Dual role of SIRT1 in UVB-induced skin tumorigenesis
|
|
- Ralf Greene
- 5 years ago
- Views:
Transcription
1 Dual role of SIRT1 in UVB-induced skin tumorigenesis Mei Ming 1, Keyoumars Soltani 1, Christopher R. Shea 1, Xiaoling Li 2, and Yu-Ying He 1 * 1 Section of Dermatology, Department of Medicine, University of Chicago, Chicago, IL, USA 2 Laboratory of Signal Transduction, NIEHS, National Institutes of Health, Research Triangle Park, NC, USA Supplemental Information: Methods Supplemental Figure s1: Related to Figure 1 Supplemental Figure s2: Related to Figure 3 Supplemental Figure s3: Related to Figure 4 sirna/plasmids transfectioin p53, p53 K382R mutant, and control plasmids were kindly provided by Dr. Xiaobing Shi (1). Cells were transfected with negative control (sinc) or sirna (ON-TARGETplus SMARTpool, Dharmacon) targeting SIRT1 (sisirt1) and/or p53 (sip53), p53, p53 mutant, or their combination with sinc or sisirt1, using Amaxa Nucleofector according to the manufacturer's instructions as described previously (2). Western blotting Protein concentrations were determined using the BCA assay (Pierce, Rockford, IL, USA) and equal amounts of protein were subjected to electrophoresis. Western blotting was performed as described previously (3). Antibodies used included XPC, SIRT1, p53, GAPDH (Santa Cruz), active Caspase 3 (Cell Signaling Technology), XPA (Kamiya Biomedical Company), and acetylated-p53 k382 (Ac-p53, Abcam). Real-time PCR Quantitative real time PCR assays were performed using ABI7300 (Applied Biosystems, Foster City, CA) in 96-well plates with the SYBR Green PCR Master Mix (Applied Biosystems) as described previously (2, 4). Amplification primers were 5'- TGGCTGGGAAGGCCTCCTCTC-3'(forward), 5'-AGATGGTGAGCGAGGCGGTGA- 3'(reverse) for mouse Bax; 5'-GCGGTGAACGATGCCTGCCT-3' (forward) and 5'- ACCTATGCAATGAGATGGATGGGGA-3' (reverse) for mouse Puma; 5'- ACTCAGGAAGATCGGAGACAAAGTG-3'(forward) and 5'-
2 ACACTCGTCCTTCAAGTCTGCTGG-3' (reverse) for mouse Noxa (5); and 5'- AGGTCGGTGTGAACGGATTTG-3 (forward) and 5 - TGTAGACCATGTAGTTGAGGTCA-3 (reverse) for mouse GAPDH. The threshold cycle number (Ct) for each sample was determined in triplicate. The Ct values for Bax, Puma and Noxa were normalized against GAPDH, and the XPC primers were used as described previously (6). Determination of two major forms of UVB-induced DNA damage in genomic DNA by slot blot assay Slot blot assays of CPD were performed as described previously (7, 8). Briefly, mouse skin or cells were collected at different time points post-uvb, and DNA was isolated using a QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA). The DNA concentration was calculated from the absorbance at 260 nm using NanoDrop 1000 (NanoDrop products, Wilmington, DE, USA). The CPD in DNA were quantified by slot blot (Bio-Rad, Hercules, CA, USA) with monoantibodies (TDM-2 for CPD, COSMO BIO Co., Tokyo, Japan) as describled previously (7). The chemiluminescence was detected with a Carestream Imaging Station (Carestream, Rochester, NY, USA). For examining repair kinetics, the percentage of repair was calculated by comparing the optical density at the indicated time with that of the corresponding absorbance at time zero when there was no opportunity for repair and 100% of CPDs were present post-uvb. TUNEL assay DNA fragmentation characteristic of apoptotic cells was evaluated by Tdt-mediated dutp nick end labeling (TUNEL) with an in situ cell detection kit (Roche) according to the manufacturer's instructions. To calculate the percentage of TUNEL-positive cells, ten random microscopic fields at 400x magnifications were examined, and apoptosis expressed as percentage of TUNEL-positive cells in the epidermis. sub-g1 flow cytometric analysis Sub-G1 flow cytometric analysis was performed to determine apoptosis as described previously (8). Briefly, cells were fixed and stained with propidium iodide. The percentage of cells at the sub-g1 phase was quantified by flow cytometry. SIRT1 activity assay in mouse skin SIRT1 activity was determined with a SIRT1 Fluorometric Kit (Biomol International) as described previously (9). This assay uses a small lysine-acetylated peptide, corresponding to K382 of human p53, as a substrate. The lysine residue is deacetylated by SIRT1, and this process is dependent on the addition of exogenous NAD +. Basically, samples were homogenized in IP buffer. The homogenates were incubated in SIRT1 assay buffer in the presence of 100uM Fluor de Lys-SIRT1 substrate and 200uM NAD + to determine the SIRT1-dependent activity. After 60 minutes of incubation at 37C, the reaction was terminated by adding a solution containing Fluor de Lys Developer and
3 2mM nicotinamide. Plates were incubated at 37 C for 1 hour. Values were determined by reading fluorescence on a plate reader with an excitation wavelength of 360nm and an emission wavelength of 460nm. SIRT1-dependent activity was calculated after subtracting of a blank consisting of buffer containing no NAD+ and expressed as a percentage of control. In all cases, we confirmed the linearity of the reaction over time. References 1. Shi X, Kachirskaia I, Yamaguchi H, West LE, Wen H, Wang EW, et al. Modulation of p53 function by SET8-mediated methylation at lysine 382. Molecular cell Aug 17;27(4): PubMed PMID: Pubmed Central PMCID: Ming M, Feng L, Shea CR, Soltani K, Zhao B, Han W, et al. PTEN positively regulates UVB-induced DNA damage repair. Cancer Res. Aug 1;71(15): PubMed PMID: Epub 2011/07/21. eng. 3. Ming M, Han W, Maddox J, Soltani K, Shea CR, Freeman DM, et al. UVBinduced ERK/AKT-dependent PTEN suppression promotes survival of epidermal keratinocytes. Oncogene. Jan 28;29(4): PubMed PMID: Epub 2009/11/03. eng. 4. Ming M, Shea CR, Guo X, Li X, Soltani K, Han W, et al. Regulation of global genome nucleotide excision repair by SIRT1 through xeroderma pigmentosum C. Proc Natl Acad Sci U S A. Dec 28;107(52): PubMed PMID: Epub 2010/12/15. eng. 5. Matsumoto A, Susaki E, Onoyama I, Nakayama K, Hoshino M, Nakayama KI. Deregulation of the p57-e2f1-p53 axis results in nonobstructive hydrocephalus and cerebellar malformation in mice. Mol Cell Biol. Oct;31(20): PubMed PMID: Epub 2011/08/17. eng. 6. Ming M, Shea CR, Guo X, Li X, Soltani K, Han W, et al. Regulation of global genome nucleotide excision repair by SIRT1 through xeroderma pigmentosum C. Proceedings of the National Academy of Sciences of the United States of America Dec 28;107(52): PubMed PMID: Pubmed Central PMCID: Maeda T, Chua PP, Chong MT, Sim AB, Nikaido O, Tron VA. Nucleotide excision repair genes are upregulated by low-dose artificial ultraviolet B: evidence of a photoprotective SOS response? J Invest Dermatol Dec;117(6): PubMed PMID: Epub 2002/03/12. eng. 8. Han W, Ming M, Zhao R, Pi J, Wu C, He YY. Nrf1 CNC-bZIP protein promotes cell survival and nucleotide excision repair through maintaining glutathione homeostasis. The Journal of biological chemistry May 25;287(22): PubMed PMID: Pubmed Central PMCID: Escande C, Chini CC, Nin V, Dykhouse KM, Novak CM, Levine J, et al. Deleted in breast cancer-1 regulates SIRT1 activity and contributes to high-fat diet-induced liver steatosis in mice. The Journal of clinical investigation Feb;120(2): PubMed PMID: Pubmed Central PMCID:
4 Supplemental Figure s1 A B Fig. s1. Skin tumors developed in UVB-irradiated and mice. A, representative skin tumors from and mice. B, histological analysis of tumors from SIRT1 and mice. Scale bar, 100 µm. Supplemental Figure s2 cko Fig. s2. Representative pictures of SKH1 hairless mice irradiated with UVB for 25 weeks.
5 Supplemental Figure s3 cko Fig. s3. Immunohistochemical analysis of the XPC protein levels in,, and cko mice. Scale bar, 25 µm.
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationReceptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D., Ph.D., Satoshi Tateda, M.D., Kenichiro Yahata, M.D.,
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationData Sheet. Fluorogenic HDAC 8 Assay Kit Catalog #: 50068
Data Sheet Fluorogenic HDAC 8 Assay Kit Catalog #: 50068 DESCRIPTION: The Fluorogenic HDAC 8 Assay Kit is a complete assay system designed to measure histone deacetylase (HDAC) 8 activity for screening
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationA dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma
Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationExtracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation
Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationInterest in any of the products, request or order them at Bio-Connect Diagnostics.
M3 CytoDEATH ELISA Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 ()26 326 44 6 T BE +32 ()2 52 12 53 Begonialaan 3a F NL +31 ()26
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationTo determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationHDAC1 Inhibitor Screening Assay Kit
HDAC1 Inhibitor Screening Assay Kit Catalog Number KA1320 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationMulti-Parameter Apoptosis Assay Kit
Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More information20S Proteasome Activity Assay Kit
20S Proteasome Activity Assay Kit For 100 Assays Cat. No. APT280 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationFree Fatty Acid Uptake Assay Kit (Fluorometric)
ab176768 Free Fatty Acid Uptake Assay Kit (Fluorometric) Instructions for Use For measurement of fatty acid uptake in cells containing fatty acid transporters. This product is for research use only and
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationLi et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationHDAC Assay Kit. (Fluorescent) (version B1) Catalog No
HDAC Assay Kit (Fluorescent) (version B1) Catalog No. 56200 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax:
More informationhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
More informationab Lysosome/Cytotoxicity Dual Staining Kit
ab133078 Lysosome/Cytotoxicity Dual Staining Kit Instructions for Use For studying lysosome function at the cellular level. This product is for research use only and is not intended for diagnostic use.
More informationCathepsin K Activity Assay Kit (Fluorometric)
ab65303 Cathepsin K Activity Assay Kit (Fluorometric) Instructions for Use For the rapid, sensitive and accurate measurement of Cathepsin K activity in various samples. This product is for research use
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)
ab156064 Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of Histone Deacetylase activity in cell lysates This product is for research
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationPrevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang
Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with
More informationDetermination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection
Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSensoLyte 520 HDAC Activity Assay Kit *Fluorimetric*
SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric* Catalog # 72084 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect HDAC activity. Enhanced Value: It provides
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationDifferentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationMolecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationFigure S1. B % of Phosphorylation 32H. 32ss
Figure S1 8H 32ss 32H 32Hc % of Phosphorylation 3 32H 2 1 32ss 1 2 3 4 Extract (μg) C % of Phosphorylation 18 12 6-32H 32Hc 8H 32ss Dbait Figure S1. List of the Dbait molecules and activation of DN-PK
More informationbeta Hydroxybutyrate (beta HB) Assay Kit
ab83390 beta Hydroxybutyrate (beta HB) Assay Kit Instructions for Use For the rapid, sensitive and accurate measurement of beta Hydroxybutyrate in various samples. This product is for research use only
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationHandheld Fluorometers
s Portable and light-weight, our handheld fluorometers provide exceptional sensitivity, rapid-reading, and reliability at a much lower cost than other portable fluorometers on the market. These convenient
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationDisrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationUniversity of Oklahoma Health Sciences Center, Oklahoma City, OK, USA; e Boone Pickens
Nanosomes carrying doxorubicin exhibit potent anticancer activity against human lung cancer cells Akhil Srivastava a,h,+, Narsireddy Amreddy a,h,+, Anish Babu a,h, Janani Panneerselvam a,h, Meghna Mehta
More informationCathepsin K Activity Assay Kit
Cathepsin K Activity Assay Kit Catalog Number KA0769 100 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationSupporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy
Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationAnti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice
Anti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice Jimmy A. Rotolo 1, Branka Stancevic 1, Jianjun Zhang 1, Guoqiang Hua 1, John Fuller 1, Xianglei Yin 1, Adriana Haimovitz-Friedman 2, Kisu
More informationRESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells
RESEARCH COMMUNICATION sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells Wei-Yi Huang, Dong-Hui Chen, Li Ning, Li-Wei Wang* Abstract
More information