Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24]

Size: px
Start display at page:

Download "Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24]"

Transcription

1 Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24] ITCR meeting, June 2016

2 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome

3 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome

4 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome

5 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome

6 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome

7 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Two paradigms for transcriptome Analysis

8 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome Genome

9 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome Genome Transcript reconstruction from RNA-Seq spliced alignments Genome

10 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Transcript reconstruction from RNA-Seq spliced alignments Genome

11 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome

12 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome Not mapping due to genome restructuring or foreign origin. +

13 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome Not mapping due to genome restructuring or foreign origin. +

14 The Ever-Growing Trinity User Community ~1.5k unique users per month >3k literature citations (~20% cancer community) Open Source software development contributions from the Trinity community. Trinity Usage Tracked by Unique IP Address

15 The Trinity Community is Global User support and training: Google group and Twitter feed for community interaction and support. Extensive documentation, user guides, tutorials and protocols Demo and training videos On-site training workshops

16 Cancer Transcriptome Analysis Toolkit Goal: to assist cancer researchers in applying RNA-Seq to genetic and functional analyses of cancer

17 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq + Genome Alignments for Reads & Transcripts

18 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing

19 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

20 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

21 Mutation Detection Using RNA-Seq Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

22 Trinity CTAT Cancer Mutation Identification Module Custom visualization is a product of multiple labs efforts. Karchin lab Mesirov lab

23 Mutation Analysis and Visualization from Within Galaxy Table of Predicted Variants with scores, attributes and rankings. Individual mutation report, including genome evidence view and annotations. Mupit 3D protein structure view (ITCR - Rachel Karchin and Mike Ryan) ** will demo **

24 Fusion Transcript Detection Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

25 Top-down Approaches to Fusion Transcript Discovery Paired-end Illumina RNA-Seq STAR-Fusion * In collaboration with Alex Dobin, developer of STAR De novo RNA-Seq assembly Trinity or Oases (MK) GMAP-fusion * In collaboration with Tom Wu, developer of GMAP Align reads to the genome, Identify discordant pairs and junction/split reads. Align transcripts to genome, Identify Fusion Transcripts /1 /1 Junction read Chr-A Chr-B Spanning frag /2 /2 Chr-A Chr-B

26 Top-down Approaches to Fusion Transcript Discovery Paired-end Illumina RNA-Seq STAR-Fusion * In collaboration with Alex Dobin, developer of STAR DISCASM STAR-alignments Just discordant or Align reads to the genome, unmapped reads Identify discordant pairs and junction/split reads. De novo RNA-Seq assembly Trinity or Oases (MK) GMAP-fusion * In collaboration with Tom Wu, developer of GMAP Align transcripts to genome, Identify Fusion Transcripts /1 /1 Junction read Chr-A Chr-B Spanning frag /2 /2 Chr-A Chr-B Compare to: Prada SoapFuse TophatFusion ChimeraScan Defuse FusionCatcher Ericscript FusionHunter Mapsplice Jaffa

27 Evaluation of Fusion-Finding Accuracy (using 75 Cancer Cell Lines, with TP = min 3 tools agree) All Fusion Prediction Accuracies STAR-Fusion De novo Assembly-based Fusion Prediction Accuracy DISCASM/Trinity Trinity JAFFA Fusion predictions ranked according to min evidence support. Cancer-associated Viruses and Microbiome

28 STAR-Fusion and DISCASM/Trinity Improve on both Speed and Accuracy of Fusion Detection Time (hours) $ Using 30M PE reads, 5 samples ea.

29 Bottom-up Fusion In silico Validation Using FusionInspector Add to whole genome. Align reads, score and assess. /2 /1 /2 * STAR enhancements to support FusionInspector Make mini-fusion contigs All fusion predictions

30 FusionInspector Fusion View BCR ABL Powered by IGV.js ITCR - Jim Robinson and Jill Mesirov

31 LincRNA Identification Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

32 SLNCKY: LincRNA Identification from Reconstructed Transcripts Jenny Chen,, Aviv Regev & Manuel Garber; Genome Biology 2016 Transcripts (reconstructed from RNA-Seq) Example: Homo sapiens metastasis associated lung adenocarcinoma transcript 1 (MALAT1), non-coding RNA Considers conserved ORFs and dn/ds Freely available, open source:

33 SLNCKY - ** will demo **

34 SLNCKY-based Re-discovery of PCAT1: Prostate Cancer Associated Transcript 1 Nature Biotechnology, 2011

35 Single Cell Tumor Heterogeneity Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports

36 Single Cell Resolution of Tumor Heterogeneity via RNA-Seq Single Cell Workflow Expression Heterogeneity Splicing Aberrations in EGFR Chromosome gain/loss Differential Expression of surface receptors TP53 Mutations A. Patel, I. Tirosh,, A. Regev, B. Bernstein. Science, 2014

37 Large-scale Copy Number Variation Inferred from Single Cell RNA-Seq Data Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma Patel, Tirosh,, Regev, Bernstein; Science 2014 Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq Tirosh, Izaar,., Regev, Garraway; Science 2016

38 Trinity CTAT InferCNV: Utility to identify large-scale CNV from single cell RNA-Seq Normal cells Tumor cells CTAT InferCNV by Tim Tickle and Itay Tirosh

39 Goal: cancer transcriptome toolkit accessible to any cancer researcher Starting point: RNA-Seq data (fastq files)

40 12/1/14 1/1/15 2/1/15 3/1/15 4/1/15 5/1/15 6/1/15 7/1/15 8/1/15 9/1/15 10/1/15 11/1/15 12/1/15 1/1/16 2/1/16 3/1/16 4/1/16 5/1/16 Access Trinity CTAT via Galaxy The National Center for Genome Analysis Support hosts the public web interface for running Trinity jobs. Backed by three devoted nodes running on the Karst system with 512GB memory each Total Galaxy Users per Month We re steadily growing since the official launch in January,

41 Scaling from individual samples

42 Scaling from individual samples to many samples

43 Firecloud Scalable Cancer Computing Solution Integration of Trinity CTAT into WDL workflows Process TCGA data Shareable workflows and data resources Also enables integration of Trinity CTAT into:

44 Got Cancer RNA-Seq? Run Trinity! Lots more to come!!!

45 Acknowledgements Aviv Regev Brian Haas Timothy Tickle Asma Bankapur Ami-levy Moonshine Alex Dobin Nathalie Pochet Nik Obholzer Cathy Wu Jing Sun Peggy Hsu Jintaek Kim Sachet Shukla Dan Landau Jill Mesirov James Robinson Tom Wu Bill Barnett Thomas Doak Carrie Ganote Robert Henschel Ben Fulton

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic

More information

Introduction. Introduction

Introduction. Introduction Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity

More information

Chip Seq Peak Calling in Galaxy

Chip Seq Peak Calling in Galaxy Chip Seq Peak Calling in Galaxy Chris Seward PowerPoint by Pei-Chen Peng Chip-Seq Peak Calling in Galaxy Chris Seward 2018 1 Introduction This goals of the lab are as follows: 1. Gain experience using

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Transcript reconstruction

Transcript reconstruction Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

Daehwan Kim September 2018

Daehwan Kim September 2018 Daehwan Kim September 2018 Michael L. Rosenberg Assistant Professor, CPRIT Scholar (214) 645-1738 Lyda Hill Department of Bioinformatics infphilo@gmail.com University of Texas Southwestern Medical Center

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Bioinformatics Laboratory Exercise

Bioinformatics Laboratory Exercise Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion

More information

Analyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015

Analyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015 Analyzing Genomic Data with PyEnsembl and Varcode Alex Rubinsteyn SciPy - July 9th, 2015 HammerLab @ Mount Sinai http://www.hammerlab.org/research/ Not biologists! Most lab members have a background in

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Integrated Analysis of Copy Number and Gene Expression

Integrated Analysis of Copy Number and Gene Expression Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose

More information

Transcriptome Analysis

Transcriptome Analysis Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits

More information

Epigenetic programming in chronic lymphocytic leukemia

Epigenetic programming in chronic lymphocytic leukemia Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Lectures 13: High throughput sequencing: Beyond the genome. Spring 2017 March 28, 2017

Lectures 13: High throughput sequencing: Beyond the genome. Spring 2017 March 28, 2017 Lectures 13: High throughput sequencing: Beyond the genome Spring 2017 March 28, 2017 h@p://www.fejes.ca/2009/06/science- cartoons- 5- rna- seq.html Omics Transcriptome - the set of all mrnas present in

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

The Cancer Genome Atlas & International Cancer Genome Consortium

The Cancer Genome Atlas & International Cancer Genome Consortium The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

Benjamin Izar, M.D., Ph.D. Instructor in Medicine, Harvard Medical School Dana-Farber Cancer Institute and Broad Institute

Benjamin Izar, M.D., Ph.D. Instructor in Medicine, Harvard Medical School Dana-Farber Cancer Institute and Broad Institute Defining cancer cell intrinsic signatures that predict response/resistance to immune checkpoint inhibition using single-cell RNA-sequencing in melanoma Benjamin Izar, M.D., Ph.D. Instructor in Medicine,

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies

More information

Multi-omics data integration colon cancer using proteogenomics approach

Multi-omics data integration colon cancer using proteogenomics approach Dept. of Medical Oncology Multi-omics data integration colon cancer using proteogenomics approach DTL Focus meeting, 29 August 2016 Thang Pham OncoProteomics Laboratory, Dept. of Medical Oncology VU University

More information

Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They?

Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Dubovenko Alexey Discovery Product Manager Sonia Novikova Solution Scientist September 2018 2 Non-Small Cell Lung Cancer

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6 Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early

More information

Cancer Informatics Lecture

Cancer Informatics Lecture Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons

More information

Supplementary Materials for

Supplementary Materials for www.sciencemag.org/content/355/6332/eaai8478/suppl/dc1 Supplementary Materials for Decoupling genetics, lineages, and microenvironment in IDH-mutant gliomas by single-cell RNA-seq Andrew S. Venteicher,

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Inference of Isoforms from Short Sequence Reads

Inference of Isoforms from Short Sequence Reads Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

cis-regulatory enrichment analysis in human, mouse and fly

cis-regulatory enrichment analysis in human, mouse and fly cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology

More information

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...

More information

CIViC Clinical Interpretations of Variants in Cancer. rnal/v49/n2/full/ng.3774.html

CIViC Clinical Interpretations of Variants in Cancer.     rnal/v49/n2/full/ng.3774.html CIViC Clinical Interpretations of Variants in Cancer www.civicdb.org http://www.nature.com/ng/jou rnal/v49/n2/full/ng.3774.html CIViC Homepage Aim Statement Curation Stats Recent Activity Links at Bottom

More information

Pan-cancer analysis of expressed somatic nucleotide variants in long intergenic non-coding RNA

Pan-cancer analysis of expressed somatic nucleotide variants in long intergenic non-coding RNA Pan-cancer analysis of expressed somatic nucleotide variants in long intergenic non-coding RNA Travers Ching 1,2, Lana X. Garmire 1,2 1 Molecular Biosciences and Bioengineering Graduate Program, University

More information

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to

More information

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and

More information

High Throughput Sequence (HTS) data analysis. Lei Zhou

High Throughput Sequence (HTS) data analysis. Lei Zhou High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015 Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies

More information

Cancer gene discovery via network analysis of somatic mutation data. Insuk Lee

Cancer gene discovery via network analysis of somatic mutation data. Insuk Lee Cancer gene discovery via network analysis of somatic mutation data Insuk Lee Cancer is a progressive genetic disorder. Accumulation of somatic mutations cause cancer. For example, in colorectal cancer,

More information

SUPPLEMENTARY APPENDIX

SUPPLEMENTARY APPENDIX SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature

More information

Using Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI

Using Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI Using Network Flow to Bridge the Gap between Genotype and Phenotype Teresa Przytycka NIH / NLM / NCBI Journal Wisla (1902) Picture from a local fare in Lublin, Poland Genotypes Phenotypes Journal Wisla

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data.

Nature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data. Supplementary Figure 1 Workflow of CDR3 sequence assembly from RNA-seq data. Paired-end short-read RNA-seq data were mapped to human reference genome hg19, and unmapped reads in the TCR regions were extracted

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Genomic Methods in Cancer Epigenetic Dysregulation

Genomic Methods in Cancer Epigenetic Dysregulation Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics

More information

Ambient temperature regulated flowering time

Ambient temperature regulated flowering time Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis

More information

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap

More information

ncounter Assay Automated Process Immobilize and align reporter for image collecting and barcode counting ncounter Prep Station

ncounter Assay Automated Process Immobilize and align reporter for image collecting and barcode counting ncounter Prep Station ncounter Assay ncounter Prep Station Automated Process Hybridize Reporter to RNA Remove excess reporters Bind reporter to surface Immobilize and align reporter Image surface Count codes Immobilize and

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Module 3: Pathway and Drug Development

Module 3: Pathway and Drug Development Module 3: Pathway and Drug Development Table of Contents 1.1 Getting Started... 6 1.2 Identifying a Dasatinib sensitive cancer signature... 7 1.2.1 Identifying and validating a Dasatinib Signature... 7

More information

Bigomics : Challenges and promises in large scale sequencing projects

Bigomics : Challenges and promises in large scale sequencing projects Bigomics : Challenges and promises in large scale sequencing projects Theodore M. Wong Ken Yocum MSST 2014 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies

More information

Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor

Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool

More information

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through

More information

Ginkgo Interactive analysis and quality assessment of single-cell CNV data

Ginkgo Interactive analysis and quality assessment of single-cell CNV data Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael

More information

Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012

Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu

More information

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016 Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important

More information

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation. SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang

More information

Core Technology Development Team Meeting

Core Technology Development Team Meeting Core Technology Development Team Meeting To hear the meeting, you must call in Toll-free phone number: 1-866-740-1260 Access Code: 2201876 For international call in numbers, please visit: https://www.readytalk.com/account-administration/international-numbers

More information

Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula

Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula Kelly Mulholland 1,2, Calvin Keeler, Jr. 2, Sharon J. Keeler 2 and Monique Robinson 2 1 Center for Bioinformatics

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy

Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy 1 SYSTEM REQUIREMENTS 1 Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy Franziska Zickmann and Bernhard Y. Renard Research Group

More information

How Personalized Medicine is Changing the Biopharmaceutical Marketplace

How Personalized Medicine is Changing the Biopharmaceutical Marketplace How Personalized Medicine is Changing the Biopharmaceutical Marketplace Marc Chioda, PharmD Associate Medical Director, Pfizer Oncology. Presentation to the Cancer Action Coalition of Virginia January

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

The Cancer Genome Atlas

The Cancer Genome Atlas The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are

More information