Low-level laser therapy (LLLT) was pioneered in

Transcription

1 Pre-Irradiation of Blood by Gallium Aluminum Arsenide (83 nm) Low-Level Laser Enhances Peripheral Endogenous Opioid Analgesia in Rats Satoshi Hagiwara, MD, PhD Hideo Iwasaka, MD, PhD Akira Hasegawa, MD Takayuki Noguchi, MD, PhD BACKGROUND: Low-level laser therapy (LLLT) has been reported to relieve pain, free of side effects. However, the mechanisms underlying LLLT are not well understood. Recent studies have also demonstrated that opioid-containing immune cells migrate to inflamed sites and release -endorphins to inhibit pain as a mode of peripheral endogenous opioid analgesia. We investigated whether pre-irradiation of blood by LLLT enhances peripheral endogenous opioid analgesia. METHODS: The effect of LLLT pretreatment of blood on peripheral endogenous opioid analgesia was evaluated in a rat model of inflammation. Additionally, the effect of LLLT on opioid production was also investigated in vitro in rat blood cells. The expression of the -endorphin precursors, proopiomelanocortin and corticotrophin releasing factor, were investigated by reverse transcription polymerase chain reaction. RESULTS: LLLT pretreatment produced an analgesic effect in inflamed peripheral tissue, which was transiently antagonized by naloxone. Correspondingly, -endorphin precursor mrna expression increased with LLLT, both in vivo and in vitro. CONCLUSION: These findings suggest that that LLLT pretreatment of blood induces analgesia in rats by enhancing peripheral endogenous opioid production, in addition to previously reported mechanisms. (Anesth Analg 28;17:158 63) Low-level laser therapy (LLLT) was pioneered in Europe and Russia in the early 196s. LLLT is principally used to treat pain by using red or near infrared monochromatic light sources emitting low energies (in the milliwatt range). 1 3 The irradiation in LLLT uses a local high photon density monochromatic light source. 4 Previous work has proposed that any biologic effects are secondary to the direct effects of photonic radiation and are not the result of thermal processes. 5 Studies of the effect of LLLT on the peripheral nervous system have also been encouraging. In a double-blind, controlled trial, LLLT and transcutaneous electric nerve stimulation both significantly reduced pain scores and improved median sensory latency in patients with carpal tunnel syndrome. 6 Pinheiro et al. also demonstrated a reduction of pain-related symptoms after treating patients with maxillofacial pain From the Department of Brain and Nerve Science, Anesthesiology, Oita University Faculty of Medicine, Idaigaoka-Hasamamachi- Yufu City-Oita, Japan. Accepted for publication April 17, 28. Address correspondence and reprint requests to Satoshi Hagiwara, PhD, Department of Brain and Nerve Science, Anesthesiology, Oita University Faculty of Medicine, 1-1 Idaigaoka-Hasamamachi- Yufu City-Oita , Japan. Address to saku@med. oita-u.ac.jp. Copyright 28 International Anesthesia Research Society DOI: /ane.b13e31817ee43e 158 disorders, including trigeminal neuralgia, with laser therapy in a nonrandomized, unblinded study. 7 In the case of neuropathic pain, LLLT may mediate analgesia by releasing local neurotransmitters such as serotonin, 1 promoting endorphin release, 8 or through antiinflammatory effects. 9 Athermic laser irradiation was found to induce a significant increase in skin microcirculation in patients with diabetic microangiopathy, as measured by infrared thermography. 1 At the same time, pain is effectively controlled by various endogenous mechanisms. Studies have shown that these mechanisms are not restricted to the central nervous system. Rather, intrinsic pain control can occur also in the peripheral nervous system, mediated by an interaction between immune cells and sensory neuron terminals. 11 Under stressful conditions or in response to corticotropin-releasing factor (CRF), circulating leukocytes can secrete opioids after migrating to inflamed tissues. 12 Upon preferentially migrating to inflamed sites, the released -endorphins activate pain-inhibiting opioid receptors. 13,14 The major endogenous opioid, -endorphin, derives from proopiomelanocortin (POMC), which may be a marker for induced analgesia. 15 The interaction between immune cell-derived opioids and opioid receptors, localized on sensory nerve terminals, can result in clinically measurable peripheral endogenous opioid analgesia. 16,17 Vol. 17, No. 3, September 28

2 In several studies, LLLT has been shown to affect several immunologic reactions The present study investigated whether LLLT pretreatment of blood induces immune cells to express -endorphins at inflamed sites, thereby enhancing peripheral endogenous opioid analgesia. METHODS Animals The study protocol was approved by the Animal Care and Use Committee of Oita University (Oita, Japan). Experiments were performed on male Sprague Dawley rats (25 3 g; Japan Charles River, Yokohama), individually housed in cages lined with sawdust. Standard laboratory rodent food and water were available ad libitum. Room temperature and relative humidity were maintained at 22.5 C and 6%, respectively, under a 12-h light and dark cycle. All testing was conducted in the light phase, using separate groups of animals. All experiments were conducted in accordance with the Institutional Committee for the Care and Use of Animals and the guidelines on ethical standards for investigations on experimental pain in animals. 21 Drugs Freund s complete adjuvant (FCA) was purchased from PIERCE (Rockford, IL). Naloxone hydrochloride (naloxone) was purchased from Sigma Chemical Co. (St. Louis, MO). Induction of Adjuvant-Induced Peripheral Inflammation In both control and LLLT animals, unilateral hindpaw inflammation was induced by injecting.15 ml of FCA into the right hindpaw. All groups were injected with.15 ml of saline into the left hindpaw. Injections were performed under brief sevoflurane anesthesia (Maruishi CO, Osaka, Japan). LLLT An infrared gallium aluminum arsenide diode laser device (Mochida Siemens Medical Systems CO, Tokyo, Japan) with a wavelength of 83 nm and a maximum power output of 1 mw was used for treatments. Rats were randomly assigned to three groups (n 2 per group): 1) saline group: receiving saline injection with no LLLT treatment; 2) control group: receiving placebo laser treatment before FCA injection; or 3) LLLT group: receiving 5 min of LLLT administered to blood (3 J total dose) before FCA injection. Under the 3% sevoflurane anesthesia, venous blood (2 ml) was obtained from the left external jugular vein and treated with placebo laser or LLLT, in the presence of heparin anticoagulation. After treatment, blood was re-transfused back into the experimental animal. This process of extrapolation, laser or placebo treatment, and re-infusion was performed five times for both control and LLLT groups, 4 h before the induction of peripheral inflammation with FCA injection. Measurement of Withdrawal Latency by Plantar Test Withdrawal latency was determined by the plantar test, using the method modified by Hargreaves et al. 22 This variable was assayed 24 h before LLLT or placebo treatment, and then 12 h, 24 h, and 96 h after the intraplantar injection of FCA or saline. The rats were placed in an acrylic box with a glass pane floor, and the plantar surface of their right hindpaw was exposed to a beam of infrared radiation (Ugo Basile, Stoelting, Chicago, IL). The latency of paw withdrawal was automatically measured by the apparatus. Paw withdrawal latencies were recorded at an infrared intensity of 7 W twice per experimental session, separated by a minimum interval of 5 min. Minimum and maximum limits for paw withdrawal latency were assigned at 1 and 3 s, respectively. Furthermore, six rats from each experimental group were given naloxone at.5 mg/kg intraperitoneally. The withdrawal latency was determined by plantar test before naloxone administration as well as 3 min post-injection. Histological Analysis After 1 day of LLLT (n 3) or placebo (n 3) treatment, six rats were anesthetized with sevoflurane and each transcardially perfused with 6 ml of warm saline, followed by 3 ml of 1% (w/v) formaldehyde. The hindpaws were removed, immediately immersed in 1% buffered formalin, embedded in paraffin, and cut into 4 m thick sections. Paraffin sections were routinely stained with hematoxylin and eosin (H&E). Specimen preparation and H&E staining were performed in the same manner for the normal group (n 3). Immunohistochemistry After 1 day of LLLT (n 3) or placebo (n 3) treatment, another six rats were also anesthetized and transcardially perfused with 6 ml of warm saline, followed by 3 ml of.16 M phosphate buffer solution (ph 6.9) containing 4% (w/v) paraformaldehyde and.2% (v/v) picric acid. The hindpaws were removed, post-fixed for 24 h, and sunk in serial solutions of 1%, 15%, and 2% (w/v) sucrose at 4 C for 24 h. The tissue was embedded in OCT Tissue Tek compound (Miles Scientific, Paris, France), frozen and cut into 7 m thick sections. The sections were incubated overnight with anti- -endorphin (1:1; Peninsula Laboratories, San Carlos, CA), incubated for 9 min with the appropriate biotinylated secondary antibody and avidin-biotin-conjugated peroxidase, washed, and stained for 3 to 5 min with 3, 3 diaminobenzidine tetrahydrochloride containing.1% H 2 O 2 in.5 M Tris-buffered saline (ph 7.6). After development, the slides were counterstained with Mayer s hematoxylin and mounted. Vol. 17, No. 3, September International Anesthesia Research Society 159

3 CRF POMC Beta-Actin A Laser Time Relative Expression Intensity (rate of beta-actin) Relative Expression Intensity (rate of beta-actin) Laser Time B # Figure 1. Reverse transcriptionpolymerase chain reaction (RT-PCR) of endogenous opioid transcripts. (A) Representative RT-PCR products of proopiomelanocortin (POMC), corticotropinreleasing factor (CRF), and -actin, 12 or 24 h after treatment of blood cells with low-level laser therapy (LLLT) or placebo. Both (B) CRF and (C) POMC expression increased after LLLT as revealed by densitometric quantification of transcripts. Data are expressed as the mean sem. P.5, compared with the control group at 12 h. #P.5, compared with the control group at 24 h. C Laser Time Cell Culture and Media Primary cultures of blood cells from experimental rats were used for in vitro experiments. Blood cells were maintained in RPMI 164 medium containing 5% heat-inactive fetal bovine serum and antibiotics at 37 C under 5% CO 2 with ConA. Cells were cultured in 16.3 mm dishes containing 2 ml medium, and collected for reverse transcription-polymerase chain reaction (RT-PCR) after 5 min of LLLT irradiation, giving a total dose of 3 J. RT-PCR RT-PCR was used to quantitatively assess changes in CRF or POMC mrna. RNA was extracted from blood cells or the hindpaws on the first and third day after FCA treatment, using the acid guanidinium thiocyanate phenol chloroform method. 24 RNA concentration was determined using a spectrophotometer DU64 (Beckman, Fullerton, CA) at 26 nm. First strand cdna synthesis from 1 g initial total RNA and subsequent PCR were conducted using a commercial RT-PCR kit (Toyobo CO, Tokyo) on a GeneAmp PCR System 24 (Perkin-Elmer, Wellesley, MA). Primers were designed and PCR conditions optimized for each target amplicon. Specific primers used were 5 CAGAACAACAGTGCGGGCTCA and 5 GGAAAAA- GTTAGCCGCAGCCT for CRF; 5 GGCCTTTCCCCTA- GAGTTCA and 5 TTGATGATGGCGTTCTTGAA for POMC; and 5 GTTCCGATGCCCCGAGGATCT and 5 GCATTTGCGGTGCACGATGGA for -actin. PCR products were confirmed by electrophoresis on 1.5% agarose gels, followed by staining with ethidium bromide. Images of the PCR amplicons were scanned and analyzed by the NIH Image 1.63 software program (Research Services Branch, Bethesda, MD). Band intensities were normalized to -actin. Statistical Analysis These data were analyzed by an analysis of variance (ANOVA). Single comparisons used one-way ANOVA whereas statistical significance of differences between two comparisons was determined by two-way ANOVA. The significance level was set at P.5. RESULTS Effects of LLLT on POMC and CRF mrna Expression in Blood Cells To better understand the physiological consequences of LLLT, we first examined its effect on rat blood cells in vitro. Before exposure of blood cells to LLLT, neither POMC nor CRF mrna were detectable. After exposure of blood cells to LLLT for 12 or 24 h, both POMC and CRF mrna expression increased, as compared to the control placebo-treated group (Fig. 1). Such an increase demonstrated that LLLT exposure induces both POMC and CRF in blood cells. Histological Analysis of Tissue Inflammation On day 2, histological analysis using H&E staining revealed little accumulation of inflammatory cells in the hindpaw plantar tissue of the normal group 16 Irradiation of Blood by Laser Enhances Opioid Analgesia ANESTHESIA & ANALGESIA

4 Figure 2. Histological appearance of subcutaneous tissue 2 days after Freund s complete adjuvant (FCA) injection to plantar hindpaw and either low-level laser therapy (LLLT) or placebo treatment. (A) Minimal accumulation of inflammatory cells is observed in saline-treated animals. An increased level of inflammatory cell accumulation was observed in both (B) placebo-treated control and (C) LLLT groups. Hematoxylin and eosin (H&E), 4. Figure 3. Change in withdrawal latency on hot plate test after Freund s complete adjuvant (FCA) injection and either low-level laser therapy (LLLT) or placebo treatment. (A) Squares represent values measured for the placebo-treated control group whereas circles represent values for the LLLT group. (B) Latency values at different time points after LLLT treatment were quantified and compared with values for the control group. Data are expressed as the mean sem from 6 to 8 rats/group. P.5, compared with the control group. Latency of response (sec) A Pre 12H 1day 2day 3day 7day Time after the treatment of LLLT (days) Laser(times) Days B Latency of response (sec) treated with saline. In contrast, similar levels of inflammatory response were noted in rats injected with FCA, followed by either placebo or LLLT (Fig. 2). Pain Withdrawal Latency Changes in Rats After FCA Treatment and Analgesic Effects of LLLT As an inverse measure of pain, withdrawal latency was significantly reduced at 12 h in rats receiving FCA and placebo treatment compared with those injected with only saline. Furthermore, the LLLT group exhibited a significant increase in withdrawal latency at 24 h after treatment in comparison to the control placebo-treated group, although no significant difference was observed at 12 h. Moreover, the significant analgesia induced by LLLT continued past 48 and 72 h. Hence, LLLT to blood significantly reduced FCA-induced hindpaw pain (P.5) (Fig. 3A). We also examined the relation between analgesia and the amount of LLLT administered. Reducing the LLLT exposure weakened the analgesic effect whereas a higher frequency of LLLT correlated with a greater analgesic effect at 24 h. Therefore, LLLT seemed to Latency of response (sec) FCA Naloxone Days 1 1 Figure 4. Change in withdrawal latency on hotplate test 1 day after naloxone administration following Freund s complete adjuvant (FCA) injection and low-level laser therapy (LLLT) or placebo treatment. Squares represent values measured for the placebo-treated control rats whereas circles represent values for the LLLT group. Data are expressed as the mean sem (n 6/group). P.5, compared with the control group. Vol. 17, No. 3, September International Anesthesia Research Society 161

5 Figure 5. Immunohistochemistry for -endorphin in subcutaneous tissue 2 days after Freund s complete adjuvant (FCA) injection. Beta-endorphin expression in tissue from (A) saline-treated, (B) placebo- and FCA-treated controls, and (C) LLLT and FCA-treated rats. Note that more -endorphin-positive inflammatory cells are present after LLLT as compared with the placebo control (4 ). Arrows indicate -endorphin immunopositive cells. exert an analgesic effect on blood cells in a dosedependent manner (Fig. 3B). Effect of Naloxone on the Analgesic Action of LLLT To verify that LLLT exerts an effect on endogenous analgesia, we antagonized opioid receptors with naloxone. Naloxone transiently reversed the analgesic effect induced by LLLT, reducing the withdrawal latency to a level comparable with that of the control group (P.5) (Fig. 4). Immunohistochemical Analysis of -endorphin Secreting Cells Immunohistochemical analysis revealed slight accumulation of -endorphin-positive cells in tissue from the control group after FCA injection. However, significantly more -endorphin-positive cells were observed in tissue from the LLLT group (Fig. 5). DISCUSSION LLLT has been reported to reduce pain in several model systems Recently, studies suggested that LLLT functions to reduce inflammatory cells. 27,28 Mechanistically, LLLT inhibits various inflammatory mediators, including tumor necrosis factor-. 24,29 In addition, LLLT has been shown to reduce cyclooxygenase-2 mrna. 3 The cyclooxygenase-2 pathway is activated in stress conditions, such as inflammation. 3 These antiinflammatory mechanisms may be related to the analgesic effect of LLLT. In the present study, we demonstrated that LLLT irradiation of blood exerted an analgesic effect on thermal nociceptive stimuli in the inflamed paw tissue of rats that can be transiently antagonized by naloxone. We further demonstrated an upregulation of peripheral opioid precursor expression in blood cells, suggestive of a direct induction by LLLT to mediate analgesia. Hence, LLLT not only exerts an antiinflammatory effect but also induces peripheral opioids to mediate analgesia. Our hypothesis is supported by several lines of evidence. LLLT enhanced the expression of -endorphins to the blood cells. Beta-endorphins, as endogenous opioids, have a potent analgesic action. 31 Moreover, -endorphins and other opioids were found to cause peripheral analgesia when its precursors, CRF and POMC, were expressed at peripherally inflamed sites. 17,32,33 In our study, LLLT irradiation of blood was associated with expression of CRF and POMC mrna. Indeed, LLLT stimulated the release of corticosteroid hormones in the inflammatory tissue in agreement with previously published work. 34 This was also demonstrated in vitro using cultured blood cells, in which POMC and CRF mrna were detected after LLLT, suggesting a possible increase in -endorphin precursors in the blood cells. This is the first study demonstrating that preirradiation of blood by LLLT enhances peripheral endogenous opioid analgesia. In addition, opioid receptors are important to the analgesic effect in inflammatory pain. 35 Treatment with LLLT might also be expected to produce peripheral analgesia in humans, since POMC and CRF mrna expression are present in human blood cells. 36,37 This finding suggests that one mechanism by which LLLT produces analgesia may be enhancement of peripheral opioids. Peripheral opioid analgesia has received considerable attention as an endogenous pathway of inhibiting pain. Experimental studies using rats have reported that endogenous opioids are released from inflammatory cells, which act on opioid receptors on the peripheral sensory nerves. 12 In conclusion, the present study demonstrates that LLLT pre-irradiation of blood may enhance peripheral endogenous opioid 162 Irradiation of Blood by Laser Enhances Opioid Analgesia ANESTHESIA & ANALGESIA

6 analgesia. However, the mechanism of CRF and POMC induction by LLLT remains unknown and should be examined further. ACKNOWLEDGMENTS The authors wish to thank Dr. Tomohisa Uchida for giving us helpful advice and counting the inflammatory cells. REFERENCES 1. Walker JB. Relief from chronic pain by low power laser irradiation. Neurosci Lett 1983;43: Emmanoulidis O, Diamantopoulos C. CW IR low-power laser application significantly accelerates chronic pain relief rehabilitation of professional athletes. A double blind study. Lasers Surg Med 1986;6: Moore KC, Hira N, Kumar PS, Jayakumar CS, Oshiro T. A double blind crossover trial of low level laser therapy in the treatment of post herpetic neuralgia. Laser Ther 1988;1: Whittaker P. Laser acupuncture: past, present, and future. Lasers Med Sci 24;19: Ohshiro T, Calderhead R. Development of low reactive-level laser therapy and its present status. J Clin Laser Med Surg 1991;9: Naeser MA, Hahn KA, Lieberman BE, Branco KF. Carpal tunnel syndrome pain treated with low-level laser and microamperes transcutaneous electric nerve stimulation: a controlled study. Arch Phys Med Rehabil 22;83: Pinheiro AL, Cavalcanti ET, Pinheiro TI, Alves MJ, Manzi CT. Low-level laser therapy in the management of disorders of the maxillofacial region. J Clin Laser Med Surg 1997;15: Yamamoto H, Ozaki A, Iguchi N, Kinoshita S. Antinociceptive effects of laser irradiation of Hoku point in rats. Pain Clin 1988;8: Ailioaie C, Lupusoru-Ailioaie LM. Beneficial effects of laser therapy in the early stages of rheumatoid arthritis onset. Laser Ther 1999;11: Schindl A, Schindl M, Schon H, Knobler R, Havelec L, Schindl L. Low-intensity laser irradiation improves skin circulation in patients with diabetic microangiopathy. Diabetes Care 1998;21: Stein C, Hassan AH, Przewlocki R, Gramsch C, Peter K, Herz A. Opioids from immunocytes interact with receptors on sensory nerves to inhibit nociception in inflammation. Proc Natl Acad SciUSA199;87: Rittner HL, Machelska H, Stein C. Leukocytes in the regulation of pain and analgesia. J Leukoc Biol 25;78: Machelska H, Cabot PJ, Mousa SA, Zhang Q, Stein C. Pain control in inflammation governed by selectins. Nat Med 1998;4: Hermanussen S, Do M, Cabot PJ. Reduction of beta-endorphincontaining immune cells in inflamed paw tissue corresponds with a reduction in immune-derived antinociception: reversible by donor activated lymphocytes. Anesth Analg 24;98: Przewłocki R, Przewłocka B. Opioids in chronic pain. Eur J Pharmacol 21;429: Stein C. The control of pain in peripheral tissue by opioids. N Engl J Med 1995;332: Cabot PJ, Carter L, Gaiddon C, Zhang Q, Schafer M, Loeffler JP, Stein C. Immune cell-derived -endorphin: production, release, and control of inflammatory pain in rats. J Clin Invest 1997; 1: Ohta A, Abergel RP, Uitto J. Laser modulation of human immune system: inhibition of lymphocyte proliferation by a gallium-arsenide laser at low energy. Lasers Surg Med 1987;7: Yu H, Chang K, Yu C, Chen J, Chen G. Low-energy helium neon laser irradiation stimulates IL-1 and IL-8 release from cultured human keratinocytes. J Invest Dermatol 1996;17: Schindl L, Schindl M, Polo L, Jori G, Perl S, Schindl A. Effects of low power laser-irradiation on differential blood count and body temperature in endotoxin-preimmunized rabbits. Life Sci 1997;6: Zimmermann M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983;16: Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 1988;32: Deleted in proof. 24. Ferreira DM, Zangaro RA, Villaverde AB, Cury Y, Frigo L, Picolo G, Longo I, Barbosa DG. Analgesic effect of He-Ne (632.8 nm) low-level laser therapy on acute inflammatory pain. Photomed Laser Surg 25;23: Zeredo JL, Sasaki KM, Takeuchi Y, Toda K. Antinociceptive effect of Er:YAG laser irradiation in the orofacial formalin test. Brain Res 25;132: Chow RT, Heller GZ, Barnsley L. The effect of 3 mw, 83 nm laser on chronic neck pain: a double-blind, randomized, placebo-controlled study. Pain 26;124: Albertini R, Villaverde AB, Aimbire F, Salgado MA, Bjordal JM, Alves LP, Munin E, Costa MS. Anti-inflammatory effects of low-level laser therapy (LLLT) with two different red wavelengths (66 nm and 684 nm) in carrageenan-induced rat paw edema. J Photochem Photobiol B 27;89: Lopes-Martins RA, Albertini R, Martins PS, Bjordal JM, Faria Neto HC. Spontaneous effects of low-level laser therapy (65 nm) in acute inflammatory mouse pleurisy induced by carrageenan. Photomed Laser Surg 25;23: Aimbire F, Lopes-Martins RA, Castro-Faria-Neto HC, Albertini R, Chavantes MC, Pacheco MT, Leonardo PS, Iversen VV, Bjordal JM. Low-level laser therapy can reduce lipopolysaccharide-induced contractile force dysfunction and TNF-alpha levels in rat diaphragm muscle. Lasers Med Sci 26;21: Albertini R, Aimbire F, Villaverde AB, Silva JA Jr, Costa MS. COX-2 mrna expression decreases in the subplantar muscle of rat paw subjected to carrageenan-induced inflammation after low level laser therapy. Inflamm Res 27;56: Hartwig AC. Peripheral beta-endorphin and pain modulation. Anesth Prog 1991;38: Lu CY, Chou AK, Wu CL, Yang CH, Chen JT, Wu PC, Lin SH, Muhammad R, Yang LC. Gene-gun particle with proopiomelanocortin cdna produces analgesia against formalininduced pain in rats. Gene Ther 22;9: Schafer M, Mousa SA, Stein C. Corticotropin-releasing factor in antinociception and inflammation. Eur J Pharmacol 1997;323: Related Articles, LinksAlbertini R, Aimbire FS, Correa FI, Ribeiro W, Cogo JC, Antunes E, Teixeira SA, De Nucci G, Castro-Faria-Neto HC, Zângaro RA, Lopes-Martins RA. Effects of different protocol doses of low power gallium-aluminumarsenate (Ga-Al-As) laser radiation (65 nm) on carrageenan induced rat paw ooedema. J Photochem Photobiol B 24;27: 74: Joris JL, Dubner R, Hargreaves KM. Opioid analgesia at peripheral sites: a target for opioids released during stress and inflammation? Anesth Analg 1987;66: Mousa SA. Morphological correlates of immune-mediated peripheral opioid analgesia. Adv Exp Med Biol 23;521: Kravchenco IV, Furalev VA. Secretion of immunoreactive corticotropin releasing factor and adrenocorticotropic hormone by T- and B-lymphocytes in response to cellular stress factors. Biochem Biophys Res Commun 1994;24: Vol. 17, No. 3, September International Anesthesia Research Society 163