EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION

Size: px
Start display at page:

Download "EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION"

Transcription

1 No. 137 EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION Takuya MIYAWAKI Professor Graduate School of Medicine, Dentistry and Pharmaceutical Sciences Okayama University Outline The present research is being conducted to further improve the evaluation of our invention to be supported by JST for which a Japanese patent has already been applied in order to apply for 5 overseas patents in the USA, Germany, Italy, France, UK and China, and which was supported by JST for a PCT patent. The invention thereof uses the fact that by adding an α2 adrenergic receptor agonist to a local anesthetic, the effect of the local anesthetic may be prolonged and a local anesthetic composition having higher safety may be made. Furthermore, an object of the present examination and research is to verify an anti-inflammatory action of this α2 adrenergic receptor agonist itself. By adding the α2 adrenergic receptor agonist into the local anesthetic, pain and swelling due to surgery can be relieved by the anti-inflammatory action and the effect of speeding recovery from treatment is expected. Technical Field of the Research Medical agent 1. Advantage of the developed technology The present research is being conducted in order to improve the value of a local anesthetic composition which is already patent pending. The local anesthetic is used in a dental therapy, surgical procedures and in pain clinics; however, from a viewpoint of controlling pain, it has been developed while focusing on obtaining a stronger anesthetic effect, a longer acting period and fewer side effects. However, after administrating the local anesthetic, an invasive procedure such as a surgery may be performed and when the effect of the local anesthetic disappears(after several hours at most), a patient may suffer from pain or swelling. In the present examination and research, we note the anti-inflammatory action of the α2 adrenergic receptor agonist (hereinafter, referred to as α2 receptor agonist)which is a substance added to the local anesthetic composition for which our patent is pending and an aim thereof is to provide the antiinflammatory action to the local anesthetic. By developing the local anesthetic having the antiinflammatory action, it is possible to suppress reactions(pain or swelling)due to the

2 inflammation which occurs along with invasive procedures, reduce the pain of the patient and further, an early recovery after the surgery may be expected. Indeed, it will be an innovative development in a field of the local anesthetic. As far as we know, there are no inventions regarding this yet, in Japan or abroad. In this regard, if we advance the research as quickly as possible, we can get a big lead over our academic rivals. 2. Marketability and Potential of the Technology Since speeding recovery after surgery means promoting early discharge of the patient from the hospital, it is an important issue for medical economics. Since there is a tendency to convert as much as possible from major surgery which needs general anesthetic towards surgery which is less invasive, so-called minimally invasive surgery is a great global aim in surgical fields. With these developments, some surgeries which have been performed using a general anesthetic will be performed using a local anesthetic and the demand for local anesthetics is expected to increase. It is reported that long term prognosis(mortality rate)after surgery is worsened due to the excessive general anesthetic use, an invasive procedure with respect to the body and overdose administration of the general anesthetic. From this viewpoint, the marketability of local anesthetics seems set to expand in the future. Furthermore, when the early recovery after the surgery is focused upon as an objective, because anti-inflammatory action will help with this greatly, it is expected that anti-inflammatory therapy will be increasingly developed in the future. However, if it is possible to provide the anti-inflammatory action along with the local anesthetic, anti-inflammatory action can be easily realized by administrating the local anesthetic, increasing its utility value so that yet more important marketability can be expected. 3. Object and Demand An objective of the present study is to verify the anti-inflammatory action which is due to α2 receptor agonist, that is added to the local anesthetic composition which is already patent pending and which is a basis for the present research. We have already verified that there is an antiedematous effect in the α2 receptor agonist through an animal test(fig. 1)

3 Fig. 1 On the basis of a test result using a mouse footpad swelling assay, Fig. 1 shows time dependent changes of inflammatory swelling(increase in footpad volume)which are caused by Carrageenin which is a prophlogistic substance. Fig. 1 shows the antiedematous effect of the α2 receptor agonist(dexmedetomidine)with respect to the inflammatory swelling due to the Carrageenin. The inflammatory reaction such as swelling or the like is amplified through a mediator of inflammation which is generated in a tissue due to the prophlogistic substance, injuries or the like. In order to explain the action mechanism of the antiedematous effect of the α2 receptor agonist, it is necessary to observe the movement of the mediator of inflammation. In this regard, a specific object of the present examination and research is to investigate the influence of the α2 receptor agonist with respect to the generation of the mediator of inflammation. 4. Planned Activities (1)Samples 1)Target animal: eight-week-old-male ICR mouse 2) Local inflammatory model: Noninfectious local inflammatory model: administer 5% Carrageenin as a prophlogistic substance 3)Stimulus site: inject subcutaneously in a rear foot paw 4) Administration of α2 receptor agonist(dexmedetomidine): local administration(mix with a prophlogistic substance) 5) Evaluation of an instance of inflammation: measure the swelling rate of the inflammatory swelling cause by the prophlogistic substance which is injected to the rear foot of the mouse along with the time lapse using a swelling volume measuring device. 6) Preparation of sample: After performing the evaluation of the inflammation, the stimulus site of the target animal is removed, the sample of the removed site is divided for immunohistochemical evaluation and for gene expression evaluation. Sequentially, the divided samples are fixed in separate preservative solutions and are immediately frozen and preserved at minus 80 by an ultra deep freezer

4 (2)Chemical evaluation of immune tissue 1) Processing of samples and HE dyeing: the samples are immersed and fixed for one night in a fixing solution of 10% formalin and are permeated by a paraffin permeating device to form a paraffin block. Using a dedicated rotary microtome, the block is sliced to have a thickness of 5µm HE dyeing is performed, and the slice is observed. 2) First antibody response: After blocking the cells by 0.5% saponin and 3% BSA, the primary antibody with respect to a target inflammatory mediator(tnf-α, IL-1β, COX2), Alexa Flour 568(Molecular Probes)red, and F-actin green for verifying cell cytoskeleton are used. 3)Secondary antibody response: Histofine simple stain is used. 4) Observation of fluorescence stain: After the coloring(brown)due to DAB coloring, nuclear staining is performed with hematoxylin and it is observed by confocal scanning laser microscopy. (3)Gene expression evaluation 1) Adjustment of sample: The sample which is preserved at minus 80 has RNA extracted and purified using a cooled microcentrifuge, a centrifuge rotor and RNA extraction kit, a Dnase treatment is performed, reverse transcription is performed using an RT kit, and a cdna library of each mediator is manufactured. 2) Quantitative evaluation of mrna by real-time polymerase chain reaction(rt-pcr): Capillary, primer for each mediator and MgCl2 are added to the manufactured cdna library. The temperature for the real-time PCR analysis system and annealing is set to be 68, the real-time PCR is performed over 40 cycles, and the mediator gene(mrna) expression quantity is determined, using β-actin as an internal reference. 5. Aim An aim of the present research is to verify whether the generation of these mediators of the inflammation are suppressed by locally administrating the α2 receptor agonist, testing with inflammatory cytokine(tnf α, IL-1β)and COX2(cyclooxygenase-2)as representative mediators of inflammation. By doing so, it is possible to prove that the anti inflammatory action of the α2 receptor agonist is not a simple phenomenon and the action mechanism can be proved as well, thereby raising the reliability of α

5 6. Patent 1 Title of the Patent local anesthetic composition Application No. PCT/JP2009/ Application date October 30, 2008 Applicant Okayama University Inventor Takuya MIYAWAKI, Tatsushi YOSHITOMI Outline It was found that by adding an α2 adrenergic receptor agonist to a local anesthetic in which adrenalin or salt thereof is included, the content of the adrenalin or the salt thereof can be reduced and a local anesthetic composition having a high safety is obtained. Contact Person Name Kenich YOSHIDA yoshidak@cc.okayama-u.ac.jp Name of department Intellectual Property Office of Organization For Research Promotion & Collaboration of OKAYAMA University Position Manager of Intellectual Property Office

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel

Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel 12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel Un-Cheol.Yeo, M.D. S&U Dermatologic Clinic,

More information

Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL

Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL 12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL Un-Cheol.Yeo, MD S&U Dermatologic Clinic,

More information

Title Suppression of tumoral metastasis and invasiveness via the control of cell-to-cell adhesion networks

Title Suppression of tumoral metastasis and invasiveness via the control of cell-to-cell adhesion networks Title Suppression of tumoral metastasis and invasiveness via the control of cell-to-cell adhesion networks Background Controlling the metastasis and invasiveness of cancer is a key element of cancer therapy,

More information

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

ExpressArt FFPE Clear RNAready kit

ExpressArt FFPE Clear RNAready kit Features and Example Results General problems with FFPE samples Formalin-fixation of tissues results in severe RNA fragmentation, as well as in RNA RNA, RNA-DNA and RNA protein cross-linking, which impairs

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

Figure S1. Figure S2. Figure S3.

Figure S1. Figure S2. Figure S3. Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

EyeGene Inc. Contact Information Korea Health Industry Development Institute

EyeGene Inc. Contact Information Korea Health Industry Development Institute EG-Mirotin: First-in-Class recombinant polypeptide novel subcutaneous drug containing RGD-motif targeted to suppress edema and vascular leakage for Nonproliferative Diabetic Retinopathy (NPDR) EyeGene

More information

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Title. CitationJournal of Bioscience and Bioengineering, 100(1): 12. Issue Date Doc URL. Type. File Information

Title. CitationJournal of Bioscience and Bioengineering, 100(1): 12. Issue Date Doc URL. Type. File Information Title Effect of chondroitin sulfate and hyaluronic acid on Author(s)Nishimoto, Shohei; Takagi, Mutsumi; Wakitani, Shigey CitationJournal of Bioscience and Bioengineering, 100(1): 12 Issue Date 2005-07

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon

More information

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT MoBiTec GmbH 2014 Page 2 Contents 1. Description... 3 2. Kit Contents... 3 3. Terms & Conditions... 3 4. AquaPreserve

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Anti-inflammatory effects of chlorella in chronic and acute inflammation

Anti-inflammatory effects of chlorella in chronic and acute inflammation 0[Scientific information] Research and Development Department, Sun Chlorella Corporation effects of chlorella in chronic and acute inflammation Presented at the Annual Meeting of Japan Society for Bioscience,

More information

Osteoclast Culture Kit

Osteoclast Culture Kit K-ASSAY KAMIYA BIOMEDICAL COMPANY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 CC-109 Mouse Osteoclast Precursor Cells,

More information

MasterPure RNA Purification Kit

MasterPure RNA Purification Kit Cat. No. MCR85102 The MasterPure RNA Purification Kit pro vides all of the reagents necessary to recover RNA from a wide variety of biological sources. This kit uses a rapid desalting process 1 to remove

More information

Influenza A viruses Detection with real time RT-PCR reagents

Influenza A viruses Detection with real time RT-PCR reagents Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer www.sysmex-europe.com RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,

More information

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,

More information

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.

More information

PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature

PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Paul W. Ackermann, MD, PhD 1, Aisha Ahmed, PhD 1, Nicos Schizas, MD 1, Jian Li, MD, PhD 1, Mahmood

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing! attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices 45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing

More information

Dako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis)

Dako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) INTERPRETATION Dako Agilent Pathology Solutions IQFISH Interpretation Guide ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) IT S ABOUT TIME For In Vitro Diagnostic Use ALK, ROS1,

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Disruptive innovation in molecular diagnostics. Hilde Windels CEO Biocartis 25 March 2017

Disruptive innovation in molecular diagnostics. Hilde Windels CEO Biocartis 25 March 2017 Disruptive innovation in molecular diagnostics Hilde Windels CEO Biocartis 25 March 2017 1 One of the key innovations in healthcare in the last decade PERSONALISED MEDICINE or HIGH PRECISION MEDICINE From

More information

Supplementary Figures for

Supplementary Figures for mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color

More information

Osteoclast Culture Kit

Osteoclast Culture Kit K-ASSAY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 For Research Use Only. 1 Rev. 091708 K-ASSAY PRODUCT INFORMATION

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

The subcortical maternal complex controls symmetric division of mouse zygotes by

The subcortical maternal complex controls symmetric division of mouse zygotes by The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,

More information

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory

More information

Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma

Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho

More information

ECL Plex Western Blotting Detection System

ECL Plex Western Blotting Detection System Part of GE Healthcare Data File 28-415-39 AA ECL Plex Western Blotting Detection System Multiplex protein detection based on direct fluorescent CyDye-labeled conjugates ECL Plex fluorescent Western blotting

More information

TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer

TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis

IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, inhibits disease development in mouse models of psoriasis Weiwen e Ja Jiang, Fu-Gang Zhu, Dong Yu, Ekambar R. Kandimalla, a a, Nicola La Monica, and Sudhir

More information

Near-UV light detection

Near-UV light detection C L I N I C A L Near-UV light detection Javier Tapia Guadix 1 Near-UV light induced fluorescence has already proven to be very useful as an alternative to classic caries-detector dyes. However its potential

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Pinpoint Slide RNA Isolation System II Catalog No. R1007

Pinpoint Slide RNA Isolation System II Catalog No. R1007 INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Instant Quality FISH. The name says it all.

Instant Quality FISH. The name says it all. PRODUCT INFORMATION HER2 IQFISH pharmdx Instant Quality FISH Instant Quality FISH. The name says it all. HER2 IQFISH pharmdx IQ: Instant Quality every time. HER2 IQFISH pharmdx stains of a HER2 non-amplified

More information

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin

More information

Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb.201510064 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Method for aster 3D tracking, extended characterization of

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections

RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections Julian Schuster, Beatrix Bahle, Andrea Herold, Sabine Lohmann Roche Innovation Center Penzberg, Germany

More information

Subjective impression of copy machine noises: an improvement of their sound quality based on physical metrics

Subjective impression of copy machine noises: an improvement of their sound quality based on physical metrics Subjective impression of copy machine noises: an improvement of their sound quality based on physical metrics Osamu Takehira a Ricoh Co. Ltd., JAPAN Sonoko Kuwano b Seiichiro Namba c Osaka University,JAPAN

More information

Source: Okayama University (JAPAN), Public Relations and Information Strategy

Source: Okayama University (JAPAN), Public Relations and Information Strategy Okayama University Medical Research Updates (OU MRU) 2016.05 Vol.24 Source: Okayama University (JAPAN), Public Relations and Information Strategy For immediate release: 09 May 2016 Okayama University research:

More information

A Project Proposal on. Transferring Education Skills of. Japanese Denture Arts. and Technology. to Rwanda

A Project Proposal on. Transferring Education Skills of. Japanese Denture Arts. and Technology. to Rwanda A Project Proposal on Transferring Education Skills of Japanese Denture Arts and Technology to Rwanda July 2012 TechnoQuay Co., Ltd 1 Introduction With our respect and appreciation to His Excellency, Dr.

More information

Blood Pressure Monitor PASESA

Blood Pressure Monitor PASESA Blood Pressure Monitor PASESA new oscillometric device with AVI&API PASESA Prevent ArterioSclerosis and Enjoy Successful Aging PASESA, digital blood pressure monitor for medical use Sit still for two minutes

More information

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment

More information

Pneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual

Pneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Pneumocystis Carinii Real Time PCR Kit Cat. No.: QD-0082-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5; Rotor Gene 2000/3000;

More information

Supplementary webappendix

Supplementary webappendix Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6

More information

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an

More information

APPENDIX 1 ETHICAL CLEARANCE

APPENDIX 1 ETHICAL CLEARANCE APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

TITLE: The Role of Telomeric Repeat Binding Factor 1 (TRF1) in Telomere Maintenance and as a Potential Prognostic Indicator in Human Breast Cancer

TITLE: The Role of Telomeric Repeat Binding Factor 1 (TRF1) in Telomere Maintenance and as a Potential Prognostic Indicator in Human Breast Cancer AD Award Number: W81XWH-04-1-0370 TITLE: The Role of Telomeric Repeat Binding Factor 1 (TRF1) in Telomere Maintenance and as a Potential Prognostic Indicator in Human Breast Cancer PRINCIPAL INVESTIGATOR:

More information

1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir

1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

Instant Quality FISH. The name says it all.

Instant Quality FISH. The name says it all. COMPANION DIAGNOSTICS Instant Quality FISH Instant Quality FISH. The name says it all. IQ: Instant Quality every time. Breast carcinoma stained with : Triple filter showing Blue DAPI colors nuclei, FITC

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products.. INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

Microtubule Teardrop Patterns

Microtubule Teardrop Patterns Supporting Information Microtubule Teardrop Patterns Kosuke Okeyoshi 1, Ryuzo Kawamura 1, Ryo Yoshida 2, and Yoshihito Osada 1 * 1 RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,

More information

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2

More information