Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Size: px
Start display at page:

Download "Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK"

Transcription

1 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) Wilmslow Road Fax: +44 (0) Manchester M20 4BX Website: Testing performed at the above address only Site activities performed away from the locations listed above: Location details Activity Address Haematology & Blood Transfusion The Christie Wilmslow Road Manchester M20 4BX Local contact Contact: Dr. Neil Wrathall Tel: +44 (0) Fax: +44 (0) Theatre Blood Issue Fridge Assessment Manager: GS2 Page 1 of 6

2 DETAIL OF ACCREDITATION Venous blood: citrated Bone marrow aspirate Cerebrospinal fluid Haematological examination activities for the purpose of clinical diagnosis Haemoglobin (HB) White Blood Cells (WBC) Platelets (PLTS) Red blood cells (RBC) Haematocrit (HCT) Mean Cell Volume (MCV) Mean Cell Haemoglobin (MCH) Mean cell haemoglobin concentration (MCHC) Red Cell Distribution (RDW) Neutrophils (NEUT) Lymphocytes (LYMP) Eosinophils (EOSO) Basophils (BASO) Monocytes (MONO) Large unstained cells (LUC) Reticulocyte enumeration Platelet count Blood film assessment (peripheral) for detection of abnormalities and cell differential. Bone marrow film for the detection of normal and abnormal morphology by microscopic examination CSF cell count and cytospin for the detection of normal and abnormal morphology by microscopic examination manufacturer s instructions Advia 2120i (flow cytometry and laser light refraction ) with reference to: LI-Haem-Christie-Advia Startup and Processing Hematek 2000 stainer modified Wright stain and Nikon microscope. Manual assessment with ref to: LI-Haem-Christie-Bloodfilm exam LI-Haem-Christie-BMSmears LI-Haem-Christie-BMReports Manual cell count, modified Wright stain with ref to : LI-Haem-CPP-CSF Assessment Manager: GS2 Page 2 of 6

3 (cont) Ascitic/pleural fluid Venous blood: citrated Haematological examination activities for the purpose of clinical diagnosis (cont d) Fluid cytospin for the detection of normal and abnormal morphology by microscopic examination Detection/screening for Plasmodium spp. Erythrocyte sedimentation Rate (ESR) manufacturer s instructions Manual cell count, modified Wright stain with ref to: LI-Haem-CPP CSF Manual method, modified Wright stain with reference to: LI-Haem-Christie-Field Stain Manual method - Sedimentation with reference to : LI-Haem Christie -ESR Sickle cell solubility Solubility screening test, TCS sickle check screening kit with reference to : LI-Haem Christie-sickletest and Bone Marrow Urine Citrated Iron levels Detection of Urinary Haemosiderin Coagulation Screen: Prothrombin time (PT) Activated partial thromboplastin time (APTT) Derived Fibrinogen Clauss Fib Thrombin time Reptilase time D-Dimer 50/50 Basic correction test FX assay Qualitative assessment using Pearls Prussian blue stain and Nikon Microscope with reference to: LI-Haem-Christie-perls LI-Haem-Christie-haemosiderin using Pearls Prussian blue (iron ) stain with ref to : LI-Haem- Christie-perls Werfen ACL TOP (50 series) with reference to: LI-Haem-Christie-ACL TOP 350 Analyser Routine Operation Assessment Manager: GS2 Page 3 of 6

4 (cont), cerebrospinal fluid and bone marrow aspirate. Haematological examination activities for the purpose of clinical diagnosis (cont d) Diagnosis and Monitoring of Haematological malignanciesdifferential assessment of surface antigens and cytoplasmic antigens using flow cytometry Identification of: manufacturer s instructions Navios/FC500 (fluorochrome labelled antibody expression ) with reference to : LI-Haem-CPP-Navios Acute-intra panels LI-Haem-CPP-Navios CLL Panel LI-Haem-Christie-FC500 Acute-Intra Panel LI-Haem-CPP-Christie-FC500CLL Panel Endothelial cells, blast cell CD34 or Peripheral Stem Cells in EDTA or Peripheral Stem Cells in EDTA or Peripheral Stem Cells in EDTA / T-helper cells and related lymphoma Mature suppressor / cytotoxic T-cells, associated T-cell lymphomas Pan T-cell marker & T-cell lymphomas Blood Transfusion Tests ABO and Rhd system investigation. O RhD positive A RhD positive B RhD positive AB RhD positive O RhD negative A RhD negative B RhD negative AB RhD negative Antibody Screen Rhesus blood group antibodies: anti-cw, anti-c, anti-c, anti-d, anti-e, anti-e CD4 CD8 CD3 Diamed ID Gel Station (immunohaematology) with reference to: LI-BB-CPP-DiamedID Gelstation Assessment Manager: GS2 Page 4 of 6

5 (cont d) / Plasma/ granulocytes/buffy coat / Blood Transfusion Tests (cont d) MNS blood group antibodies: anti-m, anti-n, anti-s, anti-s P blood group antibodies: anti- P1 - Lutheran blood group antibodies: anti-lua, Lewis blood group antibodies: anti-lea, anti-leb Kell system blood group antibodies: anti-k, anti-k, anti- Kpa Duffy blood group antibodies: anti-fya, anti-fyb Kidd blood group antibodies: anti-jka, anti-jkb Antiglobulin test Manual group and Screen Quick blood group Direct Antiglogulin test Serological Cross match Emergency crossmatch manufacturer s instructions: Diamed ID Gel Station (immunohaematology) with reference to: LI-BB-CPP-DiamedID Gelstation LI-BB-Christie-Direct Coombs test Diamed Diaclon cards with reference to : LI-BB-Christie-G&S LI-BB-Christie-QG Diamed LISS/Coombs cards with reference to LI-BB-Christie-Direct Coombs test Diamed LISS Coombs cards, Diaclon card and Diamed reagents With reference to: LI-BB-Christie-Gel Column cross match Diamed LISS Coombs cards, Diaclon card and Diamed reagents With reference to: LI-BB-Christie-Gel Column cross match Assessment Manager: GS2 Page 5 of 6

6 (cont) / Blood Transfusion Tests (cont d) Antibody panels antigens of the following systems: Rh C,D,E,c,e,Cw MNSs M,N,S,s P P1 Lutheran Lua Kell K,k,Kpa Lewis Lea, Leb Duffy Fya, Fyb Kidd Jka, Jkb manufacturer s instructions: Manual Diamed LISS/Coombs cards and NaCl enzyme cards with reference to: LI-BB-Christie-cell panels END Assessment Manager: GS2 Page 6 of 6

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK University Hospitals NHS Foundation Trust Haematology and Transfusion Department Mindelsohn Way Edgbaston Contact: Tel: +44 (0) 121 371 5963

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology & lood Transfusion East Kent Hospitals University NHS Foundation Trust William Harvey Hospital Kennington Road Willesborough

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 20 June 2017 ccredited to Haematology & Blood Tranfusion Craigavon rea Hospital

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Dr Fergus Jack Poole Hospital Tel: +44 (0) 1202 442 497 Longfleet Road E-Mail: fergus.jack@poole.nhs.uk

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences (Haematology) Pathology Building Queen Alexandra Hospital Portsmouth PO6 3LY United Kingdom Contact: Mrs Victoria Hunt Tel:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK Schedule of Accreditation 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK Department of Haematology & Blood Transfusion Levels 3 & 5 Torbay Hospital Lowe s Bridge Torquay TQ2

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Schedule of ccreditation ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Royal lexandria Hospital Corsebar Road Paisley P2 9PN Contact:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences Pathology Building Hull Royal Infirmary Anlaby Road Hull HU3 2JZ Contact: Dr Andrew Botham Tel: +44 (0)1482

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK - Cheltenham Hospital Hatherley Lane Cheltenham GL51 6SY Contact: Chris Watson Tel: +44 (0) 1242 246516 E-Mail: chris.watson@nuffieldhealth.com

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Schedule of Accreditation 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK The Department of Haematology Brighton and Sussex Pathology The Royal Sussex County Hospital

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: 60 Whitfield Street London W1N 4EU Contact:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Blood Sciences The Princess Alexandra Hospital Hamstel Road Harlow CM20 1QX Contact: Eva Nkansah Tel: +44 (0)1279444455 ext

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Rapid Response Laboratory United Kingdom Contact: Gavyn Barrett Tel: +44 (0) 20 7307 7373 E-Mail: Gavyn.barrett@tdlpathology.com Website:

More information

Lab Guide Hematology Section Lab Guide

Lab Guide Hematology Section Lab Guide Lab Guide - 2018 Hematology Section Lab Guide Activated Partial Thromboplastin Time (APTT) One tube 2.7 ml citrated blood sample filled up to the mark on the tube label. (Light blue top tube, citrated

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

HAEMATOLOGY INTRODUCTION

HAEMATOLOGY INTRODUCTION HAEMATOLOGY INTRODUCTION Haematology Laboratory offers a comprehensive range of routine and specialised haematological investigations. The laboratory also offers Routine Urine Sediment Microscopy and molecular

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK St Mary s Hospital 1 st loor Cambridge Wing

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology Department Contact: Ian Diton Eastbourne Hospital Tel: +44 (0) 1323 417400 ex 4127 Kings Drive E-Mail: ian.diton@nhs.net Eastbourne

More information

Clinical & Laboratory Assessment

Clinical & Laboratory Assessment Clinical & Laboratory Assessment Dr Roger Pool NHLS & University of Pretoria Clinical Assessment (History) Anaemia ( haemoglobin) Dyspnoea (shortness of breath) Tiredness Angina Headache Clinical Assessment

More information

Hematology & Coagulation Practicum Objectives CLS - 647

Hematology & Coagulation Practicum Objectives CLS - 647 Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered

Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition

Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition Introduction to replace blood lost by hemorrhage or to correct

More information

Interpreting Blood Tests Part 1. Dr Andrew Smith

Interpreting Blood Tests Part 1. Dr Andrew Smith Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

Hematology Revision. By Dr.AboRashad . Mob

Hematology Revision. By Dr.AboRashad  . Mob 1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00

More information

Immunohematology (Introduction)

Immunohematology (Introduction) Modified from Serotonin version Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition Introduction to replace blood

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Leeds General Infirmary Old Medical School Great George Street LS1 3EX Contact: Richard Liversidge Tel: +44 (0)113 3923947

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria Introduction to Haematology Prof Roger Pool Department of Haematology University of Pretoria Suggested reading Haematology at a Glance Atul Mehta & Victor Hoffbrand Second Edition Published by Blackwell

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

Paper ID: ART

Paper ID: ART analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in

More information

The testing of Donated Blood and Components at NHSBT

The testing of Donated Blood and Components at NHSBT The testing of Donated Blood and Components at NHSBT NHSBT is responsible for collecting all donated blood and platelets in England, then processing into components before issuing to client hospitals.

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Medical Laboratory Accreditation Programme

Medical Laboratory Accreditation Programme Client Client Number 7551 Address Pathlab Lakes Ltd - Rotorua, PO Box 130, Seventh Avenue, Tauranga, 3140 Rotorua Hospital, Pukeroa Street, Rotorua, 3010 Telephone 07 349-7907 URL Authorised Representative

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

Significance of Antibodies and appropriate selection of red cells for transfusion Chris Elliott Haematology Service manager

Significance of Antibodies and appropriate selection of red cells for transfusion Chris Elliott Haematology Service manager Significance of Antibodies and appropriate selection of red cells for transfusion Chris Elliott Haematology Service manager James Cook University Hospital Friarage Hospital Over the next 30 minutes Bit

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Significance of Antibodies and appropriate selection of red cells for transfusion

Significance of Antibodies and appropriate selection of red cells for transfusion Significance of Antibodies and appropriate selection of red cells for transfusion James Cook University Hospital Friarage Hospital Bit of basic immunology Serological red cell transfusion reactions Testing

More information

Haematology Comparability Document

Haematology Comparability Document South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44

More information

Friday, June 3,2011 Aaron T. Gerds, MD HEMATOLOGY FELLOW S CONFERENCE

Friday, June 3,2011 Aaron T. Gerds, MD HEMATOLOGY FELLOW S CONFERENCE Friday, June 3,2011 Aaron T. Gerds, MD HEMATOLOGY FELLOW S CONFERENCE Admit H&P - September 25, 1998 48 year old man with a history of diabetes, hypertension, and chronic anemia who has felt weak since

More information

Significance of Antibodies and appropriate selection of red cells for transfusion. Divis ion of Pat hology

Significance of Antibodies and appropriate selection of red cells for transfusion. Divis ion of Pat hology Significance of Antibodies and appropriate selection of red cells for transfusion Bit of basic immunology Serological red cell transfusion reactions Testing and sample timing Problems Coping strategies

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Francis House 9 King s Head Yard London SE1 9NA Contact: Rokhsana Umar Tel: +44 (0)207-18850804 Fax: +44 (0)207-18884775

More information

Title: Blood Transfusion Laboratory User Handbook

Title: Blood Transfusion Laboratory User Handbook Title: Blood Transfusion Laboratory User Handbook No.of copies : 1 Location of copies : 1. Web site 2. Contents Introduction 2 High risk specimens 2 Referred work 2 Location of the laboratory 2 Transportation

More information

Antibody identification. Antibody specificity

Antibody identification. Antibody specificity Red blood cell (RBC) transfusions are frequently used in sickle-cell anaemia (SCA) patients to treat and prevent the complications of their disease. Acute simple transfusions are usually used to treat

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice

Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood Multiple Choice 1) The matrix of blood is called: A) buffy coat B) plasma C) erythrocytes D) lymphocytes E) formed elements Diff: 1 Page

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK lood Sciences Department Zone 3 Laboratories

More information

What are the functions of blood?

What are the functions of blood? What are the functions of blood? Transportation: oxygen, nutrients, wastes, carbon dioxide, nitrogen from amino acids and hormones, lipoproteins HDL and LDL Hemoglobin carries oxygen and CO2, (CO poisoning)

More information

Chapter 19: Cardiovascular System: Blood

Chapter 19: Cardiovascular System: Blood Chapter 19: Cardiovascular System: Blood I. Functions of Blood A. List and describe the seven major homeostatic functions of blood: 1. 2. 3. 4. 5. 6. 7. II. Plasma A. Composition 1. It is a fluid consisting

More information

Blood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma

Blood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma Blood Blood The only fluid tissue in the human body Classified as a connective tissue Living cells = formed elements Non-living matrix = plasma Blood Physical Characteristics of Blood Color range Oxygen-rich

More information

Apheresis: Transfusion Indications. Sasha Wilson: Transfusion Senior Nurse

Apheresis: Transfusion Indications. Sasha Wilson: Transfusion Senior Nurse Apheresis: Transfusion Indications Sasha Wilson: Transfusion Senior Nurse Apheresis: Transfusion Indications Focus of talk will be blood component transfusion in the context of apheresis procedures: Special

More information

8/28/2018. Disclosures. Objectives. None. Automation to PreciseType and Everything in Between

8/28/2018. Disclosures. Objectives. None. Automation to PreciseType and Everything in Between Automation to PreciseType and Everything in Between Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles None Disclosures Objectives Describe the application of molecular testing

More information

Automation to PreciseType and Everything in Between. Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles

Automation to PreciseType and Everything in Between. Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles Automation to PreciseType and Everything in Between Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles None Disclosures Objectives Describe the application of molecular testing

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Cytopathology Laboratory ltnagelvin Hospital Glenshane Road Londonderry

More information

Functions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood

Functions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood Unit 6 Cardiovascular System: Blood Functions of Blood With each beat of the heart, approximately 75 ml of blood is pumped On average, the heart beats 70 times per minute Every minute, the heart pumps

More information

Kidd Blood Group System

Kidd Blood Group System Kidd Blood Group System Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 02-05-2009 History

More information

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT HPWET Hematopathology Consultation, MML Embed Client Hematopathology Consult REVISED INAL DIAGNOSIS Interpretation Peripheral blood, bone marrow aspirate and biopsies, bilateral iliac crests: 1. Normocellular

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Composition of Blood

Composition of Blood Blood Blood Blood serves as a vehicle for distributing body heat and for transporting nutrients, respiratory gases, and other substances throughout the body. Composition of Blood Blood is the only fluid

More information

Pathology Service User Guide Haematology

Pathology Service User Guide Haematology Pathology Service User Guide Haematology Worthing This section of the Pathology Service User Guide includes: Routine haematology Immunology Haematinic investigations Haemoglobinopathy screening Bone marrow

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS

HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS 1 of 6 Policy #: 800 (PLH-800-13) Initiated Date: 12/4/2002 Reviewed Date: 8/1/2016 Subject: HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS Approved by: Laboratory Director, Jerry Barker (electronic signature)

More information

Preferred Clinical Services for Leading Age Florida August 26-27, 2015

Preferred Clinical Services for Leading Age Florida August 26-27, 2015 DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading

More information

Immunohematology. Done by : Zaid Al-Ghnaneem

Immunohematology. Done by : Zaid Al-Ghnaneem Immunohematology Done by : Zaid Al-Ghnaneem Hello everyone, in this sheet we will talk mainly about immunohematology which is the reactions between our immune system with Antigens found mainly within blood

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

Chapter 19 Cardiovascular System Blood: Functions. Plasma

Chapter 19 Cardiovascular System Blood: Functions. Plasma Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that

More information

Blood Cell Identification Graded

Blood Cell Identification Graded Blood Cell Identification Graded Case History The patient was a five-day-old girl with an elevated unconjugated bilirubin and a weakly positive direct antiglobulin test (DAT). Her CBC showed: WBC = 11.0

More information

Chapter 11. Lecture and Animation Outline

Chapter 11. Lecture and Animation Outline Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Cellular Pathology Department University College London Hospital Rockefeller Building University Street London WC1E 6JJ Contact: Gavyn Barrett

More information

+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies

+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies In house hematology laboratories: pros and cons of bench-top analyzers and the essentials of a blood film exam. NCSU-CVM Clinical Pathology January 22, 2014 Jaime Tarigo, DVM, PhD, DACVP Goals Understand

More information