Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8
|
|
|
- Shanon Hudson
- 5 years ago
- Views:
Transcription
1 Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8 Genbank NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ AK NM_ NM_ NM_ NM_ Description Mus musculus acyloxyacyl hydrolase (Aoah), mrna [NM_012054] Mus musculus calsyntenin 3 (Clstn3), mrna [NM_153508] Mus musculus retinoid X receptor alpha (Rxra), mrna [NM_011305] Mus musculus RNA guanylyltransferase and 5'-phosphatase (Rngtt), mrna [NM_011884] Mus musculus proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n), mrna [NM_013892] Mus musculus manic fringe homolog (Drosophila) (Mfng), mrna [NM_008595] Mus musculus protein kinase C, zeta (Prkcz), transcript variant 1, mrna [NM_008860] Mus musculus brain expressed gene 4 (Bex4), mrna [NM_212457] Mus musculus pre-b lymphocyte gene 3 (Vpreb3), mrna [NM_009514] Mus musculus activator of basal transcription (Abt1), mrna [NM_013924] Mus musculus RIKEN cdna G06 gene ( G06Rik), mrna [NM_028661] Mus musculus cdna sequence BC (BC004728), transcript variant 1, mrna [NM_174992] Mus musculus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 (Atp5g2), mrna [NM_026468] Mus musculus zinc finger protein of the cerebellum 3 (Zic3), mrna [NM_009575] Mus musculus transmembrane protein 101 (Tmem101), mrna [NM_029649] Mus musculus 18-day embryo whole body cdna, RIKEN full-length enriched library, clone: j15 product:hypothetical Transthyretin/Transthyretin-related containing protein, full insert sequence. [AK004470] Mus musculus cytochrome c oxidase, subunit VIc (Cox6c), mrna [NM_053071] Mus musculus mediator of RNA polymerase II transcription, subunit 31 homolog (yeast) (Med31), mrna [NM_026068] Mus musculus cytochrome c oxidase, subunit XVII assembly protein homolog (yeast) (Cox17), mrna [NM_ ] Mus musculus vaccinia related kinase 3 (Vrk3), mrna [NM_133945] AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: n02 product:hypothetical Adenylate kinase/glutamic acid-rich region containing protein, full insert sequence. [AK019664] NM_ Mus musculus myosin X (Myo10), mrna [NM_019472] NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus WD repeat domain 40B (Wdr40b), mrna [NM_178739] Mus musculus growth differentiation factor 3 (Gdf3), mrna [NM_008108] Mus musculus RAD9 homolog B (S. cerevisiae) (Rad9b), mrna [NM_144912] Mus musculus zinc finger protein of the cerebellum 5 (Zic5), mrna [NM_022987] Mus musculus POU domain, class 5, transcription factor 1 (Pou5f1), mrna [NM_013633] Mus musculus tumor-associated calcium signal transducer 1 (Tacstd1), mrna [NM_008532] Mus musculus protein tyrosine phosphatase, non-receptor type 6 (Ptpn6), transcript variant 1, mrna [NM_013545] Mus musculus ubiquitously expressed transcript (Uxt), mrna [NM_013840] Mus musculus L-threonine dehydrogenase (Tdh), mrna [NM_021480] Mus musculus nitric oxide synthase interacting protein (Nosip), mrna [NM_025533]
2 NM_ NM_ NM_ NM_ Mus musculus activator of basal transcription (Abt1), mrna [NM_013924] Mus musculus RIKEN cdna D03 gene ( D03Rik), mrna [NM_144953] Mus musculus ubiquitously expressed transcript (Uxt), mrna [NM_013840] Mus musculus glutathione S-transferase, theta 2 (Gstt2), mrna [NM_010361] NM_ Mus musculus solute carrier family 37 (glycerol-3-phosphate transporter), member 1 (Slc37a1), mrna [NM_153062] NM_ Mus musculus tight junction protein 3 (Tjp3), mrna [NM_013769] NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus glia maturation factor, gamma (Gmfg), transcript variant 1, mrna [NM_022024] Mus musculus microtubule-associated protein 7 (Mtap7), mrna [NM_008635] Mus musculus microtubule-associated protein 7 (Mtap7), mrna [NM_008635] Mus musculus protein kinase C, zeta (Prkcz), transcript variant 1, mrna [NM_008860] Mus musculus protein kinase C, zeta (Prkcz), transcript variant 1, mrna [NM_008860] Mus musculus RIKEN cdna J01 gene ( J01Rik), mrna [NM_029554] NM_ Mus musculus extraembryonic, spermatogenesis, homeobox 1 (Esx1), mrna [NM_007957] NM_ Mus musculus nuclear receptor subfamily 0, group B, member 1 (Nr0b1), mrna [NM_007430] NM_ Mus musculus zinc finger, AN1-type domain 6 (Zfand6), mrna [NM_022985] NM_ Mus musculus solute carrier family 12 (potassium/chloride transporters), member 8 (Slc12a8), mrna [NM_134251] NM_ Mus musculus proprotein convertase subtilisin/kexin type 1 inhibitor (Pcsk1n), mrna [NM_013892] NM_ Mus musculus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 (Atp5g2), mrna [NM_026468] NM_ Mus musculus pumilio 1 (Drosophila) (Pum1), mrna [NM_030722] NM_ NM_ NM_ NM_ NM_ Mus musculus ring finger protein 125 (Rnf125), mrna [NM_026301] Mus musculus WAP four-disulfide core domain 2 (Wfdc2), mrna [NM_026323] Mus musculus activator of basal transcription (Abt1), mrna [NM_013924] Mus musculus pre-b lymphocyte gene 3 (Vpreb3), mrna [NM_009514] Mus musculus retinoid X receptor alpha (Rxra), mrna [NM_011305] NM_ Mus musculus RIKEN cdna B13 gene ( B13Rik), transcript variant 1, mrna [NM_025838] NM_ Mus musculus cdna sequence BC (BC038822), mrna [NM_172293] NM_ NM_ AK NM_ NM_ NM_ NM_ NM_ Mus musculus peroxisome biogenesis factor 7 (Pex7), mrna [NM_008822] Mus musculus dynein light chain Tctex-type 1 (Dynlt1), mrna [NM_009342] Mus musculus ES cells cdna, RIKEN full-length enriched library, clone: p08 product:hypothetical Proline-rich region profile/zn-finger, C2H2 type containing protein, full insert sequence. [AK010559] Mus musculus renal tumor antigen (Rage), mrna [NM_011973] Mus musculus renal tumor antigen (Rage), mrna [NM_011973] Mus musculus RNA guanylyltransferase and 5'-phosphatase (Rngtt), mrna [NM_011884] Mus musculus glia maturation factor, gamma (Gmfg), transcript variant 1, mrna [NM_022024] Mus musculus kit oncogene (Kit), mrna [NM_021099] AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: n02 product:hypothetical Adenylate kinase/glutamic acid-rich region
3 NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ containing protein, full insert sequence. [AK019664] Mus musculus ATP synthase, H+ transporting, mitochondrial F1F0 complex, subunit e (Atp5k), mrna [NM_007507] Mus musculus zinc finger and BTB domain containing 32 (Zbtb32), mrna [NM_021397] Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), mrna Mus musculus tubulin tyrosine ligase-like family, member 6 (Ttll6), mrna [NM_172799] Mus musculus developmental pluripotency-associated 3 (Dppa3), mrna [NM_139218] Mus musculus RING1 and YY1 binding protein (Rybp), mrna [NM_019743] Mus musculus alpha-kinase 3 (Alpk3), mrna [NM_054085] Mus musculus PRAME family member 12 (Pramef12), mrna [NM_029948] Mus musculus Rap1 interacting factor 1 homolog (yeast) (Rif1), mrna [NM_175238] Mus musculus zinc finger protein 42 (Zfp42), mrna [NM_009556] Mus musculus reproductive homeobox 6 (Rhox6), mrna [NM_008955] Mus musculus Epstein-Barr virus induced gene 3 (Ebi3), mrna [NM_015766] Mus musculus ubiquitin specific peptidase 28 (Usp28), mrna [NM_175482] Mus musculus delta-like 3 (Drosophila) (Dll3), mrna [NM_007866] Mus musculus SRY-box containing gene 18 (Sox18), mrna [NM_009236] NM_ Mus musculus developmental pluripotency associated 4 (Dppa4), transcript variant 1, mrna [NM_028610] NM_ Mus musculus anaphase promoting complex subunit 10 (Anapc10), mrna [NM_026904] NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus estrogen related receptor, beta (Esrrb), mrna [NM_011934] Mus musculus anaphase promoting complex subunit 10 (Anapc10), mrna [NM_026904] Mus musculus reproductive homeobox 9 (Rhox9), mrna [NM_023894] Mus musculus solute carrier family 5 (neutral amino acid transporters, system A), member 4b (Slc5a4b), mrna [NM_023219] Mus musculus protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform (Ppp2r2c), mrna [NM_172994] Mus musculus major urinary protein 1 (Mup1), mrna [NM_031188] Mus musculus secretin (Sct), mrna [NM_011328] Mus musculus developmental pluripotency associated 5 (Dppa5), mrna [NM_025274] Mus musculus zona pellucida glycoprotein 3 (Zp3), mrna [NM_011776] Mus musculus transcription factor CP2-like 1 (Tcfcp2l1), mrna [NM_023755] Mus musculus roundabout homolog 4 (Drosophila) (Robo4), mrna [NM_028783] Mus musculus fucokinase (Fuk), transcript variant 1, mrna [NM_172283] Mus musculus tumor rejection antigen P1A (Trap1a), mrna [NM_011635] Mus musculus DNA segment, Chr 11, ERATO Doi 636, expressed (D11Ertd636e), transcript variant 2, mrna [NM_029794] Mus musculus SRY-box containing gene 21 (Sox21), mrna [NM_145464] Mus musculus ADP-ribosyltransferase 5 (Art5), mrna [NM_007491] Mus musculus Rap1 interacting factor 1 homolog (yeast) (Rif1), mrna [NM_175238] Mus musculus transcription factor CP2-like 1 (Tcfcp2l1), mrna [NM_023755] Mus musculus microtubule associated serine/threonine kinase 1 (Mast1), mrna [NM_019945]
4 NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus calcyphosine-like (Capsl), mrna [NM_029341] Mus musculus sulfotransferase family 4A, member 1 (Sult4a1), mrna [NM_013873] Mus musculus solute carrier family 5 (neutral amino acid transporters, system A), member 4b (Slc5a4b), mrna [NM_023219] Mus musculus solute carrier family 5 (neutral amino acid transporters, system A), member 4b (Slc5a4b), mrna [NM_023219] Mus musculus solute carrier family 2 (facilitated glucose transporter), member 3 (Slc2a3), mrna [NM_011401] Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), mrna Mus musculus myelin-associated oligodendrocytic basic protein (Mobp), transcript variant 1, mrna [NM_008614] Mus musculus developmental pluripotency associated 5 (Dppa5), mrna [NM_025274] Mus musculus SRY-box containing gene 21 (Sox21), mrna [NM_145464] Mus musculus disabled homolog 1 (Drosophila) (Dab1), transcript variant 1, mrna [NM_010014] Mus musculus stathmin-like 3 (Stmn3), mrna [NM_009133] Mus musculus autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) (Aire), mrna [NM_009646] Mus musculus disabled homolog 1 (Drosophila) (Dab1), transcript variant 1, mrna [NM_010014] Mus musculus Der1-like domain family, member 3 (Derl3), mrna [NM_024440] Mus musculus lymphocyte antigen 6 complex, locus G6E (Ly6g6e), mrna [NM_027366] Mus musculus SRY-box containing gene 2 (Sox2), mrna [NM_011443] Mus musculus RIKEN cdna C330003B14 gene (C330003B14Rik), mrna [NM_175342] AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: h02 product:hypothetical AMP-dependent synthetase and ligase containing protein, full insert sequence [AK028078] NM_ Mus musculus zinc finger protein 42 (Zfp42), mrna [NM_009556] XM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ AK NM_ NM_ NM_ PREDICTED: Mus musculus RIKEN cdna D15 gene ( D15Rik), mrna [XM_356184] Mus musculus zona pellucida glycoprotein 3 (Zp3), mrna [NM_011776] Mus musculus RIKEN cdna O08 gene ( O08Rik), mrna [NM_144518] Mus musculus RIKEN cdna L05 gene ( L05Rik), mrna [NM_026480] Mus musculus RIKEN cdna O08 gene ( O08Rik), mrna [NM_144518] Mus musculus RING1 and YY1 binding protein (Rybp), mrna [NM_019743] Mus musculus septin 1 (Sept1), mrna [NM_017461] Mus musculus glycosyltransferase-like 1B (Gyltl1b), mrna [NM_172670] Mus musculus gastrulation brain homeobox 2 (Gbx2), mrna [NM_010262] Mus musculus apolipoprotein E (Apoe), mrna [NM_009696] Mus musculus prostaglandin D2 synthase (brain) (Ptgds), mrna [NM_008963] Mus musculus 10 days embryo whole body cdna, RIKEN full-length enriched library, clone: e04 product:similar to MAJOR URINARY PROTEINS 11 AND 8 (MUP11 AND MUP8) (FRAGMENT) [Mus musculus], full insert sequence. [AK011413] Mus musculus nuclear receptor subfamily 5, group A, member 2 (Nr5a2), mrna [NM_030676] Mus musculus coagulation factor II (F2), mrna [NM_010168] Mus musculus sulfotransferase family 4A, member 1 (Sult4a1), mrna [NM_013873]
5 NM_ Mus musculus phosducin-like 2 (Pdcl2), mrna [NM_023508] AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: a02 product:hypothetical Glutamic acid-rich region containing protein, full insert sequence. [AK006101] NM_ Mus musculus tuberous sclerosis 1 (Tsc1), mrna [NM_022887] NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ XM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus programmed cell death protein 7 (Pdcd7), mrna [NM_016688] Mus musculus myelin-associated glycoprotein (Mag), mrna [NM_010758] Mus musculus minichromosome maintenance deficient 2 mitotin (S. cerevisiae) (Mcm2), mrna [NM_008564] Mus musculus histocompatibility 2, blastocyst (H2-Bl), mrna [NM_008199] Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), mrna Mus musculus Kruppel-like factor 2 (lung) (Klf2), mrna [NM_008452] Mus musculus SRY-box containing gene 15 (Sox15), mrna [NM_009235] Mus musculus left right determination factor 1 (Lefty1), mrna [NM_010094] Mus musculus elastase 2A (Ela2a), mrna [NM_007919] Mus musculus coiled-coil domain containing 101 (Ccdc101), mrna [NM_029339] Mus musculus RIKEN cdna P11 gene ( P11Rik), mrna [NM_025503] Mus musculus procollagen, type IX, alpha 2 (Col9a2), mrna [NM_007741] Mus musculus leukemia inhibitory factor receptor (Lifr), mrna [NM_013584] Mus musculus DNA (cytosine-5-)-methyltransferase 3-like (Dnmt3l), mrna [NM_019448] Mus musculus leukemia inhibitory factor receptor (Lifr), mrna [NM_013584] Mus musculus golgi SNAP receptor complex member 1 (Gosr1), mrna [NM_016810] Mus musculus transmembrane 4 superfamily member 5 (Tm4sf5), mrna [NM_029360] Mus musculus transmembrane protein 170 (Tmem170), mrna [NM_025781] Mus musculus histocompatibility 2, blastocyst (H2-Bl), mrna [NM_008199] PREDICTED: Mus musculus RIKEN cdna A530057A03 gene (A530057A03Rik), mrna [XM_130488] Mus musculus tuberous sclerosis 1 (Tsc1), mrna [NM_022887] Mus musculus histocompatibility 2, blastocyst (H2-Bl), mrna [NM_008199] Mus musculus golgi SNAP receptor complex member 1 (Gosr1), mrna [NM_016810] Mus musculus leukemia inhibitory factor receptor (Lifr), mrna [NM_013584] Mus musculus dead end homolog 1 (zebrafish) (Dnd1), mrna [NM_173383] Mus musculus F-box protein 5 (Fbxo5), mrna [NM_025995] Mus musculus RIKEN cdna G04 gene ( G04Rik), mrna [NM_027622] NM_ Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), mrna AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: j07 product:hypothetical protein, full insert sequence. [AK016694] NM_ Mus musculus aurora kinase C (Aurkc), mrna [NM_020572] NM_ NM_ NM_ NM_ Mus musculus histone aminotransferase 1 (Hat1), mrna [NM_026115] Mus musculus quinolinate phosphoribosyltransferase (Qprt), mrna [NM_133686] Mus musculus cytochrome c, testis (Cyct), mrna [NM_009989] Mus musculus tuberous sclerosis 1 (Tsc1), mrna [NM_022887]
6 NM_ Mus musculus zinc finger, HIT type 3 (Znhit3), mrna [NM_ ] NM_ Mus musculus NLR family, pyrin domain containing 14 (Nlrp14), mrna [NM_ ] NM_ Mus musculus peptidyl arginine deiminase, type III (Padi3), mrna [NM_011060] NM_ NM_ NM_ Mus musculus spermatogenesis and oogenesis specific basic helix-loop-helix 2 (Sohlh2), mrna [NM_028937] Mus musculus asialoglycoprotein receptor 2 (Asgr2), mrna [NM_007493] Mus musculus RIKEN cdna H20 gene ( H20Rik), mrna [NM_173756] NM_ Mus musculus gem (nuclear organelle) associated protein 5 (Gemin5), mrna [NM_172558] NM_ Mus musculus asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2- mannosyltransferase) (Alg11), mrna [NM_183142] NM_ Mus musculus leukemia inhibitory factor receptor (Lifr), mrna [NM_013584] AK NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ Mus musculus 13 days embryo head cdna, RIKEN full-length enriched library, clone: l15 product:unclassifiable, full insert sequence. [AK014173] Mus musculus undifferentiated embryonic cell transcription factor 1 (Utf1), mrna [NM_009482] Mus musculus zinc finger protein 371 (Zfp371), mrna [NM_133204] Mus musculus CD6 antigen (Cd6), transcript variant 2, mrna [NM_009852] Mus musculus myelin-associated glycoprotein (Mag), mrna [NM_010758] Mus musculus Kruppel-like factor 2 (lung) (Klf2), mrna [NM_008452] Mus musculus aurora kinase C (Aurkc), mrna [NM_020572] Mus musculus putative neuronal cell adhesion molecule (Punc), mrna [NM_008988] Mus musculus protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb), mrna [NM_023587] Mus musculus Kruppel-like factor 4 (gut) (Klf4), mrna [NM_010637] Mus musculus testis expressed gene 101 (Tex101), mrna [NM_019981] Mus musculus T-cell lymphoma breakpoint 1 (Tcl1), mrna [NM_009337] Mus musculus DNA methyltransferase 3A (Dnmt3a), transcript variant 1, mrna [NM_007872] Mus musculus l(3)mbt-like 2 (Drosophila) (L3mbtl2), mrna [NM_145993] Mus musculus cytokine receptor-like factor 3 (Crlf3), mrna [NM_018776] Mus musculus cdna sequence BC (BC060631), mrna [NM_177700] Mus musculus DNA methyltransferase 3A (Dnmt3a), transcript variant 1, mrna [NM_007872] Mus musculus dynein, axonemal, intermediate chain 1 (Dnaic1), mrna [NM_175138] Mus musculus cdna sequence BC (BC060631), mrna [NM_177700] Mus musculus cytokine receptor-like factor 3 (Crlf3), mrna [NM_018776] Mus musculus l(3)mbt-like 2 (Drosophila) (L3mbtl2), mrna [NM_145993]
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
2.2 Cell Construction
2.2 Cell Construction Elemental composition of typical bacterial cell C 50%, O 20%, N 14%, H 8%, P 3%, S 1%, and others (K +, Na +, Ca 2+, Mg 2+, Cl -, vitamin) Molecular building blocks Lipids Carbohydrates
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
Objective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
CELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
Molecular building blocks
2.22 Cell Construction Elemental l composition of ftypical lbacterial cell C 50%, O 20%, N 14%, H 8%, P 3%, S 1%, and others (K +, Na +, Ca 2+, Mg 2+, Cl -, vitamin) Molecular building blocks Lipids Carbohydrates
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD
MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD 1) 37% molecular weight of about 97KDa 2) 14.6% molecular weight of about 45 KDa 3+4) 27.4% molecular weight
Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine
Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine dr.abuhassand@gmail.com An overview of cellular components Endoplasmic reticulum (ER) It is a network of membrane-enclosed
Maturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
Summary of Endomembrane-system
Summary of Endomembrane-system 1. Endomembrane System: The structural and functional relationship organelles including ER,Golgi complex, lysosome, endosomes, secretory vesicles. 2. Membrane-bound structures
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed
BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
BIOL 4374/BCHS 4313 Cell Biology Exam #2 March 22, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #2 March 22, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) In the
Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Concept 5.4: Proteins have many structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Protein functions include structural support, storage,
Proteasomes. When Death Comes a Knock n. Warren Gallagher Chem412, Spring 2001
Proteasomes When Death Comes a Knock n Warren Gallagher Chem412, Spring 2001 I. Introduction Introduction The central dogma Genetic information is used to make proteins. DNA RNA Proteins Proteins are the
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Effects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Previous Class. Today. Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism. Protein Kinase Catalytic Properties
Previous Class Detection of enzymatic intermediates: Protein tyrosine phosphatase mechanism Today Protein Kinase Catalytic Properties Protein Phosphorylation Phosphorylation: key protein modification
Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age
Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age Gene Description Score Fold-change Classification Sephs2 selenophosphate synthase 2 2.680 3.7 Metabolism
Cellular functions of protein degradation
Protein Degradation Cellular functions of protein degradation 1. Elimination of misfolded and damaged proteins: Environmental toxins, translation errors and genetic mutations can damage proteins. Misfolded
Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
Lecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting
Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Question No. 1 of 10 Question 1. Which of the following statements about the nucleus is correct? Question #01 A. The
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
Chapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
Signal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
Lecture 5: Drug targets (continued)
Lecture 5: Drug targets (continued) IIa. Enzymes as drug targets (HMG-CoA example) Many drugs are inhibitors of enzymes that catalyze biologically important reactions. The conversion of HMG-CoA to mevalonic
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Supplemental Data. NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man
Supplemental Data NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man Jianhua Yu 1,2*, Takeki Mitsui 1,3*, Min Wei 1, Hsiaoyin Mao 1, Jonathan P Butchar 4, Mithun
Campbell Biology in Focus (Urry) Chapter 9 The Cell Cycle. 9.1 Multiple-Choice Questions
Campbell Biology in Focus (Urry) Chapter 9 The Cell Cycle 9.1 Multiple-Choice Questions 1) Starting with a fertilized egg (zygote), a series of five cell divisions would produce an early embryo with how
Processing of RNA II Biochemistry 302. February 13, 2006
Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:
Genetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
Short polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer
HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3
Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed
Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression
Biochemistry 2 Recita0on Amino Acid Metabolism
Biochemistry 2 Recita0on Amino Acid Metabolism 04-20- 2015 Glutamine and Glutamate as key entry points for NH 4 + Amino acid catabolism Glutamine synthetase enables toxic NH 4 + to combine with glutamate
Nucleic acids. Nucleic acids are information-rich polymers of nucleotides
Nucleic acids Nucleic acids are information-rich polymers of nucleotides DNA and RNA Serve as the blueprints for proteins and thus control the life of a cell RNA and DNA are made up of very similar nucleotides.
Biology Teach Yourself Series Topic 3: Chemical Nature of the Cell
Biology Teach Yourself Series Topic 3: Chemical Nature of the Cell A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2013 Page 1 of 19 Contents
Syllabus for BASIC METABOLIC PRINCIPLES
Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the
Chemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
Lecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
Chapter 23 Enzymes 1
Chapter 23 Enzymes 1 Enzymes Ribbon diagram of cytochrome c oxidase, the enzyme that directly uses oxygen during respiration. 2 Enzyme Catalysis Enzyme: A biological catalyst. With the exception of some
Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
Cell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm
Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp
MCB II MCDB 3451 Exam 1 Spring, minutes, close everything and be concise!
MCB II MCDB 3451 Exam 1 Spring, 2016 50 minutes, close everything and be concise! Name ID NOTE: QUESTIONS ARE NOT ALL WORTH THE SAME POINTS Total (100) Grade EXAM 1, 2016 MCBII Name 1. Which is UNIQUE
1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled
Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions
Properties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but far from the only one!!!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids
Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
NBCE Mock Board Questions Biochemistry
1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.
This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
Chapter 10. Regulatory Strategy
Chapter 10 Regulatory Strategy Regulation of enzymatic activity: 1. Allosteric Control. Allosteric proteins have a regulatory site(s) and multiple functional sites Activity of proteins is regulated by
Polyomaviridae. Spring
Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
Gene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
Lecture 10 - Protein Turnover and Amino Acid Catabolism
Lecture 10 - Protein Turnover and Amino Acid Catabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire 1 Introduction 2 Proteins are degraded into amino acids. Protein
Posttranslational Modification of Proteins
Posttranslational Modification of Proteins Expanding Natures Inventory Christopher T. Walsh Harvard Medical School RoBERTS AND CoMPANY PuBLISHERS Englewood, Col ~1 ado,. Brief Contents Preface xv Reviewers
Model Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology)
Model Answer M.Sc. Zoology (First Semester) Examination-2013 Paper LZT 103 (Endocrinology) Section A 1. (i) d (ii) b (iii) b (iv) c (v) c (vi) a (vii) c (viii) a (ix) d (x) b Section B Q.2 Answer Hormonal
PCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
Mitochondria and ATP Synthesis
Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy
Protein kinases are enzymes that add a phosphate group to proteins according to the. ATP + protein OH > Protein OPO 3 + ADP
Protein kinase Protein kinases are enzymes that add a phosphate group to proteins according to the following equation: 2 ATP + protein OH > Protein OPO 3 + ADP ATP represents adenosine trisphosphate, ADP
Tala Saleh. Ahmad Attari. Mamoun Ahram
23 Tala Saleh Ahmad Attari Minna Mushtaha Mamoun Ahram In the previous lecture, we discussed the mechanisms of regulating enzymes through inhibitors. Now, we will start this lecture by discussing regulation
Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads.
Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads. Genes differentially expressed between C57BL/6J (B6) and 129S1/SvImJ (129). Note: Positive
Biomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
The Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5
Key Concepts: The Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5 Proteins include a diversity of structures, resulting in a wide range of functions Proteins Enzymatic s
The Structure and Function of Macromolecules
The Structure and Function of Macromolecules Macromolecules are polymers Polymer long molecule consisting of many similar building blocks. Monomer the small building block molecules. Carbohydrates, proteins
REGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER
REGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER RNA Splicing Lecture 3, Biological Regulatory Mechanisms, H. Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice
Developing a clinically feasible personalized medicine approach to pediatric
Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott
7 Pathways That Harvest Chemical Energy
7 Pathways That Harvest Chemical Energy Pathways That Harvest Chemical Energy How Does Glucose Oxidation Release Chemical Energy? What Are the Aerobic Pathways of Glucose Metabolism? How Is Energy Harvested
Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide
Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide pulsed T2 cells. clone avidity by 4-hour 51 Cr-release assay 50% lysis at E:T 10:1 [LML peptide, M] #24
MBB 115:511 and 694:407 Final Exam Niederman/Deis
MBB 115:511 and 694:407 Final Exam Niederman/Deis Tue. Dec. 19, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth two points.
BIO 5099: Molecular Biology for Computer Scientists (et al)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes
REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
Cell Physiology Final Exam Fall 2008
Cell Physiology Final Exam Fall 2008 Guys, The average on the test was 69.9. Before you start reading the right answers please do me a favor and remember till the end of your life that GLUCOSE TRANSPORT
WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA
A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure
SUPPLEMENTARY INFORMATION
Supplementary Table 1- Differential expression of stress-related genes. Feature Number Probe Name Systematic Name Gene Name Description 30248 A_52_P342860 NM_007954 Es1 Mus musculus esterase 1 (Es1), mrna
Phosphoproteomics and the Origin and Operations of the Kineome
Phosphoproteomics and the Origin and Operations of the Kineome Presented by Steven Pelech, Ph.D. Professor, Department of Medicine, University of British Columbia President & CSO, Kinexus Bioinformatics
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):
Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 A schematic representation of the most relevant
Ch. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis!
Chapter 3 Part 2! Pages 65 89 (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! The Cell Theory! Living organisms are composed of one or more cells.!
Eukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,