Expanded View Figures

Size: px
Start display at page:

Download "Expanded View Figures"

Transcription

1 Molecular Systems iology Immediate late genes decode ERK signal duration Florian Uhlitz et al Expanded View Figures Figure EV. cquired samples from HEK9ΔRF:ER cells. Microarrays - Untreated I +U Microarray time course data was used for model fitting and definition. RN-Seq time course data of metabolically labelled (SU) cells were used for determination of transcription rates and steady-state half-lives in untreated cells. C qpcr time course data were used for validation of the identified signal duration decoding principle. Data information: Numbers indicate independent biological measurements per condition and time point. +CYHX ctd +ctd Untreated II EGF FGF RN-Seq SU C qpcr Untreated U6 EV Molecular Systems iology : 9 7 ª 7 The uthors

2 Florian Uhlitz et al Immediate late genes decode ERK signal duration Molecular Systems iology wrss delayed χ =. α=.5 df = wrss immediate Figure EV. Model-based temporal gene identification. Sum of weighted squared residuals (wrss) for simple (immediate) and complete (delayed) model. The complete model was rejected for genes with v <. and Dt < min to only accept significantly better fitted genes for the complete model and to reflect time intervals in sampling. Mean fitting error [%] Mean prediction error [%] U6 EGF FGF Figure EV. Goodness of gene expression predictions. Mean fitting errors across temporal s, calculated as the mean of absolute residuals. Mean prediction errors across temporal s for tested signalling scenarios, calculated as the mean of absolute residuals. Data information: oxplots show median and inter-quartile range. IQR is extended with whiskers to the largest and smallest value respectively, but no further than.5 IQR from hinges. ª 7 The uthors Molecular Systems iology : 9 7 EV

3 Molecular Systems iology Immediate late genes decode ERK signal duration Florian Uhlitz et al HEKRF ctd derived mrn half life ON [min] rho =.7 rho.6 rho =.7 rho =.6 HEKRF ctd derived mrn half life OFF [min] Gene density.5..5 HEKRF SU derived mrn half life OFF [min] rho =.57 rho =. rho =.55 rho =. HEKRF ctd derived mrn half life OFF [min] Gene density.5..5 C Friedel (9) Yang () HEKRF median mrn half life [min] rho =.6 rho =. rho =.6 rho =. rho =.66 rho =.5 rho =.7 rho =.96 Gene density.6... Literature mrn half life [min] Temporal no Figure EV. mrn half-life comparisons for HEK9ΔRF:ER cells. Treatment comparison: ctd-derived half-lives in -pretreated versus untreated HEK9ΔRF:ER cells. Method comparison: ctd-derived half-lives compared to SU-derived half-lives in untreated HEK9ΔRF:ER cells. C Literature comparison: HEK9ΔRF:ER median mrn half-lives compared to published mrn half-lives in two different studies. Data information: Spearman correlation is indicated for all genes and for each gene. EV Molecular Systems iology : 9 7 ª 7 The uthors

4 Florian Uhlitz et al Immediate late genes decode ERK signal duration Molecular Systems iology transcription rate log [TPM/h] h h h h h rho =. rho =.67 rho =.6 rho =.55 rho =.5 Model derived mrn half life [min] nascent mrn total mrn log TPM 5 h h h h h h h h h h Figure EV5. nti-correlation of transcription rate and mrn half-life and comparison of nascent and total mrn levels in -stimulated HEK9ΔRF:ER. Comparison of absolute log transcription rate [TPM/h = transcripts per million per hour] after different periods of treatment and model-derived mrn half-life in HEK9ΔRF:ER. nti-correlation indicates that short mrn half-lives in s are compensated with high transcription rates. Comparison of nascent and total mrn levels after different periods of treatment in HEK9ΔRF:ER. s have higher nascent mrn levels after stimulation than s and s but end up at similar total mrn levels after prolonged activation. Data information: oxplots in () show median and inter-quartile range. IQR is extended with whiskers to the largest and smallest value respectively, but no further than.5 IQR from hinges. Figure EV6. Signal duration effects on mrn and protein level in -treated HEK9ΔRF:ER cells, and conservation of mrn response dynamics in rat PC and human MCF7 cells. mrn log fold changes in qpcr time course data for five different ERK signal durations in HEK9ΔRF:ER cells (cf. Fig EVC for treatment scheme). Representative Western blot for protein fold changes shown in Fig 6E. CLU and FOSL were measured on the same membrane; hence, lower GPDH control corresponds to both blots. C Comparison of HEK9ΔRF:ER and PC cells. Left panel: Spearman correlation of maximum mrn log fold changes in -treated HEK9ΔRF:ER cells and corresponding homologues in NGF-treated PC cells. Middle panel: Spearman correlation of mrn response times in -treated HEK9ΔRF:ER cells and peak expression time points of corresponding homologues in NGF-treated rat PC cells. Right panel: Spearman correlation of median mrn half-lives in HEK9ΔRF:ER cells and peak expression time points of corresponding homologues in NGF-treated rat PC cells. D Comparison of HEK9ΔRF:ER and MCF7 cells. ª 7 The uthors Molecular Systems iology : 9 7 EV

5 Molecular Systems iology Immediate late genes decode ERK signal duration Florian Uhlitz et al mrn log fc DUSP EGR EGR FOS FOS JUN RC CLU DUSP6 FOSL NR PTGS TFPI TNFRSF ZCCHC ZFP6 PPPR5 EGF Temporal Signal duration.5 h h 5h h h h 5h h EGR GPDH FOS GPDH CLU FOSL GPDH C HEKRF max log fc 6 rho =. HEKRF response time [h] rho =.7 HEKRF median mrn half life [h] rho =.6 SRG D 6 PC NGF max log fc PC NGF PC NGF HEKRF max log fc 6 rho =. HEKRF response time [h] rho =.6 HEKRF median mrn half life [h] rho =.6 SRG 6 MCF7 HRG max log fc MCF7 HRG MCF7 HRG Figure EV6. EV5 Molecular Systems iology : 9 7 ª 7 The uthors

6 Florian Uhlitz et al Immediate late genes decode ERK signal duration Molecular Systems iology EtOH +U6 n = 5; t = h n = 5; t = h n = 5; t = h FSC 7 6. % 9.6 %.7 % Cleaved Casp (FL ) Figure EV7. Gene Ontology enrichment and apoptosis in sustained versus transiently induced HEK9ΔRFER cells. Gene Ontology iological Process term enrichment for s, s and s. Score corresponds to significant enrichment in respective, where Score = log (P-value). Significant enrichments are highlighted with coloured border. ackground colour intensities correspond to denoted fractions and are normalised columnwise. FCS data to detect cleaved Casp-positive cells among untreated or treated HEK9ΔRF:ER cells as a marker for apoptosis. EtOH: no ERK signalling. : sustained ERK signalling. +U6: -h pulse ERK signalling. ª 7 The uthors Molecular Systems iology : 9 7 EV6

Expanded View Figures

Expanded View Figures EMO Molecular Medicine Proteomic map of squamous cell carcinomas Hanibal ohnenberger et al Expanded View Figures Figure EV1. Technical reproducibility. Pearson s correlation analysis of normalised SILC

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea

More information

Expanded View Figures

Expanded View Figures Molecular Systems iology Tumor CNs reflect metabolic selection Nicholas Graham et al Expanded View Figures Human primary tumors CN CN characterization by unsupervised PC Human Signature Human Signature

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach) High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set

More information

Nature Medicine: doi: /nm.4078

Nature Medicine: doi: /nm.4078 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro. RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Differential roles of ERRFI1 in EGFR and AKT pathway regulation affect cancer proliferation

Differential roles of ERRFI1 in EGFR and AKT pathway regulation affect cancer proliferation rticle Differential roles of ERRFI1 in EGFR and KT pathway regulation affect cancer proliferation Junmei airns 1 Liewei Wang 1,*, rooke L Fridley 2,3, Gregory D Jenkins 2, Yongxian Zhuang 1, Jia Yu 1 &

More information

Figure S1A. Blood glucose levels in mice after glucose injection

Figure S1A. Blood glucose levels in mice after glucose injection ## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose

More information

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

Characterization of mirna-regulated networks, hubs of signaling, and biomarkers in obstruction-induced bladder dysfunction

Characterization of mirna-regulated networks, hubs of signaling, and biomarkers in obstruction-induced bladder dysfunction Characterization of mirna-regulated networks, hubs of signaling, and biomarkers in obstruction-induced bladder dysfunction Ali Hashemi Gheinani, 1 Bernhard Kiss, 2 Felix Moltzahn, 2 Irene Keller, 3 Rémy

More information

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Expanded View Figures

Expanded View Figures Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

MEA DISCUSSION PAPERS

MEA DISCUSSION PAPERS Inference Problems under a Special Form of Heteroskedasticity Helmut Farbmacher, Heinrich Kögel 03-2015 MEA DISCUSSION PAPERS mea Amalienstr. 33_D-80799 Munich_Phone+49 89 38602-355_Fax +49 89 38602-390_www.mea.mpisoc.mpg.de

More information

Summarizing Data. (Ch 1.1, 1.3, , 2.4.3, 2.5)

Summarizing Data. (Ch 1.1, 1.3, , 2.4.3, 2.5) 1 Summarizing Data (Ch 1.1, 1.3, 1.10-1.13, 2.4.3, 2.5) Populations and Samples An investigation of some characteristic of a population of interest. Example: You want to study the average GPA of juniors

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

3: Summary Statistics

3: Summary Statistics 3: Summary Statistics Review Questions 1. List three measures of central location. 2. The two distinct measures of spread are: 3. A study shows a mean of 0.98 and median of 0.56. What does this suggest

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Integrated network analysis reveals distinct regulatory roles of transcription factors and micrornas

Integrated network analysis reveals distinct regulatory roles of transcription factors and micrornas Integrated network analysis reveals distinct regulatory roles of transcription factors and micrornas Yu Guo 1,2,4, Katherine Alexander 1, Andrew G Clark 1, Andrew Grimson 1 and Haiyuan Yu 2,3* 1 Department

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

Statistics Assignment 11 - Solutions

Statistics Assignment 11 - Solutions Statistics 44.3 Assignment 11 - Solutions 1. Samples were taken of individuals with each blood type to see if the average white blood cell count differed among types. Eleven individuals in each group were

More information

Recruitment of HBO1 Histone Acetylase and Blocks

Recruitment of HBO1 Histone Acetylase and Blocks Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin

More information

The corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics:

The corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics: Correction H3K4me3 readth Is Linked to Cell Identity and Transcriptional Consistency érénice A. enayoun, Elizabeth A. Pollina, Duygu Ucar, Salah Mahmoudi, Kalpana Karra, Edith D. Wong, Keerthana Devarajan,

More information

Expanded View Figures

Expanded View Figures The EMO Journal Dnmt regulates translational fidelity Francesca Tuorto et al Expanded View Figures x E3 cells/µl W g/l HG x e3 cells/µl PLT % of cell type 8 day 8 month % of cell type 8 day 8 month 8 day

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Early Learning vs Early Variability 1.5 r = p = Early Learning r = p = e 005. Early Learning 0.

Early Learning vs Early Variability 1.5 r = p = Early Learning r = p = e 005. Early Learning 0. The temporal structure of motor variability is dynamically regulated and predicts individual differences in motor learning ability Howard Wu *, Yohsuke Miyamoto *, Luis Nicolas Gonzales-Castro, Bence P.

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

RNA-seq: filtering, quality control and visualisation. COMBINE RNA-seq Workshop

RNA-seq: filtering, quality control and visualisation. COMBINE RNA-seq Workshop RNA-seq: filtering, quality control and visualisation COMBINE RNA-seq Workshop QC and visualisation (part 1) Slide taken from COMBINE RNAseq workshop on 23/09/2016 RNA-seq of Mouse mammary gland Basal

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline

Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation

More information

SD-1 SD-1: Cathepsin B levels in TNF treated hch

SD-1 SD-1: Cathepsin B levels in TNF treated hch SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces

More information

High-Throughput Sequencing Course

High-Throughput Sequencing Course High-Throughput Sequencing Course Introduction Biostatistics and Bioinformatics Summer 2017 From Raw Unaligned Reads To Aligned Reads To Counts Differential Expression Differential Expression 3 2 1 0 1

More information

Averages and Variation

Averages and Variation Chapter 3 Averages and Variation Name Section 3.1 Measures of Central Tendency: Mode, Median, and Mean Objective: In this lesson you learned how to compute, interpret, and explain mean, median, and mode.

More information

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils

More information

Hao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming*

Hao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming* Comparison of transcriptomes and gene expression profiles of two chilling- and drought-tolerant and intolerant Nicotiana tabacum varieties under low temperature and drought stress Hao D. H., Ma W. G.,

More information

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in

More information

Comparison of discrimination methods for the classification of tumors using gene expression data

Comparison of discrimination methods for the classification of tumors using gene expression data Comparison of discrimination methods for the classification of tumors using gene expression data Sandrine Dudoit, Jane Fridlyand 2 and Terry Speed 2,. Mathematical Sciences Research Institute, Berkeley

More information

period. The distribution of PREs and TCs, stratified by synoptic category

period. The distribution of PREs and TCs, stratified by synoptic category 3. Climatology of PREs during 1988 2008 3.1 Overview A total of 56 PREs associated with 38 Atlantic basin TCs were identified for the 1988 2008 period. The distribution of PREs and TCs, stratified by synoptic

More information

Supplementary Data for:

Supplementary Data for: Supplementary Data for: Tumour sampling method can significantly influence gene expression profiles derived from neoadjuvant window studies Dominic A. Pearce 1, Laura M. Arthur 1, Arran K. Turnbull 1,

More information

Chapter 5: Global Analysis of the Effect of Densin. Knockout on Gene Transcription in the Brain

Chapter 5: Global Analysis of the Effect of Densin. Knockout on Gene Transcription in the Brain Chapter 5: Global Analysis of the Effect of Densin Knockout on Gene Transcription in the Brain Introduction High throughput methods for analyzing transcriptional changes in response to deletion or mutation

More information

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

SDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes

SDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes Figure S1. Percentages of Granzyme expressing D8 + T lymphocytes 13.5% 1.4%.6% 77% 21% 24% 76% 8 8 Granzyme + (%) 6 4 2 Granzyme + (%) 6 4 2 D8 + Tnaive Tcm Tem Temra D8 + D8 + D28 + D8 + D28 null We analyzed

More information

Table S1: Data-generating Model:

Table S1: Data-generating Model: Table S1: Data-generating Model: Below are the parameters used for the data-generating model (section 1.5). The model was generated using CNORode. The data generating model is included below (figure S1).

More information

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang

More information

4.2 RESULTS AND DISCUSSION

4.2 RESULTS AND DISCUSSION phosphorylated proteins on treatment with Erlotinib.This chapter describes the finding of the SILAC experiment. 4.2 RESULTS AND DISCUSSION This is the first global report of its kind using dual strategies

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Biol403 MAP kinase signalling

Biol403 MAP kinase signalling Biol403 MAP kinase signalling The mitogen activated protein kinase (MAPK) pathway is a signalling cascade activated by a diverse range of effectors. The cascade regulates many cellular activities including

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training. Supplementary Figure 1 Behavioral training. a, Mazes used for behavioral training. Asterisks indicate reward location. Only some example mazes are shown (for example, right choice and not left choice maze

More information

POLS 5377 Scope & Method of Political Science. Correlation within SPSS. Key Questions: How to compute and interpret the following measures in SPSS

POLS 5377 Scope & Method of Political Science. Correlation within SPSS. Key Questions: How to compute and interpret the following measures in SPSS POLS 5377 Scope & Method of Political Science Week 15 Measure of Association - 2 Correlation within SPSS 2 Key Questions: How to compute and interpret the following measures in SPSS Ordinal Variable Gamma

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide

More information

Question 1(25= )

Question 1(25= ) MSG500 Final 20-0-2 Examiner: Rebecka Jörnsten, 060-49949 Remember: To pass this course you also have to hand in a final project to the examiner. Open book, open notes but no calculators or computers allowed.

More information

Water Microbiology Proficiency Test Scheme. Overview & Description

Water Microbiology Proficiency Test Scheme. Overview & Description National Laboratory Association South Africa Association Incorporated under Section 21 Not for Gain) P.O. Box 298 1 De Havilland Crescent Persequor Park Persequor Technopark Pretoria, South Africa, 0020

More information

10. LINEAR REGRESSION AND CORRELATION

10. LINEAR REGRESSION AND CORRELATION 1 10. LINEAR REGRESSION AND CORRELATION The contingency table describes an association between two nominal (categorical) variables (e.g., use of supplemental oxygen and mountaineer survival ). We have

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/- Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-

More information

Activation of a PML/TP53 axis underlies acute promyelocytic. leukemia cure

Activation of a PML/TP53 axis underlies acute promyelocytic. leukemia cure Activation of a PML/TP53 ais underlies acute promyelocytic leukemia cure Julien Ablain, Kim Rice, Hassane Soilihi, Aurélien de Reynies, Saverio Minucci & Hugues de Thé a PLZF-RARA vs PLZF-RARA pathway

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

OWa 22 80) :IEZ

OWa 22 80) :IEZ Clinical Study Report: 20025409 Part 2 Date: 22 September 2008 OWa 22 80) 06 --- :IEZ Page 1 SYNOPSIS Name of the Sponsor: Name of Finished Product: Name of Active Ingredient: Immunex Corporation Panitumumab

More information

1) What is the independent variable? What is our Dependent Variable?

1) What is the independent variable? What is our Dependent Variable? 1) What is the independent variable? What is our Dependent Variable? Independent Variable: Whether the font color and word name are the same or different. (Congruency) Dependent Variable: The amount of

More information

(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.

(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ. Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Outline. Practice. Confounding Variables. Discuss. Observational Studies vs Experiments. Observational Studies vs Experiments

Outline. Practice. Confounding Variables. Discuss. Observational Studies vs Experiments. Observational Studies vs Experiments 1 2 Outline Finish sampling slides from Tuesday. Study design what do you do with the subjects/units once you select them? (OI Sections 1.4-1.5) Observational studies vs. experiments Descriptive statistics

More information

Population. Sample. AP Statistics Notes for Chapter 1 Section 1.0 Making Sense of Data. Statistics: Data Analysis:

Population. Sample. AP Statistics Notes for Chapter 1 Section 1.0 Making Sense of Data. Statistics: Data Analysis: Section 1.0 Making Sense of Data Statistics: Data Analysis: Individuals objects described by a set of data Variable any characteristic of an individual Categorical Variable places an individual into one

More information

Consistency of Encoding in Monkey Visual Cortex

Consistency of Encoding in Monkey Visual Cortex The Journal of Neuroscience, October 15, 2001, 21(20):8210 8221 Consistency of Encoding in Monkey Visual Cortex Matthew C. Wiener, Mike W. Oram, Zheng Liu, and Barry J. Richmond Laboratory of Neuropsychology,

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.

Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents

More information

fraction (soluble sugars, starch and total NSC). Conditional and marginal R 2 values are given for

fraction (soluble sugars, starch and total NSC). Conditional and marginal R 2 values are given for 1 2 Martínez-Vilalta, Sala, Asensio, Galiano, Hoch, Palacio, Piper and Lloret. Dynamics of non- structural carbohydrates in terrestrial plants: a global synthesis. Ecological Monographs. 3 4 APPENDIX S2.

More information

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.

More information

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1 a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

More information

Neocortex Zbtb20 / NFIA / Sox9

Neocortex Zbtb20 / NFIA / Sox9 Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive

More information

Gene-microRNA network module analysis for ovarian cancer

Gene-microRNA network module analysis for ovarian cancer Gene-microRNA network module analysis for ovarian cancer Shuqin Zhang School of Mathematical Sciences Fudan University Oct. 4, 2016 Outline Introduction Materials and Methods Results Conclusions Introduction

More information

Midterm Exam MMI 409 Spring 2009 Gordon Bleil

Midterm Exam MMI 409 Spring 2009 Gordon Bleil Midterm Exam MMI 409 Spring 2009 Gordon Bleil Table of contents: (Hyperlinked to problem sections) Problem 1 Hypothesis Tests Results Inferences Problem 2 Hypothesis Tests Results Inferences Problem 3

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................

More information