Supplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
|
|
|
- Kristin Collins
- 5 years ago
- Views:
Transcription
1 Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji 1, Takayuki Isagawa 1, Shogo Yamamoto 1, Takanori Fujita 1, Ryota Yamanaka 1, Yukiko Tanaka 1, Toshihiro Nukiwa 2, Victor E. Marquez, Yuichi Ishikawa 6, Masakazu Ichinose 2, Hiroyuki Aburatani 1 1 Genome Science Division, Research Center for Advanced Science and Technology (RCAST), The University of Tokyo, Japan; 2 Department of Respiratory Medicine, Graduate School of Medicine, Tohoku University, Japan; 3 Department of Molecular Oncology, Graduate School of Medicine, Chiba University, Japan; 4 CREST, Japan Science and Technology Agency (JST); Chemical Biology Laboratory, Frederick National Laboratory for Cancer Research, National Cancer Institute, USA; 6 Divison of Pathology, the Cancer Institute Hospital, Japanese Foundation for Cancer Research, Japan. 1/7
2 2/7 Sato T, et al. Supplementary Table S1. List of 71 genes showing higher expression in SCLC by >10-fold compared to normal tissues. Genes Probes Genechip score in SCLCs Genechip score in normal tissues Average Standard error Average Standard error Folds P-values GRP _at 2, E-03 INSM _s_at 1, E-04 TMSB1A 20347_s_at 1, E-0 LOC _at E-01 ASCL _s_at E-02 HES _at 1, E-06 CDKN2A _at E-07 MAGEA _x_at E-02 NUF _at E-09 DSCR _s_at E-04 SOX _s_at E-02 ISL _at 1, E-02 MAGEA2/A3/A _x_at E-02 CACNA1A 1894_s_at E-03 SOX _at 3, E-10 NOL _at E-03 NDC _at E-06 SCGB1D _at E-03 TOP2A _at 1, E-09 E2F _at E-07 RAD1AP _at E-09 GHRH 21424_at E-02 SP _at E-02 CALCA _s_at E-01 CENPF _s_at E-07 TTK _at E-10 POU2AF _at E-02 STIL 20339_at E-11 SFTA _at E-04 MELK 20482_at E-08 HAPLN _at E-01 ASPM _s_at E-09 FLJ _at E-02 FBXO 21887_s_at E-10 PRDM _at E-04 NRTN _at E-02 LOC _at E-02 AVP _at E-01 ADCYAP _at E-02 EN1 2209_at E-02 DLGAP _at E-09 HELLS 22730_at E-08 POU4F _at E-03 KIF _at E-09 NLRP _a_at E-03 HEPACAM _at E-0 ZNF _x_at E-08 EZH _s_at E-10 CCNB _at E-09 PLK _at E-09 TPH _at E-02 SOX _at E-02 MAD2L _s_at 1, E-11 SCN3A _s_at E-02 HMMR 20716_at E-08 MIAT _at 1, E-04 SVIP 23000_at E-07 CENPK _at E-08 TMPRSS _at E-03 FOXA _at E-02 NUSAP _at 1, E-11 GAS _at E-02 MMP _at 1, E-04 CBX _at E-09 LGSN _at E-04 KCNMB _at E-03 NEUROD1 1607_s_at E-02 GUCA1A 12_g_at E-01 PBK _at E-09 NMU _at E-04 SLC44A 23763_at E-03
3 Sato T, et al. Supplementary Table S2. Characteristics of three SCLC cell lines H209 Lu130 DMS3 Organism Human Human Human Ethnicity Caucasian Asian (Japanese) Caucasian Gender Male Male Male Age years 80 years 4 years Disease Small cell lung cancer Small cell lung cancer Small cell lung cancer RB1 Missense 1 p.c706f (c.2117g>t) p3 Splice site 1 Intronic (c.673-2a>t) Wild type Missense 2 p.p93l (c.278c>t) Wild type Missense 3 p.s241f (c.722c>t) Growth in vitro Floating Floating Attached (monolayer) 3/7
4 Sato T, et al. Supplementary Table S3. ChIP-PCR primers Genes Primer sequences Location Anneal GAPDH AAGACCTTGGGCTGGGACT and GCTGCGGGCTCAATTTATAG chr12: 6,13,837-6,13, C ADAM33 CACCGCCCAGTCTGCATAG and GATTAGCCAGTCCTGCACAGC chr20: 3,609,746 3,609,84 62 C ITGB4 ACTCAGGTCCACAGGGCACTT and GGCTTGCTCCTGGATTTGG chr17: 71,227,323 71,227, C 4/7
5 Sato T, et al. Supplementary figure legends Supplementary Fig. S1. Expression levels of PRC2 members in lung cancer. Expression levels of EZH2, SUZ12 and EED in SCLC were compared with those in adenocarcinoma (Ad) and squamous cell carcinoma (Sq) of the lung. Expression levels of PRC2 members in SCLC were significantly higher than other lung cancer types as well as than normal tissues (N). Red circle, the lung. Supplementary Fig. S2. ChIP-sequencing analyses of H3K27me3 and SUZ12 in Lu130. (a) Similar patterns of H3K27me3 and SUZ12 marks around HOXA, HOXB, HOXC, and HOXD cluster regions were representatively shown. (b) H3K27me3(+) regions and SUZ12(+) regions were 48.1 Mbp and 30.7 Mbp, respectively, and were confirmed to be well-overlapped. Supplementary Fig. S3. Full-length blots for JUB and PTRF expression. Protein expression of introduced JUB and PTRF with V-tag and α-tubulin was confirmed by western blotting using anti-v antibody and anti-α-tubulin antibody, respectively. Supplementary Fig. S4. Robustness to use the set of four genes to classify SCLC. (a) When reported RNA-seq data of SCLC 4 was analyzed by the K-means sample clustering with the four genes, the optimal cluster size was again shown to be two, and the two groups of samples (blue and red spots) were shown by the multi dimensional scaling plot. (b) The one group (blue) could be simply characterized with low JUB and high GRP expression again, and the other one (red) again showed high JUB and low GRP expression. /7
6 Sato T, et al. Supplementary Fig. S. Full-length blots for EZH2 expression. Protein expression of EZH2 and α-tubulin was analyzed by western blotting using anti-ezh2 antibody and anti-α-tubulin antibody, respectively. Blue arrows, blots for the analyzed proteins. Gels were run on the same experimental conditions except gel concentrations; 10% gel was used for both EZH2 and Tubulin in DMS3, 7% gel for EZH2 in Lu130 and H209, and 12% gel for Tubulin in Lu130 and H209. Supplementary Fig. S6. Repression of CAV1 in SCLC. (a) The three SCLC cell lines showed very low expression levels of CAV1, compared to SAEC. (b) Clinical SCLC samples showed lower expression levels of CAV1 compared to the normal lung (red circle) (0.12-fold), or compared to the normal tissues (N) (P=0.004). 6/7
7 Sato T, et al. Supplementary reference 1. Pleasance, E.D. et al. A small-cell lung cancer genome with complex signatures of tobacco exposure. Nature 463 (7278), (2010). 2. Fujita, T. et al. Comprehensive analysis of p3 gene mutation characteristics in lung carcinoma with special reference to histological subtypes. Int J Oncol 1 (), (1999). 3. Forbes, S. et al. COSMIC 200. Br J Cancer 94 (2), (2006). 4. Peifer, M. et al. Integrative genome analyses identify key somatic driver mutations of small-cell lung cancer. Nat Genet 44 (10), (2012). 7/7
8 EZH2 Fig. S1 Genechip score Ad Sq SCLC N SUZ12 Genechip score Ad Sq SCLC N EED Genechip score Ad Sq SCLC N
9 Fig. S2 a 1 SUZ12 1 K27me3 0 20kb HOX A cluster A11AS 1 SUZ12 1 K27me3 0 0kb HOX B cluster B6 B8 B1 B2 B3 B4 B B7 B9 B13 A1 A2 A3 A4 A A6 A7 A9 A10 A11 A13 PRAC 1 SUZ12 1 K27me3 0 20kb HOX C cluster C13 C12 C11 C10 C9 C8 C6 C C4 1 SUZ12 1 K27me3 0 20kb HOX D cluster D9 D13 D12 D11 D10 D8 D4 D3 D1 HOTAIR b 8.8M H3K27me3(+) region 26.2M 48.1Mbps 21.9M SUZ12(+) region 30.7Mbps Overlapped region 21.9Mbps
10 Fig. S3 Anti-V for PTRF Mock PTRF Anti-V for JUB Mock JUB Anti-Tubulin Anti-Tubulin Mock PTRF Mock JUB
11 Fig. S4 a 0. JUB + EPHB4 + GRP + ASCL1 b 10 JUB v.s. GRP Group-L Group-H GRP (log2) JUB (log2)
12 Fig. S DMS3 Lu130 H209 (-) 48h 72h 96h (-) 48h 96h 144h (-) 48h 72h 96h EZH2 Tubulin
13 Fig. S6 a Genechip score CAV1 0 SAEC Lu130 H209 DMS3 b 8000 CAV1 Genechip score SCLC N
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Is genomic grading killing histological grading?
Is genomic grading killing histological grading? Christos Sotiriou MD PhD Fonds National de Recherche Scientifique (FNRS) Université Libre de Bruxelles (ULB) Institut Jules Bordet Histological Grade and
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Molecular Pathology of Ovarian Carcinoma with Morphological Correlation
Molecular athology of Ovarian Carcinoma with Morphological Correlation Kathleen R. Cho, M.D. Comprehensive Cancer Center and Departments of athology and Internal Medicine University of Michigan Medical
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Integrative Radiation Biology
Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity Aleix Prat, Barbara Adamo, Cheng Fan, Vicente Peg, Maria Vidal, Patricia Galván, Ana Vivancos, Paolo
Identifying transcriptional dichotomies by "stochastic sampling"
Identifying transcriptional dichotomies by "stochastic sampling" Kevin Janes and Joan Brugge Department of Cell Biology Harvard Medical School pakt (S473) keratin 10 DAPI National Cancer Institute (CA105134)
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic
Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
Supplementary information. Supplementary figure 1. Flow chart of study design
Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the
Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club
Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi
Supplementary Methods
Supplementary Methods Short Read Preprocessing Reads are preprocessed differently according to how they will be used: detection of the variant in the tumor, discovery of an artifact in the normal or for
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.
Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Columbia College of P&S Sarah Huang Hans Snoeck biorxiv ; doi: https://doi.org/ /261461
Generation of pulmonary neuroendocrine cells and tumors resembling small cell lung cancers from human embryonic stem cells Weill Cornell Medicine Joyce Chen Arun Unni Harold Varmus Asaf Poran Olivier Elemento
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and
Nature Getetics: doi: /ng.3471
Supplementary Figure 1 Summary of exome sequencing data. ( a ) Exome tumor normal sample sizes for bladder cancer (BLCA), breast cancer (BRCA), carcinoid (CARC), chronic lymphocytic leukemia (CLLX), colorectal
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Identification of Potential Therapeutic Targets by Molecular and Genomic Profiling of 628 Cases of Uterine Serous Carcinoma
Identification of Potential Therapeutic Targets by Molecular and Genomic Profiling of 628 Cases of Uterine Serous Carcinoma Nathaniel L Jones 1, Joanne Xiu 2, Sandeep K. Reddy 2, Ana I. Tergas 1, William
Supplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY FIGURES AND TABLES
PD 0332991, a selective cyclin D kinase 4/6 inhibitor, sensitizes lung cancer cells to treatment with epidermal growth factor receptor tyrosine kinase inhibitors SUPPLEMENTARY FIGURES AND TABLES Supplementary
of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
MIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.
Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class
Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients
Vertical Magnetic Separation of Circulating Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Chang Eun Yoo 1,2#, Jong-Myeon Park 3#, Hui-Sung Moon 1,2, Je-Gun Joung 2, Dae-Soon Son
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
SUPPLEMENTARY INFORMATION
DOI:.3/ncb7 Hematopoiesis Expression (Protein) Competition PRC integration Polycomb-mediated gene repression Cell fate HSC PRC SELF-RENEWAL Cbx Cbx4 PRC progenitor genes PROG Cbx PRC Cbx4 DIFFERENTIATION
Nature Genetics: doi: /ng Supplementary Figure 1. Alternative splicing events in the 5K panel.
Supplementary Figure 1 Alternative splicing events in the 5K panel. The majority of cryptic splicing occurred by creation of an AG or GT (Type I). While some other mutations increased the usage of a nearby
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of 1,000 most differentially expressed genes with NKX2-1 amplification in lung adenocarcinoma cell lines and anti-correlated
ddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2
Relative expression.6.5.4.3.2.1 OsDDM1a OsDDM1b OsDRM2 TG TG TG ddm1a (PFG_3-5165) P1 P3 ddm1b (PFG_2-619) P2 531bp 5233bp P1 P4 P3 P2 F1 R1 F1 TG TG TG F1 R1 C ddm1a -/- -/- ddm1b -/- +/- +/- -/- D (PFG_3-411)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER
Technology Transfer in Diagnostic Pathology. 6th Central European Regional Meeting. Cytopathology. Balatonfüred, Hungary, April 7-9, 2011. RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Philippe
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Comparison of Triple Negative Breast Cancer between Asian and Western Data Sets
2010 IEEE International Conference on Bioinformatics and Biomedicine Workshops Comparison of Triple Negative Breast Cancer between Asian and Western Data Sets Lee H. Chen Bioinformatics and Biostatistics
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko
Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
A secondary RET mutation in the activation loop conferring resistance to vandetanib through allosteric effects
A secondary RET mutation in the activation loop conferring resistance to vandetanib through allosteric effects -Elucidation of a novel drug resistance mechanism based on a nationwide genome screening program
Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9
Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9 Kristine E. Yoder, a * and Ralf Bundschuh b a Department of Molecular Virology, Immunology and Medical Genetics, Center
Introduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
RNA-mediated paternal heredity of diet-induced obesity and metabolic disorders
RNA-mediated paternal heredity of diet-induced obesity and metabolic disorders Valérie Grandjean 1,2,3 $, Sandra Fourré 4, Diana Andrea Fernandes De Abreu 5, Marie-Alix Derieppe 1,2,3, Jean-Jacques Remy
oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two
Supplementary Fig. 1 a Kdm3a Kdm4b β-actin Oocyte Testis Oocyte Testis Oocyte Testis b 1.8 Relative expression.6.4.2 Kdm3a Kdm4b RT-PCR analysis of Kdm3a and Kdm4b expression in oocytes and testes. Twenty
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
Supplementary Figure 1. Linkage analysis of Family 7. Red arrow, position of SRRM2 gene in chromosome16.
A germline mutation in SRRM2, a splicing factor gene, is implicated in papillary thyroid carcinoma predisposition Jerneja Tomsic 1, Huiling He 1, Keiko Akagi 1, Sandya Liyanarachchi 1, Qun Pan 2, Blake
Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in
Visualizing Cancer Heterogeneity with Dynamic Flow
Visualizing Cancer Heterogeneity with Dynamic Flow Teppei Nakano and Kazuki Ikeda Keio University School of Medicine, Tokyo 160-8582, Japan keiohigh2nd@gmail.com Department of Physics, Osaka University,
Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.
Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately
Discovery of Essential Growth Drivers in Cancer Brings Magical Drugs to Patients
Discovery of Essential Growth Drivers in Cancer Brings Magical Drugs to Patients Hiroyuki Mano, MD, PhD Department of Cellular Signaling, Graduate School of Medicine, The University of Tokyo, Japan What
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC
Cancer Cell, Volume 33 Supplemental Information lncrna Epigenetic Landscape Analysis Identifies as an Oncogenic lncrna that Interacts with and Promotes Cell-Cycle Progression in Cancer Zehua Wang, Bo Yang,
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature14122 Supplementary Table 1: EZH2 Co-Expression Gene Signature Top 116 genes co-expressed with EZH2 across 9 Oncomine studies Gene Description Symbol ALS2CR4
Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular