Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24]
|
|
- Malcolm Osborne
- 5 years ago
- Views:
Transcription
1 Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24] ITCR meeting, June 2016
2 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome
3 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome
4 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome
5 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome
6 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor T + the associated microbiome, virome
7 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Two paradigms for transcriptome Analysis
8 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome Genome
9 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome Genome Transcript reconstruction from RNA-Seq spliced alignments Genome
10 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Transcript reconstruction from RNA-Seq spliced alignments Genome
11 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome
12 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome Not mapping due to genome restructuring or foreign origin. +
13 Contemporary strategies for transcript analysis from RNA-Seq RNA-Seq reads Spliced alignment of RNA-Seq to genome De novo transcript assembly Genome Align to genome Transcript reconstruction from RNA-Seq spliced alignments Genome Not mapping due to genome restructuring or foreign origin. +
14 The Ever-Growing Trinity User Community ~1.5k unique users per month >3k literature citations (~20% cancer community) Open Source software development contributions from the Trinity community. Trinity Usage Tracked by Unique IP Address
15 The Trinity Community is Global User support and training: Google group and Twitter feed for community interaction and support. Extensive documentation, user guides, tutorials and protocols Demo and training videos On-site training workshops
16 Cancer Transcriptome Analysis Toolkit Goal: to assist cancer researchers in applying RNA-Seq to genetic and functional analyses of cancer
17 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq + Genome Alignments for Reads & Transcripts
18 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing
19 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
20 Trinity Cancer Transcriptome Analysis Toolkit Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
21 Mutation Detection Using RNA-Seq Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
22 Trinity CTAT Cancer Mutation Identification Module Custom visualization is a product of multiple labs efforts. Karchin lab Mesirov lab
23 Mutation Analysis and Visualization from Within Galaxy Table of Predicted Variants with scores, attributes and rankings. Individual mutation report, including genome evidence view and annotations. Mupit 3D protein structure view (ITCR - Rachel Karchin and Mike Ryan) ** will demo **
24 Fusion Transcript Detection Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
25 Top-down Approaches to Fusion Transcript Discovery Paired-end Illumina RNA-Seq STAR-Fusion * In collaboration with Alex Dobin, developer of STAR De novo RNA-Seq assembly Trinity or Oases (MK) GMAP-fusion * In collaboration with Tom Wu, developer of GMAP Align reads to the genome, Identify discordant pairs and junction/split reads. Align transcripts to genome, Identify Fusion Transcripts /1 /1 Junction read Chr-A Chr-B Spanning frag /2 /2 Chr-A Chr-B
26 Top-down Approaches to Fusion Transcript Discovery Paired-end Illumina RNA-Seq STAR-Fusion * In collaboration with Alex Dobin, developer of STAR DISCASM STAR-alignments Just discordant or Align reads to the genome, unmapped reads Identify discordant pairs and junction/split reads. De novo RNA-Seq assembly Trinity or Oases (MK) GMAP-fusion * In collaboration with Tom Wu, developer of GMAP Align transcripts to genome, Identify Fusion Transcripts /1 /1 Junction read Chr-A Chr-B Spanning frag /2 /2 Chr-A Chr-B Compare to: Prada SoapFuse TophatFusion ChimeraScan Defuse FusionCatcher Ericscript FusionHunter Mapsplice Jaffa
27 Evaluation of Fusion-Finding Accuracy (using 75 Cancer Cell Lines, with TP = min 3 tools agree) All Fusion Prediction Accuracies STAR-Fusion De novo Assembly-based Fusion Prediction Accuracy DISCASM/Trinity Trinity JAFFA Fusion predictions ranked according to min evidence support. Cancer-associated Viruses and Microbiome
28 STAR-Fusion and DISCASM/Trinity Improve on both Speed and Accuracy of Fusion Detection Time (hours) $ Using 30M PE reads, 5 samples ea.
29 Bottom-up Fusion In silico Validation Using FusionInspector Add to whole genome. Align reads, score and assess. /2 /1 /2 * STAR enhancements to support FusionInspector Make mini-fusion contigs All fusion predictions
30 FusionInspector Fusion View BCR ABL Powered by IGV.js ITCR - Jim Robinson and Jill Mesirov
31 LincRNA Identification Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
32 SLNCKY: LincRNA Identification from Reconstructed Transcripts Jenny Chen,, Aviv Regev & Manuel Garber; Genome Biology 2016 Transcripts (reconstructed from RNA-Seq) Example: Homo sapiens metastasis associated lung adenocarcinoma transcript 1 (MALAT1), non-coding RNA Considers conserved ORFs and dn/ds Freely available, open source:
33 SLNCKY - ** will demo **
34 SLNCKY-based Re-discovery of PCAT1: Prostate Cancer Associated Transcript 1 Nature Biotechnology, 2011
35 Single Cell Tumor Heterogeneity Cancer RNA- Seq Mutations + Genome Alignments for Reads & Transcripts Single Cell Tumor Heterogeneity Viruses & Microbes Fusion Transcripts Transcript Expression LincRNAs Alternative Splicing Interactive Visualizations and Summary Reports
36 Single Cell Resolution of Tumor Heterogeneity via RNA-Seq Single Cell Workflow Expression Heterogeneity Splicing Aberrations in EGFR Chromosome gain/loss Differential Expression of surface receptors TP53 Mutations A. Patel, I. Tirosh,, A. Regev, B. Bernstein. Science, 2014
37 Large-scale Copy Number Variation Inferred from Single Cell RNA-Seq Data Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma Patel, Tirosh,, Regev, Bernstein; Science 2014 Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq Tirosh, Izaar,., Regev, Garraway; Science 2016
38 Trinity CTAT InferCNV: Utility to identify large-scale CNV from single cell RNA-Seq Normal cells Tumor cells CTAT InferCNV by Tim Tickle and Itay Tirosh
39 Goal: cancer transcriptome toolkit accessible to any cancer researcher Starting point: RNA-Seq data (fastq files)
40 12/1/14 1/1/15 2/1/15 3/1/15 4/1/15 5/1/15 6/1/15 7/1/15 8/1/15 9/1/15 10/1/15 11/1/15 12/1/15 1/1/16 2/1/16 3/1/16 4/1/16 5/1/16 Access Trinity CTAT via Galaxy The National Center for Genome Analysis Support hosts the public web interface for running Trinity jobs. Backed by three devoted nodes running on the Karst system with 512GB memory each Total Galaxy Users per Month We re steadily growing since the official launch in January,
41 Scaling from individual samples
42 Scaling from individual samples to many samples
43 Firecloud Scalable Cancer Computing Solution Integration of Trinity CTAT into WDL workflows Process TCGA data Shareable workflows and data resources Also enables integration of Trinity CTAT into:
44 Got Cancer RNA-Seq? Run Trinity! Lots more to come!!!
45 Acknowledgements Aviv Regev Brian Haas Timothy Tickle Asma Bankapur Ami-levy Moonshine Alex Dobin Nathalie Pochet Nik Obholzer Cathy Wu Jing Sun Peggy Hsu Jintaek Kim Sachet Shukla Dan Landau Jill Mesirov James Robinson Tom Wu Bill Barnett Thomas Doak Carrie Ganote Robert Henschel Ben Fulton
RNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationTranscriptome and isoform reconstruc1on with short reads. Tangled up in reads
Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity
More informationChip Seq Peak Calling in Galaxy
Chip Seq Peak Calling in Galaxy Chris Seward PowerPoint by Pei-Chen Peng Chip-Seq Peak Calling in Galaxy Chris Seward 2018 1 Introduction This goals of the lab are as follows: 1. Gain experience using
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationTranscript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
More informationDNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
More informationDaehwan Kim September 2018
Daehwan Kim September 2018 Michael L. Rosenberg Assistant Professor, CPRIT Scholar (214) 645-1738 Lyda Hill Department of Bioinformatics infphilo@gmail.com University of Texas Southwestern Medical Center
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationBioinformatics Laboratory Exercise
Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion
More informationAnalyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015
Analyzing Genomic Data with PyEnsembl and Varcode Alex Rubinsteyn SciPy - July 9th, 2015 HammerLab @ Mount Sinai http://www.hammerlab.org/research/ Not biologists! Most lab members have a background in
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationDeploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven
Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationTranscriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
More informationEpigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationLectures 13: High throughput sequencing: Beyond the genome. Spring 2017 March 28, 2017
Lectures 13: High throughput sequencing: Beyond the genome Spring 2017 March 28, 2017 h@p://www.fejes.ca/2009/06/science- cartoons- 5- rna- seq.html Omics Transcriptome - the set of all mrnas present in
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
More informationThe Cancer Genome Atlas & International Cancer Genome Consortium
The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More information6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
More informationBenjamin Izar, M.D., Ph.D. Instructor in Medicine, Harvard Medical School Dana-Farber Cancer Institute and Broad Institute
Defining cancer cell intrinsic signatures that predict response/resistance to immune checkpoint inhibition using single-cell RNA-sequencing in melanoma Benjamin Izar, M.D., Ph.D. Instructor in Medicine,
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationMulti-omics data integration colon cancer using proteogenomics approach
Dept. of Medical Oncology Multi-omics data integration colon cancer using proteogenomics approach DTL Focus meeting, 29 August 2016 Thang Pham OncoProteomics Laboratory, Dept. of Medical Oncology VU University
More informationIdentifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They?
Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Dubovenko Alexey Discovery Product Manager Sonia Novikova Solution Scientist September 2018 2 Non-Small Cell Lung Cancer
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationCancer Informatics Lecture
Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons
More informationSupplementary Materials for
www.sciencemag.org/content/355/6332/eaai8478/suppl/dc1 Supplementary Materials for Decoupling genetics, lineages, and microenvironment in IDH-mutant gliomas by single-cell RNA-seq Andrew S. Venteicher,
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationInference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationcis-regulatory enrichment analysis in human, mouse and fly
cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology
More informationOncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies
OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...
More informationCIViC Clinical Interpretations of Variants in Cancer. rnal/v49/n2/full/ng.3774.html
CIViC Clinical Interpretations of Variants in Cancer www.civicdb.org http://www.nature.com/ng/jou rnal/v49/n2/full/ng.3774.html CIViC Homepage Aim Statement Curation Stats Recent Activity Links at Bottom
More informationPan-cancer analysis of expressed somatic nucleotide variants in long intergenic non-coding RNA
Pan-cancer analysis of expressed somatic nucleotide variants in long intergenic non-coding RNA Travers Ching 1,2, Lana X. Garmire 1,2 1 Molecular Biosciences and Bioengineering Graduate Program, University
More informationAliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos
Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to
More information38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
More informationHigh Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationMetabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
More informationCancer gene discovery via network analysis of somatic mutation data. Insuk Lee
Cancer gene discovery via network analysis of somatic mutation data Insuk Lee Cancer is a progressive genetic disorder. Accumulation of somatic mutations cause cancer. For example, in colorectal cancer,
More informationSUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
More informationUsing Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI
Using Network Flow to Bridge the Gap between Genotype and Phenotype Teresa Przytycka NIH / NLM / NCBI Journal Wisla (1902) Picture from a local fare in Lublin, Poland Genotypes Phenotypes Journal Wisla
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data.
Supplementary Figure 1 Workflow of CDR3 sequence assembly from RNA-seq data. Paired-end short-read RNA-seq data were mapped to human reference genome hg19, and unmapped reads in the TCR regions were extracted
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationGenomic Methods in Cancer Epigenetic Dysregulation
Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationFigure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationncounter Assay Automated Process Immobilize and align reporter for image collecting and barcode counting ncounter Prep Station
ncounter Assay ncounter Prep Station Automated Process Hybridize Reporter to RNA Remove excess reporters Bind reporter to surface Immobilize and align reporter Image surface Count codes Immobilize and
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationModule 3: Pathway and Drug Development
Module 3: Pathway and Drug Development Table of Contents 1.1 Getting Started... 6 1.2 Identifying a Dasatinib sensitive cancer signature... 7 1.2.1 Identifying and validating a Dasatinib Signature... 7
More informationBigomics : Challenges and promises in large scale sequencing projects
Bigomics : Challenges and promises in large scale sequencing projects Theodore M. Wong Ken Yocum MSST 2014 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationScreening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery
Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies
More informationProteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool
More informationExploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein
Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through
More informationGinkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
More informationClonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu
More informationGenetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationPatterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
More informationSUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.
SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang
More informationCore Technology Development Team Meeting
Core Technology Development Team Meeting To hear the meeting, you must call in Toll-free phone number: 1-866-740-1260 Access Code: 2201876 For international call in numbers, please visit: https://www.readytalk.com/account-administration/international-numbers
More informationCharacterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula
Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula Kelly Mulholland 1,2, Calvin Keeler, Jr. 2, Sharon J. Keeler 2 and Monique Robinson 2 1 Center for Bioinformatics
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationSupplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy
1 SYSTEM REQUIREMENTS 1 Supplementary Material for IPred - Integrating Ab Initio and Evidence Based Gene Predictions to Improve Prediction Accuracy Franziska Zickmann and Bernhard Y. Renard Research Group
More informationHow Personalized Medicine is Changing the Biopharmaceutical Marketplace
How Personalized Medicine is Changing the Biopharmaceutical Marketplace Marc Chioda, PharmD Associate Medical Director, Pfizer Oncology. Presentation to the Cancer Action Coalition of Virginia January
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationThe Cancer Genome Atlas
The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are
More information