Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 Supplementary Information Title: Role of Cytochrome P450 (CYP)1A in Hyperoxic Lung Injury: Analysis of the Transcriptome and Proteome Authors: Krithika Lingappan a, Suman Maity b, Weiwu Jiang a, Lihua Wang a, Xanthi Couroucli a, Alex Weith a,c, Guodong Zhou d, Cristian Coarfa b and Bhagavatula Moorthy a*

2 Table S1: Up regulated genes across all genotypes (Hyperoxia exposed mice compared to room air controls) WT GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator MT1 Metallothionein CDKN1A Cyclin Dependent Kinase Inhibitor 1A 8.01 AKAP12 A- Kinase Anchoring Protein ANKRD1 Ankyrin Repeat Domain TNFRSF12A TNF Receptor Superfamily Member 12A 6.36 CTGF Connective Tissue Growth Factor 5.47 GADD45G Growth Arrest And DNA Damage Inducible Gamma 5.47 GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator ANKRD1 Ankyrin Repeat Domain CDKN1A Cyclin Dependent Kinase Inhibitor 1A 6.53 MT1 Metallothionein TGM2 Transglutaminase TRIB3 Tribbles Pseudokinase TNFRSF12A TNF Receptor Superfamily Member 12A 5.13 Cyp1a2- /-

3 GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator ANKRD1 Ankyrin Repeat Domain AREG Amphiregulin 7.72 MT1 Metallothionein TNFRSF12A TNF Receptor Superfamily Member 12A 5.92 MTHFD2 Methylenetetrahydrofolate Dehydrogenase (NADP+ Dependent) 2, 5.16 Methenyltetrahydrofolate Cyclohydrolase ASNS Asparagine Synthetase (Glutamine- Hydrolyzing) 5.13 CTGF Connective Tissue Growth Factor 5.04

4 Table S2: Down regulated genes across all genotypes (Hyperoxia exposed mice compared to room air controls) WT ASAH3L N- Acylsphingosine Amidohydrolase 3- Like 0.26 EAR2 V- Erba- Related Protein EDNRB Endothelin Receptor Type B 0.24 FMO1 Flavin- Containing Monooxygenase 0.28 LYZ1 Lysozyme (Renal Amyloidosis) 0.26 MUP2 Methionine Permease 0.24 TMEM100 Transmembrane Protein ASAH3L N- Acylsphingosine Amidohydrolase 3- Like 0.28 CXCL12 C- X- C Motif Chemokine Ligand EAR2 V- Erba- Related Protein LYZ1 Lysozyme (Renal Amyloidosis) 0.22 MUP2 Methionine Permease 0.26 TMEM100 Transmembrane Protein Cyp1a2- /- EAR2 V- Erba- Related Protein EAR3 V- Erba- Related Protein

5 LYZ1 Lysozyme (Renal Amyloidosis) 0.25 SFTPA1 Surfactant Protein A THBD Thrombomodulin 0.28 TMEM100 Transmembrane Protein

6 Table S4: Down regulated genes in Room Air (WT vs. and WT vs. Cyp1a2- /- ) vs. WT CBX1 Chromobox CD200 CD RPL29 Ribosomal protein L NNMT Nicotinamide N- methyltransferase 0.34 EPM2AIP1 EPM2A (laforin) interacting protein MELA Melanoma antigen 0.54 ATG3 Autophagy related CLASRP CLK4- associating serine/arginine rich protein 0.55 WDR82 WD repeat domain containing CD59 CD Cyp1a2- /- vs. WT MUP2 Major urinary protein MUP3 Major urinary protein TTR Transthyretin 0.47 MUP5 Major urinary protein APOA Apolipoprotein A- II 0.51 RHBDL2 Rhomboid, veinlet- like ACTC1 Actin, alpha, cardiac muscle KLF2 Kruppel like factor MT- ND5 NADH dehydrogenase 5, mitochondrial 0.59

7 Table S3: Up regulated genes in Room Air (WT vs. and WT vs. Cyp1a2- /- ) vs. WT ERDR1 Erythroid Differentiation Regulator PGLYRP1 Peptidoglycan recognition protein ADAT2 Adenosine deaminase, trna specific SORL1 Sortilin related receptor Rpl29- ps2 Ribosomal protein L29, pseudogene SLC27A6 Solute carrier family 27 (fatty acid transporter), member HSPA8 Heat shock protein KLF2 Kruppel- like factor IL18 Interleukin Cyp1a2- /- vs. WT MAP3K6 Mitogen- activated protein kinase kinase kinase KLF9 Kruppel- like factor ANGPTL4 Angiopoietin- like FKBP5 FK506 binding protein FAM107A Family with sequence similarity 107, member A 1.93 NPR3 Natriuretic peptide receptor EAR3 Eosinophil- associated, ribonuclease A family, member SPARC Secreted acidic cysteine rich glycoprotein 1.85 LPL Lipoprotein lipase 1.82

8 Figure S1 Room Air Hyperoxia mtor c-met Keap1 PTEN Figure S1. Hyperoxia- exposed WT and Cyp1a1- WT_Room Air WT_Hyperoxia p70s6k E-Cadherin FAK Fibronectin MEK1/2 ps217/221 Src py416 RPS6 IRS1 beta-catenin ps33 Cyclin D1 Stat5 py694 EZH1 Stat5 XRCC1 p53 BRCA1 ATR ps428 Mre11 LCN2 Src py527 p90rsk VEGFR2 BIM cjun ps73 eif4e PTCH CHK2 pt68 ACC1 ps79 GSK-3a/b ps21/9 AMPKa pt172 LKB1 ps428 /- mice are characterized by robust and distinct proteomic changes compared to room air controls. Reverse Phase Protein Analysis (RPPA) was used to generate proteomic profiles of WT and mice exposed to hyperoxia. Differential protein expression was evaluated BM mmh Room Air BM mmm BM mmo BM mhw Hyperoxia BM mh_ BM mh6 using parametric t- test (significance for fdr- Cyp1a1-/- Room Air Cyp1a1-/- Hyperoxia ACC1 ps79 AMPKa pt172 EZH2 LKB1 ps248 Akt ps473 S6 ps235/s236 S6 ps240/s244 ELK-1 ps383 Stat3 py705 GSK-3a/b ps21/9 4EBP1 pt37/t46 Rab25 VEGFR2 Axl py702 PKCa ps657 Caspase7 BRCA1 p38 NFkB p65 PI3K p110a Akt Zeta BIM Src py527 mtor PI3K p85 PTEN FAK Keap1 Stat5 py69 TAZ adjusted q- value<0.25). Proteomic changes of hyperoxia exposed mice compared to room air controls in WT and mice

9 Table S5: RPPA profile of differentially expressed proteins in the lung after exposure to hyperoxia in and Cyp1a2- /- compared to WT mice Antibody Gene Symbol fold change p- value over WT fdr- adjusted q- value Antibody Gene Symbol Cyp1a2- /- fold change Cyp1a2- /- over WT p- value Cyp1a2- /- fdr- adjusted q- value AMPKa pt172 PRKAA c- Raf RAF GSK- 3a/b ps21/9 GSK3A, GSK3B Stat5 STAT CHK2 pt68 CHEK IGF1R IGF1R ELK- 1 ps383 ELK ACC1 ACACA PTCH PTCH mtor FRAP Stat3 py705 STAT VEGFR2 KDR LKB1 ps428 STK Bcl- xl BCL2L eif4e EIF4E p70s6k pt389 RPS6KB Bcl- xl BCL2L Stat3 py705 STAT Stat5 py694 STAT S6 ps240/s244 RPS GSK3B GSK3B PI3K p110a PIK3CA p38 MAPK E- Cadherin CDH PI3K p85 PIK3R Src py527 SRC EBP1 pt37/t46 EIF4EBP p70s6k RPS6KB c- Met MET ACC1 ACACA

10 EGFR py1173 EGFR mtor FRAP Keap1 KEAP PKCa PRKCA Zeta YWHAZ beta- Catenin ps33 CTNNB PKCa ps657 PRKCA VEGFR2 KDR BRCA1 BRCA PTEN PTEN LCN2 LCN Mre11 MRE11A

11 Table S6: RPPA profile of differentially expressed proteins in the lung after exposure in WT and mice after exposure to hyperoxia compared to room air (RA) controls. Antibody Gene Symbol WT O 2 RA fold change WT O 2 RA p- value WT O 2 RA fdr- adjusted q- value Antibody Gene Symbol O 2 over RA fold change O 2 over RA p- value O 2 over RA fdr- adjusted q- value LCN2 LCN Caspase7 CASP Mre11 MRE11A BIM BCL2L VEGFR2 KDR BRCA1 BRCA PTEN PTEN PKCa ps657 PRKCA BRCA1 BRCA Stat5 py694 STAT c- Met MET PTEN PTEN Src py416 SRC Keap1 KEAP p70s6k RPS6KB VEGFR2 KDR E- Cadherin CDH p38 MAPK AKT1 AKT2 beta- Catenin ps33 CTNNB Akt AKT p53 TP Zeta YWHAZ Src py527 SRC EBP1 pt37/t46 EIF4EBP BIM BCL2L Src py527 SRC Stat5 STAT Axl py702 AXL Keap1 KEAP PI3K p85 PIK3R mtor FRAP FAK PTK RPS6 RPS mtor FRAP XRCC1 XRCC PI3K p110a PIK3CA

12 p90rsk RPS6KA NFkB p65 NFKB IRS1 IRS TAZ WWTR ATR ps428 ATR Rab25 RAB Fibronectin FN EZH2 EZH Cyclin D1 CCND ELK- 1 ps383 ELK FAK PTK ACC1 ps79 ACACA ACACB Stat5 py694 STAT GSK- 3a/b ps21/9 GSK3A, GSK3B EZH2 EZH LKB1 ps428 STK MEK1/2 ps217/221 MAP2K Stat3 py705 STAT AKT1 AKT2 LKB1 ps428 STK Akt.pS473 AKT eif4e EIF4E AMPKa pt172 PRKAA cjun ps73 JUN S6 ps235/s236 RPS PTCH PTCH S6 ps240/s244 RPS CHK2 pt68 CHEK GSK- 3a/b ps21/9 GSK3A, GSK3B AMPKa pt172 PRKAA ACC1 ps79 ACACA ACACB

13 Table S7: Primer List Gene Symbol Gene name Identifier 1 Ankrd1 Ankyrin repeat domain 1 Mm _m1 2 Gdf15 Growth differentiation factor 15 Mm _m1 3 Nupr1 Nuclear protein transcription regulator 1 Mm _m1 4 Areg Amphiegulin Mm m1 5 P21(Trp63) Transformation protein63 Mm m1 6 CTGF Connective tissue growth factor Mm g1 7 Hmox1 Heme oxygenase1 Mm m1 8 Dusp1 daul specificity phosph Mm g1 9 Slc2a3 solutate carrier family2 member3 Mm m1 10 Nme1 Nucleoside diphosphate kines1 Mm m1 11 PCNA Proliferating cell nuclear antigen Mm g1 12 XPC Xeroderma pigmentosum complementation groupc Mm m1 13 CD63 CD63 antigen Mm g1 14 Abca1 ATP- binding casette sub- family A (ABC1),member1 Mm m1

Phosphorylation Site Company Cat #

Phosphorylation Site Company Cat # Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell

More information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

More information

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF

More information

Case Study - Informatics

Case Study - Informatics bd@jubilantbiosys.com Case Study - Informatics www.jubilantbiosys.com Validating as a Prognostic marker and Therapeutic Target for Multiple Cancers Introduction Human genome projects and high throughput

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

More information

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018 Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations

More information

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

More information

SIRT6 histone deacetylase functions as a potential oncogene in human melanoma -

SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - Garcia-Peterson et al Supplementary Figure S:Tissue microarray (TMA) staining and organization. A) Diagram of the TMA indicating

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Effect of Acid and Pepsin on LPR-Sensitive Mucins In Vitro

Effect of Acid and Pepsin on LPR-Sensitive Mucins In Vitro Novel Drug Targets for Reflux Disease Role of LPR in Injury and Disease is Controversial Nikki Johnston, Ph.D. Department of Otolaryngology and Communication Sciences Medical College of Wisconsin Milwaukee,

More information

Protein SD Units (P-value) Cluster order

Protein SD Units (P-value) Cluster order SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA

Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology

More information

PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb

PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb NEWSLETTER Version 1 From Research to Discovery PI3K / AKT / mtor Signalling Pathway in Cancer PI3K / AKT / mtor Related Antibodies from CovalAb www.covalab.com CovalAb - 11 avenue Albert Einstein 69100

More information

q 2017 by The University of Chicago. All rights reserved. DOI: /690105

q 2017 by The University of Chicago. All rights reserved. DOI: /690105 q 2017 by The University of Chicago. All rights reserved. DOI: 10.1086/690105 Appendix from R. M. Cox et al., Hormonally Mediated Increases in Sex-Biased Gene Expression Accompany the Breakdown of Between-

More information

Illumina s Cancer Research Portfolio and Dedicated Workflows

Illumina s Cancer Research Portfolio and Dedicated Workflows Illumina s Cancer Research Portfolio and Dedicated Workflows Michael Sohn Clinical Sales Specialist Spain&Italy 2017 2017 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish,

More information

Lecture #27 Lecturer A. N. Koval

Lecture #27 Lecturer A. N. Koval Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates

More information

Therapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center

Therapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Therapeutic Resistance to HER2 Targeted Therapies Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Relevant Financial Disclosures Millennium/Takeda Pharmaceuticals (consultant, sponsored

More information

Supplementary Figure 1. The overlap between statistically-significant and highconfidence

Supplementary Figure 1. The overlap between statistically-significant and highconfidence Supplementary figures Supplementary Figure 1. The overlap between statistically-significant and highconfidence PPIs with previously reported PPIs in public databases. Venn diagrams showing the overlap

More information

Plasma-Seq conducted with blood from male individuals without cancer.

Plasma-Seq conducted with blood from male individuals without cancer. Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer

More information

Diagnostic test Suggested website label Description Hospitals available

Diagnostic test Suggested website label Description Hospitals available Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular

More information

Content Prioritization And Content Entry and Quality Control Process

Content Prioritization And Content Entry and Quality Control Process Content Prioritization And Content Entry and Quality Control Process The process of data capture begins with the definition of the content module or sub-module to be built (see figure 1). Broadly we define

More information

Supplement 8: Candidate age-related genes and pathways

Supplement 8: Candidate age-related genes and pathways Supplement 8: Candidate age-related genes and pathways Function Untreated cohort (cohort 1) Treated cohort (cohort 2) Genes Gene sets Effect of age Effect of age FDR of 2 nd Effect of age adjusted Effect

More information

blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific

blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and

More information

Supplemental Table 1:

Supplemental Table 1: Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession

More information

Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells

Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun

More information

Response and resistance to BRAF inhibitors in melanoma

Response and resistance to BRAF inhibitors in melanoma Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations

More information

Supplementary figures

Supplementary figures Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Breast Cancer RESULT INTERPRETATION THERAPRINT OVERVIEW

Breast Cancer RESULT INTERPRETATION THERAPRINT OVERVIEW Breast Cancer PAGE 1 OF 7 Patient: DOB: Patient #: Gender: Customer Ref.: SPECIMEN Requisition: Collection Date: Date Received: Report Date: Specimen Site: Tumor Origin: Unspecified Breast PHYSICIAN Ordering

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information

Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 )

Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 ) Signal transduction and protein kinase inhibitors Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Protein Kinases in the Human Genome 518 kinases 1.7 % of human genome Lipid kinases Nucleotide kinases Cell Signaling

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

EGFR: fundamenteel en klinisch

EGFR: fundamenteel en klinisch EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

Nature Medicine: doi: /nm.3559

Nature Medicine: doi: /nm.3559 Supplementary Note 1. A sample alteration report. Each alteration nominated by PHIAL is curated to answer specific fields that are intended to guide physician interpretation. Gene Alteration Patient ID

More information

Interrogating mtor Inhibition in Patients with HRPC

Interrogating mtor Inhibition in Patients with HRPC Interrogating mtor Inhibition in Patients with HRPC Daniel George, John Madden, Andrew Armstrong, Mark Dewhirst, Nancy Major, and Phillip Febbo Divisions of Medical Oncology, Urology, Pathology, Radiology,

More information

Oncogenes and Tumor. supressors

Oncogenes and Tumor. supressors Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene

More information

Clinically Useful Next Generation Sequencing and Molecular Testing in Gliomas MacLean P. Nasrallah, MD PhD

Clinically Useful Next Generation Sequencing and Molecular Testing in Gliomas MacLean P. Nasrallah, MD PhD Clinically Useful Next Generation Sequencing and Molecular Testing in Gliomas MacLean P. Nasrallah, MD PhD Neuropathology Fellow Division of Neuropathology Center for Personalized Diagnosis (CPD) Glial

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

SureSelect Cancer All-In-One Custom and Catalog NGS Assays SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

An Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine

An Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine An Integrative Pharmacogemic Approach Identifies Two-drug Combination Therapies for Personalized Cancer Medicine Yin Liu 1,2,3, Teng Fei 4,5, Xiaoqi Zheng 6, Myles Brown 4,5, Peng Zhang 7*, X. Shirley

More information

Oncology Biomarker Panel

Oncology Biomarker Panel Oncology Biomarker Panel HTG EdgeSeq Oncology Biomarker Panel The HTG EdgeSeq Oncology Biomarker Panel profiles tumor samples in order to identify therapeutic targets and drug response markers using an

More information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855 Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

More information

MAPK Pathway

MAPK Pathway MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth

More information

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

More information

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

More information

Enabling Personalized

Enabling Personalized Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development

More information

Overcoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding

Overcoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding Supplementary Information Overcoming Resistance to Inhibitors Through State-Specific Kinase Binding Chris J. Novotny 1, Sirkku Pollari 2, Jin H. Park 3, Mark A. Lemmon 3,4, Weijun Shen 2*, Kevan M. Shokat

More information

Precision Oncology: Experience at UW

Precision Oncology: Experience at UW Precision Oncology: Experience at UW Colin Pritchard MD, PhD University of Washington, Department of Lab Medicine WSMOS Meeting November 1, 2013 Conflict of Interest Disclosures I declare the following,

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

What is the status of the technologies of "precision medicine?

What is the status of the technologies of precision medicine? Session 2: What is the status of the technologies of "precision medicine? Gideon Blumenthal, MD, Clinical Team Leader, Thoracic and Head/Neck Oncology, Center for Drug Evaluation and Research (CDER), U.S.

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE

APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

Prognostic value of DNA repair based stratification of hepatocellular carcinoma

Prognostic value of DNA repair based stratification of hepatocellular carcinoma Prognostic value of DNA repair based stratification of hepatocellular carcinoma Zhuo Lin 1, 2 #, Shi-Hao Xu 3 #, Hai-Qing Wang 4, Yi-Jing Cai 1, 2, Li Ying 3, Mei Song 1, 2, Yu-Qun Wang 1, 2, Shan-Jie

More information

Jocelyn Chapman, MD Division of Gynecologic Oncology. Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic

Jocelyn Chapman, MD Division of Gynecologic Oncology. Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic Jocelyn Chapman, MD Division of Gynecologic Oncology Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic Genetics underlies all cancers Somatic or tumor genetics Germline or inherited genetics

More information

2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10)

2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10) Appendix Data The hvps- signalling module counteracts inhibition of the PIK-Akt pathway to maintain mtorc activity and tumour growth Ruzica Bago, Eeva Sommer, Pau Castel, Claire Crafter, Fiona P. Bailey,

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation

More information

Designer Affinity Reagents. Brian Kay

Designer Affinity Reagents. Brian Kay Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm x 10

More information

Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays

Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Dr. Markus Ehrat Zeptosens A Division of Bayer Schweiz AG SSOM Meeting March 16 /17

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Pedro A. Martinez, PhD June 10 th, 2016

Pedro A. Martinez, PhD June 10 th, 2016 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA1 Function in Murine β-thalassemia Pedro A. Martinez, PhD June 10 th, 2016 ACE-536 is a

More information

Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways

Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed

More information

Exons from 137 genes were targeted for hybrid selection and massively parallel sequencing.

Exons from 137 genes were targeted for hybrid selection and massively parallel sequencing. SUPPLEMENTARY TABLES Supplementary Table 1. Targeted Genes ABL1 ABL2 AKT1 AKT2 AKT3 ALK APC ATM AURKA BCL2 BRAF BRCA1 BRCA2 CCND1 CCNE1 CDC73 CDH1 CDK4 CDK6 CDK8 CDKN1A CDKN2A CEBPA CHEK1 CHEK2 CREBBP

More information

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have

More information

Next generation sequencing on FFPE tumor tissues for lung and colorectal carcinoma diagnostics and research Sakari Knuutila

Next generation sequencing on FFPE tumor tissues for lung and colorectal carcinoma diagnostics and research Sakari Knuutila Next generation sequencing on FFPE tumor tissues for lung and colorectal carcinoma diagnostics and research Sakari Knuutila Faculty of Medicine / Haartman Institute / Department of Pathology / Sakari Knuutila

More information

Table 1A. Genes enriched as over-expressed in DPM treatment group

Table 1A. Genes enriched as over-expressed in DPM treatment group Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later

More information

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

More information

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular

More information

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.

Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain. Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm

More information

Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles

Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI 10.5012/bkcs.2011.32.6. Supporting Information Evaluation of Toxicity and Gene Expression

More information

Supplementary Material. Table S1. Summary of mapping results

Supplementary Material. Table S1. Summary of mapping results Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598

More information

Pedro A. Martinez, PhD December 7 th, 2015

Pedro A. Martinez, PhD December 7 th, 2015 RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline

More information

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block) RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format

More information

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng. Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class

More information

Secuenciación masiva: papel en la toma de decisiones

Secuenciación masiva: papel en la toma de decisiones Secuenciación masiva: papel en la toma de decisiones Cancer is a Genetic Disease Development of cancer is driven by the acquisition of somatic genetic alterations: Nonsynonymous point mutations: missense.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1- Differential expression of stress-related genes. Feature Number Probe Name Systematic Name Gene Name Description 30248 A_52_P342860 NM_007954 Es1 Mus musculus esterase 1 (Es1), mrna

More information

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b. Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure

More information

CENTRAL LABORATORY SERVICES

CENTRAL LABORATORY SERVICES CENTRAL LABORATORY SERVICES Bridging the Gaps in Biomarker Development and Testing for Global Clinical Trials Biomarkers, Digital Pathology & the Central Lab Presentation Title Presenter Name July 16,

More information