Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
|
|
- Brian York
- 5 years ago
- Views:
Transcription
1 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) Wilmslow Road Fax: +44 (0) Manchester M20 4BX Website: Testing performed at the above address only Site activities performed away from the locations listed above: Location details Activity Address Haematology & Blood Transfusion The Christie Wilmslow Road Manchester M20 4BX Local contact Contact: Dr. Neil Wrathall Tel: +44 (0) Fax: +44 (0) Theatre Blood Issue Fridge Assessment Manager: GS2 Page 1 of 6
2 DETAIL OF ACCREDITATION Venous blood: citrated Bone marrow aspirate Cerebrospinal fluid Haematological examination activities for the purpose of clinical diagnosis Haemoglobin (HB) White Blood Cells (WBC) Platelets (PLTS) Red blood cells (RBC) Haematocrit (HCT) Mean Cell Volume (MCV) Mean Cell Haemoglobin (MCH) Mean cell haemoglobin concentration (MCHC) Red Cell Distribution (RDW) Neutrophils (NEUT) Lymphocytes (LYMP) Eosinophils (EOSO) Basophils (BASO) Monocytes (MONO) Large unstained cells (LUC) Reticulocyte enumeration Platelet count Blood film assessment (peripheral) for detection of abnormalities and cell differential. Bone marrow film for the detection of normal and abnormal morphology by microscopic examination CSF cell count and cytospin for the detection of normal and abnormal morphology by microscopic examination manufacturer s instructions Advia 2120i (flow cytometry and laser light refraction ) with reference to: LI-Haem-Christie-Advia Startup and Processing Hematek 2000 stainer modified Wright stain and Nikon microscope. Manual assessment with ref to: LI-Haem-Christie-Bloodfilm exam LI-Haem-Christie-BMSmears LI-Haem-Christie-BMReports Manual cell count, modified Wright stain with ref to : LI-Haem-CPP-CSF Assessment Manager: GS2 Page 2 of 6
3 (cont) Ascitic/pleural fluid Venous blood: citrated Haematological examination activities for the purpose of clinical diagnosis (cont d) Fluid cytospin for the detection of normal and abnormal morphology by microscopic examination Detection/screening for Plasmodium spp. Erythrocyte sedimentation Rate (ESR) manufacturer s instructions Manual cell count, modified Wright stain with ref to: LI-Haem-CPP CSF Manual method, modified Wright stain with reference to: LI-Haem-Christie-Field Stain Manual method - Sedimentation with reference to : LI-Haem Christie -ESR Sickle cell solubility Solubility screening test, TCS sickle check screening kit with reference to : LI-Haem Christie-sickletest and Bone Marrow Urine Citrated Iron levels Detection of Urinary Haemosiderin Coagulation Screen: Prothrombin time (PT) Activated partial thromboplastin time (APTT) Derived Fibrinogen Clauss Fib Thrombin time Reptilase time D-Dimer 50/50 Basic correction test FX assay Qualitative assessment using Pearls Prussian blue stain and Nikon Microscope with reference to: LI-Haem-Christie-perls LI-Haem-Christie-haemosiderin using Pearls Prussian blue (iron ) stain with ref to : LI-Haem- Christie-perls Werfen ACL TOP (50 series) with reference to: LI-Haem-Christie-ACL TOP 350 Analyser Routine Operation Assessment Manager: GS2 Page 3 of 6
4 (cont), cerebrospinal fluid and bone marrow aspirate. Haematological examination activities for the purpose of clinical diagnosis (cont d) Diagnosis and Monitoring of Haematological malignanciesdifferential assessment of surface antigens and cytoplasmic antigens using flow cytometry Identification of: manufacturer s instructions Navios/FC500 (fluorochrome labelled antibody expression ) with reference to : LI-Haem-CPP-Navios Acute-intra panels LI-Haem-CPP-Navios CLL Panel LI-Haem-Christie-FC500 Acute-Intra Panel LI-Haem-CPP-Christie-FC500CLL Panel Endothelial cells, blast cell CD34 or Peripheral Stem Cells in EDTA or Peripheral Stem Cells in EDTA or Peripheral Stem Cells in EDTA / T-helper cells and related lymphoma Mature suppressor / cytotoxic T-cells, associated T-cell lymphomas Pan T-cell marker & T-cell lymphomas Blood Transfusion Tests ABO and Rhd system investigation. O RhD positive A RhD positive B RhD positive AB RhD positive O RhD negative A RhD negative B RhD negative AB RhD negative Antibody Screen Rhesus blood group antibodies: anti-cw, anti-c, anti-c, anti-d, anti-e, anti-e CD4 CD8 CD3 Diamed ID Gel Station (immunohaematology) with reference to: LI-BB-CPP-DiamedID Gelstation Assessment Manager: GS2 Page 4 of 6
5 (cont d) / Plasma/ granulocytes/buffy coat / Blood Transfusion Tests (cont d) MNS blood group antibodies: anti-m, anti-n, anti-s, anti-s P blood group antibodies: anti- P1 - Lutheran blood group antibodies: anti-lua, Lewis blood group antibodies: anti-lea, anti-leb Kell system blood group antibodies: anti-k, anti-k, anti- Kpa Duffy blood group antibodies: anti-fya, anti-fyb Kidd blood group antibodies: anti-jka, anti-jkb Antiglobulin test Manual group and Screen Quick blood group Direct Antiglogulin test Serological Cross match Emergency crossmatch manufacturer s instructions: Diamed ID Gel Station (immunohaematology) with reference to: LI-BB-CPP-DiamedID Gelstation LI-BB-Christie-Direct Coombs test Diamed Diaclon cards with reference to : LI-BB-Christie-G&S LI-BB-Christie-QG Diamed LISS/Coombs cards with reference to LI-BB-Christie-Direct Coombs test Diamed LISS Coombs cards, Diaclon card and Diamed reagents With reference to: LI-BB-Christie-Gel Column cross match Diamed LISS Coombs cards, Diaclon card and Diamed reagents With reference to: LI-BB-Christie-Gel Column cross match Assessment Manager: GS2 Page 5 of 6
6 (cont) / Blood Transfusion Tests (cont d) Antibody panels antigens of the following systems: Rh C,D,E,c,e,Cw MNSs M,N,S,s P P1 Lutheran Lua Kell K,k,Kpa Lewis Lea, Leb Duffy Fya, Fyb Kidd Jka, Jkb manufacturer s instructions: Manual Diamed LISS/Coombs cards and NaCl enzyme cards with reference to: LI-BB-Christie-cell panels END Assessment Manager: GS2 Page 6 of 6
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK University Hospitals NHS Foundation Trust Haematology and Transfusion Department Mindelsohn Way Edgbaston Contact: Tel: +44 (0) 121 371 5963
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology & lood Transfusion East Kent Hospitals University NHS Foundation Trust William Harvey Hospital Kennington Road Willesborough
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 20 June 2017 ccredited to Haematology & Blood Tranfusion Craigavon rea Hospital
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Dr Fergus Jack Poole Hospital Tel: +44 (0) 1202 442 497 Longfleet Road E-Mail: fergus.jack@poole.nhs.uk
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences (Haematology) Pathology Building Queen Alexandra Hospital Portsmouth PO6 3LY United Kingdom Contact: Mrs Victoria Hunt Tel:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK
Schedule of Accreditation 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK Department of Haematology & Blood Transfusion Levels 3 & 5 Torbay Hospital Lowe s Bridge Torquay TQ2
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
ccredited to Laboratory locations: Schedule of ccreditation ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Royal lexandria Hospital Corsebar Road Paisley P2 9PN Contact:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences Pathology Building Hull Royal Infirmary Anlaby Road Hull HU3 2JZ Contact: Dr Andrew Botham Tel: +44 (0)1482
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK - Cheltenham Hospital Hatherley Lane Cheltenham GL51 6SY Contact: Chris Watson Tel: +44 (0) 1242 246516 E-Mail: chris.watson@nuffieldhealth.com
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: Schedule of Accreditation 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK The Department of Haematology Brighton and Sussex Pathology The Royal Sussex County Hospital
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: 60 Whitfield Street London W1N 4EU Contact:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Blood Sciences The Princess Alexandra Hospital Hamstel Road Harlow CM20 1QX Contact: Eva Nkansah Tel: +44 (0)1279444455 ext
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Rapid Response Laboratory United Kingdom Contact: Gavyn Barrett Tel: +44 (0) 20 7307 7373 E-Mail: Gavyn.barrett@tdlpathology.com Website:
More informationLab Guide Hematology Section Lab Guide
Lab Guide - 2018 Hematology Section Lab Guide Activated Partial Thromboplastin Time (APTT) One tube 2.7 ml citrated blood sample filled up to the mark on the tube label. (Light blue top tube, citrated
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationHAEMATOLOGY INTRODUCTION
HAEMATOLOGY INTRODUCTION Haematology Laboratory offers a comprehensive range of routine and specialised haematological investigations. The laboratory also offers Routine Urine Sediment Microscopy and molecular
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
ccredited to Laboratory locations: Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK St Mary s Hospital 1 st loor Cambridge Wing
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology Department Contact: Ian Diton Eastbourne Hospital Tel: +44 (0) 1323 417400 ex 4127 Kings Drive E-Mail: ian.diton@nhs.net Eastbourne
More informationClinical & Laboratory Assessment
Clinical & Laboratory Assessment Dr Roger Pool NHLS & University of Pretoria Clinical Assessment (History) Anaemia ( haemoglobin) Dyspnoea (shortness of breath) Tiredness Angina Headache Clinical Assessment
More informationHematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationCase Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationImmunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition
Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition Introduction to replace blood lost by hemorrhage or to correct
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationHematology Revision. By Dr.AboRashad . Mob
1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
More informationImmunohematology (Introduction)
Modified from Serotonin version Immunohematology (Introduction) References: -Blood Groups and Red Cell Antigens (Laura Dean) -Cellular and molecular immunology, 8 th edition Introduction to replace blood
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Leeds General Infirmary Old Medical School Great George Street LS1 3EX Contact: Richard Liversidge Tel: +44 (0)113 3923947
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationIntroduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria
Introduction to Haematology Prof Roger Pool Department of Haematology University of Pretoria Suggested reading Haematology at a Glance Atul Mehta & Victor Hoffbrand Second Edition Published by Blackwell
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationPaper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
More informationThe testing of Donated Blood and Components at NHSBT
The testing of Donated Blood and Components at NHSBT NHSBT is responsible for collecting all donated blood and platelets in England, then processing into components before issuing to client hospitals.
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationMedical Laboratory Accreditation Programme
Client Client Number 7551 Address Pathlab Lakes Ltd - Rotorua, PO Box 130, Seventh Avenue, Tauranga, 3140 Rotorua Hospital, Pukeroa Street, Rotorua, 3010 Telephone 07 349-7907 URL Authorised Representative
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationSignificance of Antibodies and appropriate selection of red cells for transfusion Chris Elliott Haematology Service manager
Significance of Antibodies and appropriate selection of red cells for transfusion Chris Elliott Haematology Service manager James Cook University Hospital Friarage Hospital Over the next 30 minutes Bit
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationBIOCHEMISTRY of BLOOD
BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationSignificance of Antibodies and appropriate selection of red cells for transfusion
Significance of Antibodies and appropriate selection of red cells for transfusion James Cook University Hospital Friarage Hospital Bit of basic immunology Serological red cell transfusion reactions Testing
More informationHaematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationBlood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah
Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44
More informationFriday, June 3,2011 Aaron T. Gerds, MD HEMATOLOGY FELLOW S CONFERENCE
Friday, June 3,2011 Aaron T. Gerds, MD HEMATOLOGY FELLOW S CONFERENCE Admit H&P - September 25, 1998 48 year old man with a history of diabetes, hypertension, and chronic anemia who has felt weak since
More informationSignificance of Antibodies and appropriate selection of red cells for transfusion. Divis ion of Pat hology
Significance of Antibodies and appropriate selection of red cells for transfusion Bit of basic immunology Serological red cell transfusion reactions Testing and sample timing Problems Coping strategies
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Francis House 9 King s Head Yard London SE1 9NA Contact: Rokhsana Umar Tel: +44 (0)207-18850804 Fax: +44 (0)207-18884775
More informationTitle: Blood Transfusion Laboratory User Handbook
Title: Blood Transfusion Laboratory User Handbook No.of copies : 1 Location of copies : 1. Web site 2. Contents Introduction 2 High risk specimens 2 Referred work 2 Location of the laboratory 2 Transportation
More informationAntibody identification. Antibody specificity
Red blood cell (RBC) transfusions are frequently used in sickle-cell anaemia (SCA) patients to treat and prevent the complications of their disease. Acute simple transfusions are usually used to treat
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationEssentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood. Multiple Choice
Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 10 Blood Multiple Choice 1) The matrix of blood is called: A) buffy coat B) plasma C) erythrocytes D) lymphocytes E) formed elements Diff: 1 Page
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationBLOOD. Dr. Vedat Evren
BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
ccredited to Laboratory locations: Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK lood Sciences Department Zone 3 Laboratories
More informationWhat are the functions of blood?
What are the functions of blood? Transportation: oxygen, nutrients, wastes, carbon dioxide, nitrogen from amino acids and hormones, lipoproteins HDL and LDL Hemoglobin carries oxygen and CO2, (CO poisoning)
More informationChapter 19: Cardiovascular System: Blood
Chapter 19: Cardiovascular System: Blood I. Functions of Blood A. List and describe the seven major homeostatic functions of blood: 1. 2. 3. 4. 5. 6. 7. II. Plasma A. Composition 1. It is a fluid consisting
More informationBlood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma
Blood Blood The only fluid tissue in the human body Classified as a connective tissue Living cells = formed elements Non-living matrix = plasma Blood Physical Characteristics of Blood Color range Oxygen-rich
More informationApheresis: Transfusion Indications. Sasha Wilson: Transfusion Senior Nurse
Apheresis: Transfusion Indications Sasha Wilson: Transfusion Senior Nurse Apheresis: Transfusion Indications Focus of talk will be blood component transfusion in the context of apheresis procedures: Special
More information8/28/2018. Disclosures. Objectives. None. Automation to PreciseType and Everything in Between
Automation to PreciseType and Everything in Between Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles None Disclosures Objectives Describe the application of molecular testing
More informationAutomation to PreciseType and Everything in Between. Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles
Automation to PreciseType and Everything in Between Jessie Singer MT(ASCP) Transfusion Medicine Children s Hospital Los Angeles None Disclosures Objectives Describe the application of molecular testing
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Cytopathology Laboratory ltnagelvin Hospital Glenshane Road Londonderry
More informationFunctions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood
Unit 6 Cardiovascular System: Blood Functions of Blood With each beat of the heart, approximately 75 ml of blood is pumped On average, the heart beats 70 times per minute Every minute, the heart pumps
More informationKidd Blood Group System
Kidd Blood Group System Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 02-05-2009 History
More informationOrdering Physician CLIENT,CLIENT. Collected REVISED REPORT
HPWET Hematopathology Consultation, MML Embed Client Hematopathology Consult REVISED INAL DIAGNOSIS Interpretation Peripheral blood, bone marrow aspirate and biopsies, bilateral iliac crests: 1. Normocellular
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationComposition of Blood
Blood Blood Blood serves as a vehicle for distributing body heat and for transporting nutrients, respiratory gases, and other substances throughout the body. Composition of Blood Blood is the only fluid
More informationPathology Service User Guide Haematology
Pathology Service User Guide Haematology Worthing This section of the Pathology Service User Guide includes: Routine haematology Immunology Haematinic investigations Haemoglobinopathy screening Bone marrow
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationHEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS
1 of 6 Policy #: 800 (PLH-800-13) Initiated Date: 12/4/2002 Reviewed Date: 8/1/2016 Subject: HEMATOLOGY AND COAGULATION ANALYTIC PROTOCOLS Approved by: Laboratory Director, Jerry Barker (electronic signature)
More informationPreferred Clinical Services for Leading Age Florida August 26-27, 2015
DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading
More informationImmunohematology. Done by : Zaid Al-Ghnaneem
Immunohematology Done by : Zaid Al-Ghnaneem Hello everyone, in this sheet we will talk mainly about immunohematology which is the reactions between our immune system with Antigens found mainly within blood
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationChapter 19 Cardiovascular System Blood: Functions. Plasma
Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationMed Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
More informationBlood Cell Identification Graded
Blood Cell Identification Graded Case History The patient was a five-day-old girl with an elevated unconjugated bilirubin and a weakly positive direct antiglobulin test (DAT). Her CBC showed: WBC = 11.0
More informationChapter 11. Lecture and Animation Outline
Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Cellular Pathology Department University College London Hospital Rockefeller Building University Street London WC1E 6JJ Contact: Gavyn Barrett
More information+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies
In house hematology laboratories: pros and cons of bench-top analyzers and the essentials of a blood film exam. NCSU-CVM Clinical Pathology January 22, 2014 Jaime Tarigo, DVM, PhD, DACVP Goals Understand
More information