Supplementary Information
|
|
- Joy Collins
- 6 years ago
- Views:
Transcription
1 Supplementary Information Title: Role of Cytochrome P450 (CYP)1A in Hyperoxic Lung Injury: Analysis of the Transcriptome and Proteome Authors: Krithika Lingappan a, Suman Maity b, Weiwu Jiang a, Lihua Wang a, Xanthi Couroucli a, Alex Weith a,c, Guodong Zhou d, Cristian Coarfa b and Bhagavatula Moorthy a*
2 Table S1: Up regulated genes across all genotypes (Hyperoxia exposed mice compared to room air controls) WT GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator MT1 Metallothionein CDKN1A Cyclin Dependent Kinase Inhibitor 1A 8.01 AKAP12 A- Kinase Anchoring Protein ANKRD1 Ankyrin Repeat Domain TNFRSF12A TNF Receptor Superfamily Member 12A 6.36 CTGF Connective Tissue Growth Factor 5.47 GADD45G Growth Arrest And DNA Damage Inducible Gamma 5.47 GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator ANKRD1 Ankyrin Repeat Domain CDKN1A Cyclin Dependent Kinase Inhibitor 1A 6.53 MT1 Metallothionein TGM2 Transglutaminase TRIB3 Tribbles Pseudokinase TNFRSF12A TNF Receptor Superfamily Member 12A 5.13 Cyp1a2- /-
3 GDF15 Growth Differentiation Factor NUPR1 Nuclear Protein 1, Transcriptional Regulator ANKRD1 Ankyrin Repeat Domain AREG Amphiregulin 7.72 MT1 Metallothionein TNFRSF12A TNF Receptor Superfamily Member 12A 5.92 MTHFD2 Methylenetetrahydrofolate Dehydrogenase (NADP+ Dependent) 2, 5.16 Methenyltetrahydrofolate Cyclohydrolase ASNS Asparagine Synthetase (Glutamine- Hydrolyzing) 5.13 CTGF Connective Tissue Growth Factor 5.04
4 Table S2: Down regulated genes across all genotypes (Hyperoxia exposed mice compared to room air controls) WT ASAH3L N- Acylsphingosine Amidohydrolase 3- Like 0.26 EAR2 V- Erba- Related Protein EDNRB Endothelin Receptor Type B 0.24 FMO1 Flavin- Containing Monooxygenase 0.28 LYZ1 Lysozyme (Renal Amyloidosis) 0.26 MUP2 Methionine Permease 0.24 TMEM100 Transmembrane Protein ASAH3L N- Acylsphingosine Amidohydrolase 3- Like 0.28 CXCL12 C- X- C Motif Chemokine Ligand EAR2 V- Erba- Related Protein LYZ1 Lysozyme (Renal Amyloidosis) 0.22 MUP2 Methionine Permease 0.26 TMEM100 Transmembrane Protein Cyp1a2- /- EAR2 V- Erba- Related Protein EAR3 V- Erba- Related Protein
5 LYZ1 Lysozyme (Renal Amyloidosis) 0.25 SFTPA1 Surfactant Protein A THBD Thrombomodulin 0.28 TMEM100 Transmembrane Protein
6 Table S4: Down regulated genes in Room Air (WT vs. and WT vs. Cyp1a2- /- ) vs. WT CBX1 Chromobox CD200 CD RPL29 Ribosomal protein L NNMT Nicotinamide N- methyltransferase 0.34 EPM2AIP1 EPM2A (laforin) interacting protein MELA Melanoma antigen 0.54 ATG3 Autophagy related CLASRP CLK4- associating serine/arginine rich protein 0.55 WDR82 WD repeat domain containing CD59 CD Cyp1a2- /- vs. WT MUP2 Major urinary protein MUP3 Major urinary protein TTR Transthyretin 0.47 MUP5 Major urinary protein APOA Apolipoprotein A- II 0.51 RHBDL2 Rhomboid, veinlet- like ACTC1 Actin, alpha, cardiac muscle KLF2 Kruppel like factor MT- ND5 NADH dehydrogenase 5, mitochondrial 0.59
7 Table S3: Up regulated genes in Room Air (WT vs. and WT vs. Cyp1a2- /- ) vs. WT ERDR1 Erythroid Differentiation Regulator PGLYRP1 Peptidoglycan recognition protein ADAT2 Adenosine deaminase, trna specific SORL1 Sortilin related receptor Rpl29- ps2 Ribosomal protein L29, pseudogene SLC27A6 Solute carrier family 27 (fatty acid transporter), member HSPA8 Heat shock protein KLF2 Kruppel- like factor IL18 Interleukin Cyp1a2- /- vs. WT MAP3K6 Mitogen- activated protein kinase kinase kinase KLF9 Kruppel- like factor ANGPTL4 Angiopoietin- like FKBP5 FK506 binding protein FAM107A Family with sequence similarity 107, member A 1.93 NPR3 Natriuretic peptide receptor EAR3 Eosinophil- associated, ribonuclease A family, member SPARC Secreted acidic cysteine rich glycoprotein 1.85 LPL Lipoprotein lipase 1.82
8 Figure S1 Room Air Hyperoxia mtor c-met Keap1 PTEN Figure S1. Hyperoxia- exposed WT and Cyp1a1- WT_Room Air WT_Hyperoxia p70s6k E-Cadherin FAK Fibronectin MEK1/2 ps217/221 Src py416 RPS6 IRS1 beta-catenin ps33 Cyclin D1 Stat5 py694 EZH1 Stat5 XRCC1 p53 BRCA1 ATR ps428 Mre11 LCN2 Src py527 p90rsk VEGFR2 BIM cjun ps73 eif4e PTCH CHK2 pt68 ACC1 ps79 GSK-3a/b ps21/9 AMPKa pt172 LKB1 ps428 /- mice are characterized by robust and distinct proteomic changes compared to room air controls. Reverse Phase Protein Analysis (RPPA) was used to generate proteomic profiles of WT and mice exposed to hyperoxia. Differential protein expression was evaluated BM mmh Room Air BM mmm BM mmo BM mhw Hyperoxia BM mh_ BM mh6 using parametric t- test (significance for fdr- Cyp1a1-/- Room Air Cyp1a1-/- Hyperoxia ACC1 ps79 AMPKa pt172 EZH2 LKB1 ps248 Akt ps473 S6 ps235/s236 S6 ps240/s244 ELK-1 ps383 Stat3 py705 GSK-3a/b ps21/9 4EBP1 pt37/t46 Rab25 VEGFR2 Axl py702 PKCa ps657 Caspase7 BRCA1 p38 NFkB p65 PI3K p110a Akt Zeta BIM Src py527 mtor PI3K p85 PTEN FAK Keap1 Stat5 py69 TAZ adjusted q- value<0.25). Proteomic changes of hyperoxia exposed mice compared to room air controls in WT and mice
9 Table S5: RPPA profile of differentially expressed proteins in the lung after exposure to hyperoxia in and Cyp1a2- /- compared to WT mice Antibody Gene Symbol fold change p- value over WT fdr- adjusted q- value Antibody Gene Symbol Cyp1a2- /- fold change Cyp1a2- /- over WT p- value Cyp1a2- /- fdr- adjusted q- value AMPKa pt172 PRKAA c- Raf RAF GSK- 3a/b ps21/9 GSK3A, GSK3B Stat5 STAT CHK2 pt68 CHEK IGF1R IGF1R ELK- 1 ps383 ELK ACC1 ACACA PTCH PTCH mtor FRAP Stat3 py705 STAT VEGFR2 KDR LKB1 ps428 STK Bcl- xl BCL2L eif4e EIF4E p70s6k pt389 RPS6KB Bcl- xl BCL2L Stat3 py705 STAT Stat5 py694 STAT S6 ps240/s244 RPS GSK3B GSK3B PI3K p110a PIK3CA p38 MAPK E- Cadherin CDH PI3K p85 PIK3R Src py527 SRC EBP1 pt37/t46 EIF4EBP p70s6k RPS6KB c- Met MET ACC1 ACACA
10 EGFR py1173 EGFR mtor FRAP Keap1 KEAP PKCa PRKCA Zeta YWHAZ beta- Catenin ps33 CTNNB PKCa ps657 PRKCA VEGFR2 KDR BRCA1 BRCA PTEN PTEN LCN2 LCN Mre11 MRE11A
11 Table S6: RPPA profile of differentially expressed proteins in the lung after exposure in WT and mice after exposure to hyperoxia compared to room air (RA) controls. Antibody Gene Symbol WT O 2 RA fold change WT O 2 RA p- value WT O 2 RA fdr- adjusted q- value Antibody Gene Symbol O 2 over RA fold change O 2 over RA p- value O 2 over RA fdr- adjusted q- value LCN2 LCN Caspase7 CASP Mre11 MRE11A BIM BCL2L VEGFR2 KDR BRCA1 BRCA PTEN PTEN PKCa ps657 PRKCA BRCA1 BRCA Stat5 py694 STAT c- Met MET PTEN PTEN Src py416 SRC Keap1 KEAP p70s6k RPS6KB VEGFR2 KDR E- Cadherin CDH p38 MAPK AKT1 AKT2 beta- Catenin ps33 CTNNB Akt AKT p53 TP Zeta YWHAZ Src py527 SRC EBP1 pt37/t46 EIF4EBP BIM BCL2L Src py527 SRC Stat5 STAT Axl py702 AXL Keap1 KEAP PI3K p85 PIK3R mtor FRAP FAK PTK RPS6 RPS mtor FRAP XRCC1 XRCC PI3K p110a PIK3CA
12 p90rsk RPS6KA NFkB p65 NFKB IRS1 IRS TAZ WWTR ATR ps428 ATR Rab25 RAB Fibronectin FN EZH2 EZH Cyclin D1 CCND ELK- 1 ps383 ELK FAK PTK ACC1 ps79 ACACA ACACB Stat5 py694 STAT GSK- 3a/b ps21/9 GSK3A, GSK3B EZH2 EZH LKB1 ps428 STK MEK1/2 ps217/221 MAP2K Stat3 py705 STAT AKT1 AKT2 LKB1 ps428 STK Akt.pS473 AKT eif4e EIF4E AMPKa pt172 PRKAA cjun ps73 JUN S6 ps235/s236 RPS PTCH PTCH S6 ps240/s244 RPS CHK2 pt68 CHEK GSK- 3a/b ps21/9 GSK3A, GSK3B AMPKa pt172 PRKAA ACC1 ps79 ACACA ACACB
13 Table S7: Primer List Gene Symbol Gene name Identifier 1 Ankrd1 Ankyrin repeat domain 1 Mm _m1 2 Gdf15 Growth differentiation factor 15 Mm _m1 3 Nupr1 Nuclear protein transcription regulator 1 Mm _m1 4 Areg Amphiegulin Mm m1 5 P21(Trp63) Transformation protein63 Mm m1 6 CTGF Connective tissue growth factor Mm g1 7 Hmox1 Heme oxygenase1 Mm m1 8 Dusp1 daul specificity phosph Mm g1 9 Slc2a3 solutate carrier family2 member3 Mm m1 10 Nme1 Nucleoside diphosphate kines1 Mm m1 11 PCNA Proliferating cell nuclear antigen Mm g1 12 XPC Xeroderma pigmentosum complementation groupc Mm m1 13 CD63 CD63 antigen Mm g1 14 Abca1 ATP- binding casette sub- family A (ABC1),member1 Mm m1
Phosphorylation Site Company Cat #
Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell
More informationSupplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
More informationDox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
More informationCase Study - Informatics
bd@jubilantbiosys.com Case Study - Informatics www.jubilantbiosys.com Validating as a Prognostic marker and Therapeutic Target for Multiple Cancers Introduction Human genome projects and high throughput
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationSupplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
More informationTargeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations
More informationU118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
More informationSIRT6 histone deacetylase functions as a potential oncogene in human melanoma -
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - Garcia-Peterson et al Supplementary Figure S:Tissue microarray (TMA) staining and organization. A) Diagram of the TMA indicating
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationEffect of Acid and Pepsin on LPR-Sensitive Mucins In Vitro
Novel Drug Targets for Reflux Disease Role of LPR in Injury and Disease is Controversial Nikki Johnston, Ph.D. Department of Otolaryngology and Communication Sciences Medical College of Wisconsin Milwaukee,
More informationProtein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
More informationA particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
More informationJennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA
Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology
More informationPI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb
NEWSLETTER Version 1 From Research to Discovery PI3K / AKT / mtor Signalling Pathway in Cancer PI3K / AKT / mtor Related Antibodies from CovalAb www.covalab.com CovalAb - 11 avenue Albert Einstein 69100
More informationq 2017 by The University of Chicago. All rights reserved. DOI: /690105
q 2017 by The University of Chicago. All rights reserved. DOI: 10.1086/690105 Appendix from R. M. Cox et al., Hormonally Mediated Increases in Sex-Biased Gene Expression Accompany the Breakdown of Between-
More informationIllumina s Cancer Research Portfolio and Dedicated Workflows
Illumina s Cancer Research Portfolio and Dedicated Workflows Michael Sohn Clinical Sales Specialist Spain&Italy 2017 2017 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish,
More informationLecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
More informationTherapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center
Therapeutic Resistance to HER2 Targeted Therapies Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Relevant Financial Disclosures Millennium/Takeda Pharmaceuticals (consultant, sponsored
More informationSupplementary Figure 1. The overlap between statistically-significant and highconfidence
Supplementary figures Supplementary Figure 1. The overlap between statistically-significant and highconfidence PPIs with previously reported PPIs in public databases. Venn diagrams showing the overlap
More informationPlasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
More informationDiagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
More informationContent Prioritization And Content Entry and Quality Control Process
Content Prioritization And Content Entry and Quality Control Process The process of data capture begins with the definition of the content module or sub-module to be built (see figure 1). Broadly we define
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationSupplement 8: Candidate age-related genes and pathways
Supplement 8: Candidate age-related genes and pathways Function Untreated cohort (cohort 1) Treated cohort (cohort 2) Genes Gene sets Effect of age Effect of age FDR of 2 nd Effect of age adjusted Effect
More informationblood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific
Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and
More informationSupplemental Table 1:
Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession
More informationSupplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells
Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun
More informationResponse and resistance to BRAF inhibitors in melanoma
Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations
More informationSupplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationBreast Cancer RESULT INTERPRETATION THERAPRINT OVERVIEW
Breast Cancer PAGE 1 OF 7 Patient: DOB: Patient #: Gender: Customer Ref.: SPECIMEN Requisition: Collection Date: Date Received: Report Date: Specimen Site: Tumor Origin: Unspecified Breast PHYSICIAN Ordering
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationRho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
More informationSignal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 )
Signal transduction and protein kinase inhibitors Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Protein Kinases in the Human Genome 518 kinases 1.7 % of human genome Lipid kinases Nucleotide kinases Cell Signaling
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationEGFR: fundamenteel en klinisch
EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationNature Medicine: doi: /nm.3559
Supplementary Note 1. A sample alteration report. Each alteration nominated by PHIAL is curated to answer specific fields that are intended to guide physician interpretation. Gene Alteration Patient ID
More informationInterrogating mtor Inhibition in Patients with HRPC
Interrogating mtor Inhibition in Patients with HRPC Daniel George, John Madden, Andrew Armstrong, Mark Dewhirst, Nancy Major, and Phillip Febbo Divisions of Medical Oncology, Urology, Pathology, Radiology,
More informationOncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
More informationClinically Useful Next Generation Sequencing and Molecular Testing in Gliomas MacLean P. Nasrallah, MD PhD
Clinically Useful Next Generation Sequencing and Molecular Testing in Gliomas MacLean P. Nasrallah, MD PhD Neuropathology Fellow Division of Neuropathology Center for Personalized Diagnosis (CPD) Glial
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationAn Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine
An Integrative Pharmacogemic Approach Identifies Two-drug Combination Therapies for Personalized Cancer Medicine Yin Liu 1,2,3, Teng Fei 4,5, Xiaoqi Zheng 6, Myles Brown 4,5, Peng Zhang 7*, X. Shirley
More informationOncology Biomarker Panel
Oncology Biomarker Panel HTG EdgeSeq Oncology Biomarker Panel The HTG EdgeSeq Oncology Biomarker Panel profiles tumor samples in order to identify therapeutic targets and drug response markers using an
More informationAACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
More informationNext Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationMAPK Pathway
MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth
More informationTable S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationEnabling Personalized
Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development
More informationOvercoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding
Supplementary Information Overcoming Resistance to Inhibitors Through State-Specific Kinase Binding Chris J. Novotny 1, Sirkku Pollari 2, Jin H. Park 3, Mark A. Lemmon 3,4, Weijun Shen 2*, Kevan M. Shokat
More informationPrecision Oncology: Experience at UW
Precision Oncology: Experience at UW Colin Pritchard MD, PhD University of Washington, Department of Lab Medicine WSMOS Meeting November 1, 2013 Conflict of Interest Disclosures I declare the following,
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationWhat is the status of the technologies of "precision medicine?
Session 2: What is the status of the technologies of "precision medicine? Gideon Blumenthal, MD, Clinical Team Leader, Thoracic and Head/Neck Oncology, Center for Drug Evaluation and Research (CDER), U.S.
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationSupplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
More informationUnderstanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationAPPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE
AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST
More informationELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
More informationPrognostic value of DNA repair based stratification of hepatocellular carcinoma
Prognostic value of DNA repair based stratification of hepatocellular carcinoma Zhuo Lin 1, 2 #, Shi-Hao Xu 3 #, Hai-Qing Wang 4, Yi-Jing Cai 1, 2, Li Ying 3, Mei Song 1, 2, Yu-Qun Wang 1, 2, Shan-Jie
More informationJocelyn Chapman, MD Division of Gynecologic Oncology. Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic
Jocelyn Chapman, MD Division of Gynecologic Oncology Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic Genetics underlies all cancers Somatic or tumor genetics Germline or inherited genetics
More information2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10)
Appendix Data The hvps- signalling module counteracts inhibition of the PIK-Akt pathway to maintain mtorc activity and tumour growth Ruzica Bago, Eeva Sommer, Pau Castel, Claire Crafter, Fiona P. Bailey,
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationTable S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation
More informationDesigner Affinity Reagents. Brian Kay
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm x 10
More informationPlanar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays
Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Dr. Markus Ehrat Zeptosens A Division of Bayer Schweiz AG SSOM Meeting March 16 /17
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationPedro A. Martinez, PhD June 10 th, 2016
(Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA1 Function in Murine β-thalassemia Pedro A. Martinez, PhD June 10 th, 2016 ACE-536 is a
More informationMechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed
More informationExons from 137 genes were targeted for hybrid selection and massively parallel sequencing.
SUPPLEMENTARY TABLES Supplementary Table 1. Targeted Genes ABL1 ABL2 AKT1 AKT2 AKT3 ALK APC ATM AURKA BCL2 BRAF BRCA1 BRCA2 CCND1 CCNE1 CDC73 CDH1 CDK4 CDK6 CDK8 CDKN1A CDKN2A CEBPA CHEK1 CHEK2 CREBBP
More informationThe PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction
The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have
More informationNext generation sequencing on FFPE tumor tissues for lung and colorectal carcinoma diagnostics and research Sakari Knuutila
Next generation sequencing on FFPE tumor tissues for lung and colorectal carcinoma diagnostics and research Sakari Knuutila Faculty of Medicine / Haartman Institute / Department of Pathology / Sakari Knuutila
More informationTable 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationIn vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell
Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later
More informationNext generation histopathological diagnosis for precision medicine in solid cancers
Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics
More informationCell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
More informationDesigner Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm
More informationSupporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles
Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI 10.5012/bkcs.2011.32.6. Supporting Information Evaluation of Toxicity and Gene Expression
More informationSupplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
More informationPedro A. Martinez, PhD December 7 th, 2015
RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline
More informationApplied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)
RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format
More informationSupplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.
Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class
More informationSecuenciación masiva: papel en la toma de decisiones
Secuenciación masiva: papel en la toma de decisiones Cancer is a Genetic Disease Development of cancer is driven by the acquisition of somatic genetic alterations: Nonsynonymous point mutations: missense.
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1- Differential expression of stress-related genes. Feature Number Probe Name Systematic Name Gene Name Description 30248 A_52_P342860 NM_007954 Es1 Mus musculus esterase 1 (Es1), mrna
More informationAdditional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More informationSupplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
More informationCENTRAL LABORATORY SERVICES
CENTRAL LABORATORY SERVICES Bridging the Gaps in Biomarker Development and Testing for Global Clinical Trials Biomarkers, Digital Pathology & the Central Lab Presentation Title Presenter Name July 16,
More information