SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
|
|
- Audra Ramsey
- 5 years ago
- Views:
Transcription
1 SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
2 Structural variation (SV) Variants larger than 50bps Affect more base pairs than SNVs and Indels Large influence on phenotype and disease 2
3 Long read alignments (.bam) SVIM Structural Variant caller for PacBio reads Detects six different classes of SVs with high precision and sensitivity Deletions (1) Collect SV evidences Evidences in read alignments (DEL, INS) SV evidences Evidences between split alignments (DEL, INS, INV, BRK, DUP) (2) Cluster SV evidences by their genomic location and span SV evidence clusters (3) Confirm / Genotype evidence clusters: Count local reads supporting ref/alt allele Analyze read alignments SV evidence clusters + support Dotplot analysis (4) Merge and classify SV evidence clusters Interspersed Duplications Cut&Paste Insertions Novel Insertions Inversions Tandem duplications COLLECT CONFIRM COMBINE 3
4 1. Collect SV evidences (1) Collect SV evidences Evidences in read alignments (DEL, INS) Long read alignments (.bam) SV evidences Evidences between split alignments (DEL, INS, INV, BRK, DUP) (2) Cluster SV evidences by their genomic location and span COLLECT Collect evidences for SVs from each individual read Search.. in alignments for long gaps in reference or read (CIGAR string) between alignments for discordant positions and orientations that indicate deleted, inserted, inverted, chimeric or duplicated pieces Collected SV evidences are mere hints to SVs Multiple hints need to be combined to pinpoint exact type and location of the event è Clustering of SV evidences 4
5 Clustering of SVs Merges evidences from multiple reads Helps to distinguish correct evidences from errors (e.g. sequencing error, alignment error) Span-position distance consists of position distance (difference in location) and span distance (diff. in length) Genome Deletion evidences 5
6 2. Confirm SVs (3) Confirm / Genotype evidence clusters: Count local reads supporting ref/alt allele Analyze read alignments SV evidence clusters Dotplot analysis CONFIRM Count number of reads that support / contradict each SV for: Confirmation (many contradicting reads indicate false positive) Genotyping (~50% supporting reads indicates heterozygous event, ~100% indicate homozygous) Two orthogonal approaches Read alignment analysis (alignment-based) Dotplot analysis (k-mer based) 6
7 Combine SVs Deletions SV evidence clusters + support (4) Merge and classify SV evidence clusters Interspersed Duplications Cut&Paste Insertions Novel Insertions Inversions Tandem duplications COMBINE Combine multiple SVs to classify higher-order events Deletion of sequence S + Insertion of sequence S somewhere else è Cut&Paste Insertion Deletion of sequence S è Deletion Insertion of sequence S è Duplication Insertion of novel sequence N è Novel Insertion 7
8 Results 8
9 Results on 6x simulated dataset 1.00 Deletions Insertions 1.00 Deletions Insertions Homozygous Precision Inversions Tandem Duplications Tool PBHoney Spots PBHoney Tails SVIM Sniffles Precision Inversions Tandem Duplications Heterozygous Recall Recall 9
10 Results on public 53x real dataset Genome in a Bottle dataset for NA12878 individual 53x coverage PacBio data (SRR ) 2676 / 68 high-confidence deletion / insertion calls Parikh, Hemang, et al. "svclassify: a method to establish benchmark structural variant calls." BMC genomics 17.1 (2016): 64. Precision Deletions Insertions Recall 53x coverage 6x coverage Tool PBHoney Spots PBHoney Tails SVIM Sniffles 10
11 Results on public 53x real dataset Implant SVs into the reference genome Align reads to this altered reference genome This simulates inverse of implanted SV: 100 deletions are simulated by inserting sequence into the reference genome. 100 inversions are simulated by inverting regions in the reference. 100 insertions are simulated by moving regions in the reference. Precision Deletions Inversions Cut&Paste Insertions Recall 53x coverage 6x coverage Tool PBHoney Spots PBHoney Tails SVIM Sniffles 11
12 Conclusion SVIM is a tool for SV detection from PacBio reads It detects and distinguishes six different SV classes Determines genomic origin and destination of insertions and duplications Improved recall and precision compared to competing methods Large improvement on low-coverage datasets github.com/eldariont/svim 12
13 Acknowledgements Martin Vingron NGMLR : Fritz Sedlazeck and Philipp Rescheneder Thanks for your attention! Questions?!" heller_d@molgen.mpg.de github.com/eldariont/svim 13
14 Runtime comparison Tool Threads CPU time (min) Wall clock time (min) PBHoney-Spots PBHoney-Spots PBHoney-Tails Sniffles Sniffles SVIM
15 Simulation protocol Simulated genome (chr21 and chr22 only) with 100 deletions, 100 insertions, 100 tandem duplications, 100 interspersed duplications, 100 inversions between 100bps and 10kbps in size (RSVSim) Simulated long reads to 6-fold coverage (SimLoRD) Run different SV callers on simulated reads Compare detected SVs with simulated (correct) SVs (require 90% reciprocal overlap) Bartenhagen, C., & Dugas, M. (2013). RSVSim: an R/Bioconductor package for the simulation of structural variations. Bioinformatics, 29(13), Stöcker, B. K., Köster, J., & Rahmann, S. (2016). Simlord: Simulation of long read data. Bioinformatics, 32(17),
16 Dotplot analysis Read Deletion Reference 16
Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing
Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationPSSV User Manual (V1.0)
PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationLEIDEN, THE NETHERLANDS
Full-length CYP2D6 diplotyping for better drug dosage and response management Henk Buermans, PhD Leiden University Medical Center Human Genetics, LGTC LEIDEN, THE NETHERLANDS CYP2D6 Function Metabolism
More informationSupplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
More informationPSSV User Manual (V2.1)
PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationCalling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017
1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationShape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon*
254 Int. J. Data Mining and Bioinformatics, Vol. 9, No. 3, 2014 Shape-based retrieval of CNV regions in read coverage data Sangkyun Hong and Jeehee Yoon* Department of Computer Engineering, Hallym University
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationCOMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION
COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION Pierre Martinez, Nicholas McGranahan, Nicolai Juul Birkbak, Marco Gerlinger, Charles Swanton* SUPPLEMENTARY INFORMATION SUPPLEMENTARY
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationVariations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationNames: Period: Punnett Square for Sex Chromosomes:
Names: Period: Human Variations Activity Background A large variety of traits exist in the human population. The large number of combinations of these traits causes individuals to look unique, or different,
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationGlobal assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping
RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationDe Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
More informationTowards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
www.bioinformation.net Volume 14(8) Software Model Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
More informationUNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms.
UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES Many things come in many forms. Give me an example of something that comes in many forms. Genes, too, come in many forms. Main Idea #1 The same gene
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationDETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING
DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third
More informationUnit 5 Review Name: Period:
Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes
More informationReview: Genome assembly Reads
Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank
More informationDevelopmental Psychology 2017
Developmental Psychology 2017 Table of Contents Lecture Notes pp. 2-29 Theorists, Theories & Evaluation pp. 29 36 Revision Questions (for all lectures) pp. 36-54 Lecture Notes Intro to Development Development
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationAndrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2
METHOD ARTICLE An enhanced method for targeted next generation sequencing copy number variant detection using ExomeDepth [version 1; referees: 1 approved, 1 approved with reservations] 1 2 1 3,4 Andrew
More informationSupplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
More informationSpectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals
Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationCNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.
Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationSupplemental Tables and Figures
Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,
More informationLinked read sequencing resolves complex genomic rearrangements in gastric cancer metastases
Greer et al. Genome Medicine (2017) 9:57 DOI 10.1186/s13073-017-0447-8 RESEARCH Linked read sequencing resolves complex genomic rearrangements in gastric cancer metastases Open Access Stephanie U. Greer
More informationChapter 15: The Chromosomal Basis of Inheritance
Name Period Chapter 15: The Chromosomal Basis of Inheritance Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2.
More informationChromosome Structure & Recombination
Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different
More information6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
More informationCHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationGenetics 275 Examination February 10, 2003.
Genetics 275 Examination February 10, 2003. Do all questions in the spaces provided. The value for this examination is twenty marks (20% of the grade for the course). The value for individual questions
More informationBECAUSE all genetic variation on which natural selection
INVESTIGATION Rates and Genomic Consequences of Spontaneous Mutational Events in Drosophila melanogaster Daniel R. Schrider,*,,1 David Houle, Michael Lynch,* and Matthew W. Hahn*, *Department of Biology
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationInGen: Dino Genetics Lab Lab Related Activity: DNA and Genetics
This activity is meant to extend your students knowledge of the topics covered in our DNA and Genetics lab. Through this activity, pairs of students will play with dominant and recessive alleles to create
More informationChromosomal Mutations
Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens
More informationReducing INDEL calling errors in whole genome and exome sequencing data.
Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationModeling Chromosome Inheritance
Task 2 Modeling Chromosome Inheritance In this task, you will model chromosome inheritance from parent to offspring for the species you created in task 1. You will use the genotypes you developed for the
More informationHuman Genetic Disorders
Human Genetic Disorders HOMOLOGOUS CHROMOSOMES Human somatic cells have 23 pairs of homologous chromosomes 23 are inherited from the mother and 23 from the father HOMOLOGOUS CHROMOSOMES Autosomes o Are
More informationIssues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014
Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like
More informationChapter 12 Multiple Choice
Chapter 12 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Gregor Mendel do to study different characteristics in his genetics experiments? a.
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationMerging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines
Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationMendelian Genetics. KEY CONCEPT Mendel s research showed that traits are inherited as discrete units.
KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Mendel laid the groundwork for genetics. Traits are distinguishing characteristics that are inherited. Genetics is the
More informationThe Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More information1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.
Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically
More informationCHROMOSOMAL THEORY OF INHERITANCE
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 7 Chapter 15 ACTIVITY #10 NAME DATE PERIOD CHROMOSOMAL THEORY OF INHERITANCE The Theory: Genes are located on chromosomes Chromosomes segregate and independently
More informationChapter 15: The Chromosomal Basis of Inheritance
Name Chapter 15: The Chromosomal Basis of Inheritance 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2. Explain the law
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationLab Activity Report: Mendelian Genetics - Genetic Disorders
Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationComprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks?
Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Embryo 1 Embryo 2 combine samples for a single sequencing chip Barcode 1 CTAAGGTAAC
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationThe Chromosomal Basis of Inheritance
The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationMolecular Characterization of Tumors Using Next-Generation Sequencing
Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationGENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS
GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS C. GRASSO, B. MODREK, Y. XING, C. LEE Department of Chemistry and Biochemistry,
More informationPersonalized Copy-Number and Segmental Duplication Maps using Next-Generation Sequencing
Supplementary Information Personalized Copy-Number and Segmental Duplication Maps using Next-Generation Sequencing Can Alkan 1,6, Jeffrey M. Kidd 1, Tomas Marques-Bonet 1,2, Gozde Aksay 1, Francesca 1
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More information