Supplementary Information
|
|
|
- Annabelle Tyler
- 5 years ago
- Views:
Transcription
1 Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori, Makiko Itami, Akinobu Araki, Miki Ohira, Masahiro Inoue, Hajime Kageyama, Sana Yokoi, Naokatsu Saeki & Akira Nakagawara
2 Supplementary Table 1 Summary of available RNA data derived from 69 newly-diagnosed malignant glioma patients. Classification n (%) All patients 69 Average age (years ± s.d.) 59.2 ± 12.6 Sex Female Male 4 58 Diagnosis Glioblastoma Anaplastic astrocytoma Anaplastic oligoastrocytoma MGMT promoter status Methylated Methylated/unmethylated Unmethylated Not available Temozolomide treatment Yes (26 211) 2 29 No ( ) 49 71
3 Recurrence-free survival Overall survival Supplementary Figure 1 a TMZ-treated (n=2) Non-TMZ-treated (n=49) P=.394 b 1 2 Time (d) MGMT high (n=1) MGMT low (n=1) P= Time (d) Supplementary Figure 1 TMZ treatment and low MGMT mrna expression are associated with favorable prognosis in malignant glioma. a) Kaplan Meier survival curves of overall survival. Subgroups of TMZ-treated (n=2) and non-tmz-treated (n=49) patients among 69 individual samples of newly diagnosed malignant gliomas (GBM, 59; anaplastic astrocytoma, 7; anaplastic oligoastrocytoma, 3). P value by log-rank test. b) Kaplan Meier survival curves of recurrence-free survival of 2 malignant glioma patients (GBM, 17; anaplastic oligoastrocytoma, 3) according to tumor sample MGMT mrna expression from patients who were TMZ-treated after resection. MGMT expression was normalized by ACTB, and then designated high (n=1) or low (n=1) according to the median value. High: n=1, mean MGMT expression = ± 2.45 s.d. Low: n=1, mean MGMT expression = 5.45 ±.7 s.d. P value by log-rank test.
4 Overall survival Supplementary Figure TAp73 high (n=59) TAp73 low (n=1).4.2 P= Time (d) Supplementary Figure 2 Kaplan Meier survival curves of overall survival time in subjects with newly diagnosed malignant gliomas according to the relative expression levels of TAp73 before chemotherapy (n=69). TAp73 was normalized to ACTB, and then designated high or low based on the normal human brain expression. High: n=59, mean TAp73 expression =.93 ±.17 s.d. Low: n=1, mean TAp73 expression =.1 ±.2 s.d. P value by log-rank test.
5 Relative TAp73 Relative MYC Relative MYCN U8 7MG YH13 SF126 KNS42 U8 7MG YH13 SF126 KNS42 U8 7MG YH13 SF126 KNS42 Relative TAp63 Relative DNp63 Relative TP53 U8 7MG YH13 SF126 KNS42 U8 7MG YH13 SF126 KNS42 U8 7MG YH13 SF126 KNS42 Supplementary Figure 3 a b YH-13 TAp63α TAp63β TAp63γ Supplementary Figure 3 Basal mrna expression levels of p53 and Myc family members in 4 GBM cell lines. a) qrt-pcr analyses of the relative steady-state mrna expression of p53 family members (TP53, TAp63, DNp63 and TAp73) and Myc family members (MYC, MYCN) in GBM cell lines (U87MG, YH-13, SF126 and KNS42), normalized by ACTB. b) RT-PCR analysis of TAp63 isoforms a, b and g in YH-13 cells.
6 Supplementary Figure 4 U87MG (p53 wt ) TMZ (mm) BAX CDKN1A MDM2 ACTB Supplementary Figure 4 RT-PCR analyses of p53 downstream target genes (BAX, CDKN1A and MDM2) in a TMZ-dependent manner.
7 Relative TAp63 Relative MYC Relative TAp63 Relative MYC Relative TAp63 Relative MYC Relative TAp63 Relative MYC Supplementary Figure 5 a U87MG (p53 wt ) * YH-13 (p53 mut ) ** U87cont U87TA3.5 U87cont U87TA3 YH13cont YH13TA3 YH13cont YH13TA3 b U87MG (p53 wt ) U87PHR U87TAp U87PHR YH-13 (p53 mut ) * U87TAp YH13GFP YH13TAp YH13GFP * YH13TAp63 Supplementary Figure 5 MYC levels are affected by TAp63 expression. a) qrt-pcr analysis of relative MYC expression in U87MG and YH-13 cells after sirna-mediated knockdown of TAp63, normalized by ACTB. *P<.5, **P<.5 by two-tailed t-test. b) qrt-pcr analysis of relative MYC expression in U87MG and YH-13 cells after lentiviral TAp63 overexpression (TAp63OE), normalized by ACTB. *P<.5 by two-tailed t-test.
8 Supplementary Figure 6 a TAp63 U87MG (p53 wt ) YH-13 (p53 mut ) sicontrol sitap63 sicontrol sitap63 b TAp63 U87MG (p53 wt ) YH-13 (p53 mut ) KNS42 (p53 mut ) Control TAp63OE Control TAp63OE Control TAp63OE MYC MYC BAX BAX CDKN1A MDM2 ACTB CDKN1A MDM2 ACTB Supplementary Figure 6 p53 downstream genes are regulated in a TAp63-dependent manner. RT-PCR analyses of p53 downstream target genes (BAX, CDKN1A and MDM2) in (a) TAp63 sirna-transfected cells and (b)tap63-overexpressing cells after lentivirus infection. ACTB was used for internal control.
9 Relative TAp63 Relative TAp63 Relative MYCN Relative MYCN U8 7cont U8 7GFP U8 7TA3 U8 7TAp63 Relative TAp63 Relative TAp63 YH13 cont YH13 TA3 Relative MYCN Relative MYCN YH13 cont YH13 GFP YH13 TA3 YH13 TAp63 Supplementary Figure 7 a U87MG (p53 wt ) NS YH-13 (p53 mut ) NS U8 7cont U8 7TA3 b U87MG (p53 wt ) 6 3 NS YH-13 (p53 mut ) 1 3 NS U8 7GFP U8 7TAp63 YH13 GFP YH13 TAp63 Supplementary Figure 7 MYCN levels are not affected by TAp63 expression. a) qrt-pcr analysis of relative MYCN expression in U87MG and YH-13 cells after sirna-mediated knockdown of TAp63, normalized by ACTB. NS, not significant, by two-tailed t-test. b) qrt-pcr analysis of relative MYCN expression in U87MG and YH-13 cells after lentiviral TAp63 overexpression (TAp63OE), normalized by ACTB. NS, not significant, by two-tailed t-test.
10 Supplementary Figure 8 a b Control TAp63OE sicontrol sitap63 TAp63 MYC ACTB Supplementary Figure 8 TAp63-MYC pathway was intact in the cancer tissue-derived spheroids (CTOS). a) Representative images of CTOS with RT-PCR analysis of overexpressed or knocked-down TAp63. Scale bar, 4 µm. b) RT-PCR analyses of TAp63, MYC and b-actin intap63 sirna-transfected CTOS and TAp63-overexpressing CTOS after lentivirus infection. ACTB was used for internal control.
11 Fold enrichment Supplementary Figure 9 YH-13 (p53 mut ) migg TAp63 migg TAp63 DMSO TMZ Supplementary Figure 9 ChIP-qPCR analyses of the amount of TAp63 recruited onto the MYC intron (R3).
12 Del2 Supplementary Figure 1 YH-13 (p53 mut ) Del1 Del1 Del Relative luciferase activity Supplementary Figure 1 Luciferase activity of MYC promoter reporters after TAp63 overexpression in YH-13 cells. Data shown as the relative activity of the firefly luciferase compared with that in control YH-13 cells.
13 Supplementary Figure 11 U87MG (p53 wt ) DAPI TUNEL Merge - TMZ + CHP134 Retinoic acid Supplementary Figure11 TMZ suppresses invasion of U87MG cell lines by day 5 of exposure without inducing apoptosis. TUNEL assay revealing no apoptotic cells in the control and TMZ-treated U87MG cells. CHP134 cells treated with 5 mm retinoic acid for 48 h served as a positive control.
14 Tumor volume (mm 3 ) Supplementary Figure 12 a ** * sitap63 sicontrol Time after second sirna injection (d) b sitap63 sicontrol TAp63 sicontrol sitap63 ACTB Supplementary Figure 12 TAp63 functions as a tumor suppressor in GBM in vivo. a) U87MG cells were inoculated into the hind legs of mice and TAp63 knockdown was performed by injecting small interference RNA (sirna) against TAp63 (sitap63) into the palpable tumors once a week. Data are representative of two independent experiments. * P=.483, ** P=.2 by two-tailed t-tests (n=5). b) Representative photographs of subcutaneous xenograft tumors derived from sicontrol- and sitap63- transfected U87MG cells. Corresponding RT-PCR analysis of xenograft-derived RNA. Scale bar, 1 mm.
15 Overall survival Overall survival Recurrence-free survival TAp63 relative expression Overall survival Supplementary Figure 13 a b 1 4 Low (n=26) High (n=33) TAp63 high (n=33) TAp63 low (n=26) P= Brain Newly diagnosed human glioblastoma 1 2 Time (d) c d TAp73 high (n=49) TAp73 low (n=1).8 MGMT high (n=9) MGMT low (n=8) P= P= Time (d) Time (d) e f MYC decrease (n=9) No change (n=8) -2-4 P=.357 P= Average MYC mrna for primary-recurrent tumor.4.2 P= Time (d) Supplementary Figure 13 TAp63 expression and MYC suppression are good prognosis factors in only GBM samples. qrt-pcr for TAp63 (a, b), TAp73 (c), MGMT (d) and MYC (e, f)
16 Supplementary Materials Primer sequences RT-PCR TAp63-sense GACCTGAGTGACCCCATGTG TAp63-antisense GAGGAGCCGTTCTGAATCTG TAp63α-sense GTCCCAGAGCACACAGACAA TAp63α-antisense CACTCCCCCTCCTCTTTGAT TAp63β-sense GTCCCAGAGCACACAGACAA TAp63β-antisense AGACTTGCCAGATCCTGACAATGCT TAp63γ-sense GTCCCAGAGCACACAGACAA TAp63γ-antisense CGGGGCTCCACAAGCTCATTC MYC-sense AGAGAAGCTGGCCTCCTACC MYC-antisense CGCCTCTTGACATTCTCCTC CDKN1A-sense ATGAAATTCACCCCCTTTCC CDKN1A-antisense CCCTAGGCTGTGCTCACTTC BAX-sense AGAGGATGATTGCCGCCGT BAX-antisense CAACCACCCTGGTCTTGGAT MDM2-sense GGTGGGAGTGATCAAAAGGA MDM2-antisense ACACAGAGCCAGGCTTTCAT ACTB -sense CAAGAGATGGCCACGGCTGCT ACTB -antisense TCCTTCTGCATCCTGTCGGCA qrt-pcr MYC-sense AGGGTCAAGTTGGACAGTGTCA MYC-antisense TGGTGCATTTTCGGTTGTTG MYCN-sense CCTTCGGTCCAGCTTTCTCA MYCN-antisense GGCCTTCTCATTCTTTACCAACTC TP53-sense GCCTGAGGTTGGCTCTGACT TP53-antisense CCATGCAGGAACTGTTACACATG TAp63-sense TGGTGCGACAAACAAGATTG TAp63-antisense ATAGGGACTGGTGGACGAGG DNp63-sense CAATGCCCAGACTCAATTTAGTG DNp63-antisense TGCTGGTCCATGCTGTTCAG TAp73-sense CACCACGTTTGAGCACCTC TAp73-antisense TGCTCAGCAGATTGAACTGG DNp73-sense AAAAGCGAAAATGCCAACAAA DNp73-antisense AGAGGCTCCGCAGCTAGTGA
17 MGMT-sense CCGTTTGCGACTTGGTACTTG MGMT-antisense CCAGTGTGGTGCGTTTCATT ChIP-PCR assay R1-sense TAAAATGCCTTTGGGTGAGG R1-antisense GCCCCACACATGATTTGTTT R2-sense CCCTTTATAATGCGAGGGTCT R2-antisense TGCCTCTCGCTGGAATTACT R3-sense CTTGGAGTAGGGACCGCATA R3-antisense AAAAGCCAAATGCCAACTTC R4-sense AGCGACTCTGGTAAGCGAAG R4-antisens AAACGCTAAAGCCCAAGGTT GAPDH-sense TTCCCTCTTCTTGACTCACC GAPDH-antisense CACAAAGGCACTCCTGGAAA ChIP-qPCR assay R1-sense TGCTATACACGCACCCCTTTC R1-antisense TCCCTCCACCACCTCCAA R3-sense TTTGCGGTGGGCAGAAA R3-antisense GCGGTCCCTACTCCAAGGA
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB
SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Nature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Color Key PCA. mir- 15a let-7c 106b let-7b let-7a 16 10b 99a 26a 20b 374b 19b 135b 125b a-5p 199b-5p 93 92b MES PN.
1123 83 528 816 84 2 17 718 Comp3 3 2 1 1 2 3 4 Comp2 a b Color Key MES PN PCA 3 2 1 1 2 3 4 Comp1 1 2 3 1 2 3 4-2 -1 1 2 mi- 15a let-7c 16b let-7b let-7a 16 1b 99a 26a 2b 374b 19b 135b 125b 9 34 125a-5p
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
PI3-Kinase Signaling. Rational Incorporation of Novel Agents into Multimodality Therapy. PI3-kinase. PI3-kinase 5/2/2010
Rational Incorporation of Novel Agents into Multimodality Therapy I3-Kinase Signaling EGF IRS1 I3K EGFR I2 I3 TEN Rictor GßL AKT RAS40 Survival Raptor GßL Daphne Haas-Kogan UCSF Annual Course April 30-May
Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Contemporary Management of Glioblastoma
Contemporary Management of Glioblastoma Incidence Rates of Primary Brain Tumors Central Brain Tumor Registry of the United States, 1992-1997 100 Number of Cases per 100,000 Population 10 1 0.1 x I x I
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Clinical significance of genetic analysis in glioblastoma treatment
Clinical significance of genetic analysis in glioblastoma treatment Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan Koji Yoshimoto Can we get prognostic
Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
PBX3/MEK/ERK1/2/LIN28/let-7b positive feedback loop enhances mesenchymal phenotype to promote glioblastoma migration and invasion
Xu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:158 https://doi.org/10.1186/s13046-018-0841-0 RESEARCH PBX3/MEK/ERK1/2/LIN28/let-7b positive feedback loop enhances mesenchymal phenotype
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to.
Stratified Medicine Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Looking in detail at cancer cells and their genetic make up. Permit
FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Technology appraisal guidance Published: 27 June 2007 nice.org.uk/guidance/ta121
Carmustine implants and temozolomide for the treatment of newly diagnosed high-grade glioma Technology appraisal guidance Published: 27 June 2007 nice.org.uk/guidance/ta121 NICE 2018. All rights reserved.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
High expression of N-myc (and STAT) interactor predicts poor prognosis and promotes tumor growth in human glioblastoma
/, Vol. 6, No.7 High expression of N-myc (and STAT) interactor predicts poor prognosis and promotes tumor growth in human glioblastoma Delong Meng 1,*, Yuanyuan Chen 1,*, Dapeng Yun 1, Yingjie Zhao 1,
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Corporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Genomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
University of Zurich. Temozolomide and MGMT forever? Zurich Open Repository and Archive. Weller, M. Year: 2010
University of Zurich Zurich Open Repository and Archive Winterthurerstr. 190 CH-8057 Zurich Year: 2010 Temozolomide and MGMT forever? Weller, M Weller, M (2010). Temozolomide and MGMT forever? Neuro-Oncology,
Involvement of FKBP6 in hepatitis C virus replication
Supplementary Information Involvement of FKBP6 in hepatitis C virus replication Hirotake Kasai 1,*, Kunihiro Kawakami 2,*, Hiromasa Yokoe 3, Kentaro Yoshimura 4, Masanori Matsuda 5, Jun Yasumoto 1, Shinya
Title Cancer Drug Phase Status
Clinical Trial Identifier Title Cancer Drug Phase Status NCT01164995 Study With Wee-1 Inhibitor MK-1775 and Carboplatin to Treat p53 Mutated Refractory and Resistant Ovarian Cancer Epithelial Ovarian Cancer
Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE
a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC
Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells were maintained in DMEM
Supplementary Materials and Methods Cell Culture HCT116 (TP53 +/+ and TP53 -/- ) cells were provided by Dr. Bert Vogelstein (Johns Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells
Hypofractionated radiation therapy for glioblastoma
Hypofractionated radiation therapy for glioblastoma Luis Souhami, MD, FASTRO Professor McGill University Department of Oncology, Division of Radiation Oncology Montreal Canada McGill University Health
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
LGR5, a novel functional glioma stem cell marker, promotes EMT by activating the Wnt/β-catenin pathway and predicts poor survival of glioma patients
Zhang et al. Journal of Experimental & Clinical Cancer Research (2018) 37:225 https://doi.org/10.1186/s13046-018-0864-6 RESEARCH Open Access LGR5, a novel functional glioma stem cell marker, promotes EMT
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,