EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION
|
|
- Alicia Waters
- 5 years ago
- Views:
Transcription
1 No. 137 EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION Takuya MIYAWAKI Professor Graduate School of Medicine, Dentistry and Pharmaceutical Sciences Okayama University Outline The present research is being conducted to further improve the evaluation of our invention to be supported by JST for which a Japanese patent has already been applied in order to apply for 5 overseas patents in the USA, Germany, Italy, France, UK and China, and which was supported by JST for a PCT patent. The invention thereof uses the fact that by adding an α2 adrenergic receptor agonist to a local anesthetic, the effect of the local anesthetic may be prolonged and a local anesthetic composition having higher safety may be made. Furthermore, an object of the present examination and research is to verify an anti-inflammatory action of this α2 adrenergic receptor agonist itself. By adding the α2 adrenergic receptor agonist into the local anesthetic, pain and swelling due to surgery can be relieved by the anti-inflammatory action and the effect of speeding recovery from treatment is expected. Technical Field of the Research Medical agent 1. Advantage of the developed technology The present research is being conducted in order to improve the value of a local anesthetic composition which is already patent pending. The local anesthetic is used in a dental therapy, surgical procedures and in pain clinics; however, from a viewpoint of controlling pain, it has been developed while focusing on obtaining a stronger anesthetic effect, a longer acting period and fewer side effects. However, after administrating the local anesthetic, an invasive procedure such as a surgery may be performed and when the effect of the local anesthetic disappears(after several hours at most), a patient may suffer from pain or swelling. In the present examination and research, we note the anti-inflammatory action of the α2 adrenergic receptor agonist (hereinafter, referred to as α2 receptor agonist)which is a substance added to the local anesthetic composition for which our patent is pending and an aim thereof is to provide the antiinflammatory action to the local anesthetic. By developing the local anesthetic having the antiinflammatory action, it is possible to suppress reactions(pain or swelling)due to the
2 inflammation which occurs along with invasive procedures, reduce the pain of the patient and further, an early recovery after the surgery may be expected. Indeed, it will be an innovative development in a field of the local anesthetic. As far as we know, there are no inventions regarding this yet, in Japan or abroad. In this regard, if we advance the research as quickly as possible, we can get a big lead over our academic rivals. 2. Marketability and Potential of the Technology Since speeding recovery after surgery means promoting early discharge of the patient from the hospital, it is an important issue for medical economics. Since there is a tendency to convert as much as possible from major surgery which needs general anesthetic towards surgery which is less invasive, so-called minimally invasive surgery is a great global aim in surgical fields. With these developments, some surgeries which have been performed using a general anesthetic will be performed using a local anesthetic and the demand for local anesthetics is expected to increase. It is reported that long term prognosis(mortality rate)after surgery is worsened due to the excessive general anesthetic use, an invasive procedure with respect to the body and overdose administration of the general anesthetic. From this viewpoint, the marketability of local anesthetics seems set to expand in the future. Furthermore, when the early recovery after the surgery is focused upon as an objective, because anti-inflammatory action will help with this greatly, it is expected that anti-inflammatory therapy will be increasingly developed in the future. However, if it is possible to provide the anti-inflammatory action along with the local anesthetic, anti-inflammatory action can be easily realized by administrating the local anesthetic, increasing its utility value so that yet more important marketability can be expected. 3. Object and Demand An objective of the present study is to verify the anti-inflammatory action which is due to α2 receptor agonist, that is added to the local anesthetic composition which is already patent pending and which is a basis for the present research. We have already verified that there is an antiedematous effect in the α2 receptor agonist through an animal test(fig. 1)
3 Fig. 1 On the basis of a test result using a mouse footpad swelling assay, Fig. 1 shows time dependent changes of inflammatory swelling(increase in footpad volume)which are caused by Carrageenin which is a prophlogistic substance. Fig. 1 shows the antiedematous effect of the α2 receptor agonist(dexmedetomidine)with respect to the inflammatory swelling due to the Carrageenin. The inflammatory reaction such as swelling or the like is amplified through a mediator of inflammation which is generated in a tissue due to the prophlogistic substance, injuries or the like. In order to explain the action mechanism of the antiedematous effect of the α2 receptor agonist, it is necessary to observe the movement of the mediator of inflammation. In this regard, a specific object of the present examination and research is to investigate the influence of the α2 receptor agonist with respect to the generation of the mediator of inflammation. 4. Planned Activities (1)Samples 1)Target animal: eight-week-old-male ICR mouse 2) Local inflammatory model: Noninfectious local inflammatory model: administer 5% Carrageenin as a prophlogistic substance 3)Stimulus site: inject subcutaneously in a rear foot paw 4) Administration of α2 receptor agonist(dexmedetomidine): local administration(mix with a prophlogistic substance) 5) Evaluation of an instance of inflammation: measure the swelling rate of the inflammatory swelling cause by the prophlogistic substance which is injected to the rear foot of the mouse along with the time lapse using a swelling volume measuring device. 6) Preparation of sample: After performing the evaluation of the inflammation, the stimulus site of the target animal is removed, the sample of the removed site is divided for immunohistochemical evaluation and for gene expression evaluation. Sequentially, the divided samples are fixed in separate preservative solutions and are immediately frozen and preserved at minus 80 by an ultra deep freezer
4 (2)Chemical evaluation of immune tissue 1) Processing of samples and HE dyeing: the samples are immersed and fixed for one night in a fixing solution of 10% formalin and are permeated by a paraffin permeating device to form a paraffin block. Using a dedicated rotary microtome, the block is sliced to have a thickness of 5µm HE dyeing is performed, and the slice is observed. 2) First antibody response: After blocking the cells by 0.5% saponin and 3% BSA, the primary antibody with respect to a target inflammatory mediator(tnf-α, IL-1β, COX2), Alexa Flour 568(Molecular Probes)red, and F-actin green for verifying cell cytoskeleton are used. 3)Secondary antibody response: Histofine simple stain is used. 4) Observation of fluorescence stain: After the coloring(brown)due to DAB coloring, nuclear staining is performed with hematoxylin and it is observed by confocal scanning laser microscopy. (3)Gene expression evaluation 1) Adjustment of sample: The sample which is preserved at minus 80 has RNA extracted and purified using a cooled microcentrifuge, a centrifuge rotor and RNA extraction kit, a Dnase treatment is performed, reverse transcription is performed using an RT kit, and a cdna library of each mediator is manufactured. 2) Quantitative evaluation of mrna by real-time polymerase chain reaction(rt-pcr): Capillary, primer for each mediator and MgCl2 are added to the manufactured cdna library. The temperature for the real-time PCR analysis system and annealing is set to be 68, the real-time PCR is performed over 40 cycles, and the mediator gene(mrna) expression quantity is determined, using β-actin as an internal reference. 5. Aim An aim of the present research is to verify whether the generation of these mediators of the inflammation are suppressed by locally administrating the α2 receptor agonist, testing with inflammatory cytokine(tnf α, IL-1β)and COX2(cyclooxygenase-2)as representative mediators of inflammation. By doing so, it is possible to prove that the anti inflammatory action of the α2 receptor agonist is not a simple phenomenon and the action mechanism can be proved as well, thereby raising the reliability of α
5 6. Patent 1 Title of the Patent local anesthetic composition Application No. PCT/JP2009/ Application date October 30, 2008 Applicant Okayama University Inventor Takuya MIYAWAKI, Tatsushi YOSHITOMI Outline It was found that by adding an α2 adrenergic receptor agonist to a local anesthetic in which adrenalin or salt thereof is included, the content of the adrenalin or the salt thereof can be reduced and a local anesthetic composition having a high safety is obtained. Contact Person Name Kenich YOSHIDA yoshidak@cc.okayama-u.ac.jp Name of department Intellectual Property Office of Organization For Research Promotion & Collaboration of OKAYAMA University Position Manager of Intellectual Property Office
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationEvaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel
12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel Un-Cheol.Yeo, M.D. S&U Dermatologic Clinic,
More informationEvaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL
12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL Un-Cheol.Yeo, MD S&U Dermatologic Clinic,
More informationTitle Suppression of tumoral metastasis and invasiveness via the control of cell-to-cell adhesion networks
Title Suppression of tumoral metastasis and invasiveness via the control of cell-to-cell adhesion networks Background Controlling the metastasis and invasiveness of cancer is a key element of cancer therapy,
More informationLeukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationExpressArt FFPE Clear RNAready kit
Features and Example Results General problems with FFPE samples Formalin-fixation of tissues results in severe RNA fragmentation, as well as in RNA RNA, RNA-DNA and RNA protein cross-linking, which impairs
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationFigure S1. Figure S2. Figure S3.
Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationEyeGene Inc. Contact Information Korea Health Industry Development Institute
EG-Mirotin: First-in-Class recombinant polypeptide novel subcutaneous drug containing RGD-motif targeted to suppress edema and vascular leakage for Nonproliferative Diabetic Retinopathy (NPDR) EyeGene
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationTitle. CitationJournal of Bioscience and Bioengineering, 100(1): 12. Issue Date Doc URL. Type. File Information
Title Effect of chondroitin sulfate and hyaluronic acid on Author(s)Nishimoto, Shohei; Takagi, Mutsumi; Wakitani, Shigey CitationJournal of Bioscience and Bioengineering, 100(1): 12 Issue Date 2005-07
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationAquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT
AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT MoBiTec GmbH 2014 Page 2 Contents 1. Description... 3 2. Kit Contents... 3 3. Terms & Conditions... 3 4. AquaPreserve
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationAnti-inflammatory effects of chlorella in chronic and acute inflammation
0[Scientific information] Research and Development Department, Sun Chlorella Corporation effects of chlorella in chronic and acute inflammation Presented at the Annual Meeting of Japan Society for Bioscience,
More informationOsteoclast Culture Kit
K-ASSAY KAMIYA BIOMEDICAL COMPANY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 CC-109 Mouse Osteoclast Precursor Cells,
More informationMasterPure RNA Purification Kit
Cat. No. MCR85102 The MasterPure RNA Purification Kit pro vides all of the reagents necessary to recover RNA from a wide variety of biological sources. This kit uses a rapid desalting process 1 to remove
More informationInfluenza A viruses Detection with real time RT-PCR reagents
Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationRD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer www.sysmex-europe.com RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationRD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as
More informationWHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More informationaltona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS
altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.
More informationPRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature
PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationExpressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.
Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Paul W. Ackermann, MD, PhD 1, Aisha Ahmed, PhD 1, Nicos Schizas, MD 1, Jian Li, MD, PhD 1, Mahmood
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationattomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!
attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationCHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
More informationDako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis)
INTERPRETATION Dako Agilent Pathology Solutions IQFISH Interpretation Guide ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) IT S ABOUT TIME For In Vitro Diagnostic Use ALK, ROS1,
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationDisruptive innovation in molecular diagnostics. Hilde Windels CEO Biocartis 25 March 2017
Disruptive innovation in molecular diagnostics Hilde Windels CEO Biocartis 25 March 2017 1 One of the key innovations in healthcare in the last decade PERSONALISED MEDICINE or HIGH PRECISION MEDICINE From
More informationSupplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
More informationAIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationOsteoclast Culture Kit
K-ASSAY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 For Research Use Only. 1 Rev. 091708 K-ASSAY PRODUCT INFORMATION
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationHIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationThe subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationSolid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma
Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho
More informationECL Plex Western Blotting Detection System
Part of GE Healthcare Data File 28-415-39 AA ECL Plex Western Blotting Detection System Multiplex protein detection based on direct fluorescent CyDye-labeled conjugates ECL Plex fluorescent Western blotting
More informationTITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
More informationSuperior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationIMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis
IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, inhibits disease development in mouse models of psoriasis Weiwen e Ja Jiang, Fu-Gang Zhu, Dong Yu, Ekambar R. Kandimalla, a a, Nicola La Monica, and Sudhir
More informationNear-UV light detection
C L I N I C A L Near-UV light detection Javier Tapia Guadix 1 Near-UV light induced fluorescence has already proven to be very useful as an alternative to classic caries-detector dyes. However its potential
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationPinpoint Slide RNA Isolation System II Catalog No. R1007
INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4
INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationInstant Quality FISH. The name says it all.
PRODUCT INFORMATION HER2 IQFISH pharmdx Instant Quality FISH Instant Quality FISH. The name says it all. HER2 IQFISH pharmdx IQ: Instant Quality every time. HER2 IQFISH pharmdx stains of a HER2 non-amplified
More informationSupporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers
Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin
More informationTanimoto et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb.201510064 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Method for aster 3D tracking, extended characterization of
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationRT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections
RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections Julian Schuster, Beatrix Bahle, Andrea Herold, Sabine Lohmann Roche Innovation Center Penzberg, Germany
More informationSubjective impression of copy machine noises: an improvement of their sound quality based on physical metrics
Subjective impression of copy machine noises: an improvement of their sound quality based on physical metrics Osamu Takehira a Ricoh Co. Ltd., JAPAN Sonoko Kuwano b Seiichiro Namba c Osaka University,JAPAN
More informationSource: Okayama University (JAPAN), Public Relations and Information Strategy
Okayama University Medical Research Updates (OU MRU) 2016.05 Vol.24 Source: Okayama University (JAPAN), Public Relations and Information Strategy For immediate release: 09 May 2016 Okayama University research:
More informationA Project Proposal on. Transferring Education Skills of. Japanese Denture Arts. and Technology. to Rwanda
A Project Proposal on Transferring Education Skills of Japanese Denture Arts and Technology to Rwanda July 2012 TechnoQuay Co., Ltd 1 Introduction With our respect and appreciation to His Excellency, Dr.
More informationBlood Pressure Monitor PASESA
Blood Pressure Monitor PASESA new oscillometric device with AVI&API PASESA Prevent ArterioSclerosis and Enjoy Successful Aging PASESA, digital blood pressure monitor for medical use Sit still for two minutes
More informationHER2 FISH pharmdx TM Interpretation Guide - Breast Cancer
P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment
More informationPneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Pneumocystis Carinii Real Time PCR Kit Cat. No.: QD-0082-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5; Rotor Gene 2000/3000;
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationE.Z.N.A. SQ Blood DNA Kit II. Table of Contents
E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6
More informationDifferentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
More informationAPPENDIX 1 ETHICAL CLEARANCE
APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationTITLE: The Role of Telomeric Repeat Binding Factor 1 (TRF1) in Telomere Maintenance and as a Potential Prognostic Indicator in Human Breast Cancer
AD Award Number: W81XWH-04-1-0370 TITLE: The Role of Telomeric Repeat Binding Factor 1 (TRF1) in Telomere Maintenance and as a Potential Prognostic Indicator in Human Breast Cancer PRINCIPAL INVESTIGATOR:
More information1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir
New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationInstant Quality FISH. The name says it all.
COMPANION DIAGNOSTICS Instant Quality FISH Instant Quality FISH. The name says it all. IQ: Instant Quality every time. Breast carcinoma stained with : Triple filter showing Blue DAPI colors nuclei, FITC
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationMicrotubule Teardrop Patterns
Supporting Information Microtubule Teardrop Patterns Kosuke Okeyoshi 1, Ryuzo Kawamura 1, Ryo Yoshida 2, and Yoshihito Osada 1 * 1 RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,
More informationTable 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
More information