. In turn, CYP metabolism led to the intra-acinar generation of toxic free radicals [1]. Braganza s group provided early evidence to substantiate this hypothesis in a study examining immunohistochemical patterns of expression of four phase Ⅰ drug-metabolizing enzymes (cytochromes P-450 ⅢA1, P-450 ⅡE, P-450 Ⅰ A2, and NADPH cytochrome P-450 reductase) and one phase Ⅱ enzyme [glutathione S-transferase (GST) 5-5] in normal donor pancreata and pancreatic tissue from six patients with chronic pancreatitis and a further six with pancreatic cancer [20]. They categorised their results according to those cytochromes were there was more than 50% increase in immunostaining compared to normal donors (on a 4 point scale from no stain to intense ). With respect to pancreatic acini, this increase was seen in CYP-450 Ⅲ A1, CYP-450 IA2 and NADPH P-450 reductase (Table 1). This phenomenon was not specific to the chronic pancreatitis patients but was also seen in pancreatic cancer and was also seen in hepatocytes and pancreatic islets. There was no functional correlate of this immunostaining. Wacke s study builds on these findings of cytochrome induction in specimens from patients with chronic pancreatitis by assessing the functional ability of microsomal fractions (containing 200 µg protein) from normal pancreata and chronic pancreatitis patients to undertake oxidative biotransformation of verapamil [21]. This study also shows increased immunostaining - both in terms of numbers of cells and also in terms of intensity for cytochrome P450 enzymes in tissues from chronic pancreatitis. There are differences between Foster s findings and those of Wacke which are attributed by the later authors to the different antibodies used as Foster s study used antibodies raised against rat liver whereas the later study used recombinant human antibodies. Wacke demonstrated increased verapamil biotransformation to norverapamil in microsomal fractions taken from chronic pancreatitis tissue [21]. Similar increases in pancreatic cytochrome P450 expression were shown in a separate study by Standop et al [22] although they showed more expression in islets than in pancreatic acinar cells. Over the last 20 years, there have been important progressions in knowledge of cytochrome P450 enzymes. Humans have 57 genes divided amongst 18 families of cytochrome P450 genes [23]. Fifteen human CYPS (all from the CYP1, CYP2 and CYP3 families) are known to be involved in xenobiotic metabolism, with a central role in phas Ⅰ drug metabolism [23]. In man, the principle members of the CYP1 family are CYP1A1, 1A2 and 1B1 [23]. Constitutive expression is very low but is inducible by exposure to aromatic hydrocarbons. The CYP2 family contribute to xenobiotic metabolism of drugs and alcohol. Current knowledge indicates that CYP 2E1 is predominantly responsible for alcohol metabolism [24]. The CYP3 family constitutes 3 members in humans and is predominantly involved in drug metabolism [25]. Current knowledge also includes awareness of transcriptional regulation of cytochrome P450 function, functional polymorphisms at CYP gene loci, potentially relevant knowledge of the propensity for acinar cells to trans-differentiate under certain conditions such as chronic glucocorticoid exposure to assume hepatocyte characteristics and evidence of substantial inter-species variation in expression patterns of these enzymes [26-29]. Consistent findings include the dominance of islet expression of cytochromes over acinar expression and the independence of CYP 450 signalling from regulation by cytosolic calcium [29-31]. Evidence that glutathione transferase is deficient in acinar cells in chronic pancreatitis GST family of enzymes are a diverse family of dimeric proteins found principally in the cytoplasm where they have a 3036 March 21, 2014 Volume 20 Issue 11

318 Siriwardena AK. Oxidative stress and chronic pancreatitis Table 1 Evidence for cytochrome induction in pancreatic acinar cells in chronic pancreatitis Ref. Cytochrome Method of assessment Histologic verification Increased expression in acinar cell Functional correlate Foster et al [20] CYP 3A1 Immunohistochemical staining > 50% No CYP 3A1 No CYP 2E of healthy donor CYP1A2 CYP1A2 NADPH NADPH Glutathione Wacke et al [21] CYP1A1 No of cases having high ratios Yes CYP1A1 2 Yes CYP1A2 compared to control CYP1A2 (verapamil biotransformation) CYP2C9 CYP2E1 CYP2E1 CYP 3A1 2 CYP3A1 Standop et al [22] CYP1A1, 2 Differences in frequency of Yes CYP1A No 2B6 immunopositivity between normal, CP CYP 2B6 2C 8/9/19 and cancer CYP 2C8/9/19 2D6 2D6 2.00E + 01 NA-OR 3A4 NA-OR 1 NADPH cytochrome P 450 reductase; 2 Expression similarly increased in normal non-diseased controls. CYP: Cytochrome P450; NA-OR: NADPH oxio reductase. central role in phase Ⅱ xenobiotic metabolism [32]. The oxidative stress hypothesis proposed that in contrast to induction of CYPs in chronic pancreatitis there was a reduction in acinar GSTs thus leading to failure of detoxification [1]. Ulrich et al [33] studied immunohistochemical staining for glutathione S-transferase-π (pi) in normal pancreata and chronic pancreatitis. There was no immunostaining in acinar cells from either normal pancreata or chronic pancreatitis [33]. In contrast, there was increased staining in the islets of patients with chronic pancreatitis compared to normal. From this evidence, the authors concluded that toxic substances have a role in the genesis of CP and suggest an important role of the islet cells in protecting the exocrine pancreas [33]. The mechanisms whereby increased islet GST protects pancreatic acinar cells is unclear. These authors then went on to examine whether the increased number of islet cells expressing GST-π and the absence in the acinar cells are compensated for by other GST iso-enzymes. They investigated the expression of GST-α and GST-µ in the same specimens and found no significant differences between normal and chronic pancreatitis. Foster s original study, which examined immunohistochemical expression of glutathione S-transferase 5-5 showed that staining was preserved in chronic pancreatitis as compared to normal [20]. Integrating this information into an increasingly complex picture, it seems difficult to argue a case for GST deficiency when the findings simply demonstrate that there was no difference in expression pattern between normal and chronic pancreatitis. Evidence that copper superoxide dismutase is deficient in acinar cells in chronic pancreatitis Superoxide dismutase (SOD) are enzymes that catalyze the dismutation of superoxide into oxygen and hydrogen peroxide and are important antioxidant mechanisms [34]. There are three major families of superoxide dismutase, depending on the metal cofactor: copper/zinc (Cu/Zn) (which binds both copper and zinc), Iron (Fe) and manganese (Mn) types (which bind either iron or manganese), and the Ni type, which binds nickel [34]. Intra-acinar deficiency of SOD was the fourth pillar of the hypothesis of oxidative stress-mediated cellular injury [1]. The evidence for this was from Hausmann s study which showed that although levels of Cu/Zn SOD were elevated in the pancreatic juice of patients with chronic pancreatitis, acinar levels detected by immunostaining were very low [35]. Milnerowicz conducted similar studies more recently but measured zinc, copper, metallothionein and Cu/Zn superoxide dismutase activity [34]. Elevated serum Cu levels together with a significant increase of Cu/Zn superoxide dismutase activity was observed in the blood of patients with chronic pancreatitis and chronic pancreatitis. In slices of the pancreas during pancreatitis, they observed variable immunohistochemical staining for Cu/Zn SOD [34]. Current knowledge of the genetics of superoxide dismutase acknowledge genetic variations in expression leading to variation in function [36]. Although relating to acute pancreatitis, Abu-Hilal et al [37] demonstrated that the erythrocyte content of superoxide dismutase was reduced during the clinical course of acute pancreatitis [37]. In an experimental model, superoxide dismutase knockout (SOD -/-) resulted in mice that were more susceptible to cerulein-induced pancreatic injury [38]. Finally, in an elegant study (again in experimental acute pancreatitis) Cuzzocrea et al [39] demonstrated that intervention with a superoxide dismutase mimetic M40401, attenuated pancreatic and remote organ injury. Evidence that CYP induction in hepatocytes leads to exposure of pancreatic acinar cells to oxidative stress by-products in chronic pancreatitis Xenobiotic exposure at the hepatocyte level leads to in March 21, 2014 Volume 20 Issue 11

319 Siriwardena AK. Oxidative stress and chronic pancreatitis duction of phase Ⅰ cytochrome P450 xenobiotic-metabolising enzymes. As the hepatocytes are quantitatively the predominant source of CYP 450 in man, Braganza proposed that their oxidant by-products may contribute to pancreatic injury by passage along the bile duct and reflux into the pancreatic duct. This theory led to the highly idiosyncratic operation of bile duct ligation to divert bile in patients with chronic pancreatitis [40]. Even 20 years after these operations, it is of concern that the report makes no mention of any institutional or regional ethics review prior to subjecting these patients to surgery. In the two patients reported in this index study, attacks of pancreatic pain continued after the surgery. There is little doubt that biliary diversion in man has no role to play in modulating episodes of pancreatic pain in chronic pancreatitis. Evidence that exogenous (dietary or medicinal) supplementation with antioxidants has a modulating effect on pancreatic injury in experimental chronic pancreatitis The difficulty in assessing the effect of antioxidant intervention in experimental chronic pancreatitis lies partly in the difficulty of reproducing this disease in animal models [41]. In particular, there has historically been a dearth of reproducible models of visceral pain in chronic pancreatitis [42]. These difficulties are reflected in the heterogeneity of animal models of chronic pancreatitis (Table 2). Gómez et al [43] used cyclosporin A to transform the acute pancreatic injury produced by caerulein injection to a more chronic form characterised by acinar loss and fibrosis. Oxidative stress was present in this model as measured by increased levels of thiobarbituric acid-reactive substance and 8-isoprostanes after induction of pancreatitis. There was also increased fibrosis as measured by an increase in transforming growth factor-β (TGF-β). This combination of inflammation and fibrosis is regarded as a mimic for human chronic pancreatitis. Intervention with vitamin E reduced lipoperoxidation, TGF-β bioactivity and increased myofibroblast apoptosis leading to a reduction in pancreatic injury and fibrosis [43]. Yoo et al [44] reported similar improvements in a murine chronic pancreatitis model following intervention with DA-9601, a novel phytochemical agent. de Las Heras- Castaño et al [45] also used the rat caerulein/cyclosporine model and demonstrated that intervention with compound antioxidant therapy similar to the combinations used in clinical practice was associated with a reduction in pancreatic fibrosis and reduction in glutathione peroxidase but no difference in antioxidant status. Mas et al [46] reported that taurine reduced pancreatic fibrosis in a model of CP produced by intraductal infusion of TNBS and concluded that Antioxidant treatment might be considered a novel option to alleviate the fibrotic process in CP. Other interventions associated with a favourable outcome in the treatment group compared to animals with experimental chronic pancreatitis include ascorbic acid [47], pravastatin [48], α-tocopherol [49,50] and taurine [51]. Difficulties in interpreting these studies are that the effects of many of the intervention agents are pleomorphic with antioxidant, anti-inflammatory and anti-fibrotic properties. Table 2 also illustrates the relatively short time course of these models and the difficulties inherent in extrapolating to the clinical setting. An overview would suggest that experimental antioxidant-type interventions are able to target pancreatic inflammatory pathways and modulate pancreatic injury. DISCUSSION This study undertakes a re-appraisal of the evidence for the hypothesis of xenobiotic-induced, micronutrient deficient, oxidative stress-mediated cellular injury in chronic pancreatitis. This reassessment is timely in light of the difference in findings between the ANTICIPATE study of antox in chronic pancreatitis and the earlier study from India. Although these differences have been carefully and critically examined [52], the underlying hypothesis has not been critically re-appraised since its introduction in the 1980s. Thus before any further studies of antioxidant therapy are undertaken it is necessary to re-assess the hypothesis and in particular to integrate this model into contemporary paradigms of chronic pancreatitis. Two important areas of potential bias should be considered. First, it is accepted that the narrative structure of the review could be regarded as a potential limitation as manuscript inclusion and exclusion could be subject to unreported bias. However, this is style of review is necessary given the relatively limited volume of evidence and the fact that many of the key articles are over 30 years old. It is thought that all major evidence has been cited. A second potential bias that should be discussed revolves around the antagonistic interpretation often generated by this hypothesis. Specifically, would an article from the current Manchester group adopt a biased stance? It should be remembered that the current group conducted the ANTICIPATE study which is the largest intervention trial of antox-based antioxidant therapy in chronic pancreatitis. The group have credibility in design and execution of balanced clinical trials in this area [53] but equally need to undertake due diligence in appraising the evidence in a constructive fashion before embarking on further clinical trials [54]. Interpreting the results bearing these potential limitations in mind, the first element of the hypothesis to consider is that of a causal association between exposure to inhalational xenobiotics and chronic pancreatitis [1]. Several important facts emerge. First, it is clear that there are few studies to examine this question. Second, the types of volatile hydrocarbon (if any) associated with pancreatic injury are unclear. Third, the key finding is that the studies fail to adequately control for alcohol intake. For example, in the McNamee study 48 (47%) of the cases consumed alcohol to excess ( 50 units for men, 35 units for women) compared to only 44 (22%) of the controls [17]. For sake of balance, it should be pointed out that in a review, Braganza et al [55] cited several instances 3038 March 21, 2014 Volume 20 Issue 11

320 Siriwardena AK. Oxidative stress and chronic pancreatitis Table 2 Interventions with evidence of modulation of experimental chronic pancreatitis First Author Animal Model of CP Intervention Modes of action Time course and Pancreatic parenchymal endpoints point of intervention Systemic endpoints Gómez et al [43] Rat ip cyclosporine A and ip caerulein Vitamin E (gavage) Anti-oxidant properties: control oxidative radicals Anti-oxidant independent properties: reduction of fibrosis Yoo et al [44] Mouse ip caerulein DA 9601 Phytochemical possessing antiinflammatory and antioxidative action de Las Heras- Rat ip cyclosporin Castaño et al [45] A and ip caerulein Mas et al [46] Rat Intraductal TNBS L-methionine β-carotene ascorbic acid α-tocopherol selenium 15 d study Reduced peroxidation (TBARS level) Intervention day 8 Reduced collagen and hyaluronic acid deposition Reduced acinar atrophy and periductal fibrosis Reduced plasma lipoperoxidation. Reduced plasma TGF-β 35 d Reduced pancreatic fibrosis None Intervention weekly from week 1 Myeloperoxidase and inos activities decreased HSP-70 increased Antioxidant 49 d Reduction in pancreatic fibrosis Intervention weekly from week 1 Similar cellular glutathione peroxidase levels to control and less than caerulein alone group Increased total antioxidant status but also increased in caerulein alone group Taurine Anti-fibrotic 28 d Tissue malondialdehyde levels increased Intervention weekly from week 1 SOD and glutathione peroxidase activities decreased Histopathologic injury scores lower Lu et al [47] Rat DBTC Ascorbic acid Antioxidant 56 d Increased SOD and reduce infusion 1 malondialdehyde Wei et al [48] Rat PD infusion of pancreatic juice/bile (PD hypertension) Li et al [49] Rat Intraductal TNBS Pravastatin 10 mg/kg per day Jiang et al [50] Rat DBTC α-tocopherol and tocotrienolrich fraction Competitive inhibition of 3-hydroxy-3- methylglutarylcoenzyme A reductase Intervention weekly from day 28 No change in pancreatic fibrosis Less atrophy 14 d Maintained secretinstimulated secretory response Intervention from day 2 Attenuated fibrosis with less expression of TGF-β mrna Maintained pancreatic exocrine function α-tocopherol Antifibrotic 28 d Reduced incidence of pseudocysts from 100% to 69% Intervention daily Ameliorates pancreatic fibrosis Antioxidant and antifibrotic 28 d Reduced pancreatic inflammation and fibrosis Intervention daily (oral) Down-regulated mrna expression of TGF-β1 and collagen-α1 Matsushita et al [51] Rat DBTC Taurine Antifibrotic 28 d Inhibition of pancreatic fibrosis Intervention day 0 Decreased apoptotic index None Reduction in weight loss Reduce serum hyaluronic acid Amelioration of weight loss Amelioration of weight loss None None 1 Dibutylin dichloride (DBTC) given by infusion into tail vein. TBARS: Thiobarbituric acid-reactive substance; TGF-β: Transforming growth factor beta; inos: Inducible nitric oxide synthase; HSP: Heat shock protein; TNBS: Trinitrobenzene sulfonic acid; SOD: Superoxide dismutase; PD: Pancreatic duct. of patients with pain related to exposure to occupational hydrocarbons whose symptoms settled on avoidance but returned on re-exposure. At the least, these findings require independent, large scale validation using a validated hydrocarbon exposure score and carefully controlling for other factors such as alcohol intake before acceptance. The available evidence does not support a conclusion that xenobiotic exposure by itself should continue to be regarded as a risk factor for chronic pancreatitis. The second element of the hypothesis is that of pancreatic cytochrome induction [1]. Integrating the findings into a modern framework there is good evidence that CYP induction occurs as a diffuse hepatic and extrahepatic response to xenobiotic exposure. However, there is little evidence to support the hypothesis of preferential acinar cell CYP induction. CYP expression in the pancre March 21, 2014 Volume 20 Issue 11

321 Siriwardena AK. Oxidative stress and chronic pancreatitis atic acinar cell is quantitatively small (although the resistance of acinar cells to phase Ⅰ metabolites is unknown) and the contemporaneous evidence from the three immunohistochemistry studies of preferential expression relates principally to islets [20-22]. To take a balanced view the link between intra-pancreatic CYP induction and acinar injury should be regarded as an association with no evidence that the former is causatively linked to chronic pancreatitis. The third element of the hypothesis relates to intraacinar depletion of GSH [1]. The findings of the review show evidence of increased islet expression of GSH and that the original study by Foster et al [20] showed that immunostaining for GSH was preserved in chronic pancreatitis tissue. Integrating this evidence into modern concepts, it is likely that endogenous cell-defence pathways are compromised during the injury phases of chronic pancreatitis but there is little evidence to suggest that the GSH transulfuration pathway is uniquely important in this process. The fourth element of the hypothesis is intra-acinar superoxide dismutase deficiency [1]. There is good evidence of SOD depletion in acute phases of injury but less to support a chronic intra-acinar depletion. Integrating current knowledge into the oxidative stress injury hypothesis would suggest that although superoxide dismutase biology is more complex than previously thought, intra-acinar deficiency of quenching activity may play a part in cellular injury in chronic pancreatitis. The fifth element is that CYP induction in hepatocytes leads to exposure of pancreatic acinar cells to oxidative stress by-products by reflux of bile into the pancreatic duct [1]. Although the liver is the principal site of CYP induction there is no evidence to suggest that oxidative by-products are carried in bile and reflux into the pancreatic duct to cause injury. Finally, in relation to experimental chronic pancreatitis, there is evidence of antioxidant modulation of pancreatic injury: tocotrienol supplementation reduced pancreatic inflammatory gene expression in an experimental rat model of chronic pancreatitis [56]. Other interventions associated with modulation of the disease course of experimental chronic pancreatitis are seen in Table 2. It is difficult and possibly inappropriate to attempt to synthesise a single common pathway of action for these agents. In acute pancreatitis, many interventions are effective in experimental models but none translate to a clinical setting and these limitations may also apply in relation to experimental chronic pancreatitis [57]. In particular, although these experimental studies suggest that exogenous supplementation with compounds with antioxidant properties may modify pancreatic injury, there is insufficient evidence to extrapolate these findings to the clinical setting [57]. To integrate these findings into modern paradigms of chronic pancreatitis, the epidemiology of chronic pancreatitis suggests a complex disease, predominantly associated with prolonged, heavy consumption of alcohol but also associated with several other causes [58,59]. Populationbased registries have allowed for better definition of the incidence of the disease and this process of identification has occurred in the latter half of the twentieth century [60,61]. To seek an association between this process of better definition of disease and hydrocarbon exposure in industrialised countries is tempting but the available literature does not support a causal association between xenobiotic exposure and pancreatic acinar injury in chronic pancreatitis. The cationic trypsinogen codon 122 R122H mutation was the first mutation clearly associated with chronic (and acute) pancreatitis [62]. The cationic trypsinogen R122H mutation is a gain of function mutation as it prevents trypsin inactivation [63]. Early and inappropriate intra-acinar trypsin activation is now recognised as an important proximal pathway step in chronic pancreatitis [64]. Other mutations including those at the serin protease inhibitor Kazal type Ⅰ/pancreatic secretory trypsin inhibitor Ⅰ (SPINK1/ PT1) mutation are also associated with chronic pancreatitis [65] and it is now understood that in genetic terms CP is a complex and heterogeneous disease. Pancreatic injury in CP is characterised by fibrosis and the role of the extracellular matrix and pancreatic stellate cells in mediating this component of injury is now better recognised [66]. Similarly, alterations in the composition of pancreatic nerves, neurotransmitters and the concept of neural remodelling [67] together with alterations in central nervous system perceptions of pain [68] are now recognised to be important component of the perception of pain in this disease. In conclusion, pancreatic acinar cell injury due to short-lived oxygen free radicals (generated by injury mediated by prematurely activated intra-acinar trypsin) is an important mechanism of cell damage in chronic pancreatitis. However, this should be seen as one of a series of cell-injury mechanisms rather than as a sole mediator. The central components of the hypothesis of xenobiotic-induced, micronutrient-deficient oxidative-stress mediated cell injury in chronic pancreatitis: xenobiotic exposure causing CYP induction, acinar CYP induction and hepatocyte mediated CYP by-products causing acinar injury by bile reflux do not withstand objective scrutiny. This view is essentially mirrored by the low use of antioxidant therapy in terms of non-analgesic medication for chronic pancreatitis [69]. In terms of the cost and ethical considerations around subjecting vulnerable patients to further trials, current clinical evidence would argue strongly against efficacy of exogenous antioxidant therapy in alcohol-related chronic pancreatitis. Although there may be options for evaluation in non-alcohol related disease the central tenets of the hypothesis are insufficiently strong even to justify this. Rationally, it is time to end the on-going debate about antioxidant therapy in chronic pancreatitis and to look for alternative truly effective interventions for patients with this dreadful disease. COMMENTS Background This study undertakes a systematic appraisal of the validity of the hypothesis of 3040 March 21, 2014 Volume 20 Issue 11

322 Siriwardena AK. Oxidative stress and chronic pancreatitis xenobiotic-induced, micronutrient-deficient, oxidative-stress mediated cellular injury in chronic pancreatitis. Research frontiers This is the first modern systematic appraisal of the validity of this hypothesis. The study also sets the available evidence in the context of current knowledge of the pathobiology of chronic pancreatitis. Innovations and breakthroughs Insight gleaned from this review is not innovative but questions the validity of the concept of xenobiotic exposure and subsequent cytochrome P450 induction in the aetiology of chronic pancreatitis. Applications The weakness of this hypothesis explains the negative results of the betterdesigned and executed studies of antioxidant therapy in chronic pancreatitis. Terminology Current terminology on chronic pancreatitis is utilised throughout. Peer review The authors reviewed the related researches and discussed the rationality of it, especially the necessary of antioxidants medication. This is an interesting review on pathogenesis of chronic pancreatitis. REFERENCES 1 Braganza JM, Dormandy TL. Micronutrient therapy for chronic pancreatitis: rationale and impact. JOP 2010; 11: [PMID: ] 2 Wallig MA. Xenobiotic metabolism, oxidant stress and chronic pancreatitis. Focus on glutathione. Digestion 1998; 59 Suppl 4: [PMID: DOI: / ] 3 Lu SC. Regulation of glutathione synthesis. Mol Aspects Med 2009; 30: [PMID: DOI: /j.mam ] 4 Guyan PM, Uden S, Braganza JM. Heightened free radical activity in pancreatitis. Free Radic Biol Med 1990; 8: [PMID: DOI: / (90)90100-W] 5 Uden S, Bilton D, Nathan L, Hunt LP, Main C, Braganza JM. Antioxidant therapy for recurrent pancreatitis: placebo-controlled trial. Aliment Pharmacol Ther 1990; 4: [PMID: DOI: /j tb00482.x] 6 Uden S, Schofield D, Miller PF, Day JP, Bottiglier T, Braganza JM. Antioxidant therapy for recurrent pancreatitis: biochemical profiles in a placebo-controlled trial. Aliment Pharmacol Ther 1992; 6: [PMID: DOI: /j tb00266.x] 7 Segal I. Pancreatitis in Soweto, South Africa. Focus on alcohol-related disease. Digestion 1998; 59 Suppl 4: [PMID: DOI: / ] 8 McCloy R. Chronic pancreatitis at Manchester, UK. Focus on antioxidant therapy. Digestion 1998; 59 Suppl 4: [PMID: DOI: / ] 9 De las Heras Castaño G, García de la Paz A, Fernández MD, Fernández Forcelledo JL. Use of antioxidants to treat pain in chronic pancreatitis. Rev Esp Enferm Dig 2000; 92: [PMID: ] 10 Uomo G, Talamini G, Rabitti PG. Antioxidant treatment in hereditary pancreatitis. A pilot study on three young patients. Dig Liver Dis 2001; 33: [PMID: DOI: /S (01) ] 11 Kirk GR, White JS, McKie L, Stevenson M, Young I, Clements WD, Rowlands BJ. Combined antioxidant therapy reduces pain and improves quality of life in chronic pancreatitis. J Gastrointest Surg 2006; 10: [PMID: DOI: /j.gassur ] 12 Siriwardena AK, Mason JM, Sheen AJ, Makin AJ, Shah NS. Antioxidant therapy does not reduce pain in patients with chronic pancreatitis: the ANTICIPATE study. Gastroenterology 2012; 143: e1 [PMID: DOI: / j.gastro ] 13 Fitzsimmons D, Kahl S, Butturini G, van Wyk M, Bornman P, Bassi C, Malfertheiner P, George SL, Johnson CD. Symptoms and quality of life in chronic pancreatitis assessed by structured interview and the EORTC QLQ-C30 and QLQ-PAN26. Am J Gastroenterol 2005; 100: [PMID: DOI: /j x] 14 Braganza JM. Limitations of patient selection and other issues in chronic pancreatitis antioxidant trial. Gastroenterology 2013; 144: e17-e18 [PMID: DOI: / j.gastro ] 15 Bhardwaj P, Garg PK, Maulik SK, Saraya A, Tandon RK, Acharya SK. A randomized controlled trial of antioxidant supplementation for pain relief in patients with chronic pancreatitis. Gastroenterology 2009; 136: e2 [PMID: DOI: /j.gastro ] 16 EUROPAC. The European Registry of hereditary pancreatitis and familial pancreatic cancer. Available from: URL: 17 McNamee R, Braganza JM, Hogg J, Leck I, Rose P, Cherry NM. Occupational exposure to hydrocarbons and chronic pancreatitis: a case-referent study. Occup Environ Med 1994; 51: [PMID: DOI: /oem ] 18 Jeppe CY, Smith MD. Transversal descriptive study of xenobiotic exposures in patients with chronic pancreatitis and pancreatic cancer. JOP 2008; 9: [PMID: ] 19 Segal I, Ally R, Hunt LP, Sandle LN, Ubbink JB, Braganza JM. Insights into the development of alcoholic chronic pancreatitis at Soweto, South Africa: a controlled cross-sectional study. Pancreas 2011; 40: [PMID: DOI: /MPA.0b013e318214f94a] 20 Foster JR, Idle JR, Hardwick JP, Bars R, Scott P, Braganza JM. Induction of drug-metabolizing enzymes in human pancreatic cancer and chronic pancreatitis. J Pathol 1993; 169: [PMID: DOI: /path ] 21 Wacke R, Kirchner A, Prall F, Nizze H, Schmidt W, Fischer U, Nitschke FP, Adam U, Fritz P, Belloc C, Drewelow B. Upregulation of cytochrome P450 1A2, 2C9, and 2E1 in chronic pancreatitis. Pancreas 1998; 16: [PMID: DOI: / ] 22 Standop J, Schneider M, Ulrich A, Büchler MW, Pour PM. Differences in immunohistochemical expression of xenobiotic-metabolizing enzymes between normal pancreas, chronic pancreatitis and pancreatic cancer. Toxicol Pathol 2003; 31: [PMID: ] 23 Pavek P, Dvorak Z. Xenobiotic-induced transcriptional regulation of xenobiotic metabolizing enzymes of the cytochrome P450 superfamily in human extrahepatic tissues. Curr Drug Metab 2008; 9: [PMID: DOI: / ] 24 Apte MV, Pirola RC, Wilson JS. Mechanisms of alcoholic pancreatitis. J Gastroenterol Hepatol 2010; 25: [PMID: DOI: / ] 25 Nelson DR. The cytochrome p450 homepage. Hum Genomics 2009; 4: [PMID: ] 26 Zordoky BN, El-Kadi AO. Role of NF-kappaB in the regulation of cytochrome P450 enzymes. Curr Drug Metab 2009; 10: [PMID: DOI: / ] 27 Burim RV, Canalle R, Martinelli Ade L, Takahashi CS. Polymorphisms in glutathione S-transferases GSTM1, GSTT1 and GSTP1 and cytochromes P450 CYP2E1 and CYP1A1 and susceptibility to cirrhosis or pancreatitis in alcoholics. Mutagenesis 2004; 19: [PMID: DOI: /mutage/geh034] 28 Wallace K, Marek CJ, Currie RA, Wright MC. Exocrine pancreas trans-differentiation to hepatocytes--a physiological response to elevated glucocorticoid in vivo. J Steroid Biochem Mol Biol 2009; 116: [PMID: DOI: / j.jsbmb ] 29 Ulrich AB, Standop J, Schmied BM, Schneider MB, Lawson TA, Pour PM. Species differences in the distribution of drugmetabolizing enzymes in the pancreas. Toxicol Pathol 2002; 30: [PMID: DOI: / March 21, 2014 Volume 20 Issue 11

323 Siriwardena AK. Oxidative stress and chronic pancreatitis 588] 30 Bruce JI, Elliott AC. Pharmacological evaluation of the role of cytochrome P450 in intracellular calcium signalling in rat pancreatic acinar cells. Br J Pharmacol 2000; 131: [PMID: DOI: /sj.bjp ] 31 Mankad P, James A, Siriwardena AK, Elliott AC, Bruce JI. Insulin protects pancreatic acinar cells from cytosolic calcium overload and inhibition of plasma membrane calcium pump. J Biol Chem 2012; 287: [PMID: DOI: /jbc.M ] 32 Hayes JD, Pulford DJ. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 1995; 30: [PMID: DOI: / ] 33 Ulrich AB, Schmied BM, Matsuzaki H, Lawson TA, Friess H, Andrén-Sandberg A, Büchler MW, Pour PM. Increased expression of glutathione S-transferase-pi in the islets of patients with primary chronic pancreatitis but not secondary chronic pancreatitis. Pancreas 2001; 22: [PMID: DOI: / ] 34 Milnerowicz H, Jabłonowska M, Bizoń A. Change of zinc, copper, and metallothionein concentrations and the copperzinc superoxide dismutase activity in patients with pancreatitis. Pancreas 2009; 38: [PMID: DOI: /MPA.0b013e3181a53d1] 35 Hausmann DH, Porstmann T, Weber I, Hausmann S, Dummler W, Liebe S, Emmrich J. Cu/Zn-SOD in human pancreatic tissue and pancreatic juice. Int J Pancreatol 1997; 22: [PMID: ] 36 Rahman SH, Nanny C, Ibrahim K, O Reilly D, Larvin M, Kingsnorth AJ, McMahon MJ. Genetic polymorphisms of GSTT1, GSTM1, GSTP1, MnSOD, and catalase in nonhereditary chronic pancreatitis: evidence of xenobiotic stress and impaired antioxidant capacity. Dig Dis Sci 2005; 50: [PMID: DOI: /s ] 37 Abu-Hilal M, McPhail MJ, Marchand L, Johnson CD. Malondialdehyde and superoxide dismutase as potential markers of severity in acute pancreatitis. JOP 2006; 7: [PMID: ] 38 Wang X, Vatamaniuk MZ, Roneker CA, Pepper MP, Hu LG, Simmons RA, Lei XG. Knockouts of SOD1 and GPX1 exert different impacts on murine islet function and pancreatic integrity. Antioxid Redox Signal 2011; 14: [PMID: DOI: /ars ] 39 Cuzzocrea S, Genovese T, Mazzon E, Di Paola R, Muià C, Britti D, Salvemini D. Reduction in the development of cerulein-induced acute pancreatitis by treatment with M40401, a new selective superoxide dismutase mimetic. Shock 2004; 22: [PMID: DOI: /01.shk ] 40 Sandilands D, Jeffrey IJ, Haboubi NY, MacLennan IA, Braganza JM. Abnormal drug metabolism in chronic pancreatitis. Treatment with antioxidants. Gastroenterology 1990; 98: [PMID: ] 41 Aghdassi AA, Mayerle J, Christochowitz S, Weiss FU, Sendler M, Lerch MM. Animal models for investigating chronic pancreatitis. Fibrogenesis Tissue Repair 2011; 4: 26 [PMID: ] 42 Westlund KN, Vera-Portocarrero L. Rat models of pancreatitis pain. Methods Mol Biol 2012; 851: [PMID: DOI: / _17] 43 Gómez JA, Molero X, Vaquero E, Alonso A, Salas A, Malagelada JR. Vitamin E attenuates biochemical and morphological features associated with development of chronic pancreatitis. Am J Physiol Gastrointest Liver Physiol 2004; 287: G162-G169 [PMID: DOI: /ajpgi ] 44 Yoo BM, Oh TY, Kim YB, Yeo M, Lee JS, Surh YJ, Ahn BO, Kim WH, Sohn S, Kim JH, Hahm KB. Novel antioxidant ameliorates the fibrosis and inflammation of cerulein-induced chronic pancreatitis in a mouse model. Pancreatology 2005; 5: [PMID: DOI: / ] 45 de Las Heras-Castaño G, García-Unzueta MT, Domínguez- Diez A, Fernández-González MD, García-de la Paz AM, Mayorga-Fernández M, Fernández-Fernández F. Pancreatic fibrosis in rats and its response to antioxidant treatment. JOP 2005; 6: [PMID: ] 46 Mas MR, Isik AT, Yamanel L, Inal V, Tasci I, Deveci S, Mas N, Comert B, Akay C. Antioxidant treatment with taurine ameliorates chronic pancreatitis in an experimental rat model. Pancreas 2006; 33: [PMID: DOI: /01. mpa ] 47 Lu XL, Song YH, Fu YB, Si JM, Qian KD. Ascorbic acid alleviates pancreatic damage induced by dibutyltin dichloride (DBTC) in rats. Yonsei Med J 2007; 48: [PMID: DOI: /ymj ] 48 Wei L, Yamamoto M, Harada M, Otsuki M. Treatment with pravastatin attenuates progression of chronic pancreatitis in rat. Lab Invest 2011; 91: [PMID: DOI: /labinvest ] 49 Li XC, Lu XL, Chen HH. α-tocopherol treatment ameliorates chronic pancreatitis in an experimental rat model induced by trinitrobenzene sulfonic acid. Pancreatology 2011; 11: 5-11 [PMID: DOI: / ] 50 Jiang F, Liao Z, Hu LH, Du YQ, Man XH, Gu JJ, Gao J, Gong YF, Li ZS. Comparison of antioxidative and antifibrotic effects of α-tocopherol with those of tocotrienol-rich fraction in a rat model of chronic pancreatitis. Pancreas 2011; 40: [PMID: DOI: /MPA.0b013e31821b59c6] 51 Matsushita K, Mizushima T, Shirahige A, Tanioka H, Sawa K, Ochi K, Tanimoto M, Koide N. Effect of taurine on acinar cell apoptosis and pancreatic fibrosis in dibutyltin dichlorideinduced chronic pancreatitis. Acta Med Okayama 2012; 66: [PMID: ] 52 Forsmark CE, Liddle RA. The challenging task of treating painful chronic pancreatitis. Gastroenterology 2012; 143: [PMID: DOI: /j.gastro ] 53 Mason J, Siriwardena AK. Designing future clinical trials in acute pancreatitis. Pancreatology 2005; 5: [PMID: DOI: / ] 54 National Information Center on Health Services Research and Health Care Technology (NICHSR). HTA 101: V. AP- PRAISING THE EVIDENCE. Accessed 7th May Available from: URL: ta10107.html 55 Braganza JM, Jolley JE, Lee WR. Occupational chemicals and pancreatitis: a link? Int J Pancreatol 1986; 1: 9-19 [PMID: ] 56 González AM, Garcia T, Samper E, Rickmann M, Vaquero EC, Molero X. Assessment of the protective effects of oral tocotrienols in arginine chronic-like pancreatitis. Am J Physiol Gastrointest Liver Physiol 2011; 301: G846-G855 [PMID: DOI: /ajpgi ] 57 Hackert T, Werner J. Antioxidant therapy in acute pancreatitis: experimental and clinical evidence. Antioxid Redox Signal 2011; 15: [PMID: DOI: / ars ] 58 Yadav D, Lowenfels AB. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro ] 59 Hirota M, Shimosegawa T, Masamune A, Kikuta K, Kume K, Hamada S, Kihara Y, Satoh A, Kimura K, Tsuji I, Kuriyama S. The sixth nationwide epidemiological survey of chronic pancreatitis in Japan. Pancreatology 2012; 12: [PMID: DOI: /j.pan ] 60 Lankisch PG, Assmus C, Maisonneuve P, Lowenfels AB. Epidemiology of pancreatic diseases in Lüneburg County. A study in a defined german population. Pancreatology 2002; 2: [PMID: DOI: / ] 61 Johnson CD, Hosking S. National statistics for diet, alcohol consumption, and chronic pancreatitis in England and Wales, Gut 1991; 32: [PMID: DOI: 3042 March 21, 2014 Volume 20 Issue 11

324 Siriwardena AK. Oxidative stress and chronic pancreatitis /gut ] 62 Whitcomb DC, Gorry MC, Preston RA, Furey W, Sossenheimer MJ, Ulrich CD, Martin SP, Gates LK, Amann ST, Toskes PP, Liddle R, McGrath K, Uomo G, Post JC, Ehrlich GD. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996; 14: [PMID: DOI: /ng ] 63 LaRusch J, Whitcomb DC. Genetics of pancreatitis. Curr Opin Gastroenterol 2011; 27: [PMID: DOI: /MOG.0b013e328349e2f8] 64 Whitcomb DC. Genetic aspects of pancreatitis. Annu Rev Med 2010; 61: [PMID: DOI: /annurev.med ] 65 Whitcomb DC, LaRusch J, Krasinskas AM, Klei L, Smith JP, Brand RE, Neoptolemos JP, Lerch MM, Tector M, Sandhu BS, Guda NM, Orlichenko L, Alkaade S, Amann ST, Anderson MA, Baillie J, Banks PA, Conwell D, Coté GA, Cotton PB, DiSario J, Farrer LA, Forsmark CE, Johnstone M, Gardner TB, Gelrud A, Greenhalf W, Haines JL, Hartman DJ, Hawes RA, Lawrence C, Lewis M, Mayerle J, Mayeux R, Melhem NM, Money ME, Muniraj T, Papachristou GI, Pericak-Vance MA, Romagnuolo J, Schellenberg GD, Sherman S, Simon P, Singh VP, Slivka A, Stolz D, Sutton R, Weiss FU, Wilcox CM, Zarnescu NO, Wisniewski SR, O Connell MR, Kienholz ML, Roeder K, Barmada MM, Yadav D, Devlin B. Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. Nat Genet 2012; 44: [PMID: DOI: /ng.2466] 66 Erkan M, Adler G, Apte MV, Bachem MG, Buchholz M, Detlefsen S, Esposito I, Friess H, Gress TM, Habisch HJ, Hwang RF, Jaster R, Kleeff J, Klöppel G, Kordes C, Logsdon CD, Masamune A, Michalski CW, Oh J, Phillips PA, Pinzani M, Reiser-Erkan C, Tsukamoto H, Wilson J. StellaTUM: current consensus and discussion on pancreatic stellate cell research. Gut 2012; 61: [PMID: ] 67 Ceyhan GO, Demir IE, Rauch U, Bergmann F, Müller MW, Büchler MW, Friess H, Schäfer KH. Pancreatic neuropathy results in neural remodeling and altered pancreatic innervation in chronic pancreatitis and pancreatic cancer. Am J Gastroenterol 2009; 104: [PMID: DOI: /ajg ] 68 Bouwense SA, Olesen SS, Drewes AM, Frøkjær JB, van Goor H, Wilder-Smith OH. Is altered central pain processing related to disease stage in chronic pancreatitis patients with pain? An exploratory study. PLoS One 2013; 8: e55460 [PMID: DOI: /journal.pone ] 69 Burton F, Alkaade S, Collins D, Muddana V, Slivka A, Brand RE, Gelrud A, Banks PA, Sherman S, Anderson MA, Romagnuolo J, Lawrence C, Baillie J, Gardner TB, Lewis MD, Amann ST, Lieb JG, O Connell M, Kennard ED, Yadav D, Whitcomb DC, Forsmark CE. Use and perceived effectiveness of non-analgesic medical therapies for chronic pancreatitis in the United States. Aliment Pharmacol Ther 2011; 33: [PMID: DOI: /j x] P- Reviewers: Liu B, Neri V, Pezzilli R, Yan MX S- Editor: Zhai HH L- Editor: A E- Editor: Ma S 3043 March 21, 2014 Volume 20 Issue 11

325 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. CASE REPORT Acute hepatitis B of genotype H resulting in persistent infection Norie Yamada, Ryuta Shigefuku, Ryuichi Sugiyama, Minoru Kobayashi, Hiroki Ikeda, Hideaki Takahashi, Chiaki Okuse, Michihiro Suzuki, Fumio Itoh, Hiroshi Yotsuyanagi, Kiyomi Yasuda, Kyoji Moriya, Kazuhiko Koike, Takaji Wakita, Takanobu Kato Norie Yamada, Ryuichi Sugiyama, Takaji Wakita, Takanobu Kato, Department of Virology Ⅱ, National Institute of Infectious Diseases, Shinjyuku-Ku, Tokyo , Japan Norie Yamada, Minoru Kobayashi, Kiyomi Yasuda, Department of Internal Medicine, Center for Liver Diseases, Kiyokawa Hospital, Suginami, Tokyo , Japan Norie Yamada, Ryuta Shigefuku, Minoru Kobayashi, Hiroki Ikeda, Hideaki Takahashi, Chiaki Okuse, Michihiro Suzuki, Fumio Itoh, Division of Gastroenterology and Hepatology, Department of Internal Medicine, St. Marianna University School of Medicine, Kanagawa , Japan Hiroshi Yotsuyanagi, Department of Infectious Diseases, Graduate School of Medicine, The University of Tokyo, Tokyo , Japan Kyoji Moriya, Department of Infection Control and Prevention, Graduate School of Medicine, The University of Tokyo, Tokyo , Japan Kazuhiko Koike, Department of Gastroenterology, Graduate School of Medicine, The University of Tokyo, Tokyo , Japan Author contributions: Shigefuku R, Kobayashi M, Ikeda H, Takahashi H, Okuse C, Suzuki M and Itoh F were the patient s attending physicians; Yotsuyanagi H, Yasuda K, Moriya K, Koike K, Wakita T and Kato T organized the study; Yamada N, Sugiyama R and Kato T performed the research; Yamada N and Kato T wrote the manuscript. Supported by Japan Society for the Promotion of Science and the Ministry of Health, Labour and Welfare and the Ministry of Education, Culture, Sports, Science and Technology of Japan Correspondence to: Takanobu Kato, MD, PhD, Department of Virology Ⅱ, National Institute of Infectious Diseases, Toyama , Shinjyuku-Ku, Tokyo , Japan. takato@nih.go.jp Telephone: Fax: Received: October 3, 2013 Revised: November 18, 2013 Accepted: December 5, 2013 Published online: March 21, 2014 Abstract A 47-year-old man presented with general fatigue and dark urine. The laboratory data showed increased levels of hepatic transaminases. The patient was positive for hepatitis B virus (HBV) markers and negative for antihuman immunodeficiency virus. The HBV-DNA titer was set to 7.7 log copies/ml. The patient was diagnosed with acute hepatitis B. The HBV infection route was obscure. The serum levels of hepatic transaminases decreased to normal ranges without any treatment, but the HBV- DNA status was maintained for at least 26 mo, indicating the presence of persistent infection. We isolated HBV from the acute-phase serum and determined the genome sequence. A phylogenetic analysis revealed that the isolated HBV was genotype H. In this patient, the elevated peak level of HBV-DNA and the risk alleles at human genome single nucleotide polymorphisms s3077 and rs in the human leukocyte antigen-dp locus were considered to be risk factors for chronic infection. This case suggests that there is a risk of persistent infection by HBV genotype H following acute hepatitis; further cases of HBV genotype H infection must be identified and characterized. Thus, the complete determination of the HBV genotype may be essential during routine clinical care of acute hepatitis B outpatients Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Acute hepatitis; Chronic hepatitis; Genotyping; Hepatitis B virus; Single nucleotide polymorphisms Core tip: Hepatitis B virus (HBV) genotype H infection is rare in Asia, particularly in Japan. Here, we report a case of acute hepatitis B caused by a genotype H strain with persistent infection, although most adult cases of acute hepatitis B are self-limiting in Japan. This case suggests that the HBV genotype H infection can be a risk factor for persistent infection. Therefore, it is necessary to investigate the characteristics of genotype H infection in an accumulation of cases. Thus, the 3044 March 21, 2014 Volume 20 Issue 11

326 Yamada N et al. Acute hepatitis B of genotype H complete determination of the HBV genotype may be essential in the routine clinical care of acute hepatitis B patients. Yamada N, Shigefuku R, Sugiyama R, Kobayashi M, Ikeda H, Takahashi H, Okuse C, Suzuki M, Itoh F, Yotsuyanagi H, Yasuda K, Moriya K, Koike K, Wakita T, Kato T. Acute hepatitis B of genotype H resulting in persistent infection. World J Gastroenterol 2014; 20(11): Available from: URL: wjgnet.com/ /full/v20/i11/3044.htm DOI: org/ /wjg.v20.i INTRODUCTION Hepatitis B is a potentially life-threatening liver infection caused by the hepatitis B virus (HBV); it represents a major global health problem. HBV can cause chronic liver diseases and increases the risk of death from cirrhosis and liver cancer. Worldwide, an estimated two billion people have been infected with HBV and more than 240 million have chronic infections [1]. The HBV genome consists of approximately 3200-nucleotides of DNA; the virus replicates using a reverse transcriptase enzyme that lacks proofreading ability. Therefore, HBV possesses diverse genetic variability, and the viral population is classified into at least eight genotypes that are designated A -H [2-6]. In Japan, genotypes B and C are prevalent among patients with chronic infections. However, in the last decades, the prevalent genotype in acute HBV infections has shifted from genotype C to A [7-9]. There are some differences in the clinical features and outcomes among the genotypes [10-13]. It has been reported that the persistent infection from acute hepatitis is prevalent in adults that are infected with genotype A HBV. Thus, determining the HBV genotype is of increasing importance even in routine clinical practice, although a reliable kit for determination of all HBV genotypes is still uncommon and is not yet covered by insurance. The host factors associated with persistent infection by HBV have also been reported, such as single nucleotide polymorphisms (SNPs) or genotypes in the human leukocyte antigen-dp locus. It may also be useful for identifying the patients who are prone to develop chronic hepatitis. In this report, we describe a case of acute hepatitis B resulting from infection by a genotype H strain of HBV. Although the laboratory data and symptoms were not distinguishable from acute hepatitis B with other genotypes, this patient developed persistent infection. CASE REPORT A 47-year-old man living in Kawasaki, Japan, presented at our hospital with general fatigue and dark urine. Approximately 1 wk before visiting the hospital, the patient developed nausea, loss of appetite, and a feeling of fullness in the abdomen. Four days later, he noted darkening of his skin and urine. Upon admission, the patient s laboratory data revealed elevated serum aspartate aminotransferase, alanine aminotransferase (ALT), lactate dehydrogenase, alkaline phosphatase, γ-glutamylt ranspeptidase, and total bilirubin (T-Bil) levels (Table 1). The prothrombin activity was within the normal range (95%). Test for hepatitis B surface antigen (HBsAg; HISCL-2000i, Sysmex, Kobe, Hyogo, Japan), hepatitis B e-antigen (HBeAg; ARCHITECT CLIA, Abbott Japan, Tokyo, Japan) and anti-hepatitis B core antigen (anti- HBc) IgM (ARCHITECT CLIA) were positive. A test for HBV-DNA was also positive, exhibiting a titer of 7.7 log copies/ml (COBAS TaqMan HBV Test v2.0, Roche Diagnostics, Tokyo, Japan). HBsAg had not been detected 2 years previously when the patient had been admitted to another hospital for treatment of acute enterocolitis. Other hepatitis virus markers were negative. Therefore, the patient was diagnosed with acute hepatitis B. The genotype of the infecting HBV, as assessed by the Immunis HBV Genotype Immunis HBV Genotype EIA Kit (Institute of Immunology, Tokyo, Japan), was determined as genotype C. The patient had not been abroad in the past 12 mo; he had no history of receiving blood or blood-related products, transfusions, or drug injections, and he reported no personal or family history of liver disease. The man was unmarried and declared that he was heterosexual, with no history of sexual contact with commercial sex workers or strangers. Antihuman immunodeficiency virus (HIV) was not detected. In the absence of medication, the patient s condition and elevated ALT level improved within a month. Anti-HBe became detectable, and HBeAg disappeared 2 mo after onset of the symptoms. HBsAg became undetectable at 5 mo, but the patient still tested positive for HBV-DNA, a status that persisted for at least 26 mo following his presentation at our hospital (Figure 1). We are now preparing to administer anti-viral medication. For further analysis of the HBV infecting this patient, HBV-DNA was extracted from the acute-phase serum using a QIAamp DNA Blood Mini kit (QIAGEN, Valencia, CA). The entire HBV genome sequence was determined after polymerase chain reaction (PCR) amplification using the following primers [the number of nucleotides (nt) added to the primers were deduced from the prototype HBV/C clone, with accession no. AB246344]. For the amplification of half of the HBV genome, the outer primers were 5 -ATTCCACCAAGCTCTGCTAG- ATCCCAGAGT-3 (nt 10-39) and 5 -GGTGCTGGT- GAACAGACCAATTTATGCCTA-3 (nt ), and the inner primers were 5 -CCTATATTTTCCTGCT- GGTGGCTCCAGTTC-3 (nt 46-75) and 5 -TAGCCTA- ATCTCCTCCC CCAACTCCTCCCA-3 (nt ). For the other half of the HBV genome, the outer primers were 5 - ACGTCGCATGGAGACCACCGTGAAC- GCCCA-3 (nt ) and 5 -AAGTCCACCAC- GAGTCTAGACTCTGTGGTA-3 (nt ), and the inner primers were 5 -CCAGGTCTTGCCCAAGGTCT- TACATAAGAG-3 (nt ) and 5 -CCCGCCT- GTAACACGAGCAGGGGTCCTAGG-3 (nt ). The PCR was performed in a thermal cycler for 30 cycles 3045 March 21, 2014 Volume 20 Issue 11

327 Yamada N et al. Acute hepatitis B of genotype H Table 1 Laboratory findings at first visit to our hospital Hematology Blood chemistry Viral markers Immunology Coagulation WBC 7400/µL TP 7.4 g/dl Anti-HA IgM (-) IgA 183 mg/dl PT% 95% Neutrophil 72.0% Albumin 4.5 g/dl Anti-HCV (-) IgG 1168 mg/dl APTT 36.4 s Eosinophil 1.0% T-Bil 11.1 mg/dl HBsAg (+) IgM 220 mg/dl Basophil 0.0% D-Bil 8.0 mg/dl Anti-HBc IgM (+) 25.5 C.O.I ANA 40, homogeneous Monocyte 10.0% AST 1942 IU/L HBeAg (+) 253 C.O.I Lymphocyte 17.0% ALT 2963 IU/L Anti-HBe (-) 0.0 % RBC 457/μL ALP 612 IU/L HBV-DNA 7.7 log copies/ml Hemoglobin 16.0 g/dl γgtp 756 IU/L Anti-HIV (-) Hematocrit 46.4% LDH 739 IU/L RPR (-) Platelet /µl BUN 8.2 mg/dl TPHA (+) Creatinine 0.64 mg/dl Anti-CMV IgG (+) T-Chol 225 mg/dl Anti-CMV IgM (-) Anti-EBV EBNA (+) Anti-EBV EA IgG (-) Anti-EBV VCA IgG (+) Anti-EBV VCA IgM (-) WBC: White blood cells; RBC: Red blood cells; ANA: Antinuclear antibody; TP: Total protein; T-Bil: Total bilirubin; D-Bil: Direct bilirubin; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; ALP: Alkaline phosphatase; γgtp: γ-glutamyltranspeptidase; LDH: Lactase dehydrogenase; BUN: Blood urea nitrogen; T-Chol: Total cholesterol; PT: Prothrombin activity; APTT: Activated partial thromboplastin time; C.O.I: Cutoff index; HA: Hepatitis A; HCV: Hepatitis C virus; HBsAg: Hepatitis B surface antigen; HBc: Hepatitis B core; HBeAg: Hepatitis B e-antigen; HBV: Hepatitis B virus; HIV: Human immunodeficiency virus; RPR: Rapid plasma regain; TPHA: Treponema pallidum hemagglutination assay; CMV: Cytomegalovirus; EBV: Epstein-Barr virus; EBNA: Epstein-Barr virus nuclear antigen; EA: Early antigen; VCA: Viral capsid antigen. ALT (IU/L) HBsAg Anti-HBs (+) (+) (-) (-) (-) (-) (-) (-) (-) (-) (94, 30 s; 60, 30 s; 72, 30 s) with TAKARA LA Taq DNA polymerase (TAKARA, Shiga, Japan). The amplified fragments were sequenced directly with an automated DNA sequencer (3500 Genetic Analyzer, Applied Biosystems, Foster City, CA, United States). The genome of the infecting HBV (designated as B-MHJ9014) was 3215 bases in size. A phylogenetic analysis was performed with this strain and several database reference strains. B-MHJ9014 sorted with the genotype-h branch of the tree and clustered with the genotype-h strains previously isolated from Japanese patients (Figure 2). The substitutions at nt 1762 and nt 1764 (the basal core promoter region) and at nt 1896 (the precore region) were not observed. The length of the deduced amino acid sequences of the S, X, Core, and P proteins were identical to those encoded by other genotype H strains in (-) (-) (-) (-) (-) (-) Months from presentation at our hospital Figure 1 Clinical course of the patient infected with the genotype H strain. The dotted line indicates the detection limit of HBV-DNA (2.1 log copy/ml); the titer of the HBV-DNA was below the lower limit at 18 mo. HBsAg: Hepatitis B surface antigen; Anti-HBs: Antibody to hepatitis B surface antigen; ALT: Alanine aminotransferase; HBV: Hepatitis B virus. (-) (-) HBV-DNA (log copies/ml) the databases. The α determinant region of the S protein of B-MHJ9014 harbored an amino acid polymorphism (phenylalanine to leucine) at residue 134. The predicted B-MHJ9014 reverse transcriptase did not include any of the amino acid substitutions known to be associated with nucleotide analog resistance. To assess the complexity of the infecting virus, S region sequences from 51 clones in acute phase serum were determined. The detected sequences were genotype H and were closely related to the consensus sequence determine by direct sequencing with 1-3 amino acids polymorphisms (data not shown). To assess the presence of human genome SNPs in the HLA-DP locus that are associated with persistent infection by HBV [14,15], a blood specimen was obtained from the patient (who had previously provided informed consent). Genomic DNA was extracted from buffy coat samples with the QIAamp DNA Mini kit (QIAGEN); DNA for SNPs rs3077 and rs were amplified with the appropriate primers and TAKARA LA Taq DNA polymerase and were sequenced directly. The patient was homozygous (G/ G) at both of these SNPs; these alleles are considered to be risk alleles for persistent infection. DISCUSSION HBV genotype H was first reported in 2002 [5]. Infections by this genotype have been found mainly in Nicaragua, Mexico, and California; this genotype is considered to be rare in Asia, particularly in Japan [5,16-18]. However, since the first recognition of genotype H in Japan in 2005, eight strains have been isolated from Japanese patients (Table 2) [18-25]. All reported genotype H strains were isolated from male patients aged 35 to 65 years old, and the major route of infection was sexual transmission (5/8, 62.5%). Four cases (50%) represent transmissions that 3046 March 21, 2014 Volume 20 Issue 11

328 Yamada N et al. Acute hepatitis B of genotype H H 100 A D 100 B C E F G AB AB AY (Nicaragua) AY (Nicaragua) AB (United States) HM (Mexico) AB (United States) AB (United States) AB (Mexico) HM (Mexico) AB (Mexico) HM (Mexico) AB (United States) AB (Mexico) AB (Mexico) AB (Mexico) AB (Mexico) AB (Mexico) AB (United States) FJ (Argentina) 86 FJ (Argentina) AB (Mexico) AY (United States) AB (Japan) EU (Thailand) AB (Japan) B-MHJ9014 (Japan) AP (Japan) AB (Japan) AB (Japan) EF (Japan) AB (Japan) AB (Japan) AB AB AB AB AB X Figure 2 A phylogenetic trees constructed using the neighbor-joining method with the full hepatitis B virus genome sequence of the isolated and reference strains. The strain isolated in this case (B-MHJ9014) is shown in bold. The horizontal bar indicates the number of nucleotide substitutions per site. The reference sequences are shown with the DDBJ/EMBL/GenBank accession numbers. The HBV genotypes are indicated on each branch. The bootstrap values (> 80%) are indicated at the nodes as a percentage of the data obtained from 1000 resamplings. HBV: Hepatitis B virus. Table 2 Genotype H strains reported in Japan No. Patient Hypothesized source of infection HIV infection 1 Clinical feature Accession number (Ref.) Age Gender Route Place 1 52 Male Unknown Japan NA Unknown blood donor AB179747, [18] 2 61 Male Sexual contact (heterosexual) Thailand NA Chronic AB205010, [19] 3 46 Male Sexual contact (bisexual) South America (+) Chronic AP007261, [20] 4 38 Male Sexual contact (homosexual) Unknown NA Chronic AB298362, [21] 5 65 Male Unknown Japan NA Acute EF157291, [22] 6 35 Male Unknown Japan NA Acute AB266536, [23] 7 60 Male Sexual contact (homosexual) Japan (-) Acute AB275308, [24] 8 60 Male Sexual contact (heterosexual) Unknown (+) Chronic AB353764, [25] 9 47 Male Unknown Japan (-) Acute to chronic AB846650, this paper 1 NA: Not available; HIV: Human immunodeficiency virus. occurred in Japan. Co-infection with HIV was not common (2/8, 25%). These characteristics were similar to the case described here. All isolated strains from Japanese patients clustered together as a branch on the phyloge- netic tree; therefore, it is possible that a specific strain of genotype H has emerged and spread in Japan. Presumably, the infrequent use of a reliable and convenient detection kit for genotype H infection has hampered the 3047 March 21, 2014 Volume 20 Issue 11

329 Yamada N et al. Acute hepatitis B of genotype H correct diagnosis of genotype H infection; some cases may be misdiagnosed and considered to be infections by other genotypes. In fact, in the current case, our HBV isolate was originally identified as genotype C by the commercial kit that is covered by insurance in Japan. This kit was developed before the discovery of genotype H; thus, such a misidentification is a potential risk, as noted in the kit s instruction manual. The clinical features of genotype H infection remain obscure. There is a growing need for an accumulation of genotype H infection cases. To this end, the use of a reliable HBV genotyping kit that can correctly distinguish all genotypes is essential for routine clinical practice. In Japan, most cases of acute hepatitis B are selflimiting, but some cases have been reported to have progressed to persistent infections [9,26-29]. Among the reported cases of genotype H infection, 4 strains were isolated from chronic hepatitis patients; in all cases, the infection was ascribed to sexual contact (Table 2) [19-21,25]. In our case, the HBV-DNA persisted for at least 26 mo. To our knowledge, this report represents the only case of genotype H infection in which chronic hepatitis was observed following acute infection. HBsAg was no longer detected at 4 mo from onset by HISCL-2000i. This disappearance was also confirmed by ARCHITECT HBsAg (CMIA, Abbott Japan, Tokyo, Japan). In the S protein analysis, we found an amino acid polymorphism in the α determinant region. This polymorphism may affect the sensitivity for detecting HBsAg. HIV infection, a well-known risk factor for prolonged HBV infection [30], was not detected in our patient. Recently, the risk factors for HBV persistent infection have been reported in an analysis of a cohort that excluded patients co-infected with HIV [29]. In that report, infection with genotype A, elevated peak levels of HBV- DNA, and attenuated peak levels of ALT were suggested as risk factors for chronic infection. In the case described here, the peak level of HBV-DNA was 7.7 log copy/ml, which was consistent with increased risk for chronic infection. However, our patient exhibited a peak level of ALT of 2963 IU/L, which is a value that would classify this individual in the self-limiting group. Therefore, the clinical features of this case did not completely fit the risk factors associated with the establishment of chronic infection in the previous analysis [29]. Another reported risk factor for chronic HBV infection is the presence of certain SNP alleles. Specifically, selected SNPs around the HLA-DP locus have been reported to be associated with chronic hepatitis B in Asians [14,15]. With the informed consent of our patient, we determined the sequences for these SNPs (rs3077 and rs ) and found that this patient harbored risk alleles at both polymorphisms. This factor may have contributed to the establishment of chronic infection in this case. In conclusion, we report a case of acute hepatitis B caused by a genotype H strain of HBV. This patient exhibited persistent infection. Our finding suggests that the infection of HBV genotype H can be a risk factor for persistent infection. We believe that it is necessary to use kits that are capable of accurate genotyping to permit an accumulation of cases and to investigate the clinical features of genotype H infection in routine clinical practice. COMMENTS Case characteristics The main symptoms were nausea, loss of appetite, and a feeling of fullness in the abdomen. Clinical diagnosis The patient was a case of acute hepatitis B caused by a genotype H strain with persistent infection. Differential diagnosis The hepatitis B virus (HBV) genotype was considered to be important to predict the outcome and clinical features. Laboratory diagnosis To diagnose this patient, the detection of HBV markers and the complete determination of the HBV genotype were essential. Treatment The anti-viral treatment was not administered because we expected this case was self-limiting. Authors are now preparing medication. Experiences and lessons The infection of HBV genotype H can be a risk factor for persistent infection and the complete determination of HBV genotype is important. Peer review To conclude the association between HBV genotype H and chronic infection, the accumulation of cases of genotype H infection is essential. REFERENCES 1 World Health Organization. Hepatitis B Fact Sheet. Accessed August Available from: URL: mediacentre/factsheets/fs204/en/indexhtml 2 Okamoto H, Tsuda F, Sakugawa H, Sastrosoewignjo RI, Imai M, Miyakawa Y, Mayumi M. Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J Gen Virol 1988; 69 (Pt 10): [PMID: DOI: / ] 3 Norder H, Couroucé AM, Magnius LO. Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology 1994; 198: [PMID: DOI: /viro ] 4 Stuyver L, De Gendt S, Van Geyt C, Zoulim F, Fried M, Schinazi RF, Rossau R. A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J Gen Virol 2000; 81: [PMID: ] 5 Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO. Genotype H: a new Amerindian genotype of hepatitis B virus revealed in Central America. J Gen Virol 2002; 2002: Kurbanov F, Tanaka Y, Mizokami M. Geographical and genetic diversity of the human hepatitis B virus. Hepatol Res 2010; 40: [PMID: DOI: /j X x] 7 Kobayashi M, Arase Y, Ikeda K, Tsubota A, Suzuki Y, Saitoh S, Kobayashi M, Suzuki F, Akuta N, Someya T, Matsuda M, Sato J, Kumada H. Clinical characteristics of patients infected with hepatitis B virus genotypes A, B, and C. J Gastroenterol 2002; 37: [PMID: ] 8 Tamada Y, Yatsuhashi H, Masaki N, Nakamuta M, Mita E, Komatsu T, Watanabe Y, Muro T, Shimada M, Hijioka T, Satoh T, Mano Y, Komeda T, Takahashi M, Kohno H, Ota H, Hayashi S, Miyakawa Y, Abiru S, Ishibashi H. Hepatitis B virus strains of subgenotype A2 with an identical sequence spreading rapidly from the capital region to all over Japan in patients with acute hepatitis B. Gut 2012; 61: [PMID: DOI: /gutjnl ] 9 Yotsuyanagi H, Ito K, Yamada N, Takahashi H, Okuse C, Yasuda K, Suzuki M, Moriya K, Mizokami M, Miyakawa Y, 3048 March 21, 2014 Volume 20 Issue 11

330 Yamada N et al. Acute hepatitis B of genotype H Koike K. High levels of hepatitis B virus after the onset of disease lead to chronic infection in patients with acute hepatitis B. Clin Infect Dis 2013; 57: [PMID: DOI: /cid/cit348] 10 Kao JH, Chen PJ, Lai MY, Chen DS. Hepatitis B genotypes correlate with clinical outcomes in patients with chronic hepatitis B. Gastroenterology 2000; 118: [PMID: ] 11 Orito E, Mizokami M, Sakugawa H, Michitaka K, Ishikawa K, Ichida T, Okanoue T, Yotsuyanagi H, Iino S. A case-control study for clinical and molecular biological differences between hepatitis B viruses of genotypes B and C. Japan HBV Genotype Research Group. Hepatology 2001; 33: [PMID: DOI: /jhep ] 12 Chu CJ, Lok AS. Clinical significance of hepatitis B virus genotypes. Hepatology 2002; 35: [PMID: DOI: /jhep ] 13 Miyakawa Y, Mizokami M. Classifying hepatitis B virus genotypes. Intervirology 2003; 46: [PMID: ] 14 Kamatani Y, Wattanapokayakit S, Ochi H, Kawaguchi T, Takahashi A, Hosono N, Kubo M, Tsunoda T, Kamatani N, Kumada H, Puseenam A, Sura T, Daigo Y, Chayama K, Chantratita W, Nakamura Y, Matsuda K. A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians. Nat Genet 2009; 41: [PMID: DOI: /ng.348] 15 Nishida N, Sawai H, Matsuura K, Sugiyama M, Ahn SH, Park JY, Hige S, Kang JH, Suzuki K, Kurosaki M, Asahina Y, Mochida S, Watanabe M, Tanaka E, Honda M, Kaneko S, Orito E, Itoh Y, Mita E, Tamori A, Murawaki Y, Hiasa Y, Sakaida I, Korenaga M, Hino K, Ide T, Kawashima M, Mawatari Y, Sageshima M, Ogasawara Y, Koike A, Izumi N, Han KH, Tanaka Y, Tokunaga K, Mizokami M. Genome-wide association study confirming association of HLA-DP with protection against chronic hepatitis B and viral clearance in Japanese and Korean. PLoS One 2012; 7: e39175 [PMID: DOI: /journal.pone ] 16 Flichman D, Galdame O, Livellara B, Viaut M, Gadano A, Campos R. Full-length genome characterization of hepatitis B virus genotype H strain isolated from serum samples collected from two chronically infected patients in Argentina. J Clin Microbiol 2009; 47: [PMID: DOI: /jcm ] 17 Roman S, Tanaka Y, Khan A, Kurbanov F, Kato H, Mizokami M, Panduro A. Occult hepatitis B in the genotype H-infected Nahuas and Huichol native Mexican population. J Med Virol 2010; 82: [PMID: DOI: /jmv.21846] 18 Ohnuma H, Yoshikawa A, Mizoguchi H, Okamoto H. Characterization of genotype H hepatitis B virus strain identified for the first time from a Japanese blood donor by nucleic acid amplification test. J Gen Virol 2005; 86: [PMID: DOI: /vir ] 19 Nakajima A, Usui M, Huy TT, Hlaing NK, Masaki N, Sata T, Abe K. Full-length sequence of hepatitis B virus belonging to genotype H identified in a Japanese patient with chronic hepatitis. Jpn J Infect Dis 2005; 58: [PMID: ] 20 Shibayama T, Masuda G, Ajisawa A, Hiruma K, Tsuda F, Nishizawa T, Takahashi M, Okamoto H. Characterization of seven genotypes (A to E, G and H) of hepatitis B virus recovered from Japanese patients infected with human immunodeficiency virus type 1. J Med Virol 2005; 76: [PMID: DOI: /jmv.20319] 21 Suzuki F, Akuta N, Suzuki Y, Yatsuji H, Sezaki H, Arase Y, Kawamura Y, Hosaka T, Kobayashi M, Ikeda K, Kobayashi M, Watahiki S, Kumada H. Selection of a virus strain resistant to entecavir in a nucleoside-naive patient with hepatitis B of genotype H. J Clin Virol 2007; 39: [PMID: DOI: /j.jcv ] 22 Tamada Y, Yano K, Komatsu T, Yatsuhashi H, Ishibashi H, Takahashi K, Mishiro S. First Domestic Case of Acute Hepatitis Caused by an HBV genotype H Strain. Kanzo 2007; 48: [DOI: /kanzo ] 23 Kumagai I, Abe K, Oikawa T, Sato A, Sato S, Endo R, Takikawa Y, Suzuki K, Masuda T, Sainokami S, Endo K, Takahashi M, Okamoto H. A male patient with severe acute hepatitis who was domestically infected with a genotype H hepatitis B virus in Iwate, Japan. J Gastroenterol 2007; 42: [PMID: DOI: /s ] 24 Chihara N, Arase Y, Suzuki F, Suzuki Y, Kobayashi M, Akuta N, Hosaka T, Sezaki H, Yatsuji H, Kawamura Y, Kobayashi M, Watahiki S, Ikeda K, Kumada H. Prolonged hepatitis after acute infection with genotype H hepatitis B virus. Intern Med 2007; 46: [PMID: ] 25 Kanada A, Takehara T, Ohkawa K, Kato M, Tatsumi T, Miyagi T, Sakamori R, Yamaguchi S, Uemura A, Kohga K, Sasakawa A, Hikita H, Kawamura K, Kanto T, Hiramatsu N, Hayashi N. Early emergence of entecavir-resistant hepatitis B virus in a patient with hepatitis B virus/human immunodeficiency virus coinfection. Hepatol Res 2008; 38: [PMID: DOI: /j X x] 26 Suzuki Y, Kobayashi M, Ikeda K, Suzuki F, Arfase Y, Akuta N, Hosaka T, Saitoh S, Kobayashi M, Someya T, Matsuda M, Sato J, Watabiki S, Miyakawa Y, Kumada H. Persistence of acute infection with hepatitis B virus genotype A and treatment in Japan. J Med Virol 2005; 76: [PMID: DOI: /jmv.20320] 27 Ozasa A, Tanaka Y, Orito E, Sugiyama M, Kang JH, Hige S, Kuramitsu T, Suzuki K, Tanaka E, Okada S, Tokita H, Asahina Y, Inoue K, Kakumu S, Okanoue T, Murawaki Y, Hino K, Onji M, Yatsuhashi H, Sakugawa H, Miyakawa Y, Ueda R, Mizokami M. Influence of genotypes and precore mutations on fulminant or chronic outcome of acute hepatitis B virus infection. Hepatology 2006; 44: [PMID: DOI: /hep.21249] 28 Miyoshi T, Hiraoka A, Hidaka S, Shimizu Y, Ninomiya K, Utsunomiya H, Tazuya N, Tanihira T, Hasebe A, Miyamoto Y, Ninomiya T, Abe M, Hiasa Y, Onji M, Michitaka K. An adult patient with acute infection with hepatitis B virus genotype C that progressed to chronic infection. Intern Med 2012; 51: [PMID: ] 29 Ito K, Yotsuyanagi H, Yatsuhashi H, Karino Y, Takikawa Y, Saito T, Arase Y, Imazeki F, Kurosaki M, Umemura T, Ichida T, Toyoda H, Yoneda M, Mita E, Yamamoto K, Michitaka K, Maeshiro T, Tanuma J, Tanaka Y, Sugiyama M, Murata K, Masaki N, Mizokami M. Risk factors for long-term persistence of serum hepatitis B surface antigen following acute hepatitis B virus infection in Japanese adults. Hepatology 2014; 59: [PMID: DOI: /hep.26635] 30 Gilson RJ, Hawkins AE, Beecham MR, Ross E, Waite J, Briggs M, McNally T, Kelly GE, Tedder RS, Weller IV. Interactions between HIV and hepatitis B virus in homosexual men: effects on the natural history of infection. AIDS 1997; 11: [PMID: ] P- Reviewers: Chan KM, Chun YH, Rodriguez-Frias F S- Editor: Qi Y L- Editor: A E- Editor: Wu HL 3049 March 21, 2014 Volume 20 Issue 11

331 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. CASE REPORT Classifying extrahepatic bile duct metachronous carcinoma by de novo neoplasia site Hyung Jun Kwon, Sang Geol Kim, Jae Min Chun, Yoon Jin Hwang Hyung Jun Kwon, Sang Geol Kim, Yoon Jin Hwang, Department of Surgery, Kyungpook National University Medical Center, Daegu , South Korea Jae Min Chun, Department of Surgery, School of Medicine, Kyungpook National University, Daegu , South Korea Author contributions: Kwon HJ was the first author and composed the majority of the manuscript; Chun JM prepared the literature review; Hwang YJ designed and coordinated the study and helped to draft the manuscript; Kim SG was the corresponding author and performed the surgery in addition to initiating and guiding the program of disease classification in the study; all authors have read and approved the final manuscript. Supported by Kyungpook National University Research Fund, 2013 Correspondence to: Sang Geol Kim, MD, Department of Surgery, Kyungpook National University Medical Center, 807 Hogukno, Buk-gu, Daegu , South Korea. ksg@knu.ac.kr Telephone: Fax: Received: October 1, 2013 Revised: December 4, 2013 Accepted: January 3, 2014 Published online: March 21, 2014 Abstract Extrahepatic bile duct (EHBD) cancer may occur metachronously, and these cancers are resectable with a favorable prognosis. We aimed to identify the pattern of metachronous EHBD cancer. We classified the cases of metachronous EHBD cancer reported in the literature thus far and investigated two new cases of metachronous EHBD cancer. A 70-year-old female underwent R0 bile duct resection for a type 1 Klatskin tumor (pt- 1N0M0). A 70-year-old male patient underwent R0 bile duct resection for a middle bile duct cancer (pt2n1m0). Imaging studies of both patients taken at 14 and 24 mo after first surgery respectively revealed a metachronous cholangiocarcinoma that required pancreaticoduodenectomy (PD). Histopathology of the both tumors after PD revealed cholangiocarcinoma invading the pancreas (pt3n0m0). Both patients have been free from recurrence for 6 years and 16 mo respectively after the second surgery. Through a review of the literature on these cases, we classified the pattern of metachronous EHBD cancer according to the site of de novo neoplasia. The proximal remnant bile duct was most commonly involved. Metachronous EHBD cancer should be distinguished from an unresectable recurrent tumor. Classifying metachronous EHBD cancer may be helpful in identifying rare metachronous tumors Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Metachronous; Extrahepatic bile duct; Cancer; Prognosis; Recurrence Core tip: The cases of metachronous double bile duct cancer described emphasize the importance of differentiating this condition from a loco-regional recurrence. It is not a progression of the initial tumor but rather a new tumor. Therefore, it may have a good prognosis. The cases that have been reported thus far have shown a favorable prognosis. Tumor classification may be valuable during the long-term follow up after the initial surgery because it allows prediction of the potential site and proper surgical methods for the new tumors. Diagnosing these tumors and classifying their patterns may allow physicians the opportunity to cure the disease. Kwon HJ, Kim SG, Chun JM, Hwang YJ. Classifying extrahepatic bile duct metachronous carcinoma by de novo neoplasia site. World J Gastroenterol 2014; 20(11): Available from: URL: DOI: INTRODUCTION Bile duct cancer may arise from anywhere along the biliary tree. Pathological factors, such as the site of tumor, 3050 March 21, 2014 Volume 20 Issue 11

332 Kwon HJ et al. Extrahepatic bile duct metachronous carcinoma A B C Figure 1 Imaging findings and gross specimen of the later metachronous bile duct tumor in case 1. A: The arrow indicates the dilated remnant distal bile duct, and the arrow heads indicate the polypoid mass lesion of the distal remnant bile duct; B: Endoscopic retrograde cholangiopancreatography revealed mild dilatation of the intrapancreatic remnant bile duct with a filling defect (arrows); C: A gross examination of the resected specimen shows a polypoid mass arising from the remnant bile duct with invasion into the pancreas. the extent of tumor spreading, and multicentricity, are critical factors for selecting the type of surgery and achieving an R0 resection. Multicentricity is one of the pathological characteristics of EHBD cancer. Synchronous bile duct and gallbladder cancer has been reported in 5.0%-7.4% of cases, but the occurrence of metachronous cancer in EHBD has rarely been reported [1-4]. Warren and Gates established a set of criteria for multiple primary malignant neoplasms: Each tumor must have definite features of malignancy; each tumor should be distinct and separate excluding the probability of one tumor being a metastasis of the other tumor [5]. Moertel proposed a definition for synchronous cancers as those occurring within 6 mo of the first primary cancer and for metachronous cancers as those occurring more than 6 mo later [6]. If synchronous multifocal EHBD cancer is diagnosed preoperatively, it usually requires aggressive resections, such as hepatectomy and pancreaticoduodenectomy, to achieve an R0 resection. Similarly, when metachronous EHBD cancer is diagnosed after the first surgery, additional resections are required to achieve an R0 resection, although the incidence, risk factors, and clinical behavior of metachronous EHBD cancer are not well known. One might assume that metachronous de novo neoplasia of the remnant bile duct could be more easily cured than can loco-regional recurrent diseases, as the former may be in an early stage. For this reason, it is clinically important to distinguish this rare metachronous cancer from loco-regional recurrences. Using a literature review, we summarized these cases and report two cases of metachronous carcinomas of the extrahepatic bile duct, both of which were successfully resected using pylorus preserving pancreaticoduodenectomy. CASE REPORT Case 1 A 70-year-old female patient presented with jaundice. Abdominal CT revealed a mass lesion on the proximal common hepatic duct. Endoscopic retrograde cholangio-pancreatography (ERCP) revealed a complete occlusion of the bile duct at the proximal common hepatic duct. Upon the diagnosis of a type 1 Klatskin tumor, we resected the extrahepatic bile duct using a Roux-en-Y hepaticojejunostomy. Histopathology revealed a T1N0M0 tumor of the bile duct with a tumor-free resection margin. The patient had been free from recurrence for 14 mo until a new lesion on the distal remnant bile duct was detected from an abdominal CT scan during a routine follow up (Figure 1A). The PET-CT also suggested a metachronous bile duct cancer of the distal remnant bile duct, and ERCP revealed mild dilatation of the intrapancreatic remnant bile duct with a filling defect (Figure 1B). We decided to perform pancreaticoduodenectomy on the newly developed lesion using the method illustrated in Figure 2. The frozen histopathology of the resected bile duct stump and the neighboring connec March 21, 2014 Volume 20 Issue 11

333 Kwon HJ et al. Extrahepatic bile duct metachronous carcinoma A B Figure 2 Panel A shows the previous bile duct resection with a Roux-en-Y hepaticojejunostomy. The lines in panel A denote where the cut was made, and the shaded area indicates the part to be resected. Panel B shows the later pyloric preserving pancreatoduodenectomy with a Roux-en-Y hepaticojejunostomy. A B Figure 3 Abdominal computed tomography findings of the later metachronous bile duct tumor in case 2 (A, B). The arrows indicate the new lesion with slight contrast enhancement at the distal remnant bile duct, but no definite mass was observed. tive tissue around superior mesenteric vein were free of carcinoma. The final pathological diagnosis of the specimen confirmed a cholangiocarcinoma with a polypoid configuration (Figure 1C) arising from the remnant bile duct with invasion into the pancreas (pt3n0m0). She was discharged 14 d after surgery without complications. The patient has been free of recurrence for 6 years after the second surgery. Case 2 A 70-year-old male patient presented with jaundice. Abdominal CT revealed a mass lesion at the middle common bile duct. ERCP revealed a complete occlusion at the middle common bile duct. We performed a resection of the extrahepatic bile duct using a Roux-en-Y hepaticojejunostomy. Histopathology revealed a T1N1M0 tumor of the bile duct with a tumor-free resection margin. He had been free from recurrence for 24 mo until a new lesion with slight contrast enhancement at distal remnant bile duct was detected from an abdominal CT scan during a routine follow up (Figure 3). The PET-CT also suggested a metachronous bile duct cancer of the distal remnant bile duct. Pancreaticoduodenectomy was performed on the newly developed lesion using the method illustrated in Figure 3. The final pathological diagnosis of the specimen confirmed a bile duct cancer invading the pancreas (pt3n0m0). The patient was discharged 15 days after surgery. He has been free of recurrence for 16 mo after the second surgery. Classification of metachronous bile duct carcinoma according to the site of de novo neoplasia The potential site of metachronous bile duct cancer depends on the type of first surgery. After a bile duct resection with or without concomitant hepatectomy, both the proximal and distal bile ducts remain (Type 1), and metachronous bile duct cancer can occur at one or both remnant bile ducts. We applied the term Type 1a to describe new tumors at the proximal remnant bile duct; Type 1b to describe those at the distal remnant bile duct; Type 1c to describe those at both the proximal and distal remnant bile ducts. After pancreatoduodenectomy with or without concomitant hepatectomy, only the proximal bile duct remains for de novo neoplasia. We applied the term Type 2 metachronous bile duct cancer to describe these tumors (Figure 4). Out of 13 cases that have been reported thus far, eight patients (Type 1) underwent bile duct resection with or without a concomitant liver resection. The remaining 5 patients underwent pancreaticoduodenectomy (Type 2), which removed the potential site for future neoplasia. In the eight Type 1 patients who were left with remnant proximal and distal bile ducts, 3052 March 21, 2014 Volume 20 Issue 11

334 Kwon HJ et al. Extrahepatic bile duct metachronous carcinoma 1a 1b 1c 2 Figure 4 Classification of metachronous bile duct carcinoma according to the site of de novo neoplasia. Type 1 tumors occur at the proximal and/or distal remnant bile ducts. Type 1a tumors with involvement of the proximal remnant bile duct only require hepatectomy. Type 1b tumors with involvement of the distal remnant bile duct only require pancreaticoduodenectomy. Type 1c tumors with involvement of both proximal and distal remnant bile ducts require hepatectomy and pancreaticoduodenectomy. Type 2 tumors with involvement of the proximal remnant bile duct after pancreatoduodenectomy require hepatectomy. Table 1 Clinical features of the patients with metachronous cancer of the bile duct described in the literature Ref. Year published Age (yr) Sex Site of Type of Time to Site of Type of Type of Status 1 st tumor 1 st surgery 1 2 nd tumor 2 nd tumor 1 2 nd surgery 2 meta-bdca Todoroki et al [11] F Perihilar LH with RYHJ 13 Y IHBD RPMS Type 1a Alive, 3 Y 5 M Seki et al [12] M Dist. BD PD 12.8 Y Prox. BD. ERH+α Type 2 Dead, 6 M F Dist. BD PD 5.8 Y Prox. BD RH Type 2 Alive, 17 M Saiura et al [10] F IHBD LH extended 7 Y Dist. BD PD Type 1a Alive, 36 M Nakakubo et al [13] F BD PD 4 Y Prox. BD. LH ext. Type 2 Dead, 14 M Okamoto et al [14] F BD Excision of cyst 3 Y Right HD RH Type 1a Alive 11.2 Y M BD PD 3.5 Y Left HD LH Type 2 Alive 2 Y Yoon et al [15] F Diffuse BDR 5.5 Y Prox. and HPD Type 1c Alive, 46 M Dist. BD F Prox. BD RH with RYHJ 2.3 Y Dist. BD PD Type 1b Alive, 9 M Hibi et al [16] M Mid. to Dist. PD 3 Y Prox. BD RH Type 2 Alive, 8 M BD Merenda et al [4] M Middle BD. BDR 2.3 Y Dist. BD PD Type 1b Alive, 6 M Present Case F Prox. BD BDR 14 M Dist. BD PD Type 1b Alive, 6 Y Present Case M Middle BD BDR 24 M Dist. BD PD Type 1b Alive, 16 M 1 In all cases, the resection margin was free from tumor after the 1 st surgery, 2 In all cases, the resection margin was free from tumor after the 2 nd surgery. RH: Roux-en-Y hepaticojejunostomy; IHBD: Intrahepatic bile duct; RPMS: Right paramedian sectorectomy; BD: Bile duct; BDR: Bile duct resection; HPD: Hepatopancreaticoduodenectomy; ERH + α: Extended right hepatectomy with partial gastrectomy and limited resection of segment 3 due to a metastatic liver tumor; LH: Left hepatectomy. there were two patients of Type 1a who required liver resection, five patients of Type 1b who required pancreaticoduodenectomy, and one patient of Type 1c who required hepatectomy and pancreaticoduodenectomy. In all of the remaining 5 patients of Type 2, whose distal bile duct was removed by a previous pancreaticoduodenectomy, liver resection was performed to resect the metachronous bile duct tumor. The most frequent type was type 2. Our present cases would be classified as type 1b metachronous bile duct cancer. DISCUSSION Although resection rates have increased, the prognosis of EHBD cancer (even after R0 resection) remains unsatisfactory [7,8]. Loco-regional recurrence is a common problem. In these cases, curative re-resection is usually impossible due to the invasiveness of the tumor and the anatomical complexity near the hepatic hilum. Furthermore, it is difficult to clarify the role and optimal regimen of adjuvant treatment in the setting of locally recurrent bile duct cancer [9]. Unlike loco-regional recurrence, metachronous de novo bile duct cancer is often curable because it is a less advanced tumor compared to a loco-regional recurrence. Some bile duct cancers are synchronously or metachronously multifocal [1-3]. However, metachronous tumors arising from the remnant bile duct epithelium have rarely 3053 March 21, 2014 Volume 20 Issue 11

335 Kwon HJ et al. Extrahepatic bile duct metachronous carcinoma been reported compared to those of the gastrointestinal tract, such as the stomach, colon, and liver [4]. The small amount of remnant bile duct tissue remaining after curative resection and the poor prognosis of this tumor may explain the rarity. Discriminating metachronous bile duct tumor from other loco-regional recurrence is clinically important because the de novo neoplasia presents a different progression from that of the prior tumor. All of the cases of metachronous bile duct cancer that have been reported thus far have been resectable with curative intent, and notably, all but two patients are alive at the time of publication (Table 1). In the English literature, Saiura et al [10] reported the first case of metachronous bile duct cancer occurring sequentially in the intrahepatic and extrahepatic bile ducts. Todoroki et al [11] and Seki et al [12] also reported three cases. We reviewed thirteen cases recently reported by Nakakudo [13], Okamoto [14], Yoon et al [15], Hibi et al [16], and Merenda et al [4], including our present cases (Table 1). In these reports, abdominal CT scan was most commonly utilized as imaging method during the follow up period. In our cases, we regularly followed up the patients with the interval of 6 mo and the abdominal CT scan was useful to detect the suspicious de novo lesions of remnant bile duct. The findings of PET-CT were consistent with the findings of abdominal CT scan. We preformed the second surgery in both cases without tissue confirmation preoperatively. In our cases, the prior lesions were a type 1 Klatskin tumor and a middle common bile duct cancer. Fortunately, bile duct resection only allowed an R0 resection. The abdominal CT scans taken at 14 and 24 mo after the initial bile duct resection in cases 1 and 2 revealed new lesions confined to the distal remnant bile duct. These imaging findings prompted us to consider metachronous bile duct cancer rather than a loco-regional recurrence. The present two cases meet the criteria for multiple metachronous tumors proposed by Warren and Gates [5] for the following reasons: (1) abdominal CT and FDG PET-CT showed no evidence of a later lesion in the distal bile duct at the time of first surgery in both cases; (2) 14 and 24 mo elapsed until the new lesions were found on imaging studies in both cases; and (3) the first and second tumors occurred at different sites of EHBD that were far from each other with normal intervening bile duct epithelium, as confirmed by the tumor-free margins in both cases. From our review of the cases reported thus far in the literature, we classified metachronous bile duct cancers according to the site of the tumor. Metachronous bile duct cancer depends on the remnant bile duct and must therefore fall into one of the types listed here (Figure 4). The remnant proximal bile duct was usually involved. Being aware of this rare metachronous tumor and its classification may be clinically valuable during long-term follow up after initial surgery because we can predict the potential site and proper second surgical methods needed to treat the metachronous bile duct. In conclusion, because metachronous bile duct cancer can be successfully treated with a second surgery, patients with EHBD cancer should be followed up closely to avoid losing the opportunity to treat this curable condition. COMMENTS Case characteristics A 70-year-old male and a 70-year-old female respectively presented a new lesion in remnant bile duct without symptoms which was discovered during the regular follow up after first surgery for extrahepatic bile duct cancer. Differential diagnosis Loco-regional recurrences. Laboratory diagnosis Laboratory test such as complete blood counts, serum amylase and liver function test in both patients were within normal limits. Imaging diagnosis Abdominal computed tomography scan of the female patient showed dilatation of the remnant distal bile duct and the polypoid mass whereas the abdominal CT scan of the male patient showed a new lesion with slight contrast enhancement at the distal remnant bile duct without definite mass. Pathological diagnosis Histopathology of the resected specimen of both patients confirmed adenocarcinoma of remnant bile duct invading into pancreas. Treatment Both patients underwent pancreaticoduodenectomy for the newly developed lesions. Related reports Unlike loco-regional recurrences which are usually unresectable with poor prognosis, the metachronous bile duct cancer may be resectable with favorable prognosis reported thus far. Term explanation Metachronous tumor is defined as tumors occurring more than 6 mo after the first primary cancer by Moertel. Experiences and lessons As show in these two cases, metachronous bile duct cancer can be successfully treated with a second surgery so the patients with extrahepatic bile duct cancer should be followed up closely to avoid losing the opportunity to treat the curable condition. Peer review This article shows the importance of differentiating curable the metachronous cholangiocellular carcinoma from loco regional recurrence of cholangiocellular carcinoma. REFERENCES 1 Gertsch P, Thomas P, Baer H, Lerut J, Zimmermann A, Blumgart LH. Multiple tumors of the biliary tract. Am J Surg 1990; 159: [PMID: DOI: /S (05) ] 2 Chijiiwa K. Synchronous carcinoma of the gall-bladder in patients with bile duct carcinoma. Aust N Z J Surg 1993; 63: [PMID: DOI: /j tb00492.x] 3 Kozuka S, Tsubone M, Hachisuka K. Evolution of carcinoma in the extrahepatic bile ducts. Cancer 1984; 54: [PMID: DOI: / ( )54:1<65::AID- CNCR >3.0.CO;2-0] 4 Merenda R, Portale G, Sturniolo GC, Marciani F, Faccioli AM, Ancona E. A rare surgical case of metachronous double carcinoma of the biliary tract. Scand J Gastroenterol 2007; 42: [PMID: DOI: / ] 5 Warren S, Gates O. Multiple primary malignant tumors. A survey of the literature and a statistical study. Am J Cancer 1932; 16: Moertel CG. Multiple primary malignant neoplasms: historical perspectives. Cancer 1977; 40: [PMID: 3054 March 21, 2014 Volume 20 Issue 11

336 Kwon HJ et al. Extrahepatic bile duct metachronous carcinoma DOI: / (197710)40:4+<1786::AID- CNCR >3.0.CO;2-2] 7 Sakamoto Y, Kosuge T, Shimada K, Sano T, Ojima H, Yamamoto J, Yamasaki S, Takayama T, Makuuchi M. Prognostic factors of surgical resection in middle and distal bile duct cancer: an analysis of 55 patients concerning the significance of ductal and radial margins. Surgery 2005; 137: [PMID: DOI: /j.surg ] 8 Todoroki T, Kawamoto T, Koike N, Fukao K, Shoda J, Takahashi H. Treatment strategy for patients with middle and lower third bile duct cancer. Br J Surg 2001; 88: [PMID: DOI: /j x] 9 Ramírez-Merino N, Aix SP, Cortés-Funes H. Chemotherapy for cholangiocarcinoma: An update. World J Gastrointest Oncol 2013; 5: [PMID: DOI: /wjgo.v5.i7.171] 10 Saiura A, Takayama T, Sano K, Toyoda H, Abe H, Kubota K, Mori M, Makuuchi M. Metachronous bile duct cancer in a patient surviving for a decade and undergoing curative surgery twice. Jpn J Clin Oncol 1999; 29: [PMID: DOI: /jjco/ ] 11 Todoroki T, Fukuda Y, Kawamoto T, Saida Y, Ohara K, Iwasaki Y, Matsuzaki O. Long-term survivors after salvage surgery combined with radiotherapy for recurrence of stage IV main hepatic duct cancer--report of two cases. Hepatogastroenterology 1993; 40: [PMID: ] 12 Seki H, Miyagawa S, Kobayashi A, Kawasaki S. Surgical treatment for biliary carcinoma arising after pancreatoduodenectomy. HPB Surg 1998; 10: [PMID: DOI: /1998/93740] 13 Nakakubo Y, Kondo S, Omi M, Hirano S, Ambo Y, Morikawa T, Okaushiba S, Kato H, Shimizu M. A case of heterochromic development of extrahepatic bile duct carcinoma and cholangiocellular carcinoma. Nihon Syokakigeka Gakkaizasshi 2001; 34: Okamoto A, Tsuruta K, Matsumoto G, Takahashi T, Kamisawa T, Egawa N, Funata N. Papillary carcinoma of the extrahepatic bile duct: characteristic features and implications in surgical treatment. J Am Coll Surg 2003; 196: [PMID: DOI: /S (02) ] 15 Yoon YS, Kim SW, Jang JY, Park YH. Curative reoperation for recurrent cancer of the extrahepatic bile duct: report of two cases. Hepatogastroenterology 2005; 52: [PMID: ] 16 Hibi T, Sakamoto Y, Tochigi N, Ojima H, Shimada K, Sano T, Kosuge T. Extended right hemihepatectomy as a salvage operation for recurrent bile duct cancer 3 years after pancreatoduodenectomy. Jpn J Clin Oncol 2006; 36: [PMID: DOI: /jjco/hyi232] P- Reviewers: Montiel-Jarquín A, Rustemovic N, Zavoral M S- Editor: Qi Y L- Editor: A E- Editor: Liu XM 3055 March 21, 2014 Volume 20 Issue 11

337 Online Submissions: doi: /wjg.v20.i World J Gastroenterol 2014 March 21; 20(11): ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. CASE REPORT Valsalva retinopathy following esophagogastroduodenosco py under propofol sedation: A case report Ju-Hong Park, Min Sagong, Woohyok Chang Ju-Hong Park, Min Sagong, Woohyok Chang, Department of Ophthalmology, Yeungnam University College of Medicine, Daegu , South Korea Author contributions: Park JH and Chang W collected the patient s clinical data; Park JH and Sagong M performed the literature search and wrote the manuscript; Chang W conceived the idea of the case report and performed the surgery. All authors approved the final manuscript. Supported by The 2012 Yeungnam University Research Grant Correspondence to: Woohyok Chang, MD, PhD, Department of Ophthalmology, Yeungnam University College of Medicine, 317-1, Daemyung-Dong, Nam-gu, Daegu , South Korea. changwh@ynu.ac.kr Telephone: Fax: Received: October 11, 2013 Revised: December 10, 2013 Accepted: January 8, 2014 Published online: March 21, 2014 Abstract We report a case of Valsalva retinopathy associated with esophagogastroduodenoscopy (EGD) under propofol sedation. A 43-year-old woman who had no previous history of systemic or ocular disease presented with a complaint of decreased vision in her left eye, which developed one day after EGD under propofol sedation. According to the referring physician, the patient had experienced multiple sustained Valsalva maneuvers during EGD. The fundus examination of the left eye showed a large preretinal hemorrhage surrounded by multiple small retinal hemorrhages in the posterior pole. One month later, fundus examination revealed a floating organized vitreous hemorrhage. The pars plana vitrectomy was performed to treat persistent vitreous hemorrhage. One month after vitrectomy, fundus examination showed normal retina and the patient s vision recovered to 20/20. Valsalva maneuver can occur during EGD under sedation, and Valsalva retinopathy should be considered as a possible cause. Valsalva retinopathy should be included in the differential diagnosis when a patient complains of blurred vision following EGD Baishideng Publishing Group Co., Limited. All rights reserved. Key words: Esophagogastroduodenoscopy; Propofol; Sedation; Valsalva retinopathy Core tip: This is the first report describing Valsalva retinopathy following esophagogastroduodenoscopy (EGD) under sedation. This case highlights Valsalva retinopathy induced by Valsalva maneuvers during EGD under incomplete propofol sedation, and that this ocular complication should be included in the differential diagnosis when a patient complains of sudden blurred vision following EGD. Park JH, Sagong M, Chang W. Valsalva retinopathy following esophagogastroduodenoscopy under propofol sedation: A case report. World J Gastroenterol 2014; 20(11): Available from: URL: i11/3056.htm DOI: INTRODUCTION Valsalva retinopathy was first described in 1972 as a superficial macular hemorrhage that is caused by a forcible exhalation against a closed glottis, resulting in a sudden rise in intrathoracic or intra-abdominal pressure [1]. The true incidence of such cases remains unknown because hemorrhages sparing the macula may be asymptomatic and only severe cases are reported [2]. Valsalva retinopathy is usually identified in healthy adults and has been associated with aerobic exercise [3], vigorous sexual activity [4], inflating balloons [5], prostate biopsy [6], dental surgery [7], episodes of constipation, vomiting and lifting in pregnant women [8,9], paroxysmal coughing [1], oratorical contest [10], colonoscopy [11], and esophagogastroduodenoscopy (EGD) without sedation [12]. The visual prognosis is favorable and the hemorrhage usually resolves spontaneously within several weeks to months March 21, 2014 Volume 20 Issue 11

338 Park JH et al. Valsalva retinopathy following esophagogastroduodenoscopy Figure 1 Initial fundus photograph of the left eye of a 43-year-old woman shows an approximately eight disc diameter preretinal hemorrhage surrounded by multiple small retinal hemorrhages in the macula. However, some cases with a large and dense hemorrhage may result in permanent vision loss because of the toxic effects of iron and pigmentary change of the macula. Recently, there is a growing trend to perform EGD under sedation (20%-78%) [13-16]. To our knowledge, this is the first report describing Valsalva retinopathy following EGD under sedation. CASE REPORT A 43-year-old woman who had no previous history of systemic or ocular disease presented with a chief complaint of sudden visual loss in her left eye. EGD under propofol sedation was performed one day prior to the sudden visual loss. According to the referring physician, the patient had experienced multiple sustained Valsalva maneuvers during the procedure. On examination, the patient was found to have the best corrected visual acuity (BCVA) 20/20 in the right eye and hand motion vision in the left eye. The anterior segments and intraocular pressure were normal. The fundus examination of the left eye showed a large preretinal hemorrhage surrounded by multiple small retinal hemorrhages in the posterior pole (Figure 1). The fundus examination of the right eye was unremarkable. We suspected Valsalva retinopathy on the basis of the patient s history and results from slit lamp examination and fundus examination. Overall, systemic examination was unremarkable, and laboratory findings were normal. We decided to observe the evolution of the hemorrhage over a period of one month. After one month, fundus examination showed a floating organized vitreous hemorrhage, and the patient s corrected visual acuity was 20/400. A 20-gauge three-port pars plana vitrectomy was performed to treat the dense organized vitreous hemorrhage. There was no abnormal vascular pathology. One month after vitrectomy, fundus examination showed normal retina without any sequelae, and the patient s vision had recovered to 20/20 (Figure 2). DISCUSSION Valsalva retinopathy is characterized by the presence of Figure 2 Fundus photograph taken one month after vitrectomy. The patient s visual acuity was fully recovered without any sequelae. preretinal hemorrhage following a Valsalva maneuver. Valsalva maneuver, including coughing, could be induced by a forcible exhalation against a closed glottis, thereby creating a sudden increase in intrathoracic and intraabdominal pressures. The increased pressure results in the spontaneous rupture of perifoveal capillaries. Valsalva retinopathy can cause a sudden loss of vision when it involves the macula. Therapeutic options for Valsalva retinopathy include conservative management, vitrectomy, and laser membranotomy [17]. Most cases resolve spontaneously with favorable visual outcomes. Routine endoscopy can be performed successfully with either moderate or deep sedation. Moderate sedation provides adequate anxiolysis, analgesia, and amnesia for most patients and is safer than deep sedation. Moderate sedation is usually recommended for most patients, although many patients may move into lighter or deeper sedation levels [18]. Generally, for upper endoscopy, adequate sedation preventing any gagging or coughing during esophageal intubation can be achieved [19]. Propofol sedation is expected to eliminate the gagging reflex and fear during EGD [20]. The mean dose of administered propofol in EGD is 161 mg [19], but low-dose propofol sedation is commonly used due to its narrow therapeutic range (1.5-5 μg/ml). In the present case, 50 mg of propofol (1 mg/kg) was administered. In a case of low-dose propofol sedation, awakening can occur during EGD, which could retrigger the cough reflex [21]. Also, in EGD, the endoscopic field should be optimized by the use of gas insufflation in EGD. Gas insufflation can cause gastric distention, leading to an increase in intra-abdominal pressure, which can transmit the pressure directly to the eye. Therefore, coughing and gastric distention may not be inhibited completely with propofol sedation, and the rise in intra-abdominal pressure can cause spontaneous rupture of perifoveal capillary bed. Valsalva retinopathy associated with vitreous hemorrhage is uncommon, and this is the first reported case of Valsalva retinopathy following EGD under propofol sedation. Only one other reported case of Valsalva retinopathy occurring during EGD exists in the publicly available literature, but it occurred without sedation [12]. In summary, the Valsalva maneuver could be caused in patients under propofol sedation during EGD because 3057 March 21, 2014 Volume 20 Issue 11

339 Park JH et al. Valsalva retinopathy following esophagogastroduodenoscopy of incomplete control of the depth of sedation. Valsalva retinopathy should be considered on the differential diagnosis when observing a patient complaining of blurred vision following EGD under sedation. COMMENTS Case characteristics A 43-year-old woman presented with a complaint of decreased vision after esophagogastroduodenoscopy (EGD) under propofol sedation. Clinical diagnosis Valsalva retinopathy was highly suspicious by clinical history. Differential diagnosis The differential diagnosis included diabetic retinopathy, leukemic retinopathy, and retinal arterial macroaneurysm. Laboratory diagnosis Laboratory findings were within normal limits. Imaging diagnosis Fundus examination showed a large preretinal hemorrhage surrounded by multiple small retinal hemorrhages in the posterior pole. Treatment One month later, pars plana vitrectomy was performed to treat persistent vitreous hemorrhage. Related reports Valsalva retinopathy has been reported following aerobic exercise, vigorous sexual activity, vomiting, forceful coughing, and weightlifting. Term explanation Valsalva retinopathy is a unilateral or bilateral condition that occurs when increased intrathoracic or intra-abdominal pressure transmitted to the eye causes a sharp rise in the intraocular venous pressure and rupture of superficial retinal capillaries. Experiences and lessons Valsalva retinopathy should be included in the differential diagnosis when a patient complains of blurred vision following EGD. Peer review Valsalva retinopathy is not a common ophthalmologic complication associated with Valsalva maneuver. This case report indicate that an unexpected sudden intra-abdominal rise in pressure can occur during EGD under propofol induced sedation, and thus could cause extensive retinal hemorrhage. REFERENCES 1 Duane TD. Valsalva hemorrhagic retinopathy. Trans Am Ophthalmol Soc 1972; 70: [PMID: ] 2 Geddes JF, Talbert DG. Paroxysmal coughing, subdural and retinal bleeding: a computer modelling approach. Neuropathol Appl Neurobiol 2006; 32: [PMID: DOI: /j x] 3 Sueke H. Valsalva retinopathy induced by vigorous nightclub dancing. Med J Aust 2009; 190: 333 [PMID: ] 4 Markovits AS. Sudden visual loss associated with sexual activity. Arch Ophthalmol 1996; 114: 106 [PMID: DOI: /archopht ] 5 Georgiou T, Pearce IA, Taylor RH. Valsalva retinopathy associated with blowing balloons. Eye (Lond) 1999; 13 (Pt 5): [PMID: DOI: /eye ] 6 Fanin LA, Thrasher JB, Mader TH, Truxal AR. Valsalva retinopathy associated with transrectal prostate biopsy. Br J Urol 1994; 74: [PMID: DOI: /j X tb16641.x] 7 Krepler K, Wedrich A, Schranz R. Intraocular hemorrhage associated with dental implant surgery. Am J Ophthalmol 1996; 122: [PMID: ] 8 Callender D, Beirouty ZA, Saba SN. Valsalva haemorrhagic retinopathy in a pregnant woman. Eye (Lond) 1995; 9 (Pt 6): [PMID: DOI: /eye ] 9 Deane JS, Ziakas N. Valsalva retinopathy in pregnancy. Eye (Lond) 1997; 11 (Pt 1): [PMID: DOI: / eye ] 10 Kim JY, Lee DH, Lee JH, Yoon IeN. Valsalva retinopathy associated with an oratorical contest. Korean J Ophthalmol 2009; 23: [PMID: DOI: /kjo ] 11 Oboh AM, Weilke F, Sheindlin J. Valsalva retinopathy as a complication of colonoscopy. J Clin Gastroenterol 2004; 38: [PMID: DOI: /01.mcg e] 12 Choi SW, Lee SJ, Rah SH. Valsalva retinopathy associated with fiberoptic gastroenteroscopy. Can J Ophthalmol 2006; 41: [PMID: DOI: /S (06)80013-X] 13 Cohen LB, Wecsler JS, Gaetano JN, Benson AA, Miller KM, Durkalski V, Aisenberg J. Endoscopic sedation in the United States: results from a nationwide survey. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 14 Paspatis GA, Manolaraki MM, Tribonias G, Theodoropoulou A, Vardas E, Konstantinidis K, Chlouverakis G, Karamanolis DG. Endoscopic sedation in Greece: results from a nationwide survey for the Hellenic Foundation of gastroenterology and nutrition. Dig Liver Dis 2009; 41: [PMID: DOI: /j.dld ] 15 Riphaus A, Rabofski M, Wehrmann T. Endoscopic sedation and monitoring practice in Germany: results from the first nationwide survey. Z Gastroenterol 2010; 48: [PMID: DOI: /s ] 16 Baudet JS, Borque P, Borja E, Alarcón-Fernández O, Sánchezdel-Río A, Campo R, Avilés J. Use of sedation in gastrointestinal endoscopy: a nationwide survey in Spain. Eur J Gastroenterol Hepatol 2009; 21: [PMID: DOI: /MEG.0b013e328314b7ca] 17 Gibran SK, Kenawy N, Wong D, Hiscott P. Changes in the retinal inner limiting membrane associated with Valsalva retinopathy. Br J Ophthalmol 2007; 91: [PMID: DOI: /bjo ] 18 Bailey PL, Zuccaro G. Sedation for endoscopic procedures: not as simple as it seems. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 19 Külling D, Orlandi M, Inauen W. Propofol sedation during endoscopic procedures: how much staff and monitoring are necessary? Gastrointest Endosc 2007; 66: [PMID: DOI: /j.gie ] 20 Yoshida H, Ayuse T, Ishizaka S, Ishitobi S, Nogami T, Oi K. Management of exaggerated gag reflex using intravenous sedation in prosthodontic treatment. Tohoku J Exp Med 2007; 212: [PMID: DOI: /tjem ] 21 Guglielminotti J, Rackelboom T, Tesniere A, Panhard X, Mentre F, Bonay M, Mantz J, Desmonts JM. Assessment of the cough reflex after propofol anaesthesia for colonoscopy. Br J Anaesth 2005; 95: [PMID: DOI: /bja/ aei175] P- Reviewers: Chatziralli IP, Sivandzadeh GR S- Editor: Wen LL L- Editor: A E- Editor: Wang CH 3058 March 21, 2014 Volume 20 Issue 11

340 Online Submissions: World J Gastroenterol 2014 March 21; 20(11): I-VI ISSN (print) ISSN (online) 2014 Baishideng Publishing Group Co., Limited. All rights reserved. INSTRUCTIONS TO AUTHORS GENERAL INFORMATION World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access (OA) journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1348 experts in gastroenterology and hepatology from 68 countries. Aims and scope The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. WJG is published by Baishideng Publishing Group (BPG) in both electronic and online forms. All WJG articles are published in WJG website and PubMed Central. The major advantages of OA journals are faster release and delivery, no page or graph restrictions, and increased visibility, usage and impact. Full-text PDF articles and electronic/online versions are freely available to global readers. After the paper is published, the author(s) can obtain high-quality PDF files, which contain the journal cover, a list of editorial board members, table of contents, text, and back cover of the journal. BPG has a strong professional editorial team composed of editorial board members, editors-in-chief, science editors, language editors, and electronic editors. BPG currently publishes 43 OA clinical medical journals, including 42 in English, has a total of editorial board members or peer reviewers, and is a world first-class publisher. Columns The columns in the issues of WJG will include: (1) Editorial: The editorial board members are invited to make comments on an important topic in their field in terms of its current research status and future directions to lead the development of this discipline; (2) Frontier: The editorial board members are invited to select a highly cited cutting-edge original paper of his/her own to summarize major findings, the problems that have been resolved and remain to be resolved, and future research directions to help readers understand his/her important academic point of view and future research directions in the field; (3) Diagnostic Advances: The editorial board members are invited to write high-quality diagnostic advances in their field to improve the diagnostic skills of readers. The topic covers general clinical diagnosis, differential diagnosis, pathological diagnosis, laboratory diagnosis, imaging diagnosis, endoscopic diagnosis, biotechnological diagnosis, functional diagnosis, and physical diagnosis; (4) Therapeutics Advances: The editorial board members are invited to write high-quality therapeutic advances in their field to help improve the therapeutic skills of readers. The topic covers medication therapy, psychotherapy, physical therapy, replacement therapy, interventional therapy, minimally invasive therapy, endoscopic therapy, transplantation therapy, and surgical therapy; (5) Field of Vision: The editorial board members are invited to write commentaries on classic articles, hot topic articles, or latest articles to keep readers at the forefront of research and increase their levels of clinical research. Classic articles refer to papers that are included in Web of Knowledge and have received a large number of citations (ranking in the top 1%) after being published for more than years, reflecting the quality and impact of papers. Hot topic articles refer to papers that are included in Web of Knowledge and have received a large number of citations after being published for no more than 2 years, reflecting cutting-edge trends in scientific research. Latest articles refer to the latest published high-quality papers that are included in PubMed, reflecting the latest research trends. These commentary articles should focus on the status quo of research, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions. Basic information about the article to be commented (including authors, article title, journal name, year, volume, and inclusive page numbers; (6) Minireviews: The editorial board members are invited to write short reviews on recent advances and trends in research of molecular biology, genomics, and related cutting-edge technologies to provide readers with the latest knowledge and help improve their diagnostic and therapeutic skills; (7) Review: To make a systematic review to focus on the status quo of research, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions; (8) Topic Highlight: The editorial board members are invited to write a series of articles (7-10 articles) to comment and discuss a hot topic to help improve the diagnostic and therapeutic skills of readers; (9) Medical Ethics: The editorial board members are invited to write articles about medical ethics to increase readers knowledge of medical ethics. The topic covers international ethics guidelines, animal studies, clinical trials, organ transplantation, etc.; (10) Clinical Case Conference or Clinicopathological Conference: The editorial board members are invited to contribute high-quality clinical case conference; (11) Original Articles: To report innovative and original findings in gastroenterology and hepatology; (12) Brief Articles: To briefly report the novel I March 21, 2014 Volume 20 Issue 11

341 Instructions to authors and innovative findings in gastroenterology and hepatology; (13) Meta-Analysis: Covers the systematic review, mixed treatment comparison, meta-regression, and overview of reviews, in order to summarize a given quantitative effect, e.g., the clinical effectiveness and safety of clinical treatments by combining data from two or more randomized controlled trials, thereby providing more precise and externally valid estimates than those which would stem from each individual dataset if analyzed separately from the others; (14) Case Report: To report a rare or typical case; (15) Letters to the Editor: To discuss and make reply to the contributions published in WJG, or to introduce and comment on a controversial issue of general interest; (16) Book Reviews: To introduce and comment on quality monographs of gastroenterology and hepatology; and (17) Autobiography: The editorial board members are invited to write their autobiography to provide readers with stories of success or failure in their scientific research career. The topic covers their basic personal information and information about when they started doing research work, where and how they did research work, what they have achieved, and their lessons from success or failure. Name of journal World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) Launch date October 1, 1995 Frequency Weekly Editors-in-chief Damian Garcia-Olmo, MD, PhD, Doctor, Professor, Surgeon, Department of Surgery, Universidad Autonoma de Madrid; Department of General Surgery, Fundacion Jimenez Diaz University Hospital, Madrid 28040, Spain Saleh A Naser, PhD, Professor, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL 32816, United States Stephen C Strom, PhD, Professor, Department of Laboratory Medicine, Division of Pathology, Karolinska Institutet, Stockholm , Sweden Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States Editorial office Jin-Lei Wang, Director Xiu-Xia Song, Vice Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: bpgoffice@wjgnet.com Publisher Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: bpgoffice@wjgnet.com Production center Beijing Baishideng BioMed Scientific Co., Limited Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: Representative office USA Office 8226 Regency Drive, Pleasanton, CA , United States Instructions to authors Full instructions are available online at com/ /g_info_ htm Indexed and abstracted in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Thomson Reuters, 2011 Impact Factor: (32/74 Gastroenterology and Hepatology). SPECIAL STATEMENT All articles published in this journal represent the viewpoints of the authors except where indicated otherwise. Biostatistical editing Statistical review is performed after peer review. We invite an expert in Biomedical Statistics to evaluate the statistical method used in the paper, including t test (group or paired comparisons), chi-squared test, ridit, probit, logit, regression (linear, curvilinear, or stepwise), correlation, analysis of variance, analysis of covariance, etc. The reviewing points include: (1) Statistical methods should be described when they are used to verify the results; (2) Whether the statistical techniques are suitable or correct; (3) Only homogeneous data can be averaged. Standard deviations are preferred to standard errors. Give the number of observations and subjects (n). Losses in observations, such as drop-outs from the study should be reported; (4) Values such as ED50, LD50, IC50 should have their 95% confidence limits calculated and compared by weighted probit analysis (Bliss and Finney); and (5) The word significantly should be replaced by its synonyms (if it indicates extent) or the P value (if it indicates statistical significance). Conflict-of-interest statement In the interests of transparency and to help reviewers assess any potential bias, WJG requires authors of all papers to declare any competing commercial, personal, political, intellectual, or religious interests in relation to the submitted work. II March 21, 2014 Volume 20 Issue 11

342 Instructions to authors Referees are also asked to indicate any potential conflict they might have reviewing a particular paper. Before submitting, authors are suggested to read Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Ethical Considerations in the Conduct and Reporting of Research: Conflicts of Interest from International Committee of Medical Journal Editors (ICMJE), which is available at: ethical_4conflicts.html. Statement of informed consent Manuscripts should contain a statement to the effect that all human studies have been reviewed by the appropriate ethics committee or it should be stated clearly in the text that all persons gave their informed consent prior to their inclusion in the study. Details that might disclose the identity of the subjects under study should be omitted. Authors should also draw attention to the Code of Ethics of the World Medical Association (Declaration of Helsinki, 1964, as revised in 2004). Sample wording: [Name of individual] has received fees for serving as a speaker, a consultant and an advisory board member for [names of organizations], and has received research funding from [names of organization]. [Name of individual] is an employee of [name of organization]. [Name of individual] owns stocks and shares in [name of organization]. [Name of individual] owns patent [patent identification and brief description]. Statement of human and animal rights When reporting the results from experiments, authors should follow the highest standards and the trial should conform to Good Clinical Practice (for example, US Food and Drug Administration Good Clinical Practice in FDA-Regulated Clinical Trials; UK Medicines Research Council Guidelines for Good Clinical Practice in Clinical Trials) and/or the World Medical Association Declaration of Helsinki. Generally, we suggest authors follow the lead investigator s national standard. If doubt exists whether the research was conducted in accordance with the above standards, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. Before submitting, authors should make their study approved by the relevant research ethics committee or institutional review board. If human participants were involved, manuscripts must be accompanied by a statement that the experiments were undertaken with the understanding and appropriate informed consent of each. Any personal item or information will not be published without explicit consents from the involved patients. If experimental animals were used, the materials and methods (experimental procedures) section must clearly indicate that appropriate measures were taken to minimize pain or discomfort, and details of animal care should be provided. SUBMISSION OF MANUSCRIPTS Manuscripts should be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Number all pages consecutively, and start each of the following sections on a new page: Title Page, Abstract, Introduction, Materials and Methods, Results, Discussion, Acknowledgements, References, Tables, Figures, and Figure Legends. Neither the editors nor the publisher are responsible for the opinions expressed by contributors. Manuscripts formally accepted for publication become the permanent property of Baishideng Publishing Group Co., Limited, and may not be reproduced by any means, in whole or in part, without the written permission of both the authors and the publisher. We reserve the right to copy-edit and put onto our website accepted manuscripts. Authors should follow the relevant guidelines for the care and use of laboratory animals of their institution or national animal welfare committee. For the sake of transparency in regard to the performance and reporting of clinical trials, we endorse the policy of the ICMJE to refuse to publish papers on clinical trial results if the trial was not recorded in a publiclyaccessible registry at its outset. The only register now available, to our knowledge, is sponsored by the United States National Library of Medicine and we encourage all potential contributors to register with it. However, in the case that other registers become available you will be duly notified. A letter of recommendation from each author s organization should be provided with the contributed article to ensure the privacy and secrecy of research is protected. Authors should retain one copy of the text, tables, photographs and illustrations because rejected manuscripts will not be returned to the author(s) and the editors will not be responsible for loss or damage to photographs and illustrations sustained during mailing. Online submissions Manuscripts should be submitted through the Online Submission System at: Authors are highly recommended to consult the ONLINE INSTRUC- TIONS TO AUTHORS ( g_info_ htm) before attempting to submit online. For assistance, authors encountering problems with the Online Submission System may send an describing the problem to bpgoffice@wjgnet.com, or by telephone: If you submit your manuscript online, do not make a postal contribution. Repeated online submission for the same manuscript is strictly prohibited. MANUSCRIPT PREPARATION All contributions should be written in English. All articles must be submitted using word-processing software. All submissions must be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Style should conform to our house format. Required information for each of the manuscript sections is as follows: Title page Title: Title should be less than 12 words. Running title: A short running title of less than 6 words should be provided. Authorship: Authorship credit should be in accordance with the standard proposed by ICMJE, based on (1) substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; (2) drafting the article or revising it critically for important intellectual content; and (3) final approval of the version to be published. Authors should meet conditions 1, 2, and 3. Institution: Author names should be given first, then the complete name of institution, city, province and postcode. For example, Xu-Chen Zhang, Li-Xin Mei, Department of Pathology, Chengde Medical College, Chengde , Hebei Province, China. One author may be represented from two institutions, for example, George Sgourakis, Department of General, Visceral, and Transplantation Surgery, Essen 45122, Germany; George Sgourakis, 2nd Surgical Department, Korgialenio-Benakio Red Cross Hospital, Athens 15451, Greece. Author contributions: The format of this section should be: III March 21, 2014 Volume 20 Issue 11

343 Instructions to authors Author contributions: Wang CL and Liang L contributed equally to this work; Wang CL, Liang L, Fu JF, Zou CC, Hong F and Wu XM designed the research; Wang CL, Zou CC, Hong F and Wu XM performed the research; Xue JZ and Lu JR contributed new reagents/analytic tools; Wang CL, Liang L and Fu JF analyzed the data; and Wang CL, Liang L and Fu JF wrote the paper. Supportive foundations: The complete name and number of supportive foundations should be provided, e.g. Supported by National Natural Science Foundation of China, No Correspondence to: Only one corresponding address should be provided. Author names should be given first, then author title, affiliation, the complete name of institution, city, postcode, province, country, and . All the letters in the should be in lower case. A space interval should be inserted between country name and address. For example, Montgomery Bissell, MD, Professor of Medicine, Chief, Liver Center, Gastroenterology Division, University of California, Box 0538, San Francisco, CA 94143, United States. montgomery.bissell@ucsf.edu Telephone and fax: Telephone and fax should consist of +, country number, district number and telephone or fax number, e.g., Telephone: Fax: Peer reviewers: All articles received are subject to peer review. Normally, three experts are invited for each article. Decision on acceptance is made only when at least two experts recommend publication of an article. All peer-reviewers are acknowledged on Express Submission and Peer-review System website. Abstract There are unstructured abstracts (no less than 200 words) and structured abstracts. The specific requirements for structured abstracts are as follows: An informative, structured abstract should accompany each manuscript. Abstracts of original contributions should be structured into the following sections: AIM (no more than 20 words; Only the purpose of the study should be included. Please write the Aim in the form of To investigate/study/ ), METH- ODS (no less than 140 words for Original Articles; and no less than 80 words for Brief Articles), RESULTS (no less than 150 words for Original Articles and no less than 120 words for Brief Articles; You should present P values where appropriate and must provide relevant data to illustrate how they were obtained, e.g., 6.92 ± 3.86 vs 3.61 ± 1.67, P < 0.001), and CONCLUSION (no more than 26 words). Key words Please list 5-10 key words, selected mainly from Index Medicus, which reflect the content of the study. Core tip Please write a summary of less than 100 words to outline the most innovative and important arguments and core contents in your paper to attract readers. Text For articles of these sections, original articles and brief articles, the main text should be structured into the following sections: INTRODUCTION, MATERIALS AND METHODS, RE- SULTS and DISCUSSION, and should include appropriate Figures and Tables. Data should be presented in the main text or in Figures and Tables, but not in both. Illustrations Figures should be numbered as 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each figure on a separate page. Detailed legends should not be provided under the figures. This part should be added into the text where the figures are applicable. Keeping all elements compiled is necessary in line-art image. Scale bars should be used rather than magnification factors, with the length of the bar defined in the legend rather than on the bar itself. File names should identify the figure and panel. Avoid layering type directly over shaded or textured areas. Please use uniform legends for the same subjects. For example: Figure 1 Pathological changes in atrophic gastritis after treatment. A:...; B:...; C:...; D:...; E:...; F:...; G: etc. It is our principle to publish high resolution-figures for the E-versions. Tables Three-line tables should be numbered 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each table. Detailed legends should not be included under tables, but rather added into the text where applicable. The information should complement, but not duplicate the text. Use one horizontal line under the title, a second under column heads, and a third below the Table, above any footnotes. Vertical and italic lines should be omitted. Notes in tables and illustrations Data that are not statistically significant should not be noted. a P < 0.05, b P < 0.01 should be noted (P > 0.05 should not be noted). If there are other series of P values, c P < 0.05 and d P < 0.01 are used. A third series of P values can be expressed as e P < 0.05 and f P < Other notes in tables or under illustrations should be expressed as 1 F, 2 F, 3 F; or sometimes as other symbols with a superscript (Arabic numerals) in the upper left corner. In a multi-curve illustration, each curve should be labeled with,,,,,, etc., in a certain sequence. Acknowledgments Brief acknowledgments of persons who have made genuine contributions to the manuscript and who endorse the data and conclusions should be included. Authors are responsible for obtaining written permission to use any copyrighted text and/or illustrations. REFERENCES Coding system The author should number the references in Arabic numerals according to the citation order in the text. Put reference numbers in square brackets in superscript at the end of citation content or after the cited author s name. For citation content which is part of the narration, the coding number and square brackets should be typeset normally. For example, Crohn s disease (CD) is associated with increased intestinal permeability [1,2]. If references are cited directly in the text, they should be put together within the text, for example, From references [19,22-24], we know that.... When the authors write the references, please ensure that the order in text is the same as in the references section, and also ensure the spelling accuracy of the first author s name. Do not list the same citation twice. PMID and DOI Pleased provide PubMed citation numbers to the reference list, e.g., PMID and DOI, which can be found at nlm.nihgov/sites/entrez?db=pubmed and org/simpletextquery/, respectively. The numbers will be used IV March 21, 2014 Volume 20 Issue 11

344 Instructions to authors in E-version of this journal. Style for journal references Authors: the name of the first author should be typed in boldfaced letters. The family name of all authors should be typed with the initial letter capitalized, followed by their abbreviated first and middle initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong Pan as Pan BR). The title of the cited article and italicized journal title (journal title should be in its abbreviated form as shown in PubMed), publication date, volume number (in black), start page, and end page [PMID: DOI: /wjg ]. Style for book references Authors: the name of the first author should be typed in boldfaced letters. The surname of all authors should be typed with the initial letter capitalized, followed by their abbreviated middle and first initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong Pan as Pan BR) Book title. Publication number. Publication place: Publication press, Year: start page and end page. Format Journals English journal article (list all authors and include the PMID where applicable) 1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J, Kubale R, Feuerbach S, Jung F. Evaluation of quantitative contrast harmonic imaging to assess malignancy of liver tumors: A prospective controlled two-center study. World J Gastroenterol 2007; 13: [PMID: DOI: /wjg ] Chinese journal article (list all authors and include the PMID where applicable) 2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic effect of Jianpi Yishen decoction in treatment of Pixudiarrhoea. Shijie Huaren Xiaohua Zazhi 1999; 7: In press 3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M. Signature of balancing selection in Arabidopsis. Proc Natl Acad Sci USA 2006; In press Organization as author 4 Diabetes Prevention Program Research Group. Hypertension, insulin, and proinsulin in participants with impaired glucose tolerance. Hypertension 2002; 40: [PMID: PMCID: DOI: /01.HYP ] Both personal authors and an organization as author 5 Vallancien G, Emberton M, Harving N, van Moorselaar RJ; Alf-One Study Group. Sexual dysfunction in 1, 274 European men suffering from lower urinary tract symptoms. J Urol 2003; 169: [PMID: DOI: /01. ju ] No author given 6 21st century heart solution may have a sting in the tail. BMJ 2002; 325: 184 [PMID: DOI: /bmj ] Volume with supplement 7 Geraud G, Spierings EL, Keywood C. Tolerability and safety of frovatriptan with short- and long-term use for treatment of migraine and in comparison with sumatriptan. Headache 2002; 42 Suppl 2: S93-99 [PMID: DOI: /j s2.7.x] Issue with no volume 8 Banit DM, Kaufer H, Hartford JM. Intraoperative frozen section analysis in revision total joint arthroplasty. Clin Orthop Relat Res 2002; (401): [PMID: DOI: / ] No volume or issue 9 Outreach: Bringing HIV-positive individuals into care. HRSA Careaction 2002; 1-6 [PMID: ] Books Personal author(s) 10 Sherlock S, Dooley J. Diseases of the liver and billiary system. 9th ed. Oxford: Blackwell Sci Pub, 1993: Chapter in a book (list all authors) 11 Lam SK. Academic investigator s perspectives of medical treatment for peptic ulcer. In: Swabb EA, Azabo S. Ulcer disease: investigation and basis for therapy. New York: Marcel Dekker, 1991: Author(s) and editor(s) 12 Breedlove GK, Schorfheide AM. Adolescent pregnancy. 2nd ed. Wieczorek RR, editor. White Plains (NY): March of Dimes Education Services, 2001: Conference proceedings 13 Harnden P, Joffe JK, Jones WG, editors. Germ cell tumours V. Proceedings of the 5th Germ cell tumours Conference; 2001 Sep 13-15; Leeds, UK. New York: Springer, 2002: Conference paper 14 Christensen S, Oppacher F. An analysis of Koza s computational effort statistic for genetic programming. In: Foster JA, Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Genetic programming. EuroGP 2002: Proceedings of the 5th European Conference on Genetic Programming; 2002 Apr 3-5; Kinsdale, Ireland. Berlin: Springer, 2002: Electronic journal (list all authors) 15 Morse SS. Factors in the emergence of infectious diseases. Emerg Infect Dis serial online, , cited ; 1(1): 24 screens. Available from: URL: ncidod/eid/index.htm Patent (list all authors) 16 Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee. Flexible endoscopic grasping and cutting device and positioning tool assembly. United States patent US Aug 1 Statistical data Write as mean ± SD or mean ± SE. Statistical expression Express t test as t (in italics), F test as F (in italics), chi square test as χ 2 (in Greek), related coefficient as r (in italics), degree of freedom as υ (in Greek), sample number as n (in italics), and probability as P (in italics). Units Use SI units. For example: body mass, m (B) = 78 kg; blood pressure, p (B) = 16.2/12.3 kpa; incubation time, t (incubation) = 96 h, blood glucose concentration, c (glucose) 6.4 ± 2.1 mmol/l; blood CEA mass concentration, p (CEA) = mg/l; CO 2 volume fraction, 50 ml/l CO 2, not 5% CO 2 ; likewise for 40 g/l formaldehyde, not 10% formalin; and mass fraction, 8 ng/g, etc. Arabic numerals such as 23, 243, 641 should be read The format for how to accurately write common units and quantums can be found at: g_info_ htm. V March 21, 2014 Volume 20 Issue 11

345 Instructions to authors Abbreviations Standard abbreviations should be defined in the abstract and on first mention in the text. In general, terms should not be abbreviated unless they are used repeatedly and the abbreviation is helpful to the reader. Permissible abbreviations are listed in Units, Symbols and Abbreviations: A Guide for Biological and Medical Editors and Authors (Ed. Baron DN, 1988) published by The Royal Society of Medicine, London. Certain commonly used abbreviations, such as DNA, RNA, HIV, LD50, PCR, HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS, ATP, EDTA, mab, can be used directly without further explanation. Italics Quantities: t time or temperature, c concentration, A area, l length, m mass, V volume. Genotypes: gyra, arg 1, c myc, c fos, etc. Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc. Biology: H. pylori, E coli, etc. Examples for paper writing All types of articles writing style and requirement will be found in the link: Info.aspx?id=15. RESUBMISSION OF THE REVISED MANUSCRIPTS Authors must revise their manuscript carefully according to the revision policies of Baishideng Publishing Group Co., Limited. The revised version, along with the signed copyright transfer agreement, responses to the reviewers, and English language Grade A certificate (for non-native speakers of English), should be submitted to the online system via the link contained in the sent by the editor. If you have any questions about the revision, please send to esps@wjgnet.com. Language evaluation The language of a manuscript will be graded before it is sent for revision. (1) Grade A: priority publishing; (2) Grade B: minor language polishing; (3) Grade C: a great deal of language polishing needed; and (4) Grade D: rejected. Revised articles should reach Grade A. Copyright assignment form Please download a Copyright assignment form from Responses to reviewers Please revise your article according to the comments/suggestions provided by the reviewers. The format for responses to the reviewers comments can be found at: com/ /g_info_ htm Proof of financial support For papers supported by a foundation, authors should provide a copy of the approval document and serial number of the foundation. STATEMENT ABOUT ANONYMOUS PUBLICA- TION OF THE PEER REVIEWERS COMMENTS In order to increase the quality of peer review, push authors to carefully revise their manuscripts based on the peer reviewers' comments, and promote academic interactions among peer reviewers, authors and readers, we decide to anonymously publish the reviewers comments and author s responses at the same time the manuscript is published online. PUBLICATION FEE WJG is an international, peer-reviewed, open access, online journal. Articles published by this journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. Authors of accepted articles must pay a publication fee. Publication fee: 1365 USD per article. All invited articles are published free of charge. VI March 21, 2014 Volume 20 Issue 11

346 Published by Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: I S S N Baishideng Publishing Group Co., Limited. All rights reserved.