Supplementary Files to Töröcsik et al. Factor XIII-A is involved in the regulation of

Supplementary Figure 1. Microarray data mining and validation

Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to

COMPREHENSIVE DIAGNOSIS FOR MITOCHONDRIAL DISORDERS

COMPREHENSIVE DIAGNOSIS FOR MITOCHONDRIAL DISORDERS MITOCHONDRIAL DISORDERS NGS PANELS MITOCHONDRIAL DISORDERS NGS PANELS Name Test code Gene Name Mitome200-Nuclear 2086 (164 nuclear genes) AARS2, ACACA,

A genome-wide association study identifies vitiligo

A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples

HTG EdgeSeq Immuno-Oncology Assay Gene List

A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK

Supplementary Material. Table S1. Summary of mapping results

Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

Supplemental Figure 1

Supplemental Figure 1 mir 26a mir 26b Supplemental Figure 1. Expression of mir-26a is higher than mir-26b in the mouse liver. Dot blot analysis of mir-26a/b expression in the livers of wild-type mice fed

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

Subject ID: Date Test Started: Specimen Type: Peripheral Blood Date of Report: Date Specimen Obtained:

TEST PERFORMED Whole exome sequencing (WES) with Focused Diagnostic Panel(s): Neuropathy, Leukodystrophy, Myopathy See below for a complete list of genes analyzed. RESULTS 1 sequence variant with potential

* Kyoto Encyclopedia of Genes and Genomes.

Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

Use of Molecular Assays to Assess Cellular Therapies

Use of Molecular Assays to Assess Cellular Therapies D. Stroncek, P. Jin, M. Sabatino, J. Ren, L. Castiello, E. Wang, and F.M. Marincola. Cellular Therapies Section Clinical Center, NIH Methods for the

Supplemental Table 1: Enriched GO categories per cluster

Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

An integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida

Supplementary information for: An integrated transcriptomic and functional genomic approach identifies a type I interferon signature as a host defense mechanism against Candida albicans in humans Sanne

Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.

Table S1 Differentially expressed genes showing > 2 fold changes and p

Nature Immunology: doi: /ni.3745

Supplementary Figure 1 Experimental settings. (a) Experimental setup and bioinformatic data analysis of transcriptomic changes induced in neonatal and adult monocytes by stimulation with 10 ng/ml LPS for

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)

RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

For focused group profiling of human HIV infection and host response genes expression

ExProfile TM Human HIV Infection and Host Response Related Gene qpcr Array For focused group profiling of human HIV infection and host response genes expression Cat. No. QG023-A (1 x 96-well plate, Format

Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health

Acute Respiratory Distress Syndrome is a TH17 and Treg immune disease By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2 Nangang 115, Taipei, Taiwan Previous

qpcr-array Analysis Service

qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

To compare the relative amount of of selected gene expression between sham and

Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,

Supplement Table 1: Genes downregualted by CSA in skin and associated cell types Associated cell types: Symbol resting cells cytokine activation T

Supplement Table 1: Genes downregualted by CSA in skin and associated cell types Associated cell types: Symbol resting cells cytokine activation T cell activation Description PITPNB _ T cell+pbmc act.

!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345()

!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345() Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:

Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing

Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging

WERNER_FIBRO_DN LEI_MYB_REGULATED_GENES BRCA1_OVEREXP_DN SUBCLASSES_DIFF P21_P53_MIDDLE_DN

Supplemental Table S1. Full List of Up-Regulated Conserved Biological Modules Between Zebrafish Liver Tumor with Human Liver, Lung, Gastric, and Prostate Tumors LvCMs (ZF liver cancer vs. human liver cancers

Supplemental Table 1. Cardiac mitochondrial acetyl proteoforms in mouse heart. Uniprot ID Gene Symbol Acetyl Proteoform Q8BWT1 Acaa2 K137 Q8BWT1

Supplemental Table 1. Cardiac mitochondrial acetyl proteoforms in mouse heart. Uniprot ID Gene Symbol Acetyl Proteoform Q8BWT1 Acaa2 K137 Q8BWT1 Acaa2 K171 Q8BWT1 Acaa2 K234 Q8BWT1 Acaa2 K240 D3Z7X0 Acad12

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

Mitochondrial Disorders Genetic Testing

Mitochondrial Disorders Genetic Testing A Comprehensive Guide 1 Introduction Mitochondrial disorders are a group of related, clinically diverse, genetic diseases with a prevalence of 1/5,000 to 1/8,500

devseek (Sequence(Analysis(Panel(for(Neurodevelopmental(Disorders

ACSL4 Mental/retardation,/XBlinked/63 XLBR ADSL Adenylosuccinase/Deficiency AR AFF2 Mental/retardation,/XBlinked,/FRAXE/type XLBR ALG6 Congenital/disorder/of/glycosylation/type/Ic AR ANK3 Mental/retardation,/autosomal/recessive/37

Hs LOC Hs.7100 T Hs YARS Tyrosyl-tRNA synthetase 0.24

Supplementary Table S1 Genes differently expressed between LNM35 and N15 UniGene ID Gene symbol Description Ratio Genes up-regulated in LNM35 Hs.535012 LOC441052 6.14 Hs.182885 SLC35B2 Solute carrier family

Supplementary Information

Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,

Supplementary Table S1: Gene expression targets

Supplementary Table S1: Gene expression targets Probe ID Gene ID Gene Descriptions Cell type Antigen-dependent activation MmugDNA.32422.1.S1_at CD180 CD180 molecule B 1 MmugDNA.18254.1.S1_at CD19 CD19

Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases

Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK

Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.

Targeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels

Targeted s and Methodology Details for Epilepsy/Seizure tic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Epilepsy/Seizure tic Panels Epilepsy Expanded Panel Epilepsy Expanded

Is genomic grading killing histological grading?

Is genomic grading killing histological grading? Christos Sotiriou MD PhD Fonds National de Recherche Scientifique (FNRS) Université Libre de Bruxelles (ULB) Institut Jules Bordet Histological Grade and

LIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1

C2orf80 1 C2orf80 A2M ANXA1 APOD ARL4A BEX1 C1S C3 CD44 CHI3L1 CHI3L2 CLU DPYD DSCAM EMP3 FN1 GBP1 GEM GLIPR1 GRIA2 IDH1 LIX1 MAP2 MDK MGST1 MIR3917 NAMPT PCMTD2 PPIA PTN PTPRZ1 S100B SCG3 SERPINA3 TCF12

Development of a custom microarray platform for nutrigenomics studies in sheep

60 th Annual Meeting of the European Federation of Animal Science Barcelona (Spain), 24-27 August 2009 Development of a custom microarray platform for nutrigenomics studies in sheep B. Stefanon 1, S. Sgorlon

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).

Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16

1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.

938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp

Supplementary Materials

Supplementary Materials Supplemental figure 1. Absolute cell count of naïve/memory compartment of CD4 and CD8 T cells in early years Absolute cell number of naïve (CD45RA+CCR7+), Stem cell memory T cell

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL UBC Chan-Yeung Centre for Occupational and Environmental Respiratory Disease Understanding exposure effects

7 Glyceraldehyde 3-Phosphate GAPDH % SYM+G+e NM_ BC JU JU JU %% 45 /

02234546789:;;;?6@A9587BA6;A6;C4D46E4C;B6;7FBC;C7G:;B6E3GB6H;H464;6854I;H464;8E9A6:5I;7A783;65=49;A@;=8C4;28B9C;J=2KI;7F4;65=49;A@;289CB5A6:;6B6@A9587BL4;2ACB7BA6C;J#M?KI;7F4; 65=49;A@;289CB5A6:;B6@A9587BL4;2ACB7BA6C;J#?KI;5AG43;C4G;B6;8683:CBC;A@;B6GBLBG83;3AEB;JNAG43KI;8EE4CCBA6;65=49C;A@;S.

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age Gene Description Score Fold-change Classification Sephs2 selenophosphate synthase 2 2.680 3.7 Metabolism

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression

Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2017 Supplementary Information for: Deconvolution of Heterogeneous Wound Tissue Samples into

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

RNA sequencing of cancer reveals novel splicing alterations

RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

Expression levels of b-pix mrna in ALS-MSCs and C-MSCs.

Supplementary Data SUPPLEMENTARY FIG. S1. The neurological functioning of ischemic rats depends on the origin of the transplanted MSCs. The scores of healthy rats in tests on forelimb placing, forelimb

Table SI. Genes overexpressed in CD34 + CD7 + prothymocytes.

Table SI. Genes overexpressed in CD34 + CD7 + prothymocytes. 1553183_at UMODL1 uromodulin-like 1 NM_173568 9.6 9.8 6.7 6.3 7 1553970_s_at CEL carboxyl ester lipase (bile salt-stimulated lipase) BC042510

Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health

Sepsis is a syndrome with hyperactivity of TH17-like innate immunity and hypoactivity of adaptive immunity By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2

Genes, Genes, Everywhere! The key to a cure for IBD

Genes, Genes, Everywhere! The key to a cure for IBD Dermot McGovern MD, PhD, FRCP Director, Translational Medicine Professor of Medicine Joshua L and Lisa Z Greer Endowed Chair in IBD Genetics F. Widjaja

SUPPLEMENTAL DATA. Table S1. Genes in each pathway selected for analysis.

SUPPLEMENTAL DATA Table S1. Genes in each pathway selected for analysis. Gene Chr Start End bp Pathway 1 AKR1C1 10 5000044 5022159 22115 COX 2 AKR1C2 10 5029967 5060207 30240 COX 3 AKR1C3 10 5077549 5149878

Integrative Radiation Biology

Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced

Supplemental Figure 1. Mother. Son. Brother. Nephew. Sister (deceased)

Supplemental Figure 1 IRF8:NM_002163:c.C602T IRF8:NM_002163:c.C671T M Son Br Nephew Sister (deceased) Supplemental Figure 1. Confirmation of family member IRF8 variants by Sanger sequencing. The proband

Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information

Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information Florent Baty 1 florent.baty@unibas.ch Michel P Bihl 1 michel.bihl@unibas.ch

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG

Eosinophils! 40! 30! 20! 10! 0! NS!

A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,

Supplemental Table S1. Table of 131 NudC-interacting proteins, classified in functional groups.

Supplemental Table S1. Table of 131 NudC-interacting proteins, classified in functional groups. IPI accession number Swiss-Prot accession number Gene Symbol Protein name Signal Transduction Protein kinases

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

Quantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes

Quantitative Real Time PCR (RT-qPCR) First strand cdna was synthesized and RT-qPCR was performed using RT2 first strand kits (Cat#330401) and RT2 qpcr Master Mix (SABioscience, Frederick, MD). Experiments

Using Ozone to Validate a. Toxicity Testing

Using Ozone to Validate a Systems Biology Approach to Toxicity Testing Robert Devlin Environmental Public Health Division US EPA Systems Biology Informed Risk Assessment Meeting NationalAcademy of Sciences

Requisition for DNA Testing. Reason for Referral: Patient Information: INCOMPLETE REQUESTS WILL BE BANKED. Test Requests: Sample Collection:

Reason for Referral: Diagnostic Testing: Affected Unaffected Carrier testing/known Family Mutation Name of index case in the family (include copy of report): Date of Birth: Relationship to this patient:

Request for expedited Result

London Health Sciences Centre Molecular Genetics Laboratories Requisition for DNA Testing DACC002 REV 20170815 AUTHORIZED SIGNATURE IS REQUIRED INCOMPLETE REQUESTS WILL BE BANKED Molecular Genetics Laboratory

MathIOmica: Dynamic Transcriptome

Printed from the Complete Wolfram Language Documentation 1 MathIOmica: Dynamic Transcriptome Loading the MathIOmica Package Classification, Clustering and Visualization of Transcriptome Time eries Importing

Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed

Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression

Figure 1. Stepwise approach of treating patients with rheumatoid arthritis.

Establish diagnosis early Document baseline disease activity and damage Estimate prognosis Initiate therapy Begin patient education Start DMARD therapy within 3 months Consider NSAID Consider local or

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Marcucci G, Radmacher MD, Maharry K, et al. MicroRNA expression

Direct Intracellular Regulators of Apoptosis Array 1

Supplement Table A Direct Intracellular Regulators of Apoptosis 2 Mean Name Description.5 2.2.9 ATM ataxia telangiectasia mutated homolog.9.8.9 Bcl2aa B-cell leukemia/lymphoma 2 related protein Aa.6 2..9

Supplemental Figure 1. Proliferation status of lung cancer cell lines in 3D lrecm.

This journal is The Royal Society of Chemistry 211 Supplemental Figure 1. Proliferation status of lung cancer cell lines in 3D lrecm. 1 9 8 %Ki-67 7 6 5 4 3 2 1 H1437 H173 A549 H23 ChagoK1 H217 H358 Supplemental

Pedro A. Martinez, PhD December 7 th, 2015

RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline

Pedro A. Martinez, PhD June 10 th, 2016

(Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA1 Function in Murine β-thalassemia Pedro A. Martinez, PhD June 10 th, 2016 ACE-536 is a

University of Groningen. B cell lymphoma Wu, Rui

University of Groningen B cell lymphoma Wu, Rui IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

BD Rhapsody Immune Response Panel Hs

Doc ID: 55665 Rev. 2.0 PRODUCT INSERT BD Rhapsody Immune Response Panel Hs BD Biosciences Kit Part Number: 633750 Purpose The BD Rhapsody Immune Response Panel Hs is a set of ready-to-use primer pools

SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B

SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described

Table 1: NFkB Target Gene Sets 1.Genes included in the subset of 15k genes selected according to a MAD-based variation filter

Supplementary Information NFkB target gene sets The NFkB target gene sets are listed below (Table1). In addition to the previously performed mapping of Affymetrix probesets and corresponding Lymphochip

Ah Receptor-Mediated Disruption of the Cardiac Embryogenesis Program Alvaro Puga Department of Environmental Health University of Cincinnati College

Ah Receptor-Mediated Disruption of the Cardiac Embryogenesis Program Alvaro Puga Department of Environmental Health University of Cincinnati College of Medicine, Ohio. Source: texasheart.org Congenital

Supplementary Figure 1

Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

1 Supplementary Table Description

1 Supplementary Table Description We created a table that contains information for human genes, including structural annotations and numerical summaries from our single-cell analysis and GTEx validation.

TABLE S1 Regulated genes in LPS-activated modcs after mir-155 knockdown, determined by Affymetrix microarray analysis.

TABLE S1 Regulated genes in LPS-activated modcs after mir-155 knockdown, determined by Affymetrix microarray analysis. Affymetrix ID Gene Symbol Genbank ID Description Fold change 204614_at SERPINB2 NM_002575

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

Bone Marrow Stroma in Myelodysplastic Syndromes

Bone Marrow Stroma in Myelodysplastic Syndromes Universidad de Salamanca Prof Mª M Consuelo del Cañizo Hematology Dept. University Hospital, Salamanca SPAIN Bone marrow stroma in MDS Introduction Mesenchymal

Psoriasis: Therapeutic Advances & The Translational Revolution. James G. Krueger, MD PhD Professor and Laboratory Head The Rockefeller University

Psoriasis: Therapeutic Advances & The Translational Revolution James G. Krueger, MD PhD Professor and Laboratory Head The Rockefeller University Conflicts Research support, consulting, or lecture fees

A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells

A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells David G. Hancock 1,2, Elena Shklovskaya 1,2, Thomas V. Guy 1,2, Reza Falsafi 3, Chris D.

Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method

Supporting Information Article Title Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method Authors Heike A. Schmitt 1,3, Andreas Pich 2, Anke Schröder 2, Verena Scheper 1,3, Giorgio

Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.

Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region

Figure 1: Effects of cisplatin on survival of lung cancer cells.

Figure 1 Figure 1: Effects of cisplatin on survival of lung cancer cells. To determine the IC 50 concentration of cisplatin, cells were treated with various concentrations of cisplatin and cell survival

Supplementary Table 3. List of genes defined in the literature as significant in monocyte-to-macrophage differentiation and polarization.

Supplementary Table 3. List of genes defined in the literature as significant in monocyte-to-macrophage differentiation and polarization. Symbol Gene Name Entrez ID Reported Expression Reference ADAM8

CHAPTER INTRODUCTION

CHAPTER 6 IDENTIFICATION OF RHEUMATOID ARTHRITIS SIGNIFICANT TARGET PROTEINS AND THEIR PATHWAYS THROUGH THE COMBINATORIAL APPROACH (RA-GIM, RA-DTP AND MICROARRAY DATANALYSIS OF RA) 6.1 INTRODUCTION The

Supplementary Information

Supplementary Information Title: Role of Cytochrome P450 (CYP)1A in Hyperoxic Lung Injury: Analysis of the Transcriptome and Proteome Authors: Krithika Lingappan a, Suman Maity b, Weiwu Jiang a, Lihua

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!

SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

Supporting Information

Supporting Information Lin et al. 10.1073/pnas.1408759111 Fig. S1. Safety and potential toxicity evaluation of M1 in immunocompetent mice. Immunocompetent BALB/c mice received two doses of i.v. infusion